JOURNAL OF BACTERIOLOGY, Sept. 1991, p. 5800-5807 Vol. 173, No. 180021-9193/91/185800-08$02.00/0Copyright © 1991, American Society for Microbiology

Integration Host Factor Binds Specifically to Multiple Sites in theompB Promoter of Escherichia coli and Inhibits Transcription

PING TSUI, LIN HUANG, AND MARTIN FREUNDLICH*Department ofBiochemistry and Cell Biology, State University ofNew York, Stony Brook, New York 11794-5212

Received 7 January 1991/Accepted 15 July 1991

Escherichia coli integration host factor (IHF) is a DNA-binding protein that participates in gene regulation,site-specific recombination, and other processes in E. coli and some of its bacteriophages and plasmids. In thepresent study, we showed that IHF is a direct negative effector of the ompB operon of E. coli. Gel retardationexperiments and DNase I footprinting studies revealed that IHF binds to three sites in the ompB promoterregion. In vitro transcription from ompB promoter fragments was specifically blocked by IHF. In vivoexperiments showed that IHF is a negative effector of ompB expression in growing cells. Analysis of IHFbinding site mutations strongly suggested that IHF binding in the ompB promoter region is necessary for thenegative effects seen in vivo.

Integration host factor (IHF) is a sequence-specific DNA-binding protein of Escherichia coli encoded by the himA andhip genes (39). This histonelike protein (10) is involved in awide variety of processes in a number of bacteriophages andplasmids, including site-specific recombination events,phage packaging and partition, and DNA replication (re-viewed in references 10 and 14). IHF also participates inregulation of gene expression in a number of phages and inE. coli (reviewed in references 10 and 14) and some othergram-negative bacteria (6, 18, 25, 48). Although the exactmechanism of action of this multifunctional protein is notcompletely understood, IHF has been shown to bend theDNA to which it binds (24, 33, 44, 47, 51, 53, 57) and in atleast one case this property was found to be critical to itsbiological function (19).We have recently found that IHF is a negative effector of

in vivo and in vitro expression of ompC and ompF in E. coli(26, 45). These major outer membrane proteins are encodedby the unlinked ompC and ompF genes (30). Expression andosmoregulation of these genes involves primarily transcrip-tional control mediated by OmpR and EnvZ, the proteinproducts of the ompB operon (22, 23). OmpR activatestranscription of ompF and ompC by binding to specificsequences upstream of the promoters in these operons (31,41). EnvZ is an inner membrane protein (11) that acts as anosmosensor and affects ompF and ompC by altering thephosphorylation state of OmpR (1, 2, 12, 28, 29). In thepresent report, we show by gel retardation analysis andDNase I footprinting that IHF binds specifically to threesites in the ompB promoter region. Transcription from ompBpromoter fragments is strongly blocked by IHF. The resultsof in vivo experiments utilizing ompB-lacZ fusions, primerextension analysis, and site-directed mutagenesis stronglysuggest that the in vitro results are physiologically signifi-cant.

MATERIALS AND METHODSBacterial strains, plasmids, and preparation of DNA frag-

ments. E. coli SB4288 containing plasmid pAT428 orpAT428X7 (8) was used for preparation of ompB promoterfragments. Plasmid pAT428X7 has an XbaI linker inserted at

* Corresponding author.

the RsaI site at +115 in the ompB fragment carried inpAT428 (8). JMS65 is a derivative of MC4100 (22) andcontains a chromosomal ompB-lacZ protein fusion (50).MF2910 is an IHF- derivative of JMS65. This strain wasconstructed by transduction using P1 lysates prepared onstrain K5185 (AhimA82::TnJO) obtained from H. Nash.MF2911 is MF2910 transformed with plasmid pPLhiphimA-5,which carries the genes coding for IHF (40); MF2705 is arecA derivative of HN99 (58); and MF2706 is an IHF-derivative of MF2705. Plasmid DNA was purified fromstrains grown in Luria broth (37) and ampicillin (50 jig/ml),and restriction fragments were isolated on 5% polyacryl-amide gels (36).

Gel mobility shift assays. Gel mobility shift assays weredone essentially as described previously (56), except that theTris-HCl in the running buffer was at 6.7 mM and electro-phoresis was carried out at 4°C. Poly(dI - dC) (Promega) at 9jig/ml was added to prevent nonspecific binding of protein tothe DNA (13).DNase footprinting. DNase footprinting reactions were

carried out as described previously (56), except for thefollowing changes. DNase I digestion was at 24°C for 2 min,and the reaction was stopped by addition of 4 mM EDTA.The products were analyzed by electrophoresis on an 8%polyacrylamide gel containing 8 M urea.Primer extension analysis. Total cell RNA was isolated (7)

from cells in mid-exponential growth at 37°C in Luria broth(37). The RNA was extracted twice with phenol-chloroform-isoamyl alcohol (25:24:1) and once with chloroform-isoamylalcohol (24:1) and precipitated with ethanol. After treatmentwith RNase-free bovine pancreatic DNase I (final concen-tration, 2 ,ugIml) in the presence of 20 mM Tris-HCl (pH8.0)-10 mM MgCl2-2 mM CaCl2-40 U of RNasin at 37°C for30 min, the RNA was extracted with phenol-chloroform-isoamyl alcohol (25:24:1) and precipitated with ethanol.RNA concentration was determined by measuring absorb-ance at 260 nm. Primer extension analysis was done by amodification of the procedure of Ausubel et al. (3). RNA (50jg) in 40 mM PIPES [piperazine-N,N'-bis(2-ethanesulfonicacid); pH 6.4]-1 mM EDTA-0.4 M NaCl-80% formamidewas incubated at 30°C for 14 h with 0.6 pmol of syntheticprimer DNA (5'-TCTTGTAGTAGTTCTCTTGCATT-3') la-beled at the 5' end with [_y-32P]ATP (4,500 Ci/mmol) bypolynucleotide kinase. After ethanol precipitation, the hy-

5800

on October 14, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

IHF INHIBITS ompB TRANSCRIPTION 5801

bridized RNA primer was dissolved in buffer containing 40mM Tris-HCI (pH 8.0), 5 mM MgCl2, 1 mM dithiothreitol, 50mM KCl, and 50 ,ug of bovine serum albumin per ,ul. Thenfour deoxynucleoside triphosphates (final concentration,0.15 mM each), 50 U of RNasin, and 40 U avian myeloblas-tosis virus reverse transcriptase were added and the primerextension reaction proceeded for 90 min at 42°C. The reac-tion was stopped with 20 mM EDTA, and then 1 pug ofRNase A was added and incubation continued for 30 min at37°C. The synthesized DNA was extracted with phenol-chloroform-isoamyl alcohol (25:24:1), precipitated with eth-anol, suspended in formamide loading buffer (3), and ana-lyzed on an 8% polyacrylamide sequencing gel.

Mutagenesis of IHF binding sites and construction of ompB-cat transcription fusions. IHF binding sites in the ompBpromoter region were mutagenized by using oligonucleotide-directed mutagenesis without phenotypic selection as de-scribed by Ausubel et al. (3). An AvaI-BstBI (-128 to + 215)or HinPI-HinPI (-73 to + 164) ompB promoter fragment wasused for mutagenesis. Mutagenesis was confirmed by dide-oxy DNA sequencing by using Sequenase version 2 (U.S.Biochemical Corp., Cleveland, Ohio). ompB-cat transcrip-tion fusions were constructed by using the promoterless catvector pKK232-8 (Pharmacia) and the normal and mutagen-ized ompB promoter fragments. LH311 is an unalteredAvaI-BstBI fragment. LH313 is the AvaI-BstBI fragmentwith the A T base pair at +3 deleted in the IHF site Cconsensus sequence. In LH315, the IHF-A site in theAvaI-BstBI fragment was removed by HinPI digestion andtwo A - T base pairs (-39 and -40) in the IHF-B siteconsensus were changed to G- C. These new plasmids wereintroduced into a strain containing an IHF mutation(MF2706) and its isogenic parent (MF2705). These strainswere grown in 15 ml of Luria broth at 37°C with shaking, andcell extracts were prepared by using a Branson 110 Sonifier(setting 3, 10 s). Chloramphenicol acetyltransferase activitywas measured by the spectrophotometric method of Shaw(49).

Materials. DNase I and urea were obtained from BethesdaResearch Laboratories, Inc. (Gaithersburg, Md.). Restric-tion enzymes and polynucleotide kinase were from NewEngland BioLabs, Inc. (Beverly, Mass.). RNasin and avianmyeloblastosis virus reverse transcriptase were purchasedfrom U.S. Biochemical Corp. Radioactive chemicals wereobtained from ICN Radiochemicals (Irvine, Calif.). Mostother chemicals were purchased from Sigma Chemical Co.(St. Louis, Mo.).

RESULTS

IHF binds to the ompB promoter region. Our previousresults showed that IHF is a direct negative effector of ompCand ompF transcription (26, 45). During these studies, wenoted a potential IHF binding site in the ompB promoterregion (58). To determine whether IHF could interact withthis region, we studied the binding of purified IHF to anend-labeled ompB promoter fragment (fragment 1 [Fig. 1])by using the gel retardation technique (13, 16). The data inFig. 2 show IHF binding to this fragment at a concentrationas low as 5 nM. At low concentrations of IHF, a singleretarded band was apparent, whereas two and then threebands of reduced mobility were seen at higher IHF concen-trations. The initial band probably represents IHF binding toa single site, while the second (Fig. 2, lane 5) and third (Fig.2, lane 6) bands most likely represent DNA-protein com-plexes in which two and three sites, respectively, are occu-

GGTAACCAGGGGCGTTTT [CATCTCGTTGATT] CCCTTTGTCTGTTTGA*60 .30

TAATGCGCACATTGGGTATAACGTGATCA [TATCAACAG [AATCjAATAATGTT] TC

I+1 IHFR3H+FGCCGAATAAATTGTATACT [TAAGCT©tTGTTT] AATATGCTTTGTAACAATTTAGG

FIG. 1. Nucleotide sequence of the promoter region of the ompBoperon. The nucleotide sequence is taken from Comeau et al. (8).The proposed -35 and -10 regions are underlined. The nucleotidesare numbered from the proposed start of transcription from the P1promoter at position 1. This position was estimated by the sizes ofrunoff transcripts from in vitro transcription experiments (see Fig. 6)and from in vivo primer extension results (see Fig. 7 and reference5). The regions protected by IHF in footprinting experiments (seeFig. 3) are indicated by horizontal lines above the sequence. Thenucleotides corresponding to those in the 13-bp IHF consensusbinding sequence (34) are enclosed in brackets. These differ from theconsensus by one, two, and two bp in sites A, B, and C, respec-tively. The restriction fragments used for in vitro transcription andbinding are as follows: fragment 1, AvaI-XbaI (-128 to +116);fragment 2, AvaI-BstBI (-128 to +215); fragment 3, AvaI-TaqI(-128 to + 147). The XbaI site in fragment 1 was created by insertionof XbaI linkers at the RsaI site at +115 (8).

pied by IHF (54). It is of interest that the band representingIHF occupancy of two sites (Fig. 2, arrow labeled A)exhibits lower mobility than the complex in which three sitesare apparently occupied (Fig. 2, arrow labeled B). This mayreflect alternative DNA conformations induced by IHF

1 2 3 4 5 6 7 8

_.- A-4- B- C

FIG. 2. Analysis of IHF binding by the gel mobility shift assay.Approximately 0.1 pmol of an end-labeled AvaI-XbaI fragment (Fig.1, fragment 1) was incubated with the following concentrations (nano-molar) of IHF: lane 1, 0; lane 2, 5; lane 3, 10; lane 4, 25; lane 5, 50;lane 6, 100; lane 7, 150; lane 8, 200. A, B, and C represent IHF-DNAcomplexes formed at medium, low, and high levels of IHF, respec-tively. These correspond to IHF binding sites A, B, and C in Fig. 1.

VOL. 173, 1991

on October 14, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

5802 TSUI ET AL.

A1 2 3 4 5

B1 2 3 4 5 6

s+30

-50 .

*-10

*10 '

C0-50

+20 .

* -70

+50 '

-w..

.-90

+70 w

*-110

cB

:}§ 3! ,rl:: :i: i, _

,- .--^. ,i:tfiBs$ aSf t-.. , ., . ,. w . :: .:. . B::'w' '' .; .B :, ;. !B . s A ,:. .... . . . .: .. . -q Z .... y 2.. ..ea. . .. , wSs'** $*@bi 4e<:

.' ..i!SB. "iNg' ''@::F . ..:: '- e ... .. .. . .. ge ... _

i_It i... -:: " : t____t-- S:=::at =

...... . ::.: "... ........ ...... :...... . . ...: .. .. _.? ._:e 4.;': :<: >?: ........ ..... . . _

.5::.:.: 44:. :::., :..

b__..:

..: ::

A

FIG. 3. In vitro DNase I footprinting of IHF in the ompBpromoter region. Panels A and B show the DNase I protectionpatterns of the bottom and top strands, respectively, of fragment 1(approximately 0.1 pmol). The concentrations (nanomolar) of IHFadded for panel A were as follows: lane 1, 0; lane 2, 50; lane 3, 100;lane 4, 150 (lane 5 shows the T+C sequencing reactions); those forpanel B were as follows: lane 2, 0; lane 3, 50; lane 4, 100; lane 5, 150(lanes 1 and 6 show the T+C and A+G sequencing reactions,respectively). The approximate extent of protection by IHF for eachbinding site is indicated by a vertical line. The sequence is numberedas shown in Fig. 1.

binding (44). Binding of IHF in other systems has beenshown to alter DNA structure (24, 33, 44, 46, 51, 53, 57).

Specific binding of IHF to multiple binding sites. We usedthe DNase I footprinting technique of Galas and Schmitz (15)to analyze the binding of IHF to the ompB promoter regionfurther. The fragment used in the previous experiment was5' end labeled at either the XbaI site (top strand) or the AvaI

1 2 3 4 5 6 7 8 9 1011

FIG. 4. Amount of IHF required in vitro for 50% protectionagainst DNase I. Approximately 0.1 pmol of fragment 1, end labeledon the bottom strand, was incubated with the following concentra-tions (nanomolar) of IHF: lane 1, 0; lane 2, 20; lane 3, 40; lane 4, 60;lane 5, 80; lane 6, 100; lane 7, 120; lane 8, 140; lane 9, 160. Lanes 10and 11 show the T+C and A+G sequencing reactions, respectively.The asterisks above lanes 2, 3, and 4 indicate the estimated amountsof IHF needed for 50% protection for sites C, A, and B, respec-tively. The approximate extent of protection by IHF for eachbinding site is indicated by a vertical line. The sequence is numberedas shown in Fig. 1.

end (bottom strand) and subjected to DNase I footprinting.The data in Fig. 3 show the pattern of protection by IHF onthe bottom (Fig. 3A) and top (Fig. 3B) strands of the ompBpromoter fragment. It is clear that IHF binds to multiplesites in this region. Protection on the top strand can be seenin three areas (Fig. 3A, sites A, B, and C). Each of these

A

c

B

A

* +30

* +10

* -10

* -30

* -50

* -70

* -90

* -110

J. BACTERIOL.

Aiww:.--.,*-w--:i:-:-::.:-

WA)*:

on October 14, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

IHF INHIBITS ompB TRANSCRIPTION 5803

A 1 2 3 4 5 6 7 8 9

603 -

310 ,

281271 -234 -194 -

B100

0-11

."" 50

.

1

_E

.Ss<

i*'t .:'.p...,. i..

118-

72 -

40IHF (nM)

FIG. 5. Effect of IHF on in vitro transcription. (A) In vitro transcription. These single round transcription experiments were carried outessentially by methods described previously (42), by using as the template approximately 0.1 pmol of either fragment 2 (lanes 1 to 4) or 3 (lanes5 to 8). An EcoRI-AhaIII (4360 to 3945) pBR322 fragment (0.1 pmol) containing the bla promoter was used as a control (lanes 5 to 9). Thefollowing concentrations (nanomolar) of IHF were added: 0, lanes 1, 5, and 9; 20, lanes 2 and 6; 40, lanes 3 and 7; 80, lanes 4 and 8.Transcripts: A, bla; B, fragment 2; C, fragment 3. 4X174 DNA cut with HaeIIl was used as size markers (sizes are indicated on the left innucleotides). (B) Quantitation of transcription. The RNA bands were cut out of the gel and counted in a liquid scintillation counter.Transcripts: fragment 2, 0; fragment 3, 0. Transcription from the bla control fragment was slightly increased by IHF (15 to 25%), stronglysuggesting that IHF inhibition of ompB was specific.

sites (Fig. 1) contains sequences similar to the proposed13-bp IHF DNA-binding sequence (34). The estimated sizeof each protected area, approximately 35 to 40 bp, is similarto that reported for IHF binding sites in other systems (9, 32,34, 44). However, the precise limit of site A could not bedetermined because of insufficient DNase activity at the endof the fragment. IHF binding to the top strand can be seen inFig. 3B. Protection at site B (nucleotides -18 to -55) is notas apparent as the results obtained by using the bottomstrand. However, numerous interactions of IHF in thisregion can be identified.We estimated the apparent binding strength of IHF for

each of the sites by titration of the ompB promoter fragmentwith increasing amounts of IHF. The amount of IHF re-quired for 50% protection against DNase I was approxi-mately 20, 40, and 60 nM for sites C, A, and B, respectively(Fig. 4). Although site C requires only one-half as much IHFas site A for 50% protection, the sequence in site C is 1 bpfarther from the 13-bp consensus than is the site A sequence(Fig. 1). However, a number of reports suggest that thebases around the consensus are also important for IHFbinding (reviewed in reference 14). When these sequencesare taken into account by using an extended consensussequence analysis (20), the C site is 5% closer to theexpanded consensus than is the A site (46).IHF inhibits ompB transcription. Strong binding of IHF to

the ompB promoter region suggests that IHF can affect theexpression of this operon. We tested this possibility byadding IHF to a purified in vitro transcription system usingDNA fragments containing the ompB promoter region astemplates. As shown in Fig. 5A, a single major transcriptwas made when either an Aval-BstBI (fragment 2) or anAval-TaqI (fragment 3) was used as the template. Theestimated sizes of the runoff transcripts were 220 nucleotides

for fragment 2 and 152 nucleotides for fragment 3, suggestingthat transcription starts at the G residue at position + 1 (Fig.1). The transcript from either template was very stronglyinhibited when IHF was added to the transcription reaction.As a control, transcription from a bla promoter fragment wasslightly increased by added IHF. Extrapolation of the data inFig. 5B indicated that ompB transcription from either frag-ment was inhibited 50% by approximately 10 nM IHF. WhenRNA polymerase was added before IHF, there was little orno inhibition of ompB transcription (Fig. 6). These results,together with the data showing that two of the IHF bindingsites overlap the ompB promoter (Fig. 1), suggest that IHFcan block RNA polymerase access to this promoter.

Effect of IHF on ompB expression in vivo. We used theprimer extension technique (3) to analyze the physiologicalsignificance of the in vitro results. RNA was isolated from anIHF mutant and its isogenic parent and hybridized with asynthetic primer corresponding to nucleotides 251 to 270 (8).An autoradiogram of the DNA synthesized from the primerby reverse transcriptase is shown in Fig. 7. The resultsindicate that the major start site of ompB transcription invivo is the same as that suggested by in vitro experiments.The intensity of the DNA suggests that less ompB mRNAwas made in the parent strain than in the IHF mutant.Quantification of the bands by using Beta-Scanner (AMBisSystems, San Diego, Calif.) showed a 4.2-fold increase in thesample from the IHF mutant. Significantly, this increase wasstrongly reduced when the IHF mutant was transformedwith a plasmid containing the structural genes for IHF (Fig.7). The data also indicate that a second transcript initiatesapproximately 22 bp downstream from the major start site.This RNA has been shown to originate from a cyclicAMP-dependent promoter which is also inhibited in vitro byIHF (27). Additional in vivo data suggest a negative role for

VOL. 173, 1991

AiMik

on October 14, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

5804 TSUI ET AL.

FIG. 6. Effect of time of IHF addition on in vitro transcription.IHF was added to the preincubation mixture either 10 min before(lanes 5 to 7) or 10 min after (lanes 1 to 4) RNA polymerase. In eachcase, incubation was continued for 10 min before transcription wasstarted by addition of magnesium acetate. Fragment 2 was used asthe template. The following concentrations (nanomolar) of IHFwere added: 0, lane 1; 20, lanes 2 and 5; 40, lanes 3 and 6; 80, lanes4 and 7. The arrowhead indicates the major ompB transcript.

IHF in ompB expression. In these experiments, 3-galactosi-dase activity from the ompB-lacZ protein fusion in JMS65was 2.5 to 3.5-fold lower in the parent than in the IHFmutant strain (Table 1).To evaluate whether IHF directly interacts with the ompB

promoter in vivo, we used oligonucleotide mutagenesis (3) toalter the IHF binding sites. The AvaI-BstBI (-128 to +215)fragment was shortened (-73 to +164) by cutting withHinPT. In addition, two A. T base pairs (-39 and -40) inthe IHF consensus sequence in the IHF-B site were changedto G. C base pairs to create mutant template LH315. Asecond mutant template, LH313, in which the A. T basepair at +3 in the IHF consensus sequence in the IHF-C sitewas deleted, was also constructed. In gel retardation assays,we were unable to detect IHF binding to the IHF-C site inLH313 or to the IHF-B or IHF-A site in LH315 (46). Theeffects of these mutations on ompB promoter function invivo were examined by cloning these mutant templates, aswell as the unaltered AvaI-BstBI fragment, in front of the catgene in pKK232-8. These new plasmids were introduced intoan IHF mutant strain and its isogenic parent, and ompBpromoter activity was determined by measuring the activityof chloramphenicol acetyltransferase. The data in Table 2show that chloramphenicol acetyltransferase activity fromthe plasmid with the unaltered ompB promoter fragment wasthreefold higher in the IHF mutant than in the parent strain.This is comparable to the increase found in chromosomalompB expression in IHF mutants (Fig. 7; Table 1). A similarincrease in ompB activity was found in the ompB template

A B C D E F

242 -

180 -

147 -

123 -

90 -

67 -

FIG. 7. Primer extension analysis. Total cellular RNA was iso-lated from cells grown in Luria broth and hybridized with a syntheticprimer complementary to ompB nucleotides 251 to 270 (8). The sameamount of RNA was used in each analysis. Primer extensionanalysis was carried out as described in Materials and Methods.Lanes: A, DNA size markers; B, RNA from JMS65; C, RNA fromMF2910 (JMS65, IHF-); D, RNA from MF2911 (MF2910 trans-formed with IHF plasmid pPLhiphimA-5); E and F, products ofA+G and C+T sequencing reactions, respectively, using ompBfragment 1 (Fig. 1). The arrow indicates the DNA fragment of 142 bpwhich corresponds to the start site at +1 (Fig. 1) estimated by thesizes of in vitro runoff transcripts. The smaller fragment of 120 bpsuggests that a second ompB transcript initiates at +23. In vivo andin vitro experiments indicated that this RNA is made from a cyclicAMP-dependent promoter located downstream from the promoterdescribed in the present report (27). The numbers on the left indicatethe sizes of the DNA marker used in nucleotides.

containing mutations in the IHF-A and IHF-B binding sites(Table 2). However, the plasmid with the ompB fragmentthat has a mutated IHF-C binding site had the same activityin the THF+ and IHF- strains, and this activity was threefoldhigher than that made from the normal ompB template in theparent strain (Table 2). These results strongly suggest thatIHF binding to the ompB promoter is necessary for the

1 2 3 4 5 6 7

J. BACTERIOL.

on October 14, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

IHF INHIBITS ompB TRANSCRIPTION 5805

TABLE 1. Effect of an IHF mutation on P-galactosidase activityin an ompB-lacZ fusion strain

Growth 13-Galactosidase activitybconditiona JM565 MF2910

Minimal medium 31.2 72.6Luria broth 45.0 127.2Nutrient broth 42.5 134.8Tryptone broth 49.2 149.1

a Cells were grown with shaking at 37°C for 16 h in minimal-glucose medium(37), Luria broth (37), 1% nutrient broth, or Tryptone broth (Difco).

b 1-Galactosidase activity was measured as described by Miller (37). Thedata are averages of four separate experiments. MF2910 is an IHF- derivativeof JM565. Enzyme activity is expressed in Miller units (37).

negative effect of IHF found in vivo and that this effect isprobably mediated primarily by IHF binding to the IHF-Csite.

DISCUSSION

In the present report, we have presented evidence thatIHF alters ompB expression in E. coli by directly interactingwith the ompB promoter. (i) Gel retardation experimentsshowed specific binding of IHF to a DNA fragment contain-ing the ompB promoter region. (ii) DNase I protectionstudies revealed three IHF binding sites in the ompB pro-moter-regulatory region. (iii) IHF strongly and specificallyinhibited transcription from the ompB promoter in vitro. Inaddition, analysis of ompB expression in growing cellsindicates that IHF also inhibits ompB transcription in vivo.This inhibition appears to be directly mediated by IHFbinding to the ompB promoter, since a site-specific mutationin the IHF-C binding site prevents the negative action of IHFon in vivo ompB promoter activity. Inactivation of theIHF-A and IHF-B binding sites did not appear to perturb theinhibitory activity of IHF in vivo, suggesting that these sitesplay little or no role in in vivo ompB expression. Alterna-tively, these sites may participate in the expression of thisoperon during cultural conditions not examined in this study(see below).IHF binding sites B and C overlap with the -35 and -10

regions, respectively, of the major ompB promoter. There-fore, as has been suggested for IHF repression of the X pcinpromoter (21), IHF could inhibit ompB transcription bycompeting with RNA polymerase for binding. Consistent

TABLE 2. Effects of mutations in IHF binding sites on in vivoompB promoter activitya

Chloramphenicol acetyltransferaseMutated IHF site(s) sp actb of strain:fragment altered

MF2705 (IHF+) MF2706 (IHF-)

LH311 None 24.6 76.1LH313 C 65.2 64.1LH315 A, B 10.2 24.4

a Cells transformed with pKK232-8 containing ompB-cat fusions weregrown in Luria broth (37) with shaking at 37°C for 16 h. Cell extracts wereprepared, and chloramphenicol acetyltransferase activity was measured asdescribed in Materials and Methods.

b Chloramphenicol acetyltransferase specific activity is expressed as micro-moles of product per milligram of protein per minute. The reduced chloram-phenicol acetyltransferase activity from LH315 was probably due to thechanges introduced at base pairs -39 and -40, which are close to the -35region of the major ompB promoter.

with this idea were results showing that there was littleinhibition of ompB transcription when RNA polymerase wasincubated with the template prior to addition of IHF. If thismechanism occurred in vivo, it would strongly depend onthe relative local concentrations of IHF and polymerase.Alternatively, IHF may alter polymerase function afterclosed complex formation, perhaps at the isomerization stepin a manner analogous to that of the lac (52) and P22 Arc (60)repressors. IHF is a direct negative effector of gene expres-sion in a number of other systems (26, 32, 33, 43, 45, 55, 56).However, little is known concerning how IHF blocks tran-scription at these promoters.

In addition to negative regulation, IHF can have a positiverole in gene expression (reviewed in reference 14). Reportssuggest that IHF can stimulate translation initiation (35) andtranscription initiation (6, 17, 18, 24, 25, 48) and elongation(59). In some of these systems (17, 24, 57), and in otherprocesses (4, 44, 47), IHF has been found to alter DNAstructure and influence the function of other DNA-bindingproteins (25, 47, 61). Therefore, the negative effect of IHF onompB transcription may be more complex than a simplemodel of direct interaction between IHF and RNA polymer-ase. In this regard, at least two additional proteins bind tothe ompB promoter region. OmpR binds within the IHF-Csite (5), and the cyclic AMP-binding protein (cyclic AMP-CRP) binds at a site located within the IHF-B binding regionand activates at least one additional promoter (27). Datasuggest that both of these proteins play a role in ompBexpression in vivo (4, 27). Taken together, these resultssuggest that the function of IHF in the orrpB promoter-regulatory region is quite complicated and involves interac-tion of IHF with a number of other DNA-binding proteins. Itis therefore probable that a detailed analysis of the effects ofeach of these proteins on ompB expression is necessarybefore the mechanism of action of IHF in this system can befully understood.IHF also has a direct negative effect on ompF and ompC

(26, 45, 46), and it is likely that IHF regulation of ompBcontributes to the overall expression of these operons. Theprecise way in which this is accomplished awaits analysis. Itis also not obvious why IHF is involved in regulation of theomp system. The physiological role of IHF in E. coli is notknown, and its concentration does not appear to vary inresponse to environmental change (14). Perhaps, as sug-gested previously (25), IHF acts in a manner similar to thatof certain general regulatory proteins in eukaryotes whosephysiological role in influencing expression of a particulargene is determined primarily through interaction with otherregulatory factors whose levels are under environmental ortemporal control (38).

ACKNOWLEDGMENTS

We are grateful to Howard Nash for his gift of purified IHF, T.Silhavy and M. Inouye for strains and plasmids, and M. Hedeshianand B. Jacob for doing the chloramphenicol acetyltransferase as-says.

This work was supported by grant GM17152 from the NationalInstitutes of Health.

REFERENCES1. Aiba, H., and T. Mizuno. 1990. Phosphorylation of a bacterial

activator protein, OmpR, by a protein kinase, EnvZ, stimulatesthe transcription of the ompF and ompC genes in Escherichiacoli. FEBS Lett. 261:19-22.

2. Aiba, H., T. Mizuno, and S. Mizushima. 1989. Transfer ofphosphoryl group between two regulatory proteins involved inosmoregulatory expression of the ompF and ompC genes in

VOL. 173, 1991

on October 14, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

5806 TSUI ET AL.

Escherichia coli. J. Biol. Chem. 264:8563-8567.3. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G.

Seidman, J. A. Smith, and K. Struhl (ed.). 1987. Currentprotocols in molecular biology. John Wiley & Sons, Inc., NewYork.

4. Berman, M. L., and D. E. Jackson. 1984. Selection of lac genefusions in vivo: ompR-lacZ fusions that define a functionaldomain of the ompR gene product. J. Bacteriol. 159:750-756.

5. Brissette, R., and M. Inouye (Robert Wood Johnson MedicalSchool). 1991. Personal communication.

6. Cannon, W. V., E. Kreutzer, H. M. Kent, E. Morett, and M.Buck. 1990. Activation of the Klebsiella pneumoniae nifUpromoter: identification of multiple and overlapping upstreamNifA binding sites. Nucleic Acids Res. 18:1693-1701.

7. Coleman, J., P. J. Green, and M. Inouye. 1984. The use of RNAscomplementary to specific mRNAs to regulate the expression ofindividual bacterial genes. Cell 37:429-436.

8. Comeau, D. E., K. Ikenaka, K. Tsung, and M. Inouye. 1985.Primary characterization of the protein products of the Esche-richia coli ompB locus: structure and regulation of synthesis ofthe OmpR and EnvZ proteins. J. Bacteriol. 164:578-584.

9. Craig, N., and H. A. Nash. 1984. E. coli integration host factorbinds to specific sites in DNA. Cell 39:707-716.

10. Drlica, K., and J. Rouviere-Yaniv. 1987. Histone-like proteins ofbacteria. Microbiol. Rev. 51:301-319.

11. Forst, S., D. Comeau, S. Norioka, and M. Inouye. 1987. Local-ization and membrane topology of EnvZ, a protein involved inosmoregulation of OmpF and OmpC in Escherichia coli. J. Biol.Chem. 262:16433-16438.

12. Forst, S., J. Delgado, and M. Inouye. 1989. Phosphorylation ofOmpR by the osmosensor EnvZ modulates expression of theompF and ompC genes in Escherichia coli. Proc. Natl. Acad.Sci. USA 84:6952-6956.

13. Fried, M., and D. Crothers. 1981. Equilibria and kinetics of Lacrepressor operator interactions by polyacrylamide gel electro-phoresis. Nucleic Acids Res. 9:6505-6526.

14. Friedman, D. I. 1988. Integration host factor: a protein for allreasons. Cell 55:545-554.

15. Galas, D., and A. Schmitz. 1978. DNase footprinting: a simplemethod for the detection of protein-DNA binding specificity.Nucleic Acids Res. 5:3157-3170.

16. Garner, M. M., and A. Revzin. 1981. A gel electrophoresismethod for quantifying the binding of proteins to specific DNAregions: applications to components of the E. coli lactoseoperon regulatory system. Nucleic Acids Res. 9:3047-3060.

17. Giladi, H., M. Gottesman, and A. B. Oppenheim. 1990. Integra-tion host factor stimulates the phage lambda pL promoter. J.Mol. Biol. 213:109-121.

18. Gober, J. W., and L. Shapiro. 1990. Integration host factor(IHF) is required for the activation of developmentally regulatedgenes in Caulobacter. Genes Dev. 4:1494-1504.

19. Goodman, S. C., and H. A. Nash. 1989. Functional replacementof a protein-induced bend in a DNA recombination site. Nature(London) 341:251-254.

20. Goodrich, J. A., M. L. Schwartz, and W. R. McClure. 1990.Searching for and predicting the activity of sites for DNAbinding proteins: compilation and analysis of the binding sitesfor Escherichia coli integration host factor (IHF). Nucleic AcidsRes. 18:4993-5000.

21. Griffo, G., A. B. Oppenheim, and M. E. Gottesman. 1989.Repression of the A pcin promoter by integrative host factor. J.Mol. Biol. 209:55-64.

22. Hall, M. N., and T. J. Silhavy. 1981. The ompB locus and theregulation of the major outer membrane porin proteins ofEscherichia coli K-12. J. Mol. Biol. 146:23-43.

23. Hall, M. N., and T. J. Silhavy. 1981. Genetic analysis of theompB locus in Escherichia coli K-12. J. Mol. Biol. 151:1-15.

24. Higgins, N. P., D. A. Collier, M. W. Kilpatrick, and H. M.Krause. 1989. Supercoiling and integration host factor changethe DNA conformation and alter the flow of convergent tran-scription in phage Mu. J. Biol. Chem. 264:3035-3042.

25. Hoover, T. R., E. Santero, S. Porter, and S. Kustu. 1990. Theintegration host factor stimulates interaction of RNA polymer-

ase with NIFA, the transcriptional activator for nitrogen fixa-tion operons. Cell 63:11-22.

26. Huang, L., P. Tsui, and M. Freundlich. 1990. Integration hostfactor is a negative effector of the in vivo and in vitro expressionof ompC in Escherichia coli. J. Bacteriol. 172:5293-5298.

27. Huang, L., P. Tsui, and M. Freundlich. Submitted for publica-tion.

28. Igo, M. M., A. J. Ninfa, and T. J. Sihavy. 1989. A bacterialenvironmental sensor that functions as a protein kinase andstimulates transcriptional activation. Genes Dev. 3:598-605.

29. Igo, M. M., A. J. Ninfa, J. B. Stock, and T. J. Silhavy. 1989.Phosphorylation and dephosphorylation of a bacterial transcrip-tional activator by a transmembrane receptor. Genes Dev.3:1725-1734.

30. Inouye, M. (ed.). 1979. Bacterial outer membranes: biogenesisand function, p. 1-12. John Wiley & Sons, Inc., New York.

31. Jo, Y.-L., F. Nara, S. Ichihara, T. Mizuno, and S. Mizushima.1986. Purification and characterization of the OmpR protein, apositive regulator involved in osmoregulatory expression of theompF and ompC genes in Escherichia coli. J. Biol. Chem.261:15252-15256.

32. Krause, H. M., and N. P. Higgins. 1986. Positive and negativeregulation of the Mu operator by Mu repressor and Escherichiacoli integration host factor. J. Biol. Chem. 261:3744-3752.

33. Kur, J., N. Hasam, and W. Szybalski. 1989. Physical andbiological consequences of interactions between integrationhost factor (IHF) and coliphage lambda late P'R promoter and itsmutants. Gene 18:1-15.

34. Leong, J. M., S. Nunes-Duby, C. F. Lesser, P. Youderian, M. M.Susskind, and A. Landy. 1985. The )80 and P22 attachmentsites: primary structure and interaction with Escherichia coliintegration host factor. J. Biol. Chem. 260:4468-4477.

35. Mahajna, J., A. B. Oppenhein, A. Rattray, and M. Gottesman.1986. Translation initiation of bacteriophage lambda gene cIIrequires integration host factor. J. Bacteriol. 165:167-174.

36. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

37. Miller, J. H. 1972. Experiments in molecular genetics. ColdSpring Harbor Laboratory, Cold Spring Harbor, N.Y.

38. Mitchell, P. J., and R. TUan. 1989. Transcriptional regulation inmammalian cells by sequence-specific DNA binding proteins.Science 245:371-378.

39. Nash, H., and C. Robertson. 1981. Purification and properties ofthe Escherichia coli protein factor required for X integrativerecombination. J. Biol. Chem. 256:9246-9253.

40. Nash, H. A., C. A. Robertson, E. Flamm, R. A. Weisberg, andH. I. Miller. 1987. Overproduction of Escherichia coli integra-tion host factor, a protein with nonidentical subunits. J. Bacte-riol. 169:4124-4127.

41. Norioka, S., G. Ramakrishnan, K. Ikenaka, and M. Inouye.1986. Interaction of a transcriptional activator, OmpR, withreciprocally osmoregulated genes, ompF and ompC, of Esche-richia coli. J. Biol. Chem. 261:17113-17119.

42. Okamoto, K., and M. Freundlich. 1986. Mechanism for theautogenous control of the crp operon: transcriptional inhibitionby a divergent RNA transcript. Proc. Natl. Acad. Sci. USA83:5000-5004.

43. Pereira, R. F., M. J. Ortuno, and R. P. Lawther. 1988. Bindingof integration host factor (IHF) to the ilvGpl promoter of theilvGMEDA operon of Escherichia coli K12. Nucleic Acids Res.16:5973-5989.

44. Prentiki, P., M. Chandler, and D. Galas. 1987. Escherichia coliintegration host factor bends the DNA at the ends of IS1 and inan insertion hotspot with multiple IHF binding sites. EMBO J.6:2479-2487.

45. Ramani, N., L. Huang, and M. Freundlich. Mol. Gen. Genet., inpress.

46. Ramani, N., L. Huang, and M. Freundlich. Unpublished data.47. Robertson, C. A., and H. A. Nash. 1988. Bending of the

bacteriophage K attachment site by Escherichia coli integrationhost factor. J. Biol. Chem. 263:3554-3557.

48. Santero, E., T. Hoover, J. Kenner, and S. Kustu. 1989. In vitro

J. BACTERIOL.

on October 14, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

IHF INHIBITS ompB TRANSCRIPTION 5807

activity of the nitrogen fixation regulatory protein NIFA. Proc.Natl. Acad. Sci. USA 86:7346-7350.

49. Shaw, W. V. 1975. Chloramphenicol acetyltransferase fromchloramphenicol resistant bacteria. Methods Enzymol. 57:737-755.

50. Slauch, J. M., and T. J. Silhavy (Princeton University). 1990.Personal communication.

51. Stenzel, T. T., P. Patel, and D. Bastia. 1987. The integration hostfactor of Escherichia coli binds to bent DNA at the origin ofreplication of the plasmid pSC101. Cell 49:709-717.

52. Straney, S. B., and D. M. Crothers. 1987. Lac repressor is a

transient gene-activating protein. Cell 51:699-707.53. Thompson, J. F., and A. Landy. 1988. Empirical estimation of

protein-induced DNA bending angles: application to site-spe-cific recombination complexes. Nucleic Acids Res. 16:9687-9705.

54. Thompson, J. F., D. Waechtler-Brulla, R. I. Gumport, J. F.Gardner, L. Moitoso de Vargas, and A. Landy. 1986. Mutationsin an integration host factor-binding site: effect on lambdasite-specific recombination and regulatory implications. J. Bac-teriol. 168:1343-1351.

55. Thompson, R. J., and G. Mosig. 1988. Integration host factor(IHF) represses a Chlamydomonas chloroplast promoter in E.coli. Nucleic Acids Res. 16:3313-3326.

56. Tsui, P., and M. Freundlich. 1988. Integration host factor bindsspecifically to sites in the ilvGMEDA operon in Escherichia coli.J. Mol. Biol. 203:817-820.

57. Tsui, P., and M. Freundlich. 1990. Integration host factor bendsthe DNA in the Escherichia coli ilvBN promoter region. Mol.Gen. Genet. 223:349-352.

58. Tsui, P., V. Helu, and M. Freundlich. 1988. Altered osmoregu-lation of ompF in integration host factor mutants of Escherichiacoli. J. Bacteriol. 170:4950-4953.

59. Tsui, P., A. Sirko, and M. Freundlich. Submitted for publica-tion.

60. Vershon, A. K., S.-M. Liao, W. R. McClure, and R. T. Sauer.1987. Interaction of the bacteriophage P22 Arc repressor withoperator DNA. J. Mol. Biol. 195:322-331.

61. Wiater, L. A., and N. D.-F. Grindley. 1988. -ya transposase andintegration host factor bind cooperatively at both ends of -yu.

EMBO J. 7:1907-1911.

VOL. 173, 1991

on October 14, 2020 by guest

http://jb.asm.org/

Dow

nloaded from