Molecular and Cellular Endocrinology, 97 (1993) 71-79 0 1993 Elsevier Scientific Publishers Ireland, Ltd. 0303-7207/93/$06.00

71

MCE 03099

Insulin-like growth factor binding proteins in the human adrenal gland

Vesa Ilvesmgki *h,a, Werner F. Blum ’ and Raimo Voutilainen b Departments of a Pathology and b Pediatrics, P.O. Box 21, SF-00014 Unit~ersi& of Helsinki, Helsinki, Finland;

’ University Children S Hospital, D- 7400 Tiibingen, Germany

(Received 21 May 1993; accepted 30 July 1993)

Key words: Insulin-like growth factor binding protein; Adrenal gland; Human

Summary

Insulin-like growth factors (IGFs) are thought to be important regulators of adrenocortical growth and steroido- genesis. IGFs are usually complexed with a family of specific IGF-binding proteins (IGFBPs) in serum, other body fluids, and in conditioned media of a variety of cell types. IGFBPs may either inhibit or potentiate the effects of IGFs. In the present study we have investigated the gene expression of the IGFBPs and IGF receptors in human fetal (HFA) and adult (HAA) adrenals. Northern blotting and/or reverse transcription polymerase chain reaction CRT-PCR) methods were used. IGFBP secretion into the cell culture medium was studied in primary cell cultures by Western ligand blotting and by radioimmunoassays. IGFBP-1 mRNA expression was low in adrenals: Northern blots were negative, but RT-PCR revealed IGFBP-1 mRNA in HFA. IGFBP-2 mRNA was equally expressed in both HFA and HAA with no differences in signal intensities by Northern blotting. IGFBP3 mRNA was detected in HFA but not in HAA by Northern blotting. IGFBP4 mRNA was expressed equally in both HFA and HAA. IGFBP-5 and -6 mRNA expression was more abundant in HAA than in HFA. IGF-I and type I and type II IGF receptor mRNAs were equally expressed in both HFA and HAA. 12-0-tetradecanoyl phorbol-13-acetate (TPA), a protein kinase regulator, upregulated IGFBP-1 in HFA cultures as determined by RIA, but ACTH was without effect. IGFBP-2 was not regulated by TPA or ACTH neither at protein nor at mRNA level. IGFBP-3 was downregulated by TPA both at protein and mRNA levels, but it was not affected by ACTH. In Western ligand blots of conditioned media from HFA cultures, we detected multiple bands. The best visualized band was a 47-44 kDa doublet, which most obviously represents IGFBP-3. Our results together with earlier findings show that all the components of the IGF system are expressed and produced locally in the human adrenal gland. There are also marked differences in the expression pattern of IGF-II and IGFBPs between fetal and adult glands. IGFBPs may have important autocrine or paracrine roles in the regulation of IGF functions in the adrenal gland.

Introduction

Insulin-like growth factors (IGFs) I and II are closely related polypeptides, which share a high degree of structural similarity with proinsulin (Daughaday and Rotwein, 1989). They interact with specific receptors, designated type I and type II IGF receptors, as well as with the insulin receptor (Czech, 1989). IGF-I is the principal mediator of growth hormone action during postnatal life, whereas IGF-II is thought to be an important fetal growth factor. There is also increasing evidence that IGFs are involved in the development of

* Corresponding author. Tel.: 358-O-4346424; Fax: 358-O-4346700.

some tumors (Daughaday, 1990). IGFs are produced in various amounts by almost all the fetal and adult tissues studied (Gray et al., 1987; Han et al., 19881, and they are thought to exert their effects locally by para/ autocrine mechanisms. IGF receptors are also widely expressed in almost all the tissues (Czech, 1989).

IGFs, but not insulin, are bound to specific IGF- binding proteins (IGFBPs) in serum and other biologi- cal fluids. The human IGFBP family consists of six different proteins, designated IGFBP- 1, IGFBP-2, IGFBP-3, IGFBP-4, IGFBP-5, and IGFBP-6 (Shimasaki and Ling, 1991). IGFBPs may modulate the IGF actions both via inhibitory and stimulatory ways and they offer a storage pool for IGFs in biological fluids, as IGFs are not stored within the cells.

IGFs arc supposed to be involved in the regulation of adrenal cortical growth and function, as both the IGF peptides and their receptors have been detected in the adrenal cortex (Feige and Baird, 1991). IGF-I is a mitogen for bovine adrenocortical cells and it also increases the steroid production of these cells (Penhoat et al., 1988). IGF-II mRNA expression in human fetal adrenal (HFA) cells is very high (Han et al., 1988; Voutilainen and Miller, 1988) and is increased by ACTH in vitro, suggesting that IGF-II may mediate the ACTH induced HFA growth (Voutilainen and MiIler, 1988; Voutilainen and Miller, 1987). IGF-II is also mitogcnic for fetal rat adrenal cells (van Dijk et al., 198X).

There are several studies describing the expression and effects of IGFs in the adrenal cortex, but very little is known about the IGFBPs and their possible role(s) in the regulation of adrenocortical cell functions. As a first step towards understanding the roles of IGFBPs in these processes, we have studied the expression of different IGFBPs in human fetal and adult adrenals.

Materials and methods

Tissues Human fetal adrenals were obtained from legal sec-

ond trimester abortions (14-20 weeks of gestation) performed for sociomedical reasons. The study proto- col was approved by the local ethical committees. Nor- mal adult adrenals were obtained from renal cell carci- noma patients, whose adrenals were removed in con- nection with nephrectomy performed due to a primary tumor. The adrenals were dissected from the surgicaf specimens by a pathologist, and they were used only if they appeared normal. All the tissue specimens were frozen in liquid nitrogen within 1 h after surgery or abortion, and they were stored at -70°C until needed for use.

Primary HFA cultures were prepared as described elsewhere (Ilvesm~ki and Voutilainen, 1991). Cells were grown on &well plastic cell culture dishes (Nunc, Roskilde, Denmark) in 1: I F-12/DMEM with 10%

TABLE I

fetal calf serum with 2 mM glutamine, 100 U/ml penicillin, 100 pg/ml streptomycin and 0.25 pg/ml amphotericin B (all these from Gibco, Paisley, UK) for 7 days. At this point synthetic ACTH-cl-24) (S- Cortrophin, Organon, Oss, The Netherlands) or 12-O- tetradecanoyl phorbol-13-acetate (TPA) (Sigma Chem- ical, St. L,ouis, MO, USA) were added as single doses, and the cultures were incubated further for l-2 days before ha~esting. Some experiments were performed in serum-free medium, which was Iscove’s modified DMEM (Sigma) with glutamine and antibiotics (as above). The media were collected and stored at - 20°C until analyzed for IGFBPs. All experiments were per- formed in duplicate or triplicate and repeated at least two times.

RNA analysis Total cellular RNA from deep-frozen tissues was

analyzed by guanidine thiocyanate-cesium chloride method (Chirgwin et al., 1979). Cytoplasmic RNA from HFA cultures was isolated as described previously (Voutilainen et al., 1986). RNA was quantified by spectrophotometry and transferred onto Hybond N filters (Amersham International, Amersham, Bucking- hamshire, UK) by Northern blotting (20-25 Fg total RNA/lane) after 1.5% agarose gel electrophoresis as described elsewhere (IlvesmZki and Voutilainen, 1991). Filters were hybridized with synthetic oligonucleotide probes for IGFBP-1 (Brinkman et al., 19881, IGFBP-2 (Binkert et al., 19891, IGFBP-3 (Wood et al., 19881, IGFBP-4 (Shimasaki et al., 19901, IGFBP-5 ~Shimasaki et al., 1991a), and IGFBP-6 (Shimasaki et al., 1991b) (Table l), which were 3’-end-labeled with terminal transferase (Boehringer Mannheim, Mannheim, Ger- many) and [a-32PldCTP (6000 Ci/mmol, Amersham). Mouse ribosomal 28 S (Arnheim, 1979) or human y-actin cDNA (Gunning et al., 1983) were used as control probes, and they were labeled by random prim- ing as described elsewhere (Ilvesmgki and Voutilainen, 1991). The hybridization and washing conditions as well as autoradiographic detection of hybridization sig- nals were as previously described (IlvesmHki and Vouti- lainen, 1991). The intensities of autoradiographic sig- nals were quantified by densitometric scanning.

IGFBP-I-h OLIGONUCLEOTIDES USED AS HYBRIDIZATION PROBES IN NORTHERN BLOT HYBRIDIZATIONS

Gene Oligonucleotide

IGFBP- 1 5’-AGG CAT CCT CTT CCC ATT CCA AGG GTA GAC-3’

IGFBP-2 5’-AGT CCT GGC AGG GGG TGG TCG CAG CTT CTT-3’

lGFBP-3 5’-AGG TAG GCG CGC AGG CGG CT6 ACG GCA CTA-3’

IGFBP-4 5'-JCJ GTG AAG CGG CCA GCC GCT CCA GCG-3’

IGFBP-5 5'-CTG AAA GTC CCC GTC AAC GTA CTC CAT-3’

IGFBP-h 5’-GGT AGA CCT CAG TCT GGA GTT GCT GCA-3’

Nucleotides Reference

743-772 Brinkman et al., 1988

655-684 Binkert et al., 1989 351-380 Wood et al., 1988 599-625 Shimasaki et al., 1990

816-842 Shimasaki et al., 1991a

511-537 Shimasaki et al., 1991b

73

Reverse transcription and polymerase chain reaction The expression of mRNAs for IGFBP-1, IGF-I, type

I IGF receptor, and type II IGF/mannose-6-phos- phate receptor was studied by reverse transcription- polymerase chain reaction CRT-PCR) amplification. The RT reactions and PCR amplifications were per- formed as described previously (Rappolee et al., 1989; Voutilainen et al., 1991). RT reaction was performed with 1 pug of total RNA and with oligo d(T),, (Boeh- ringer Mannheim) as a primer at 37°C for 60 min. The reaction volume was 10 ~1, after incubation it was further diluted up to 20 ~1, and 1 ~1 of this mixture was used for each PCR amplification.

and stained with ethidium bromide. Amplified prod- ucts were detected by ultraviolet light transillumination and by autoradiography after Southern blotting and hybridization with internal oligonucleotides to confirm the specificity of the PCR products. IGF-I PCR prod- ucts, however, were detected with IGF-I cDNA probe (Bell et al., 1984). The internal oligonucleotides were planned so that the same oligonucleotides could be used in Southern hybridizations of the PCR products as well as in Northern hybridizations. The sequences for internal oligonucleotides are given in Table 2.

Radioimmunoassays The amplifation primers (Table 2) were based on IGFBP-1, -2, and -3 levels of conditioned cell cul-

previously published sequences for IGFBP-1 (Brink- ture media from HFA cell cultures were measured by man et al., 19881, IGF-I (Rotwein, 19861, type I IGF specific radioimmunoassays. The antibody for IGFBP-1 receptor (Ullrich et al., 19861, type II IGF receptor RIA was produced in rabbits against isolated human (Morgan et al., 19871, and P-actin (Ponte et al., 1984). IGFBP-1 (pp12 from Dr. Hans Bohn, Behringwerke, The primers (and also other oligonucleotides used) Marburg, Germany) (Bohn and Kraus, 1980) and was were synthesized with an Applied Biosystems 380B used at a final dilution of 1: 7500. No cross-reaction DNA synthesizer at the Cancer Biology Laboratory, with human IGFBP-2 or IGFBP-3 was observed up to University of Helsinki. The PCR reactidn mixture (50 1 pg/ml in RIA or with other IGFBPs in Western ~1) was as previously described (Voutilainen et al., blotting. Standards and tracer were prepared from 1991), except that primer concentration was 0.5 PM human IGFBP-1 (~~12). Radiolabelling was performed and that tetramethylammonium chloride (TMAC, 50 as previously described (Blum et al., 1990). Condi- PM) (Hung et al., 1990) was included. After RT, actin tioned cell culture media were used undiluted. The PCR was always performed first to verify that the RNA assay mixture was composed of 100 ~1 each of sample specimens were intact. The PCR reaction mixtures or standard, tracer (20000 cpm) and antibody. Half- were first heated to 94°C for initial denaturation (90 s), maximal displacement occurred at 20 ng/ml, and intra- and then cycled using a Hybaid thermal reactor (Ted- and inter-assay coefficients of variation were 3.4 and dington, UK). IGBP-1 and p-actin were amplified 35 8.1%, respectively. IGFBP-2 was measured by a novel cycles and IGF-I and IGF receptors 40 cycles (de- specific RIA. Briefly, a polyclonal antibody against a naturation at 94°C for 30 s, annealing at 58°C for 30 s, synthetic partial sequence (human IGFBP-2 (176-190)) and elongation at 72°C for 90 s>. 10 ~1 aliquots of was produced in rabbits. It did not cross-react with reaction mixtures were run in 1.5% agarose gel with human IGFBP-1 or IGFBP3 in RIA up to 1 pg/ml. molecular weight marker (+X174 DNA-HaeIII digest) The tracer was prepared by radioiodination of (Tyr)“-

TABLE 2

PCR PRIMERS FOR IGFBP-1, IGF-I, IGF RECEPTORS, AND a-ACTIN AMPLIFICATIONS

The PGR primer and internal oligonucleotide sequences and the corresponding nucleotides in respective cDNAs are shown.

Gene PCR primers Nucleotides Product Hybridization probe

IGFBP-1

IGF-I

IGF-IR

IGF-IIR

p-actin

sense: AACCTCTGCACGCCCTCACC 327-346 antisense: AGGGATCCTCTTCCCATTCCAAGGGTAGAC 743-772

sense: AAATCAGCAGTCTTCCAACC 190-209 antisense: CTTCTGGGTCTTGGGCATGT 565-584 sense: AACCACGAGGCTGAGAAGCT 2464-2483 antisense: CAGCATAATCACCAACCCTC 2891-2910 sense: TCAACATCTGTGGAAGTGTG 344-363 antisense: GAATAGAGAAGTGTCCGGATCGGAGTC 745-771 sense: CCCAGGCACGCAGGGCGGTGAT 153-172 antisense: TCAAACATGATCTGGGTCAT 396-415

445 bp 362-391 5'-GGG AGC GGA GGC GTC AGA CTC CTG CAC

GCA-3'

395 bp IGF-I cDNA

447 bp 2653-2679 5'-TTC TCG CTG ATC CTC AAC TTG TGA TCC-3'

428 bp 591-617 5'-GTC CTC CAC TCA AAG TAG TGC ACA CAT-3'

263 bp 312-338 5'-CTC GGG AGC CAC ACG CAG CTC ATT GTA-3'

bp = base pair. Numbering of the sequences is based on the following cloning articles: IGFBP-1, Brinkman et al., 1988; IGF-IR, Ullrich et al., 1986; IGF-IIR, Morgan et al., 1987; /3-actin, Ponte et al., 1984; IGF-I cDNA, Bell et al., 1984.

7-t

IGFBP-2 ( 176 190). For preparation of standards IGFBP-2 (176-190) was calibrated with recombinant

human IGFBP-2 (kindly supplied by Dr. J. Schwander, Base], Switzerland). The assay was performed as a conventional RlA using a double-antibody technique

for separation of bound and unbound tracer. Half-max- imal displacement of the tracer was obtained at 57 ng/ml, and intra- and inter-assay coefficients of varia- tion were 3.7 and 9.6%, respectively. Details of the assay have been published elsewhere (Blum et al., 19931. IGFBP-3 was measured by a previously de-

scribed RIA (Blum ct al., 1990).

Conditioned media from HFA cell cultures were concentrated 40-fold in 10000 molecular weight cutoff

Sentricon microconcentrators (Amicon, Danvers, MA, USA). Western ligand blots were prepared as de-

scribed by Hossenlopp et al. (1986) with slight modifi- cations. 2 ~1 samples were electrophoresed on 10% SDS-polyacrylamide gels, electroblotted onto nitrocel- lulose membranes, incubated with ““I-IGF-I (0.5 X 10h cpm/ml, 20 ml/filter) overnight, and exposed to film for l-5 days. Unconditioned medium and a normal

serum sample were always included in gels as controls. “‘C-1abellcd Rainbow protein molecular weight mark- crs wcrc purchased from Amersham.

Results

The mRNA expression of different IGFBPs in hu-

man fetal and adult adrenals was studied by Northern blotting or RT-PCR. At least three different fetal and adult specimens were used to study the expression of each binding protein. IGFBP-1 mRNA was not de-

tccted from total cellular RNA by Northern blotting (25 pg/lane, data not shown). With RT-PCR we de- tectcd IGFBP-1 mRNA from the fetal adrenals, but

not from adult adrenals (Fig. 1). In contrast to IGFBP- 1, all the other IGFBPs were detected from adrenal specimens by Northern blotting (Fig. 2). IGFBP-2 mRNA was found from both fetal and adult adrenals, and there was no difference between these two. IGFBP-3 was detected from fetal but not from adult adrenals, whereas IGFBP-4 was equally expressed in both fetal and adult adrenals. IGFBP-5 expression was slightly stronger in adult adrenals, and there was al- ways a band of approximately 1.7 kb in addition to the 6.0 kb in adult but not in fetal adrenal specimens. Thcrc was also some additional hybridization between 2.3 and 4.0 kb in adult adrenals, but we do not know if that is specific to IGFBP-5. IGFBP-6 mRNA was also more abundant in the adult than in the fetal adrenals.

The possible regulation of IGFBP mRNAs by ACTH or TPA was studied in primary HFA cultures (Fig. 3).

abp- 31obp-

- 445 bp

Fig. 1. Expression of IGFBP-I mRNA in human adrenals analyzed

by RT-PCR. 1 pg of total RNA was reverse transcribed and the

resulting cDNAs were amplified 35 cycles with IGFBP-1 specific

primers as described in Materials and methods. Ethidium bromide

stained 1.5% agarose gel and the corresponding Southern blot hy-

bridized with a “P-labelled internal IGFBP-I specific oligonu-

cleotide are shown. Lanes: marker (6x174 DNA-Hue111 digest);

HFA. human fetal adrenal (in viva); HAA, human adult adrenal:

cultured human fetal adrenal: HF liver, human fetal liver; negative

control (no RNA in RT-reaction). Expected size of the DNA product

(in bp) is shown at the right. The sizes of the molecular weight

marker nearest to the amplified PCR product are shown at the left.

Neither of these agents was able to induce any change in IGFBP-2 mRNA accumulation. However, IGFBP-3 mRNA was clearly downregulated by TPA treatment, but ACTH had no effect. The effects of ACTH and TPA on IGF-II and y-actin mRNA levels are also shown in Fig. 3 for comparison. The regulation of IGFBP-2 and -3 mRNAs by ACTH and TPA was also studied in human adult adrenal cell cultures. IGFBP-3 mRNA was not detected in adult cultures, and there was no regulation of IGFBP-2 mRNA (data not shown).

The secretion of the IGFBPs by HFA cells was also studied by Western ligand blotting and by RlAs in primary cell cultures. In ligand blots we detected multi-

F A F A F A

K5FBP-3

-2.6kb 16S-b + 16s +

2.5 kb -

F A F A

-6.Okb f 28s

16s + - 1.7kb

f 16s - 1.6kb

Fig. 2. Expression of IGFBP-2-6 mRNAs in human fetal and adult

adrenals analyzed by Northern blotting. RNA samples were run in

1.5% agarose gels and Northern blotted. Representative Northern

blots are shown. The equal RNA loading of each filter was checked

by hybridization with 28s RNA cDNA probe (not shown). Total

RNA amounts and times of exposure were: IGFBP-2: 20 pg, 12 days;

IGFBP-3: 25 gg, 21 days; IGFBP-4: 20 pg, 28 days; IGFBP-5 and -6:

25 Fg, 10 days. F, human fetal adrenal; A, human adult adrenal. The

transcript sizes of different IGFBPs are shown at the right of each

blot.

ple bands (Fig. 4). The best visualized was the lower band of the 47-44 kDa doublet, which probably repre- sents IGFBP-3. A 35 kDa band most obviously repre- senting IGFBP-2 was also seen in all the HFA condi- tioned media studied. In some experiments we could also find two additional bands: a 28-30 kDa band and a 24 kDa band (data not shown). The former may be either IGFBP-1 or -5 and the latter is most obviously IGFBP-4. ACTH did not cause regulation in any of these bands. IGFBP-1, -2, and -3 levels from condi- tioned cell culture media of HFA primary cell cultures were also measured by RIA. A representative result showing IGFBP-1, -2, and -3 results from one cell culture is shown in Table 3. IGFBP-1 levels were rather low, in controls and ACTH-treated cultures IGFBP-1 concentrations were usually below 1 ng/ml, but TPA increased IGFBP-1 up to 1.5-2.3 ng/ml in repeated experiments. IGFBP-2 levels varied between lo-20 ng/ml, and no regulation was observed. IGFBP- 3 levels ranged between 10 and 70 ng/ml. TPA de- creased IGFBP-3 levels 34%, and the decrease was statistically significant (Wilcoxon’s test, p < 0.005) as calculated from the pooled data (eleven pairs of plates

IGFB P-2

Mkb- - 2.0 kb

Fig. 3. Regulation of IGFBP-3 and IGFBP-2 mRNAs in cultured

human fetal adrenocortical cells. The cells were first grown to

subconfluence for 7 days, and then incubated without stimulants

(control), with 200 ng/ml ACTH or with 10 ng/ml TPA for two

days. Cytoplasmic RNA was extracted and Northern blotted (8

fig/lane). The blot was sequentially hybridized with probes for

IGFBP-3, IGFBP-2, IGF-II and y-actin. The autoradiographic re-

sults are shown. Times of exposure were 28 days for IGFBP-3,

IGFBP-2 and IGF-II and 7 days for y-actin. Transcript sizes (in kbl

or ribosomal RNA bands (28s and 18.9 are also shown.

B kDa

46

-30

-21.5

Fig. 4. Western ligand blot showing IGFBPs in the conditioned

media from human fetal adrenal cell cultures. Cells were first cul-

tured to subconfluence for 7 days, and then incubated with or

without ACTH (200 ng/ml) in serum-free medium. 2 ~1 samples of

40-fold concentrated media’and 2 ~1 of unconcentrated serum were

ligand blotted as described in Materials and methods. A representa-

tive ligand blot is shown. Exposure time was 5 days. Lanes: uncondi-

tioned culture medium (medium); conditioned medium from

ACTH-treated cells (ACTH); conditioned medium from control cells

without stimuli (control); human adult serum (serum). Molecular

weight marker sizes are shown at the right (in kDa).

from six different fetuses). ACTH neither decreased nor increased IGFBP-3 significantly in the same pooled data (Wilcoxon’s test, p > 0.10).

603bp-

310bp-

I J

Fig. 5. Expression of IGF-I in human fetal and adult adrenals

analyzed by RT-PCR (40 cycles). 1.5% agarose gel of the amplified

PCR products and the corresponding Southern blot after hybridiza-

tion with IGF-I cDNA are shown. Lanes and other details are as in

Fig. 1.

It has been shown previously that human fetal adrenals express abundant IGF-II, but very little IGF-I

mRNA (Han et al., 1988). On the other hand, IGF-II mRNA levels in human adult adrenals are very low (Voutilainen and Miller, 1988). We studied the expres- sion of IGF-I mRNA in fetal and adult adrenals first with cDNA and cRNA probes from total cellular RNA, but we did not detect any signals (data not shown). We then tried RT-PCR to investigate the adrenal IGF-I mRNA levels (Fig. 5). IGF-I mRNA was detected in approximately equal amounts from adult and fetal adrenals in vivo, from cultured fetal adrenal cells, and from human fetal liver. We also studied the expression of type I and type II IGF receptors with RT-PCR from adult and fetal adrenals (Fig. 6). The expression level was equal in both fetal and adult glands.

Discussion

Our data show that there are several differences in the expression of IGFBPs in human fetal and adult adrenals. Both fetal and adult adrenals expressed type I and type II receptors as well as IGF-I. There are

several lines of evidence that the IGFs are important auto/paracrine regulators of the adrenal cortex (Feige and Baird, 1991). IGF-II mRNA levels in human fetal adrenals are very high but almost undetectable in the adult gland (Voutilainen and Miller, 1988) suggesting a role for IGF-II in the fetal gland. ACTH is able to upregulate IGF-II mRNA levels in cultured HFA cells (Voutilainen and Miller, 1987) suggesting that this may

be at least one mechanism through which ACTH regu- lates the growth of the adrenal cortex in the fetus. Our

results suggest that IGFBP-I and IGFBP-3 may also have some specific functions in human fetal adrenals, as they were detected only in fetal glands but not in adult ones. On the other hand, IGFBP-5 and IGFBP-6 were more abundant in the adult adrenals, suggesting a role for them in the postnatal adrenal. IGFBP-2 and IGFBP-4 were equally expressed in both fetal and

adult adrenals. IGFBP-3 was the most abundant IGFBP secreted into HFA culture media as measured by both ligand blotting and RIA (Fig. 4 and Table 3). However,

IGFBP-3 mRNA bands were rather weak in HFA in vivo as compared with the other IGFBPs (Fig. 2). IGFBP-3 mRNA was more easily detected in cultured HFA cells (Fig. 3 and not shown), and it may be that its transcription rate or mRNA stability were strength- ened during culture. IGFBP-2 has been thought to be a fetal IGFBP (like IGFBP-l), as its tissue mRNA levels in the rat are high during fetal life and decline after

birth (Ooi et al., 1990). Moreover, IGFBP-2 serum levels are higher during fetal than during adult life in both rat and human (Lyons and Smith, 1986, Clem- mons et al., 1991). However, our results do not support any specific role for IGFBP-2 in the fetal adrenal gland, as the expression level in the adult gland is

equal. In other systems IGFBPs have been shown to either inhibit or stimulate the actions of IGFs depend-

ing on the tissue and cell type (Rosenfeld et al., 1990). Despite the large number of studies on IGFs in the

adrenal cortex, only few reports on IGFBPs in adrenals have been published previously. Expression of IGFBP- 1 has been detected in human fetal adrenals by immuno- histochemistry (Hill et al., 1989, Waites et al., 1990).

IGFBP-1 mRNA has been found in human fetal adrenals by nuclease protection hybridization (Hill et al., 19891, which is in agreement with our study. How- ever, there are no previous studies about IGFBP-1 in adult adrenals. IGFBP-2 and IGFBP-3 have been de- tected by immunohistochemistry in the human fetal adrenal with intensity equal to IGFBP-1 (Hill and Clemmons, 1992). In tissue distribution studies in the rat, it has been shown that mRNAs for IGFBP-3 (Shimasaki et al., 1989), IGFBP-4 (Shimasaki et al., 19901, IGFBP-5 (Shimasaki et al., 1991a), and IGFBP-6 (Shimasaki et al., 1991b) are also expressed in the adrenal gland as well as in multiple other tissues, suggesting local auto/paracrine functions. It has been

TABLE 3

EFFECTS OF ACTH AND TPA ON IGFBP-1, IGFBP-2, AND IGFBP-3 PRODUCTION IN CULTURED HUMAN FETAL ADRENOCORTICAL CELLS

The cells were first grown to subconfluence for 7 days and then treated with ACTH or TPA for 2 days. IGFBP values fng/ml) were determined from the conditioned cell culture media by RIAs as described in Materials and methods. A representative result (mean + range, n = 2) from three similar experiments is shown. All the values are from a single cell culture experiment.

Treatment IGFBP-1

Control <l ACTH (10 ng/ml) < 1 TPA (10 ng/ml) 1.57+0.02

IGFBP-2

11.4+ 1.6 12.6 k 2.2 15.2 f 2.0

IGFBP-3

68.3 + 1.3 62.1 f 1.3 40.7 + 3.4

shown by ligand blotting that bovine adrenal fascicu- lata cells in culture secrete at least three different IGFBPs: the 38-42 kDa doublet, and the 28-31 and 24 kDa bands (Penhoat et al., 1991). ACTH and an- giotensin II increased the 38-42 kDa doublet and decreased the 28-31 kDa bands. It seems that human fetal adrenal differs from bovine adrenal in this re- spect, as we did not find any IGFBP regulation by ACTH.

77

The protein kinase C (PKC) system may be involved in the regulation of IGFBP production in some cell types. It has been shown that phorbol ester TPA stimu- lates IGFBP-1 production in cultured human granulosa cells (Jalkanen et al., 19891, in thyroid cells (Egg0 et al., 19911, in endometrial carcinoma cell lines (Gong et al., 19921, and in hepatoma cells (Lee et al., 1992, Unterman et al., 1992). These findings accord with our results, as we showed that IGFBP-1 levels in HFA cell culture media were increased after incubations with TPA. According to the experiments where different PKC inhibitors were used in HepG2 cell cultures, it seems that the stimulation of IGFBP-1 levels by TPA may be mediated through down-regulation, rather than stimulation, of PKC (Lee et al., 1992). However, the regulation of IGFBP-1 may be tissue-specific, since in decidual cells TPA had no effect on IGFBP-1 produc- tion (Clemmons et al., 1990). The regulation of IGFBP-3 production is obviously also tissue-specific as TPA stimulated IGFBP-3 both at protein (Bachrach et al., 1989) and mRNA levels (Bachrach et al., 1991) in sheep thyroid cells, but inhibited in our human fetal adrenal cells. IGFs belong to the polypeptide growth factors, which are thought to play a central role in the regulation of growth and function of the adrenal cortex

IGF-IIR

Fig. 6. Expression of type I and type II IGF receptors in human fetal and adult adrenals analyzed by RT-PCR (40 cycles). 1.5% agarose gels and their corresponding Southern blots are shown. Lanes are as in Fig. 1 except that human adult liver RNA specimen (HA liver) was used as a

control in IGF-IIR PCR. Expected sizes of the amplified PCR products (in bp) are also shown.

7x

(Feige and Baird, 1991). Previously, we have shown that IGF-II mRNA levels in human fetal adrenals are very high, but in adult adrenals almost undetectable (Voutilainen and Miller, 1988). This is in sharp con- trast with the adrenal IGF-I mRNA levels, which have

been below the detection level, in our previous North- ern blotting studies (not shown). In the present study

by using a sensitive RT-PCR method, however, we were able to detect IGF-I mRNA from both fetal and adult adrenals with no difference in the signal magni- tude. The presence of IGF-I mRNA in the adrenals

raises the possibility that in addition to IGF-II also IGF-I may be involved in the regulation of human

adrenocortical cell functions, as it is in other species

(Feige and Baird, 1991). It is generally thought that most of the biological

effects of both IGF-I and IGF-II are mediated via type I, and not the type II IGF receptor. This view is based on the findings that a type I IGF receptor blocking antibody (cu-IR-3) abolishes the mitogenic effects of both IGF-I and IGF-II (Conover et al., 1986, Furlan- etto et al., 1987). However, it has been shown that IGF-II may also stimulate growth at least in some cell lines via the type II IGF receptor (Tally et al., 1987; Mathieu et al., 1990). Furthermore, the inhibitory ef- fect of IGF-II on IGFBP-2 production in granulosa

cells (Cataldo et al., 1993) and the effects of IGF-II .on muscle cell motility may be mediated via the type II

IGF receptor (Minniti et al., 1992). As both receptor types are expressed in human fetal and adult adrenals, the IGFs may mediate their effects via both of these receptors. This could be studied by using IGF-analogs, which bind only to one of these receptors.

In conclusion, the present results show that all the currently known six IGF-binding proteins are ex-

pressed in the adrenal gland. There are also marked differences in the expression pattern between fetal and adult glands suggesting different functions. IGFBPs may have important autocrine or paracrine roles in the regulation of IGF functions in the adrenal gland.

Acknowledgements

The skillful technical assistance of Ms. Merja Haukka, Ms. Eija Teva, and Ms. Paivi Laitinen is greatly appreciated. We thank Dr. Fredrika Pekonen for providing iodinated IGF-I for ligand blot studies. This study was financially supported by the Jalmari and Rauha Ahokas Foundation, the Finnish Medical Foun- dation, the Academy of Finland, the Sigrid Juselius Foundation, and the Nordisk Insulin Foundation.

References

Amheim, N. (19791 Gene 7, 83-96.

Bachrach, L.K., Eggo, M.C., Burrow, G.N., Liu, F., Tram, T. and

Powell. D.R. (19911 Endocrinology 128, 1967-1973.

Bachrach, L.K., Liu, F.R., Burrow, G.N. and Eggo. M.C. (19891

Endocrinology 125, 2831-2838.

Bell, G.I., Merryweather, J.P., Sanchez-Pescador, R., Stempien,

M.M., Priestley, L., Scott, J. and Rail, L.B. (1984) Nature 310.

775-777.

Binkert, C., Landwehr, J., Mary, J.-L., Schwander, J. and Heinrich,

G. (1989) EMBO J. 8, 2497-2502.

Blum, W.F., Horn, N., Kratzsch, J., Jcergensen, J.O.L., Juul. A.,

Teale, D., Mohnike, K. and Ranke, M.B. (1993) Growth Regul. 3,

100-104.

Blum, W.F., Ranke, M.B., Kiezmann, K., Gauggel, E., Zeisel, H.J.

and Bierich, J.R. (1990) J. Clin. Endocrinol. Metab. 70, 1292-

1298.

Bohn, H. and Kraus, W. (1980) Arch. Gynecol. 229, 279-291.

Brinkman, A., Groffen, C., Kortleve, D.J., Geurts van Kessel, A. and

Drop, S.L.S. (1988) EMBO J. 7, 2417-2423.

Cataldo, N.A., Woodruff, T.K. and Giudice, L.C. (19931 J. Clin.

Endocrinol. Metab. 76, 2077215.

Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. and Rutter, W.J.

(1979) Biochemistry 18, 5294-5299.

Clemmons, D.R., Snyder, D.K. and Busby Jr., W.H. (1991) J. Clin.

Endocrinol. Metab. 73, 727-733.

Clemmons, D.R., Thrailkill, K.M., Handwerger, S.and Busby Jr.,

W.H. (1990) Endocrinology 127, 643-650.

Conover, C.A., Misra, P., Hintz, R.L. and Rosenfeld, R.G. (19861

Biochem. Biophys. Res. Commun. 139, 501-508.

Czech, M.P. (1989) Cell 59, 235-238.

Daughaday, W.H. (1990) Endocrinology 127, l-4.

Daughaday, W.H. and Rotwein, P. (1989) Endocr. Rev. 10, 68-91.

Eggo, M.C., Bacrach, L.K., Brown, A.L. and Burrow, G.N. (1991)

Growth Factors 4, 221-230.

Feige, J.-J. and Baird, A. (1991) Prog. Growth Factor Res. 3,

103-113.

Furlanetto, R.W., DiCarlo, J.N. and Wisehart, C. (1987) J. Clin.

Endocrinol. Metab. 64, 1142-1149.

Gong, Y., Ballejo, G., Alkhalaf, B., Molnar, P., Murphy, L.C. and

Murphy, L.J. (1992) Endocrinology 131, 2747-2754.

Gray, A., Tam, A.W., Dull, T.J., Hayflick, J., Pintar, J., Cavenee,

W.K., Koufos, A. and Ullrich, A. (1987) DNA 6, 283-295.

Gunning, P., Ponte, P., Okayama, H., Engel, J., Blau, H. and Kedes,

L. (1983) Mol. Cell. Biol. 3, 787-795.

Han, V.K.M., Lund, P.K., Lee, DC. and D’Ercole, A.J. (1988) J.

Clin. Endocrinol. Metab. 66, 422-429.

Hill, D.J. and Clemmons, D.R. (1992) Growth Factors 6, 315-326.

Hill, D.J., Clemmons, D.R., Wilson, S., Han, V.K.M., Strain, A.J.

and Mimer, R.D.G. (19891 J. Mol. Endocrinol. 2, 31-38.

Hill, D.J., Han, V.K.M., Clemmons, D.R., Camacho-Hubner, C. and

Wang J.F. (1989) in Insulin-like Growth Factor Binding Proteins

(Drop, S.L.S. and Hintz, R.L. eds.1, pp. 55-61, Elsevier, Amster-

dam.

Hossenlopp, P.. Seurin, D., Segovia-Quinson, B., Hardouin, S. and

Binoux, M. (1986) Anal. Biochem. 154, 138-143.

Hung, T., Mak, K. and Fang, K. (1990) Nucleic Acids Res. 18, 4953.

Ilvesmlki, V. and Voutilainen, R. (1991) Endocrinology 128, 1450-

1458.

Jalkanen, J., Suikkari, A.-M., Koistinen, R., Biitzow, R., Ritvos, O.,

SeppHlH, M. and Ranta, T. (1989) J. Clin. Endocrinol. Metab. 69,

1174-1179.

Lee, P.D.K., Abdel-Maguid, L.S. and Snuggs, M.B. (1992) J. Clin.

Endocrinol. Metab. 75, 459-464.

Lyons, R.M. and Smith, G.L. (1986) Mol. Cell. Endocrinol. 45,

263-270.

Mathieu, M., Rochefort, H., Barenton, B., Prebois, C. and Vignon, F. (1990) Mol. Endocrinol. 4, 1327-1335.

Minniti, C.P., Kohn, E.C., Grubb, J.H., Sly, W.S., Oh, Y., Miiller,

H.L., Rosenfeld, R.G. and Helman, L.J. (1992) J. Biol. Chem. 267, 9000-9004.

79

Morgan, D.O., Edman, J.C., Standring, D.N., Fried, V.A., Smith, M.C., Roth, R.A. and Rutter, W.J. (1987) Nature 329, 301-307.

Ooi, G.T., Orlowski, CC., Brown, A.L., Becker, R.E., Unterman, T.G. and Rechler, M.M. (1990) Mol. Endocrinol. 4, 321-328.

Penhoat, A., Chatelain, P.G., Jaillard, C. and Saez, J.M. (1988) Endocrinology 122, 2518-2526.

Penhoat, A., Leduque, P., Jaillard, C., Chatelain, P.G., Dubois, P.M. and Saez, J.M. (1991) J. Mol. Endocrinol. 7, 223-232.

Ponte, P., Ng, S.-Y., Engel, J., Gunning, P. and Kedes, L. (1984) Nucl. Acids Res. 12, 1687-1696.

Rappolee, D.A., Wang, A., Mark, D. and Werb, Z. (1989) J. Cell. Biochem. 39, 1-11.

Rosenfeld, R.G., Lamson, G., Pham, H., Oh, Y., Conover, C., De Leon, D.D., Donovan, SM., Ocrant, I. and Giudice, L. (1990) Recent Prog. Horm. Res. 46, 99-159.

Rotwein, P. (1986) Proc. Natl. Acad. Sci. USA 83, 77-81. Shimasaki, S. and Ling, N. (1991) Prog. Growth Factor Res. 3,

243-266. Shimasaki, S., Shimonaka, M., Zhang, H.-P. and Ling, N. (1991a) J.

Biol. Chem. 266, 10646-10653. Shimasaki, S., Gao, L., Shimonaka, M. and Ling, N. (1991bJ Mol.

Endocrinol. 5, 938-948. Shimasaki, S., Koba, A., Mercado, M., Shimonaka, M. and Ling, N.

(1989) Biochem. Biophys. Res. Commun. 165, 907-912.

Shimasaki, S., Uchiyama, F., Shimonaka, M. and Ling, N. (1990) Mol. Endocrinol. 4, 1451-1458.

Tally, M., Ii, C.H. and Hall, K. (1987) B&hem. Biophys. Res. Commun. 148,811-816.

Ullrich, A., Gray, A., Tam, A.W., Yang-Feng, T., Tsubokawa, M., Collins, C., Henzel, W., Le Bon, T., Kathuria, S., Chen, E., Jacobs, S., Francke, U., Ramachandran, J. and Fujita-Yamaguchi, Y. (1986) EMBO J. 5, 2503-2512.

Unterman, T.G., Lacson, R.G., Jentel, J.J. and Oehler, D.T. (1992) Biochem. Biophys. Res. Commun. 182, 262-268.

van Dijk, J.P., Tanswell, A.K. and Challis, J.R.G. (1988) J. En- docrinol. 119, 509-516.

Voutilainen, R. and Miller, W.L. (1987) Proc. Natl. Acad. Sci. USA 84, 1590-1594.

Voutilainen, R. and Miller, W.L. (1988) DNA 7, 9-15. Voutilainen, R., ErCmaa, M. and Ritvos, 0. (1991) J. Clin. En-

docrinol. Metab. 73, 1026-1030. Voutilainen, R., Tapanainen, J., Chung, B., Matteson, K.J. and

Miller, W.L. (1986) J. Clin. Endocrinol. Metab. 63, 202-207. Waites, G.T., James, R.F.L., Walker, R.A. and Bell, S.C. (1990) J.

Endocrinol. 124, 333-339. Wood, W.I., Cachianes, G., Henzel, W.J., Winslow, G.A., Spencer,

.%A., Hellmiss, R., Martin, J.L. and Baxter, R.C. (1988) Mol. Endocrinol. 2, 1176- 1185.