Interleukin-1b and microRNA-146a in an immature rat model

and children with mesial temporal lobe epilepsy*Ahmed Omran, *Jing Peng, *Ciliu Zhang, *Qiu-Lian Xiang, yJinfeng Xue, *Na Gan,

*Huimin Kong, and *Fei Yin

*Department of Pediatrics, Xiangya Hospital of Central South University, Changsha, Hunan, China; and

yThe State Key Laboratory of Medical Genetics, Central South University, Changsha, Hunan, China

SUMMARY

Purpose: Increasing evidence indicates that neuroinflam-

mation plays a critical role in the pathogenesis of mesial

temporal lobe epilepsy (MTLE). The aim of this study was

to investigate the dynamic expression of interleukin (IL)–

1b as a proinflammatory cytokine and microRNA (miR)-

146a as a posttranscriptional inflammation-associated

microRNA (miRNA) in the hippocampi of an immature

rat model and children with MTLE.

Methods: To study the expression of IL-1b and miR-146a,

we performed a reverse transcription polymerase chain

reaction, Western blot, and real-time quantitative PCR

on the hippocampi of immature rats at 11 days of age.

Expression was monitored in the acute, latent, and

chronic stages of disease (2 h and 3 and 8 weeks after

induction of lithium-pilocarpine status epilepticus, respec-

tively), and in control hippocampal tissues corresponding

to the same timeframes. Similar expression methods

were applied to hippocampi obtained from children with

MTLE and normal controls.

Key Findings: The expression of IL-1b and miR-146a in

both children and immature rats with MTLE differs

according to the stage of MTLE development. Both IL-1b

and miR-146a are significantly up-regulated, but in oppo-

site ways: IL-1b expression is highest in the acute stage,

when expression of miR-146a is at its lowest level; miR-

146a expression is highest in the latent stage, when IL-1b

expression is at its lowest level. Both IL-1b and miR-146a

are up-regulated in the chronic stage, but not as much as

in the other stages.

Significance: Our study is the first to focus on the expres-

sion of miR-146a in the immature rat model of lithium-

pilocarpine MTLE and in children with MTLE. We have

detected that the expression of proinflammatory

cytokine IL-1b and posttranscriptional inflammation-

associated miR-146a is variable depending on the disease

stage. Furthermore, both IL-1b and miR-146a are up-

regulated in immature rats and children with MTLE. Our

findings elucidate the role of inflammation in the

pathogenesis of MTLE in the immature rat model and

children. Therefore, modulation of the IL-1b–miR-146a

axis may be a novel therapeutic target in the treatment

of MTLE.

KEY WORDS: IL-1b, miR-146a, Mesial temporal lobe

epilepsy, Gene expression, Inflammation, Immature rat.

Seizure is the most common pediatric neurologicdisorder, with 4–10% of children having at least one attackof seizure in the first 16 years of life (Friedman & Ghazala,2006). Despite currently available antiepileptic drugs,20–40% of all patients with epilepsy remain refractory tomedical management (Engel, 1998; Mohanraj & Brodie,2006; Stephen et al., 2006). Mesial temporal lobe epilepsy(MTLE) is one of the most common and intractable formsof seizure disorder. It usually begins in childhood and isoften associated with a history of prolonged or complex(and possibly simple) febrile seizures (Annegers et al.,

1987; Berg & Shinnar, 1996). Epilepsy in children is differ-ent from that in adults (Spencer & Huh, 2008). It has beenwell established that the brain is more susceptible to seizureearly in life, and that seizures in the immature brain arelikely to be dependent on different mechanisms than thosein the adult brain (Coppola & Moshe, 2009; Wahab et al.,2011). Epilepsy in early childhood is often difficult to treat,which may be due to physiologic immaturities in ionhomeostasis and other developmental characteristics(Sheizaf et al., 2007; Usta et al., 2007).

Increasing evidence highlights the activation of inflam-matory pathways in temporal lobe epilepsy (TLE) and sug-gests that a persistent up-regulation of inflammatory geneexpression may contribute to the etiopathogenesis of TLE(Vezzani & Granata, 2005; Vezzani et al., 2008). The proin-flammatory cytokine interleukin (IL)–1b is thought to play akey role in the development of seizures and epilepsy(Vezzani & Baram, 2007). Many recent studies have shown

Accepted April 19, 2012; Early View publication June 18, 2012.Address correspondence to Fei Yin, Department of Pediatrics, Xiangya

Hospital of Central South University, No. 87 Xiangya Road, Changsha,Hunan 410008, China. E-mail: yf_2323@yahoo.com

Wiley Periodicals, Inc.ª 2012 International League Against Epilepsy

Epilepsia, 53(7):1215–1224, 2012doi: 10.1111/j.1528-1167.2012.03540.x

FULL-LENGTH ORIGINAL RESEARCH

1215

increased expression of IL-1b after experimental seizuresand epilepsy (Rijkers et al., 2009; Akin et al., 2011; J�rvel�et al., 2011; Pernot et al., 2011; Vezzani et al., 2011). Sei-zure-induced IL-1b is found predominantly in brain struc-tures with the most severe seizure-induced neuronal damage(Vezzani et al., 1999; Eriksson et al., 2000; Rizzi et al.,2003; Marini et al., 2004; Ravizza et al., 2005). It is notablethat the intracerebral injection of IL-1 receptor antagonist(IL-1Ra) has powerful anticonvulsant effects (Vezzani et al.,2002). Recent findings suggest that targeting proinflamma-tory events with antiinflammatory therapy could be effectivein controlling drug-resistant pediatric seizures by improvingthe integrity of the blood–brain barrier (BBB) and blockingthe epileptogenic process (Marchi et al., 2011; Abrahamet al., 2012). A number of posttranscriptional inflammation-associated microRNAs (miRNAs), such as brain-enrichedmiR-146a, have been strongly implicated in the regulation ofinnate immune, viral, and inflammatory responses (Lukiw &Pogue, 2007; Nakasa et al., 2008; Sonkoly et al., 2008;Stanczyk et al., 2008; Keiichiro et al., 2009; Tang et al.,2009; Larner-Svensson et al., 2010; Li et al., 2011).

Typically, miRNAs are 18–24 nucleotide long, single-stranded molecules that suppress the expression of protein-coding genes at the posttranscriptional level by directingtranslational repression, mRNA destabilization, or a combi-nation of the two (Bartel, 2009). Aronica et al. (2010) werethe first to report the altered expression pattern of miR-146a, as shown in epileptic rats and adult patients with TLE,shedding new light on molecular mechanisms in the proepi-leptogenic inflammatory signaling processes. Other studieshave examined the relationship between IL-1b and miR-146a in other systems, including alveolar cells (Perry et al.,2008), smooth muscle cells (Larner-Svensson et al., 2010),and pancreatic beta cells (Roggli et al., 2010).

In this study we aimed to detect the dynamic expressionof IL-1b as a proinflammatory cytokine and miR-146a as aposttranscriptional inflammation-associated miRNA in thehippocampi of an immature rat model in the three stages ofMTLE development (acute, latent, and chronic), and to con-firm the results in the chronic stage by examining expres-sion in the hippocampi of children with MTLE. This studyprovides new insight into the role of inflammation in thepathogenesis of MTLE development in an immature ratmodel and in children, and suggests that modulation of theIL-1b–miR-146a axis may be a novel therapeutic target inthe treatment of MTLE.

Methods

Experimental animalsWe started our experiment with 52 immature Sprague-

Dawley rats of either sex at postnatal day 11 (PN11) fromthe Experimental Animal Center of Xiangya Medical Col-lege, Central South University. The animals were housed ina room with controlled temperature (20 € 2�C) and humid-

ity (50–60%) and were kept on an alternating 12-h light-dark cycle. Animals had free access to food and water. The52 rats were randomly divided into two groups: experimen-tal group E (n = 36) and control group C (n = 16). Theywere allowed to adapt to laboratory conditions for at least1 week before starting the experiments. All procedures wereapproved by the Institutional Animal Care and Use Commit-tee of Central South University.

Epilepsy inductionOn PN11, the E rats (n = 36) were injected with lithium

chloride (125 mg/kg, i.p.; Sigma-Aldrich Chemie, Deisen-hofen, Germany) followed 18–20 h later by pilocarpinehydrochloride treatment (30 mg/kg, i.p.; Boehringer Mann-heim, Indianapolis, IN, U.S.A.) to induce status epilepticus.Methylscopolamine (1 mg/kg, i.p.), a muscarinic antagonistthat does not cross the BBB, was administered 15 min beforepilocarpine treatment to reduce the peripheral effects of theconvulsant and thus enhance survival. The severity of con-vulsions was evaluated by Racine’s classification (Racine,1972). Only animals classified higher than stage 3 were usedin this study. Status epilepticus was defined as seizure-likeactivity lasting at least 30 min. Intraperitoneal pilocarpineadministration (10 mg/kg) was repeated every 30 min ifthere was no seizure attack or if seizure activities were classi-fied lower than Racine’s stage 4. The maximum dose forpilocarpine injection was 60 mg/kg. Ninety minutes afterthe onset of status epilepticus, all status epilepticus rats wereadministered diazepam (10 mg/kg, i.p.; Sigma-Aldrich) toterminate the seizure activity. The C rats (n = 16) receivedan injection of the same amount of normal saline as areplacement for pilocarpine. Following pilocarpine treat-ment, the rats were video-monitored for 8 weeks (24 h/day),using an infrared ray monitor during periods of early moni-toring. We observed spontaneous seizures occurring mainlyaround 3 weeks after status epilepticus. Chronic seizuresoccurred at 8 weeks post–pilocarpine administration with afrequency of 5–12 seizures in 24 h. The time between lastspontaneous seizure and analysis was usually <24 h.

Based on the epilepsy development stages, the samplesize was divided randomly into six groups: (1) acute controlgroup, AC (control rats, 2 h after pilocarpine administra-tion; n = 8); (2) acute seizure group, AS (induced rats, 2 hafter pilocarpine administration; n = 8); (3) latent controlgroup, LC (control rats, 3 weeks after pilocarpine adminis-tration; n = 8); (4) latent seizure group, LS (induced rats,3 weeks after pilocarpine administration; n = 8); (5)chronic spontaneous seizure group, SS (induced rats thatshowed spontaneous seizures 8 weeks after pilocarpineadministration; n = 8); and (6) chronic no spontaneous sei-zure group NSS (induced rats that did not show spontaneousseizures 8 weeks after pilocarpine administration; n = 8).The rats that failed to develop status epilepticus after pilo-carpine treatment were euthanized and were rejected fromthe experiment.

1216

A. Omran et al.

Epilepsia, 53(7):1215–1224, 2012doi: 10.1111/j.1528-1167.2012.03540.x

MTLE children and controlsSpecimens were obtained at surgery from five children

undergoing unilateral selective amygdalohippocampectomyfor drug-resistant MTLE with typical imaging features andpathologic confirmation of hippocampal sclerosis. The deci-sion for surgery was based on convergent evidence of clini-cal and electroencephalography (EEG) recordings duringprolonged video-EEG monitoring, high-resolution magneticresonance imaging (MRI) indicating mesial temporal lobeseizure onset, and invasive electroencephalography record-ings. Surgical specimens were examined by routine pathol-ogy. As control tissue, five normal hippocampal sampleswere obtained at autopsy from children (postmortem delay:max. 12 h) with no history of any brain disease. Neuropa-thologic studies confirmed that control tissues were normal.Clinical information on children with MTLE and controls ispresented in Table 1. This study was approved by the Insti-tutional Ethics Committee of Central South University andwritten informed consent was obtained from the parents ofall patients before analysis.

Rat tissue preparation for RNA isolationThe immature rats were sacrificed under deep anesthesia

by intraperitoneal injection of chloral hydrate (10%, 5 ml/kg)at 2 h and 3 and 8 weeks after pilocarpine-induced statusepilepticus. Rats were decapitated in the acute phase (2 hafter status epilepticus; n = 8), latent period (3 weeks afterstatus epilepticus, without any spontaneous seizures; n = 8),and in the chronic epileptic phase (8 weeks after status epi-lepticus; n = 8; only rats that exhibited daily seizures wereincluded in this group). Control rats for the three subgroupswere also included. After decapitation, the hippocampus wasremoved quickly using RNase-free instruments. All materialwas frozen on dry ice and stored at )80�C until use.

RNA isolationFor RNA isolation, frozen material was homogenized in

1 ml Trizol Reagent (Invitrogen, Carlsbad, CA, U.S.A.) foreach 50 mg of hippocampal tissue. After adding 0.2 ml ofchloroform, the aqueous phase was isolated using PhaseLock tubes (Eppendorf, Hamburg, Germany). RNA wasprecipitated with 0.5 ml isopropyl alcohol, washed twicewith 75% ethanol, and dissolved in nuclease-free water. Theconcentration and purity of RNA were determined at260/280 nm using a nanodrop spectrophotometer (OceanOptics, Dunedin, FL, U.S.A.).

Protein extractionA total of 30–80 mg of hippocampus was ground to

powder in liquid nitrogen, dissolved in 400 ml lysis buffer(7 M urea, 2 M thiourea, 2% NP-40, 1% Triton X-100,100 mM dithiothreitol (DTT), 5 mM phenylmethylsulfonylfluroide (PMSF), 4% (3-[(3-Cholamidopropyl)dimethyl-ammonio]-1 propanesulfonate) CHAPS, 0.5 mM ethylen-ediaminetetraacetic acid (EDTA), 40 mM Tris, 2%pharmalyte, 1 mg/ml DNase I, and 0.25 mg/ml RNase A),vortexed, and incubated (4�C, 60 min) Chemicals for pro-tein extraction were obtained from Amresco (Solon, OH,U.S.A.). The mixture was centrifuged (12 000 g/min,60 min, 4�C). The resulting supernatants, containing pro-teins, were then precipitated with acetone (1:4, overnight,)20�C, followed by centrifugation at 12 000 g, 10 min, at4�C) for deionization. After removing residual acetone byair-drying, the protein pellets were redissolved with lysisbuffer. After being centrifuged (12 000 g/min, 10 min,4�C) again, the supernatant was the total protein solution.The concentration of the total proteins was determined bya 2D-Quant Kit (GE Healthcare, Piscataway, NJ, U.S.A.).Each sample was prepared individually.

Table 1. Clinical characterization of MTLE children and controls

ID Sex Age (years)

Duration of

epilepsy (years)

Side of hippocampus

sample

Antiepileptic drugs MTS Grading

(Blumcke et al., 2007)

Child seizure (CS)

E1 F 8 5 L PB, LAM, VPA MTS type 1b

E2 F 9 3 R LEV, LAM, VPA MTS type 1a

E3 M 10 6 R CBZ, VPA, LEV MTS type 1b

E4 M 10 3 L CBZ, VPA, LAM MTS type 1a

E5 F 12 5 R CBZ, VPA, PHT MTS type 1b

ID Sex Age (years)

Postmortem

interval (h)

Side of hippocampus

sample Causes of death

Child control (CC)

C1 F 8 10 R Fatal chest trauma

C2 M 10 8 R Fatal abdominal trauma

C3 M 10 12 L Fatal chest trauma

C4 F 11 10 L Cardiomyopathy

C5 M 12 11 R Acute pancreatitis

E1-E5 represents 5 children with MTLE; C1-C5 represents 5 children without brain disease; CS, child seizure; CC, child control; L, Left; R, Right; CBZ,carbamazepine; LAM, lamotrigine; LEV, levetiracetam; OXC, oxcarbazepine; PB, phenobarbitone; PHT, phenytoin; VPA, valproate; TOP, topiramate; MTS, mesialtemporal sclerosis.

1217

Neuroinflammation and MTLE Development

Epilepsia, 53(7):1215–1224, 2012doi: 10.1111/j.1528-1167.2012.03540.x

IL-1b expression by reverse transcription polymerasechain reaction in the hippocampi of immature rats andchildren with MTLE

Total hippocampal RNA (1 lg) was reverse-transcribedusing a RevertAid First Strand complementary DNA(cDNA) Synthesis Kit (Thermo Scientific’s FermentasMolecular Biology Tools, Waltham, MA, U.S.A.) in thepresence of oligo -(dT)- 18 primers Table 2. PCR was per-formed in a total volume of 25 ll using Taq PCR Master-Mix (Qiagen, Valencia, CA, U.S.A.) according to themanufacturer’s instructions. The amplification productswere visualized by electrophoresis at 90 V for 30 min in1.5% (w/v) agarose gels and stained with ethidium bromide(0.5 lg/ml). The images were acquired by a gel image sys-tem (Tanon 1600; Tanon, Sanghai, China). Values were nor-malized to b- actin.

Detection of IL-1b expression by Western blot in thehippocampi of immature rats and children with MTLE

In total, 30 lg of total protein was run on a 12%sodium dodecyl sulfate–polyacrylamide (SDS-polyacryl-amide) gel, and the polyvinylidene fluoride (PVDF) mem-branes were incubated overnight at 4�C with polyclonalantibodies against IL-1b (Novus Biologicals, Littleton,CO, U.S.A.) at 1:500 dilutions. This was subsequentlyincubated with horseradish peroxidase (HRP)-conjugatedsheep anti-rabbit IgG (Amersham Biosciences, Piscata-way, NJ, U.S.A.) at 1:5,000 dilutions. b-Actin was usedas a loading control. The reactions were visualized usingan enhanced chemiluminescence (ECL) detection system.Signals on the blots were visualized by autography. Thefilm signals were digitally scanned and then quantifiedusing FluorChem software (Alpha Innotech, San Leandro,CA, U.S.A.).

miR-146a expression by qPCR in the hippocampi ofimmature rats and children with MTLE

cDNA was generated using an Invitrogen miRNA reverse-transcription kit according to the manufacturer’s instruc-tions. miR-146a and U6B small nuclear RNA gene (rnu6b)expression was analyzed using Invitrogen miRNA assays,which were run on the Applied Biosystems 7900HT (Foster

City, CA, U.S.A.) according to the instructions and manufac-turer set conditions. Data analysis was performed with thesoftware provided by the manufacturer, using the 2-(��Ct)method to determine the relative-quantitative level of miR-146a and expressed as a fold-difference to the relevant con-trol. Values were normalized to the U6B small nuclear RNAgene (rnu6b).

Statistical analysisAll of the data are expressed as means € standard devia-

tion (SD). A Student’s t-test was performed to determinesignificant differences between two groups. One-way analy-sis of variance (ANOVA) followed by Student-Neuman-Keuls post hoc tests was utilized to determine significantdifferences among multiple groups. p < 0.05 was consid-ered to be statistically significant.

Results

Behavior and seizures in an immature rat modelIn each pilocarpine-treated animal, clinical signs of sei-

zure activity were observed. All rats exhibited a well-defined pattern of behavior after pilocarpine treatment, suchas akinesia, ataxic lurching, tremor, head bobbing, mastica-tory automatisms with myoclonus of facial muscles, andwet dog shakes at onset. Behavioral changes were consistentwith the features of human MTLE.

Eighty-nine percent of all pilocarpine-induced rats(n = 32) progressed to status epilepticus with bilateral limbclonus, rearing, and falling after a 15–35 min injection ofpilocarpine.

The acute seizure and acute control groups were sacri-ficed 2 h after status epilepticus. Spontaneous seizuresoccurred mainly 3 weeks after pilocarpine administration.Seizures were generally characterized by a focal onset(immobility, mechanical mutation, mouth clonus, forelimbclonus), occasionally culminating in a generalized convul-sive stage, lasting about 30 s to 1.5 min. The latent seizureand latent control groups were sacrificed 3 weeks after sta-tus epilepticus.

Chronic seizures occurred 8 weeks after pilocarpineadministration. At this time point, 50% of the remaining

Table 2. Primer sequences and PCR conditions

Primer Forward Reverse Condition

Rat IL-1b TGGCAGCTACCTATGTCTTGC CCACTTGTTGGCTTATGTTCTG 94�C 4 min, 26 cycles of 94�C 30 s, 58�C 30 s,

72�C 30 s, 72�C 8 min

Human IL-1b AGTGGCAATGAGGATGACTTGT AGATGAAGGGAAAGAAGGTGCT 94�C 4 min, 28 cycles of 94�C 30 s, 59�C 30 s,

72�C 30 s, 72�C 8 min

Rat b- actin GAGAGGGAAATCGTGCGTGAC CATCTGCTGGAAGGTGGACA 94�C 4 min, 25 cycles of 94�C 30 s, 60�C 30 s,

72�C 30 s, 72�C 8 min

Human b- actin CTGGGACGACATGGAGAAAA AAGGAAGGCTGGAAGAGTGC 94�C 4min, 28 cycles of 94�C 30 s, 58�C 30 s,

72�C 30 s, 72�C 8 min

1218

A. Omran et al.

Epilepsia, 53(7):1215–1224, 2012doi: 10.1111/j.1528-1167.2012.03540.x

pilocarpine-induced rats manifested with chronic MTLE,experiencing seizures one to several times per day withsymptoms as described above. These rats were consideredthe SS group. The remaining rats had no spontaneous sei-zures, and were considered the NSS group.

Dynamic expression pattern of IL-1b in immature ratsRT-PCR results showed significant up-regulation of

IL-1b mRNA expression in all hippocampal tissues in boththe acute and chronic stages (p < 0.05) of MTLE develop-ment in the immature rat model, whereas the control grouphad greater up-regulation in the acute stage. In the latentstage, IL-1b mRNA expression was almost equal to expres-sion values in the control group. In immature rat tissues, IL-1b expression was normalized to that of b-actin (Fig. 1A,B).We confirmed our results by detecting IL-1b protein expres-sion by Western blot (WB), which showed the samedynamic changes as IL-1b mRNA (Fig. 1C). The compari-

son of IL-1b mRNA expression means in the MTLE imma-ture rat models and control groups in the three stages areshown in Table 3.

IL-1b expression in children with MTLERT-PCR results showed significantly higher expression

of IL-1b mRNA in the hippocampal tissues of children withMTLE than controls (patients, mean € SD 0.48 € 0.084;controls, mean € SD 0.25 € 0.088 p < 0.05). This resultwas confirmed by detecting the expression of IL-1b proteinby WB, which also showed higher expression in thepatients’ tissues compared to the control group. In the chil-dren’ tissues, IL-1b expressions was normalized to that ofb-actin (Fig. 2A–C).

Dynamic relative expression pattern of miR-146a inimmature rats

Quantitative PCR (qPCR) results showed significant up-regulation of miR-146a expression in all hippocampaltissues in the latent and chronic stages of MTLE develop-ment in the immature rat model. Expression was higher inthe latent stage, with a mean of 2.8 € 0.2 compared to thecontrol group mean of 1 € 0.1 (p < 0.05), and a mean of1.8 € 0.2 in the chronic stage compared to the control groupmean of 1 € 0.1 (p < 0.05). In the acute stage, miR-146aexpression levels were no different between the epilepticand control groups. In rat tissues, miR-146a expression wasnormalized to that of the U6B small nuclear RNA gene(rnu6b) (Fig. 3).

Relative expression of miR-146a in children with MTLEqPCR results showed significantly higher expression of

miR-146a in the hippocampal tissue of children with MTLEcompared to tissue from the control group, with a mean of3 € 0.2 compared to the control group mean of 1 € 0.2(p < 0.05). In the tissues obtained from children, miR-146aexpression was normalized to that of the U6B small nuclearRNA gene (rnu6b) (Fig. 4).

The dynamic expression pattern of IL-1b and miR-146ain the three stages of MTLE development in thehippocampi of immature rats

IL-1b showed its highest expression in the acute stage,whereas miR-146a expression levels were no different fromthe expression levels of controls. Meanwhile, miR-146a

A

B

C

Figure 1.

IL-1b dynamic expression patterns in the three stages of MTLE

development in an immature rat model. (A) Gray value rate of

IL-1b and b-actin expressions in the three stages of MTLE

development compared with control groups. (B) Significant up-

regulation occurred in the acute and chronic stages, with higher

expression in the acute stage. In the latent stage of MTLE,

expression was nearly equal to the control group (n = 8/

group). *p < 0.05. (C) IL-1b and b-actin protein expression in

the three stages of MTLE development compared with control

groups. (AC, acute control; AS, acute seizure; LC, latent con-

trol; LS, latent seizure; NSS, no spontaneous seizure; SS, spon-

taneous seizure).

Epilepsia ILAE

Table 3. Expression means of IL-1b in the three

stages of MTLE development in an immature rat

model and controls

Diseases stage MTLE Control

Acute stage 0.36 ± 0.01 0.11 ± 0.01

Latent stage 0.27 ± 0.08 0.12 ± 0.02

Chronic stage 0.096 ± 0.01 0.08 ± 0.02

1219

Neuroinflammation and MTLE Development

Epilepsia, 53(7):1215–1224, 2012doi: 10.1111/j.1528-1167.2012.03540.x

showed its highest expression in the latent stage, whereasIL-1b had its lowest expression in that stage, nearly similarto the expression levels of the controls. In the chronic stage,miR-146a was still significantly up-regulated, as was theexpression of IL-1b, through lower expression levels than inthe acute stage (Fig. 5A,B).

Discussion

Despite extensive research, the mechanism for the causeand progression of epilepsy is still unknown (Koh, 2009).

Pharmacologic findings suggest that brain inflammationin epilepsy contributes to seizures (Hulkkonen et al., 2004;Iyer et al., 2010). This concept is further supported by thefact that both experimental and clinical studies show thatvarious mediators of inflammation are present in the brain,

cerebrospinal fluid (CSF), and blood in epileptic conditions(Peltola et al., 2000, 2002; Hulkkonen et al., 2004).St�phane et al. (2010) reported that there are accumulatingdata showing that inflammation worsens the consequencesof epilepsy models in both mature and immature brains.

Understanding the mechanisms by which early lifeepilepsy develops would permit the design of selective,

Figure 3.

miR-146a relative dynamic expression in the three stages of

MTLE development in an immature rat model. Significant

up-regulation occurred in the latent and chronic stages, with

higher expression in the latent stage. In the acute stage, there

was no difference in expression between the epileptic and con-

trol groups. (n = 8/group) *p < 0.05 (AC, acute control; AS,

acute seizure; LC, latent control; LS, latent seizure; NSS, no

spontaneous seizure; SS, spontaneous seizure).

Epilepsia ILAE

Figure 4.

Relative expression of miR-146a in the hippocampal tissues

obtained from MTLE children and normal controls. Significant

up-regulation occurred in the MTLE children compared to nor-

mal controls. (n = 5/group). *p < 0.05 (CC, child control; CS,

child seizure).

Epilepsia ILAE

A

B

C

Figure 2.

IL-1b expression in hippocampal tissues obtained from MTLE

children and normal controls. (A) Gray value rate of IL-1b and

b-actin expression in children with MTLE compared to normal

controls. (B) Significant up-regulation occurred in the MTLE

children compared to normal controls. (n = 5/group).

*p < 0.05 (C) IL-1b and b-actin protein expression in children

with MTLE compared to normal controls. (CC, child control;

CS, child seizure).

Epilepsia ILAE

1220

A. Omran et al.

Epilepsia, 53(7):1215–1224, 2012doi: 10.1111/j.1528-1167.2012.03540.x

preventative, or interventional strategies. In our previouswork (Damaye et al., 2011; Wu et al., 2011), we found thatlithium-pilocarpine caused hippocampal pathology in animmature rat model. To uncover whether neuroinflamma-tion enhances epileptogenesis in the immature brain, westarted our experiment with immature rats on PN11, whichcorresponds to the same term in the human brain (Vannucciet al., 1999), and used human tissues from children surgi-cally treated for drug-resistant MTLE. We focused on thedynamic expression pattern of IL-1b as a proinflammatorycytokine and miR-146a as an inflammation-associatedmiRNA in the three stages of MTLE development inthe immature rat model, and we confirmed our results bydetecting their expression in children with MTLE, which isequal to the chronic stage in the animal model.

Our results revealed an up-regulation of both IL-1b andmiR-146a expression levels associated with seizures, sup-porting the hypothesis that IL-1b and miR-146a are media-tors of inflammation, which facilitates the epileptic process.Although our experiments show a fluctuating pattern withIL-1b mRNA and protein expression, its chronic expressionin the immature rat model and in children supports the ideathat this proinflammatory cytokine plays a role in theprocess of seizure generation, rather than being merely abiochemical epiphenomenon of seizures.

The first evidence of an active role for IL-1b in seizureswas provided by Vezzani et al. (1999, 2000), and showedthat the intracerebral application of IL-1b increases seizureactivity. Ravizza et al. (2006) later showed that seizures aredramatically reduced when endogenous IL-1b synthesis isblocked by inhibiting interleukin-1 converting enzyme(ICE) or in mice with a null mutation of ICE.

We also showed that the expression of IL-1b and miR-146a differs according to the stage of MTLE development

in the immature rat model. Both IL-1b and miR-146a aresignificantly up-regulated in children and seem to be regu-lated in opposite ways: IL-1b expression was highest in theacute stage, when expression of miR-146a was at its lowestlevel; miR-146a expression was highest in the latent stage,when IL-1b expression was at its lowest level. Both IL-1band miR-146a are up-regulated in the chronic stage, whencompared to their expression levels in control groups, andthe same is true in children with MTLE at the same stage,when compared with controls.

We therefore agree with other studies that found theseizure-induced peak in IL-1b expression to occur in theacute stage of epilepsy (Eriksson et al., 2000; Voutsinos-Porche et al., 2004). In PN15 rats, Ravizza et al. (2005)also found that IL-1b was significantly induced in theacute stage 4 h after status epilepticus. This observationcan be explained by the fact that neuronal injury leads torapid production of IL-1b (Allan et al., 2005). Immediateseizure-induced IL-1b expression has been described inseveral animal models for seizures and epilepsy, and isbelieved to stem from seizure-induced opening of theBBB, which allows circulating proteins to enter (Van Vli-et et al., 2007). IL-1b–expressing leukocytes appear toenter the central nervous system (CNS) after seizure-induced changes in the expression of vascular cell adhe-sion molecules (Fabene et al., 2008), which would explainwhy IL-1b levels were also significantly higher in the hip-pocampi of rats that became epileptic after febrile statusepilepticus (Heida & Pittman, 2005).

In the latent stage, IL-1b expression decreased to a levelsimilar to that in the control group. This result is supportedby findings that show no up-regulation of IL-1b in the latentperiod after pilocarpine-induced status epilepticus (Rijkerset al., 2009). This significant decrease in IL-1b expression

Figure 5.

Dynamic expression patterns of the IL-1b and miR-146a in the three stages of MTLE development. (A,B) In the acute stage, IL-1bshowed its highest expression when miR-146a was at its lowest level. In the latent stage, miR-146a showed its highest expression

when IL-1b was at its lowest level. In the chronic stage, both were up-regulated. (AS, acute seizure; LS, latent seizure; SS, spontaneous

seizure).

Epilepsia ILAE

1221

Neuroinflammation and MTLE Development

Epilepsia, 53(7):1215–1224, 2012doi: 10.1111/j.1528-1167.2012.03540.x

and its association with the highest level of miR-146aexpression in this animal model support the hypothesis thatmiR-146a may represent an attempt to modulate the inflam-matory response triggered by IL-1b by decreasing itsexpression level. Further studies are required to investigatethe direct relationship between these two markers in thisanimal model.

We observed a chronic IL-1b expression similar to whathas been described in other studies (De Simoni et al., 2000;Chapman et al., 2006). We found an up-regulation of IL-1bin children with MTLE and immature rats in the chronicstage, as compared with the normal control group. Ravizzaet al. (2008) reported that specimens from adult patientswith TLE showed increased production of IL-1b. Thisincrease in IL-1b expression was associated with the onsetof chronic spontaneous seizures. This finding, as well as theabsence of seizure activity in the latent stage, supports theidea of a role for this proinflammatory cytokine in the pro-cess of seizure generation.

miR-146a was up-regulated during epileptogenesis andin the chronic epileptic stage in the immature rat modelof MTLE, and also in children. Many researchers havesuggested a link between miR-146a and human inflamma-tory diseases (Taganov et al., 2006; Pedersen & David,2008; Sheedy & O’Neill, 2008). The involvement ofmiR-146a in the regulation of inflammatory/innateimmune pathways suggests that its overexpression or un-derexpression may contribute to inflammatory diseases(Sonkoly & Pivarcsi, 2009). Aronica et al. (2010) was thefirst to report an altered expression pattern of miR-146ain epileptic rats and temporal lobe epilepsy patients, andshowed up-regulation of miR-146a in the latent andchronic stages of disease in the rat model and in humantissues. Our study is the first to focus on the expressionof miR-146a in the immature rat model of lithium-pilo-carpine MTLE and in children with MTLE. Hu et al.(2011) studied the expression profile of miRNAs in rathippocampus following lithium-pilocarpine–induced sta-tus epilepticus and did not report any difference in theexpression pattern of miR-146a in the acute stagebetween the epilepsy model and control, which coincideswith our findings in this study.

The prominent expression of miR-146a in the latent stageafter 3 weeks of status epilepticus induction corresponds tothe time of maximal astroglial and microglial activation andup-regulation of several other genes involved in the immuneresponse (Aronica et al., 2000, 2001; Hendriksen et al.,2001; Gorter et al., 2006). In association with our results,Song et al. (2011) showed significant up-regulation ofmiR-146a as one of the 18 up-regulated miRNAs in thehippocampus of chronic TLE rats, suggesting that it mayplay a potential role in TLE pathogenesis. The chronicexpression of miR-146a in the immature rat model and inchildren with MTLE supports the role of this posttranscrip-

tional inflammation-associated miRNA in the process ofMTLE development.

In conclusion, to address the effect of inflammation onepileptogenesis in the developing brain, we examined thedynamic expression pattern of IL-1b as a proinflammatorycytokine and miR-146a as a posttranscriptional inflamma-tion–associated miRNA, in both immature rats and childrenwith MTLE. Our observations demonstrated up-regulationof both IL-1b and miR-146a associated with seizures andchanging with disease stage. The different expression pat-terns of both IL-1b and miR-146a at different stages suggestan interactive relationship. We are the first to examine theexpression of miR-146a in the immature brain of this animalmodel and in children with MTLE. Our findings support therole of inflammation in the pathogenesis of MTLE develop-ment and, consequently, modulation of the IL-1b–miR-146a axis may be a new target for antiepileptic therapy.

Acknowledgments

This work was kindly supported by the National Natural Science Foun-dation of China (NO. 30872790, 30901631, 81171226, 81100846) and, theScientific and Technological Department of Hunan Province(2011FJ3163). Additional support was received from the Ph.D. ProgramsFoundation of the Ministry of Education of China (20090162110041). Weare most grateful to Dr. Zhiquan Yang (Department of Neurosurgery, Xian-gya Hospital, China) for providing child epilepsy and control tissues andDr. Dalia Elimam (Department of Pediatrics, Suez Canal University,Egypt) for critically reviewing the manuscript. All coauthors have beensubstantively involved in the study and/or the preparation of the manu-script. There are no undisclosed groups or persons who have had a primaryrole in the study and/or in manuscript preparation and all co-authors haveseen and approved the submitted version of the paper and accept responsi-bility for its content.

Disclosure

None of the authors has any conflict of interest to disclose. We also con-firm that we have read the Journal’s position on issues involved in ethicalpublication and affirm that this report is consistent with those guidelines.

References

Abraham J, Fox PD, Condello C, Bartolini A, Koh S. (2012) Minocyclineattenuates microglia activation and blocks the long-term epileptogeniceffects of early-life seizures. Neurobiol Dis 46:425–430.

Akin D, Ravizza T, Maroso M, Carcak N, Eryigit T, Vanzulli I, Aker RG,Vezzani A, Onat FY. (2011) IL-1b is induced in reactive astrocytes inthe somatosensory cortex of rats with genetic absence epilepsy at theonset of spike-and-wave discharges, and contributes to their occur-rence. Neurobiol Dis 44:259–269.

Allan SM, Tyrrell PJ, Rothwell NJ. (2005) Interleukin-1 and neuronalinjury. Nat Rev Immunol 5:629–640.

Annegers JF, Hauser WA, Shirts SB, Kurland LT. (1987) Factors prognos-tic of unprovoked seizures after febrile convulsions. N Engl J Med316:493–498.

Aronica E, van Vliet EA, Mayboroda OA, Troost D, da Silva FH, GorterJA. (2000) Upregulation of metabotropic glutamate receptor subtypemGluR3 and mGluR5 in reactive astrocytes in a rat model of mesialtemporal lobe epilepsy. Eur J Neurosci 12:2333–2344.

Aronica E, van Vliet EA, Hendriksen E, Troost D, Lopes da Silva FH,Gorter JA, Cystatin C. (2001) A cysteine protease inhibitor, is persis-

1222

A. Omran et al.

Epilepsia, 53(7):1215–1224, 2012doi: 10.1111/j.1528-1167.2012.03540.x

tently up-regulated in neurons and glia in a rat model for mesial tempo-ral lobe epilepsy. Eur J Neurosci 4:1485–1491.

Aronica E, Fluiter K, Iyer A, Zurolo E, Vreijling J, van Vliet EA, BaayenJC, Gorter JA. (2010) Expression pattern of miR-146a, an inflamma-tion-associated microRNA, in experimental and human temporal lobeepilepsy. Eur J Neurosci 31:1100–1107.

Bartel DP. (2009) microRNAs: target recognition and regulatory functions.Cell 136:215–233.

Berg AT, Shinnar S. (1996) Unprovoked seizures in children with febrileseizures: short-term outcome. Neurology 47:562–568.

Bl�mcke I, Pauli E, Clusmann H, Schramm J, Becker A, Elger C, Mers-chhemke M, Meencke HJ, Lehmann T, von Deimling A, Scheiwe C,Zentner J, Volk B, Romstçck J, Stefan H, Hildebrandt M. (2007) A newclinico-pathological classification system for mesial temporal sclerosis.Acta Neuropathol 113:235–244.

Chapman S, Kadar T, Gilat E. (2006) Seizure duration following sarinexposure affects neuro-inflammatory markers in the rat brain. Neuro-toxicology 27:277–283.

Coppola A, Moshe SL. (2009) Why is the developing brain more suscepti-ble to status epilepticus? Epilepsia 50:25–26.

Damaye CA, Wu L, Peng J, He F, Zhang C, Lan Y, Walijee SM,Yin F. (2011) An experimental study on dynamic morphologicalchanges and expression pattern of GFAP and synapsin i in the hippo-campus of MTLE models for immature rats. Int J Neurosci 121:575–588.

De Simoni MG, Perego C, Ravizza T, Moneta D, Conti M, Marchesi F, DeLuigi A, Garattini S, Vezzani A. (2000) Inflammatory cytokines andrelated genes are induced in the rat hippocampus by limbic status epi-lepticus. Eur J Neurosci 12:2623–2633.

Engel J Jr. (1998) Etiology as a risk factor for medically refractory epilepsy:a case for early surgical intervention. Neurology 51:1243–1244.

Eriksson C, Zou LP, Ahlenius S, Winblad B, Schultzberg M. (2000) Inhibi-tion of kainic acid induced expression of interleukin-1 beta and interleu-kin-1 receptor antagonist mRNA in the rat brain by NMDA receptorantagonists. Brain Res Mol Brain Res 85:103–113.

Fabene PF, Navarro MG, Martinello M, Rossi B, Merigo F, Ottoboni L,Bach S, Angiari S, Benati D, Chakir A, Zanetti L, Chio F, Osculati A,Marzola P, Nicolato E, Homeister JW, Xia L, Lowe JB, McEver RP,Osculati F, Sbarbati A, Butcher EC, Constantin G. (2008) A role forleukocyte-endothelial adhesion mechanisms in epilepsy. Nat Med14:1377–1383.

Friedman MJ, Ghazala QS. (2006) Seizure in children. Pediatr Clin N Am53:257–277.

Gorter JA, Van Vliet E, Aronica E, Rauwerda H, Breit T, Lopes da SilvaFH, Wadman WJ. (2006) Potential new antiepileptogenic targets indi-cated by microarray analysis in a rat model for temporal lobe epilepsy.J Neurosci 26:11083–11110.

Heida JG, Pittman QJ. (2005) Causal links between brain cytokines andexperimental febrile convulsions in the rat. Epilepsia 46:1906–1913.

Hendriksen H, Datson NA, Ghijsen WE, van Vliet EA, da Silva FH, GorterJA, Vreugdenhil E. (2001) Altered hippocampal gene expression priorto the onset of spontaneous seizures in the rat post-status epilepticusmodel. Eur J Neurosci 14:1475–1484.

Hu K, Zhang C, Long L, Long X, Feng L, Li Y, Xiao B. (2011) Expressionprofile of microRNAs in rat hippocampus following lithium–pilocar-pine-induced status epilepticus. Neurosci Lett 488:252–257.

Hulkkonen J, Koskikallio E, Rainesalo S, Ker�nen T, Hurme M, Peltola J.(2004) The balance of inhibitory and excitatory cytokines is differentlyregulated in vivo and in vitro among therapy resistant epilepsy patients.Epilepsy Res 59:199–205.

Iyer A, Zurolo E, Spliet WG, van Rijen PC, Baayen JC, Gorter JA, AronicaE. (2010) Evaluation of the innate and adaptive immunity in type I andtype II focal cortical dysplasias. Epilepsia 51:1763–1773.

J�rvel� JT, Lopez-Picon FR, Plysjuk A, Ruohonen S, Holopainen IE.(2011) Temporal profiles of age-dependent changes in cytokine mRNAexpression and glial cell activation after status epilepticus in postnatalrat hippocampus. J Neuroinflammation 8:29.

Keiichiro Y, Tomoyuki N, Shigeru M, Masakazu I, Masataka D, Nobuo A,Yuji Y, Hiroshi A, Mitsuo O. (2009) Expression of microRNA-146 inosteoarthritis cartilage. Arthritis Rheum 60:1035–1041.

Koh S. (2009) Gene expression in immature and mature hippocampus afterstatus epilepticus. In Schwartzkroin P (Ed) Encyclopedia of basic epi-lepsy research. Academic Press, Oxford, pp. 227–235.

Larner-Svensson HM, Williams AE, Tsitsiou E, Perry MM, Jiang X, ChungKF, Lindsay MA. (2010) Pharmacological studies of the mechanismand function of interleukin-1b-induced miRNA-146a expression in pri-mary human airway smooth muscle. Respir Res 11:68.

Li X, Gibson G, Kim JS, Kroin J, Xu S, van Wijnen AJ, Im HJ. (2011)MicroRNA-146a is linked to pain-related pathophysiology of osteoar-thritis. Gene 480:34–41.

Lukiw WJ, Pogue AI. (2007) Induction of specific micro RNA (miRNA)species by ROS generating metal sulfates in primary human brain cells.J Inorg Biochem 101:1265–1269.

Marchi N, Granata T, Freri E, Ciusani E, Ragona F, Puvenna V, Teng Q,Alexopolous A, Janigro D. (2011) Efficacy of anti-inflammatory ther-apy in a model of acute seizures and in a population of pediatric drugresistant epileptics. PLoS ONE 6:e18200.

Marini H, Altavilla D, Bellomo M, Adamo EB, Marini R, Laureanti F, Bon-accorso MC, Seminara P, Passaniti M, Minutoli L, Bitto A, Calapai G,Squadrito F. (2004) Modulation of IL-1 beta gene expression by lipidperoxidation inhibition after kainic acid-induced rat brain injury. ExpNeurol 188:178–186.

Mohanraj R, Brodie MJ. (2006) Diagnosing refractory epilepsy: responseto sequential treatment schedules. Eur J Neurol 13:277–282.

Nakasa T, Miyaki S, Okubo A, Hashimoto M, Nishida K, Ochi M, AsaharaH. (2008) Expression of microRNA-146 in rheumatoid arthritis syno-vial tissue. Arthritis Rheum 58:1284–1292.

Pedersen I, David M. (2008) MicroRNAs in the immune response. Cytokine43:391–394.

Peltola J, Palmio J, Korhonen L, Suhonen J, Miettinen A, Hurme M, Lind-holm D, Ker�nen T. (2000) Interleukin-6 and interleukin-1 receptorantagonist in cerebrospinal fluid from patients with recent tonic-clonicseizures. Epilepsy Res 41:205–211.

Peltola J, Laaksonen J, Haapala AM, Hurme M, Rainesale S, Ker�nen T.(2002) Indicators of inflammation after recent tonic-clonic epilepticseizures correlate with plasma interleukin-6 levels. Seizure 11:44–46.

Pernot F, Heinrich C, Barbier L, Peinnequin A, Carpentier P, Dhote F,Baille V, Beaup C, Depaulis A, Dorandeu F. (2011) Inflammatorychanges during epileptogenesis and spontaneous seizures in a mousemodel of mesiotemporal lobe epilepsy. Epilepsia 52:2315–2325.

Perry MM, Moschos SA, Williams AE, Shepherd NJ, Larner-SvenssonHM, Lindsay MA. (2008) Rapid changes in microRNA-146a expres-sion negatively regulate the IL-1beta-induced inflammatory response inhuman lung alveolar epithelial cells. J Immunol 180:5689–5698.

Racine RJ. (1972) Modification of seizure activity by electrical stimulation.II. Motor seizure. Electroencephalogr Clin Neurophysiol 32:281–294.

Ravizza T, Rizzi M, Perego C, Richichi C, Veliskova J, Moshe SL, DeSimoni MG, Vezzani A. (2005) Inflammatory response and glia activa-tion in developing rat hippocampus after status epilepticus. Epilepsia46:113–117.

Ravizza T, Lucas SM, Balosso S, Bernardino L, Ku G, Noe F, No� F,Malva J, Randle JC, Allan S, Vezzani A. (2006) Inactivation ofcaspase-1 in rodent brain: a novel anticonvulsive strategy. Epilepsia 47:1160–1168.

Ravizza T, Gagliardi B, Noe F, Boer K, Aronica E, Vezzani A. (2008)Innate and adaptive immunity during epileptogenesis and spontaneousseizures: evidence from experimental models and human temporal lobeepilepsy. Neurobiol Dis 29:142–160.

Rijkers K, Majoie HJ, Hoogland G, Kenis G, De Baets M, Vles JS. (2009)The role of interleukin-1 in seizures and epilepsy: a critical review. ExpNeurol 216:258–271.

Rizzi M, Perego C, Aliprandi M, Richichi C, Ravizza T, Colella D, Vel�skov�J, Mosh� SL, De Simoni MG, Vezzani A. (2003) Glia activation andcytokine increase in rat hippocampus by kainic acid-induced status epi-lepticus during postnatal development. Neurobiol Dis 14:494–503.

Roggli E, Britan A, Gattesco S, Lin-Marq N, Abderrahmani A, Meda P,Regazzi R. (2010) Involvement of microRNAs in the cytotoxiceffects exerted by proinflammatory cytokines on pancreatic beta-cells.Diabetes 59:978–986.

Sheedy FJ, O’Neill LA. (2008) Adding fuel to fire: microRNAs as a newclass of mediators of inflammation. Ann Rheum Dis 67:50–55.

Sheizaf B, Mazor M, Landau D, Burstein E, Bashiri A, Hershkovitz R.(2007) Early sonographic prenatal diagnosis of seizures. UltrasoundObstet Gynecol 30:1007–1009.

Song YJ, Tian XB, Zhang S, Zhang YX, Li X, Li D, Cheng Y, Zhang JN,Kang CS, Zhao W. (2011) Temporal lobe epilepsy induces differential

1223

Neuroinflammation and MTLE Development

Epilepsia, 53(7):1215–1224, 2012doi: 10.1111/j.1528-1167.2012.03540.x

expression of hippocampal miRNAs including let-7e and miR-23a/b.Brain Res 1387:134–140.

Sonkoly E, Pivarcsi A. (2009) microRNAs in Inflammation. Int Rev Immu-nol 28:535–561.

Sonkoly E, Stahle M, Pivarcsi A. (2008) microRNAs: novel regulators inskin inflammation. Clin Exp Dermatol 33:312–315.

Spencer S, Huh L. (2008) Outcomes of epilepsy surgery in adults and chil-dren. Lancet Neurol 7:525–537.

Stanczyk J, Pedrioli DM, Brentano F, Sanchez-Pernaute O, Kolling C, GayRE, Detmar M, Gay S, Kyburz D. (2008) Altered expression of microR-NA in synovial fibroblasts and synovial tissue in rheumatoid arthritis.Arthritis Rheum 58:1001–1009.

St�phane A, Don S, Andrey M, Raman S. (2010) Inflammation induced byLPS enhances epileptogenesis in immature rat and may be partiallyreversed by IL1RA. Epilepsia 51:34–38.

Stephen LJ, Kelly K, Mohanraj R, Brodie MJ. (2006) Pharmacological out-comes in older people with newly diagnosed epilepsy. Epilepsy Behav8:434–437.

Taganov KD, Boldin MP, Chang KJ, Baltimore D. (2006) NF-kappaB-dependent induction of microRNA miR-146, an inhibitor targetedto signaling proteins of innate immune responses. Proc Natl Acad SciU S A 103:12481–12486.

Tang Y, Luo X, Cui H, Ni X, Yuan M, Guo Y, Huang X, Zhou H, de VriesN, Tak PP, Chen S, Shen N. (2009) MicroRNA-146A contributes toabnormal activation of the type I interferon pathway in human lupus bytargeting the key signaling proteins. Arthritis Rheum 60:1065–1075.

Usta IM, Adra AM, Nassar AH. (2007) Ultrasonographic diagnosis of fetalseizures: a case report and review of the literature. BJOG 114:1031–1033.

Van Vliet EA, da Costa AS, Redeker S, van Schaik R, Aronica E, GorterJA. (2007) Blood–brain barrier leakage may lead to progression of tem-poral lobe epilepsy. Brain 130:521–534.

Vannucci RC, Connor JR, Mauger DT, Palmer C, Smith MB, Towfighi J,Vannucci SJ. (1999) Rat model of perinatal hypoxic-ischemic braindamage. J Neurosci Res 55:158–163.

Vezzani A, Baram TZ. (2007) New roles for interleukin-1 Beta in the mech-anisms of epilepsy. Epilepsy Curr 7:45–50.

Vezzani A, Granata T. (2005) Brain inflammation in epilepsy: experimen-tal and clinical evidence. Epilepsia 46:1724–1743.

Vezzani A, Conti M, De Luigi A, Ravizza T, Moneta D, Marchesi F, DeSimoni MG. (1999) Interleukin-1beta immunoreactivity and microgliaare enhanced in the rat hippocampus by focal kainate application: func-tional evidence for enhancement of electrographic seizures. J Neurosci19:5054–5065.

Vezzani A, Moneta D, Conti M, Richichi C, Ravizza T, De Luigi A, DeSimoni MG, Sperk G, Andell-Jonsson S, Lundkvist J, Iverfeldt K,Bartfai T. (2000) Powerful anticonvulsant action of IL-1 receptor antag-onist on intracerebral injection and astrocytic overexpression in mice.Proc Natl Acad Sci U S A 97:11534–11539.

Vezzani A, Moneta D, Richichi C, Aliprandi M, Burrows SJ, Ravizza T,Perego C, De Simoni MG. (2002) Functional role of inflammatory cyto-kines and antiinflammatory molecules in seizures and epileptogenesis.Epilepsia 43:30–35.

Vezzani A, Ravizza T, Balosso S, Aronica E. (2008) Glia as a source ofcytokines: implications for neuronal excitability and survival. Epilepsia49:24–32.

Vezzani A, French J, Bartfai T, Baram TZ. (2011) The role of inflammationin epilepsy. Nat Rev Neurol 7:31–40.

Voutsinos-Porche B, Koning E, Kaplan H, Ferrandon A, Guenounou M,Nehlig A, Motte J. (2004) Temporal patterns of the cerebral inflamma-tory response in the rat lithium-pilocarpine model of temporal lobe epi-lepsy. Neurobiol Dis 17:385–402.

Wahab A, Albus K, Heinemann U. (2011) Age and region specific effectsof anticonvulsants and bumetanide on 4-aminopyridine induced seizurelike events in hippocampal-entorhinal cortex slices. Epilepsia 52:94–103.

Wu L, Peng J, Wei C, Liu G, Wang G, Li K, Yin F. (2011) Characterization,using comparative proteomics, of differentially expressed proteins inthe hippocampus of the mesial temporal lobe of epileptic rats followingtreatment with valproate. Amino Acids 40:221–238.

1224

A. Omran et al.

Epilepsia, 53(7):1215–1224, 2012doi: 10.1111/j.1528-1167.2012.03540.x