international dna day and genome congress...

INTERNATIONAL

DNA DAY AND GENOME

CONGRESS 2017

(IDDGC’17)

ABSTRACT BOOK

APRIL 24-28, 2017

AHİ EVRAN UNIVERSITY

KIRŞEHİR / TURKEY

INTERNATIONAL DNA DAY AND GENOME CONGRESS APRIL 24-28, 2017

AHĠ EVRAN UNIVERSITY KIRġEHĠR / TURKEY

http://dna-day.com & http://dna-gunu.com

IDDGC’17 ORGANIZING COMMITTEE

HONORARY CHAIR

Prof. Dr. Vatan KARAKAYA

(Rector of Ahi Evran University)

CHAIR

Lütfi TUTAR, Ph.D – Ahi Evran University, Turkey

ORGANIZING COMMITTEE

Akın Tekcan, Ph.D. – Ahi Evran University, Turkey

Ergin KARĠPTAġ, Ph.D. – Ahi Evran University, Turkey

Esen TUTAR, Ph.D. – KahramanmaraĢ Sütçü Ġmam University, Turkey

Faruk SELÇUK, Ph.D. – Ahi Evran University, Turkey

Hakan BOZDOĞAN, Ph.D. – Ahi Evran University, Turkey

Hakan GÜR, Ph.D. – Ahi Evran University, Turkey

Hatice ÖĞÜTCÜ, Ph.D. – Ahi Evran University, Turkey

Mahmut ERBEY, Ph.D – Ahi Evran University, Turkey

Makbule ERDOĞDU, Ph.D – Ahi Evran University, Turkey

Serap YALÇIN AZARKAN, Ph.D. – Ahi Evran University, Turkey




IDDGC’17 LOCAL ORGANIZING COMMITTEE

Cafer YÜKSEL

Deniz ġANLI

Esin KIRAY

Hülya AVġAR

Kübra Sueda AKINCI

Mehmet DEMĠRER

Melih ġENTÜRK

Miyase ASLANTAġ

Muhammed Yunus Emre KARAMAN

Murat Hüdavendiğar MANAV

Osman Bahadır ABDĠOĞLU

Selin ÖZKAN KOTĠLOĞLU, Ph.D.

Yasemin ERBEY

Zeynep YILMAZ




IDDGC’17 INTERNATIONAL SCIENTIFIC COMMITTEE

1. Aftab AHMAD, Ph.D. - National Academy of Young Scientists (NAYS), Pakistan

2. Akın Tekcan, Ph.D. – Ahi Evran University, Turkey

3. Ali Osman BELDÜZ, Ph.D. - Karadeniz Technical University, Turkey

4. Alexander KAGANSKY, Ph.D. - The University of Edinburgh, United Kingdom

5. Arzu ÇELĠK, Ph.D. - Boğaziçi University, Turkey

6. Ayman Moawad MAHMOUD, Ph.D. - Beni-Suef University, Egypt & Charité University

Medicine-Berlin, Germany

7. Aykut ÜREN, M.D., Ph.D. – Georgetown University, Washington D.C., USA

8. Aysun ADAN, Ph.D. – Abdullah Gül University, Turkey

9. Bahattin TANYOLAÇ, Ph.D. – Ege University, Turkey

10. BarıĢ ÖZÜDOĞRU, Ph.D. – Hacettepe University, Turkey

11. Besim OGRETMEN, Ph.D. - Medical University of South Carolina, SC, USA

12. Devrim ARSLAN, Ph.D. – Acıbadem University, Turkey

13. Diğdem AKTOPRAKLIGĠL, Ph.D. – TÜBĠTAK Marmara Research Center, Turkey

14. Elif SEVĠM, Ph.D. – Ahi Evran University, Turkey

15. Engin ULUKAYA, Ph.D. - Ġstinye University, Turkey

16. Ergin KARĠPTAġ, Ph.D. – Ahi Evran University, Turkey

17. Ergül BERBER, Ph.D. – Arel University, Turkey

18. Esen TUTAR, Ph.D. – KahramanmaraĢ Sütçü Ġmam University, Turkey

19. Fahriye ERCAN, Ph.D. – Ahi Evran University, Turkey

20. Fevzi BARDAKÇI, Ph.D. – Adnan Menderes University, Turkey

21. Fikrettin ġAHĠN, Ph.D. – Yeditepe University, Turkey

22. Gamze TURNA, Ph.D. – Ahi Evran University, Turkey

23. Geylani CAN, Ph.D. – Oxford University, United Kingdom

24. Gökçen YUVALI ÇELĠK, Ph.D. – Erciyes University, Turkey

25. Gijs J.L. WUITE, Ph.D - Vrije University, Holland

26. Hakan GÜR, Ph.D. – Ahi Evran University, Turkey

27. Halise Ġnci GÜL, Ph.D. – Atatürk University, Turkey

28. Halime Hanım PENÇE, Ph.D. – Health Sciences University, Turkey

29. Harun ÇĠFTÇĠ, Ph.D. – Ahi Evran University, Turkey

30. Hatice ÖĞÜTCÜ, Ph.D. – Ahi Evran University, Turkey

31. Hikmet GEÇKĠL, Ph.D. – Ġnönü University, Turkey

32. Ġbrahim YAMAN, Ph.D. – Boğaziçi University, Turkey




33. Ġlhami GÜLÇĠN, Ph.D. – Atatürk University, Turkey

34. Ġlhan YAYLIM, Ph.D. – ASDETAE, Ġstanbul University, Turkey

35. Jens ALLMER, Ph.D. – Ġzmir Institute of Technology, Turkey

36. Lütfi TUTAR, Ph.D. – Ahi Evran University, Turkey

37. Mahmut ERBEY, Ph.D. – Ahi Evran University, Turkey

38. Martin A. LYSAK, Ph.D. – CEITEC, Masaryk University, Czech Republic

39. Michael SAN FRANCISCO, Ph.D. – Texas Technical University, TX, USA

40. Milica PEŠIģ, Ph.D. – University of Belgrade, Serbia

41. Minoo RASSOULZADEGAN, Ph.D. – Université Nice Sophia Antipolis, France

42. Mohamed A FARAG, Ph.D. – Cairo University, Egypt

43. Mona El Khatib, Ph.D. – Abdullah Gül University, Turkey

44. Nudrat Aisha AKRAM, Ph.D. – Government College University Faisalabad, Pakistan

45. Oktay Ġsmail KAPLAN, Ph.D. – Medeniyet University, Turkey

46. Özgür ġAHĠN, Ph.D. – Bilkent University, Turkey

47. Petek BALLAR KIRMIZIBAYRAK, Ph.D. – Ege University, Turkey

48. Rana B. MR. AL-DAJANI, Ph.D. – The Hashemite University, Jordan

49. Salih GENCER, Ph.D. – Üsküdar University, Turkey

50. Semir BEYAZ, Ph.D. – Harvard University, USA

51. Sena SEZEN, Ph.D. – Karadeniz Technical University, Turkey

52. Serap YALÇIN AZARKAN, Ph.D. – Ahi Evran University, Turkey

53. Serdar DURDAĞI, Ph.D. – BahçeĢehir University, Turkey

54. Servet ÖZCAN, Ph.D. – Erciyes University, Turkey

55. Sevil DĠNÇER ĠġOĞLU, Ph.D. – Abdullah Gül University, Turkey

56. Sinan AKGÖL, Ph.D. – Ege University, Turkey

57. Sümer ARAS, Ph.D. – Ankara University, Turkey

58. Tolga KANKILIÇ, Ph.D. – Aksaray University, Turkey

59. Ufuk GÜNDÜZ, Ph.D. – Middle East Technical University, Turkey

60. Umberto GALDERISI, Ph.D. – Second University of Naples (UNIVERSITÀ DEGLI

STUDI DELLA CAMPANIA LUIGI VANVITELLI), Italy & Temple University, USA

61. Utku PERKTAġ, Ph.D. – Hacettepe University, Turkey

62. Vidushi S NEERGHEEN-BHUJUN, Ph.D. – University of Mauritius, Mauritius

63. Yuriy ORLOV, Ph.D. – Russian Academy of Sciences & Institute of Cytology and Genetics

SB RAS, Novosibirsk, Russia

64. Yusuf BARAN, Ph.D. – Ġzmir Institute of Technology & Abdullah Gül University, Turkey

65. Yusuf TUTAR, Ph.D. – Health Sciences University, Turkey




66. Zeynep ÇAKIR, Ph.D. – University of Freiburg, Germany


AHİ EVRAN UNIVERSITY KIRŞEHİR / TURKEY


TABLE OF CONTENTS

INVITED TALKS… 1-10

ORAL PRESENTATIONS… 11-120

POSTER PRESENTATIONS…121-251

Oral Presentations enumerated as IDDGC17-OP-XXX

Poster Presentations enumerated as IDDGC17-PP-XXX

INTERNATIONAL DNA DAY AND GENOME CONGRESS 2017 (IDDGC’17)

PUBLICATION DATE: 05 May, 2017




1

INVITED

TALKS




2

INVITED TALK 1

RNA-mediated epigenetic heredity: mouse models of an acquired pathology

Minoo RASSOULZADEGAN

Institut Biology de Valrose

Centre de Biochimie, Université de Nice Parc Valrose, 06108, Nice, France

In the recent years, our laboratory introduced a new, and for some colleagues disturbing concept, a mode of heredity

distinct from the Mendelian paradigm, mediated by sperm noncoding RNAs (Rassoulzadegan et al., Nature 2006; Wagner

et al., Dev Cell 2008; Grandjean et al, Development 2009). Experimental proofs were provided by microinjection into

naive embryos of a variety of mRNA fragments and microRNAs. It led in three independent instances to the mitotically

and meiotically stable transcriptional upregulation of the sequence-homologous target locus (paramutation). In the most

recent period, the notion was not only validated, but extended by others to animal models of heritable pathologies ranging

from diabetes to psychiatric diseases. Thus, it is now highlighted a way to search for unexplained hereditary characters

and diseases. We ourselves further documented RNA-mediated heredity by evidencing a requirement for the methylation

of the vector and the target transcript (Kiani et al, PLoS Genetics, 2013). Our present projects comprising the evaluation

of a possible generalized model of epigenetic determinations by sperm RNAs; and the pursuit of a role of RNA

methylation in development and heredity, joining our own expertise in genetics and the generation of animal models.




3

INVITED TALK 2

Pseudogenes and Apoptosis in Cancer

Yusuf TUTAR

University of Health Sciences

Sağlık Bilimleri Üniversitesi, Mektebi Tıbbiyeyi Şahane, Üsküdar, İstanbul, Turkey

Cancer cells express pseudogenes and the genes control several mechanisms to help cancer cell survival. Apoptosis

mechanism at mitochondrial and cytosolic level communicates through pseudogenes of Heat Shock Proteins. The talk

covers detail of the mechanism and currently designed inhibitors for this pathway.




4

INVITED TALK 3

Myeloma cells can corrupt senescent mesenchymal stromal cells and impair their anti-tumor activity

Umberto GALDERISI

Campania University ―Luigi Vanvitelli‖, Naples, Italy

Senescent cells secrete several molecules that help to prevent the progression of cancer. However, cancer cells can also

misuse these secreted elements to survive and grow. Since the molecular and functional bases of these different elements

remain poorly understood, we analyzed the effect of senescent mesenchymal stromal cell (MSC) secretome on the

biology of ARH-77 myeloma cells. In addition to differentiating in mesodermal derivatives, MSCs have sustained interest

among researchers by supporting hematopoiesis, contributing to tissue homeostasis, and modulating inflammatory

response, all activities accomplished primarily by the secretion of cytokines and growth factors. Moreover, senescence

profoundly affects the composition of MSC secretome. In this study, we induced MSC senescence by oxidative stress,

DNA damage, and replicative exhaustion. While the first two are considered to induce acute senescence, extensive

proliferation triggers replicative (i.e., chronic) senescence. We cultivated cancer cells in the presence of acute and chronic

senescent MSC-conditioned media and evaluated their proliferation, DNA damage, apoptosis, and senescence. Our

findings revealed that senescent secretomes induced apoptosis or senescence, if not both, to different extents. This anti-

tumor activity became heavily impaired when secretomes were collected from senescent cells previously in contact (i.e.,

primed) with cancer cells. Our analysis of senescent MSC secretomes with LC-MS/MS followed by Gene Ontology

classification further indicated that priming with cancer profoundly affected secretome composition by abrogating the

production of pro-senescent and apoptotic factors. We thus showed for the first time that compared with cancer-primed

MSCs, naïve senescent MSCs can exert different effects on tumor progression.




5

INVITED TALK 4

Multi-Scale Molecular Modeling Approaches for Drug Designing Studies

Serdar DURDAĞI

Bahcesehir University, School of Medicine, Turkey

In this talk, successful examples of multi-scale molecular modeling approaches from our Laboratory (Computational

Biology and Molecular Simulations Lab) for drug designing studies will be covered.




6

INVITED TALK 5

Autophagy repression: A novel anti-leukemic function of histone deacytelase inhibitors

Mona EL KHATIB

Abdullah Gul University

Barbaros mah, Ekilet bul, 38080, Kocasinan/Kayseri, Turkey

Histone deacetylase (HDAC) inhibitors (HDACis) are well-characterized anti-cancer agents with promising results in

clinical trials. However, mechanistically little is known regarding their selectivity in killing malignant cells while sparing

normal cells. Gene expression-based chemical genomics identified HDACis as being particularly potent against Down

syndrome-associated myeloid leukemia (DS-AMKL) blasts. Investigating the antileukemic function of HDACis revealed

their transcriptional and post-translational regulation of key autophagic proteins, including ATG7. This leads to

suppression of autophagy, a lysosomal degradation process that can protect cells against damaged or unnecessary

organelles and protein aggregates. DS-AMKL cells exhibit low baseline autophagy due to mammalian target of

rapamycin (mTOR) activation. Consequently, HDAC inhibition repressed autophagy below a critical threshold, which

resulted in accumulation of mitochondria, production of reactive oxygen species, DNA damage and apoptosis. Those

HDACi-mediated effects could be reverted upon autophagy activation or aggravated upon further pharmacological or

genetic inhibition. Our findings were further extended to other major acute myeloid leukemia subgroups with low basal

level autophagy. The constitutive suppression of autophagy due to mTOR activation represents an inherent difference

between cancer and normal cells. Thus, via autophagy suppression, HDACis deprive cells of an essential pro-survival

mechanism, which translates into an attractive strategy to specifically target cancer cells.




7

INVITED TALK 6

Mechanisms of Multidrug Resistance in Hematological Malignancies

Yusuf BARAN1,2

1- Izmir Institute of Technology, Faculty of Science, Department of Molecular Biology and Genetics, İzmir, Turkey

2- Abdullah Gul University, Faculty of Life and Natural Sciences, Department of Molecular Biology & Genetics,

Kayseri, Turkey

Chemotherapy is the most widely used treatment strategy for cancer which is the highest second reason for humanbeing

deaths after heart related diseases. However, cellular resistance mechanisms developed by cancer cells and tissues in the

beginning or proceeding times to applied anticancer agents is a significant problem preventing succesfull therapy.

Resistance developed by cancer cells to structurally and functionally different cytotoxic agents is called as multi drug

resistance. The resistance can be observed in the beginning of the treatment or during the treatment known as intrinsic or

acquired resistance, respectively. The resistance phenotype is associated with the tumor cells that gain a cross-resistance

to large range of drugs that are structurally and functionally different.

Drug resistance mechanisms have different molecular genetics and biochemical reasons depending on the applied drug

and the type of cancer. Secondary genetic alterations and disorders in cancer cells may also result in drug resistance. That

is why it has vital importance to study and consider all signaling pathways, in multidrug resistance of cancer.

Multidrug resistance raises via many unrelated mechanisms, such as overexpression of energy-dependent efflux proteins,

decrease in uptake of the agents, increase or alteration in drug targets, alterations in cell cycle checkpoints, inactivation of

the agents, compartmentalization of the agents, inhibition of apoptosis, increases in DNA repair mechanisms, problems

related with drug metabolism and aberrant metabolism of bioactive sphingolipids. Exact elucidation of resistance

mechanisms and molecular and biochemical approaches to overcome multidrug resistance have been a major goal in

cancer research. In this talk, we will explain the mechanisms contributing multidrug resistance in cancer chemotherapy

and also touche on the approaches for reversing the resistance.




8

INVITED TALK 7

Targeted Drug Delivery via Polymer Coated Magnetic Nanoparticles

Ufuk GÜNDÜZ

Middle East Technical University

METU, Biological Sciences. Üniversiteler Bulvarı, Ankara, Turkey

Targetable magnetic nanoparticles coated with polymers, characterized by high surface-to-volume ratios, are excellent

scaffolds for loading targeting moieties, permeation enhancers, imaging tags, and drugs, providing diagnostic and

therapeutic capabilities.

Magnetic nanoparticles coated with Chitosan, PHB, PEG, Dextran, or PAMAM may be used in cancer drug targeting.

Surface modifications of nanoparticles with organic polymers enable stabilization of nanoparticles, reduce agglomeration,

provide functional groups, furnish internal cavities for loading of therapeutics and prevent immediate uptake of drug

loaded nanoparticles by the reticuloendothelial system.




9

INVITED TALK 8

Why Biodiversity is crucial for Biomedicine and vice versa?

Alexander (Sasha) KAGANSKIY

Chancellor‘s Fellow

University of Edinburgh, 12/6 Perth street, Edinburgh, EH3 5DP, UK

We observe a sharp decline in biodiversity since modern extinction rates are high, at 100 to 1000 times greater than

background extinction rates calculated over the eras. Though new species appear, however, existing species go extinct at

a rate 1000 times that of species formation. The biodiversity loss will alter the ecosystem functions and their ability to

provide goods and services for the human health and wellbeing. More importantly, the irreversible loss of traditional

medicine and metabolites diversity concomitant with the extinction of microbes, plants, fungi and animals will threaten

the scientific discoveries for medicinal purposes. Despite all efforts to include biodiversity protection within the

international agendas, developing countries, the home of most of the world‘s biodiversity, are rapidly losing their

biodiversity heritage. Here we argue that biodiversity is also the key for maintaining public health as well as the success

of global drug discovery efforts. Despite scientific or technical "improvements" and managerial "process optimisation",

drug discovery was more productive in the 1950s, 1960s, and 1970s, when many of the methodologies that are now

widely applied had not been invented and when other R&D approaches were dominant. In particular, most early

successful blockbuster drugs were derived from phenotypic screening rather than target-based drug discovery. Our

phenotype based screening of various natural extracts using patient derived cell lines are pointing to the multitude of the

anti-cancer molecules, which promise to solve cancer problems, provided conservation and research of the host species.

We aim to create an interdisciplinary knowledge hub to connect conservation, medical chemistry, public health data,

traditional medicine, etc. to facilitate global efforts in preserving natural bio- and chemodiversity.




10

INVITED TALK 9

Plant Transcription Factors

Emine Sümer ARAS

Ankara University, Faculty of Science, Department of Biology, Tandogan/Ankara, Turkey

Regulated gene expression is one of the most complex activities in cells because it involves the integration of signal

transduction pathways, the movement of proteins between cellular compartments, alterations in chromosome structure,

RNA synthesis, and RNA processing. To understand plant growth and development at the molecular level, a detailed

knowledge of the mechanisms of transcription is required.

Regulation of transcription can be controlled by the transcription factors (TFs) which bind the specific gene promoter

sequences. Transcription factors (TFs) play an important role in growth and development of plants as well as all

organisms in the nature. Up to date, approximately 30 TF families were identified and they were classified according to

the conserved motifs that code for the DNA-binding domains. Approximately half of them were considered as plant

specific TFs such as AP2/ERF, WRKY, NAC, B3, SBP and DOF families.

In recent genome – wide studies, bioinformatics approaches are being used for the identification of new proteins and

genes in plants. Though omic technologies such as genomics, transcriptomics and metabolomics have become

widespread, there is not enough study contains genome wide identification and expression analysis of transcription factor

families in plant species such as common bean.




11

ORAL

PRESENTATIONS




12

IDDGC17-OP-101

COMPUTATIONAL TOOLS FOR THE DISCOVERY AND ANNOTATION OF LONG NON-

CODING RNA (LNCRNA) SPECIES

Gökhan Karakülah1

1Ġzmir International Biomedicine and Genome Institute, Dokuz Eylül University, Ġnciraltı, 35340, Ġzmir, Turkey. E-mail:

[email protected]

Aims and Scopes: Long non-coding RNAs (lncRNAs) are transcripts that lack of protein coding function, 200 bp or longer, and play

crucial roles in transcriptional, post-transcriptional and epigenetic regulation [1-2]. Several reports have appeared in recent years

documenting the discovery and characterization of previously un-annotated lncRNAs from transcriptome libraries of a wide variety of

organisms. However, annotation of lncRNAs remains challenging as they generally do not have certain sequence characteristics used

for their functional prediction [3]. Herein, I briefly summarized 10 commonly used lncRNA annotation tools, and demonstrated a

multi-step bioinformatics analysis pipeline for the lncRNA discovery from public RNA-sequencing dataset.

Materials and Methods: The user interfaces, contents, parameters, and features of 10 lncRNA annotation tools, including DIANA-

LncBase [4], Linc2Go [5], lncPro [6], LncRNA2Function [7], lncRNAMap [8], lncRNAtor [9], LongTarget [10], ncFANs [11],

TANRIC [12], and TF2LncRNA [13] were studied in detail. Additionally, the lncRNA identification pipeline was performed on the

transcriptome dataset of rod photoreceptors in the developing mammalian retina [14].

Results and Discussion: LncRNA annotation tools offer individual analysis features and help us better understand biological

functions of lncRNA transcripts. For instance, while Linc2Go allows inspecting potential lncRNA-microRNA interactions,

LongTarget is a simple and convenient platform to predict putative triplex target sites of lncRNAs on the human and mouse DNA.

Furthermore, the lncRNA identification analysis led to discovery of 376 previously un-annotated lncRNA species, which might have

functional roles in the rod cell development. I believe that the lncRNA identification and annotation tools introduced here will guide

lncRNA biologists to analyze their experimental dataset and to build new bioinformatics-driven hypotheses.

Keywords: Long non-coding RNA; bioinformatics; databases; RNA sequencing; transcript annotation; transcript discovery

References:

[1] Ulitsky, I.; Shkumatava A.; Jan C. H.; Sive H. Bartel D. P. Cell 2011, 147, 1537-1550.

[2] Rinn, J. L.; Kertesz M.; Wang J. K.; Squazzo S. L.; Xu X.; Brugmann S. A.; Goodnough L. H.; Helms J. A.; Farnham P. J.; Segal E. Chang H. Y.

Cell 2007, 129, 1311-1323.

[3] Derrien, T.; Johnson R.; Bussotti G.; Tanzer A.; Djebali S.; Tilgner H.; Guernec G.; Martin D.; Merkel A.; Knowles D. G.; Lagarde J.; Veeravalli

L.; Ruan X.; Ruan Y.; Lassmann T.; Carninci P.; Brown J. B.; Lipovich L.; Gonzalez J. M.; Thomas M.; Davis C. A.; Shiekhattar R.; Gingeras T. R.;

Hubbard T. J.; Notredame C.; Harrow J. Guigo R. Genome Res 2012, 22, 1775-1789.

[4] Paraskevopoulou, M. D.; Georgakilas G.; Kostoulas N.; Reczko M.; Maragkakis M.; Dalamagas T. M. Hatzigeorgiou A. G. Nucleic Acids Res

2013, 41, D239-245.

[5] Liu, K.; Yan Z.; Li Y. Sun Z. Bioinformatics 2013, 29, 2221-2222.

[6] Lu, Q.; Ren S.; Lu M.; Zhang Y.; Zhu D.; Zhang X. Li T. BMC Genomics 2013, 14, 651.

[7] Jiang, Q.; Ma R.; Wang J.; Wu X.; Jin S.; Peng J.; Tan R.; Zhang T.; Li Y. Wang Y. BMC Genomics 2015, 16 Suppl 3, S2.

[8] Chan, W. L.; Huang H. D. Chang J. G. Comput Biol Chem 2014, 50, 41-49.

[9] Park, C.; Yu N.; Choi I.; Kim W. Lee S. Bioinformatics 2014, 30, 2480-2485.

[10] He, S.; Zhang H.; Liu H. Zhu H. Bioinformatics 2015, 31, 178-186.

[11] Liao, Q.; Xiao H.; Bu D.; Xie C.; Miao R.; Luo H.; Zhao G.; Yu K.; Zhao H.; Skogerbo G.; Chen R.; Wu Z.; Liu C. Zhao Y. Nucleic Acids Res

2011, 39, W118-124.

[12] Cao, W.; Liu J. N.; Liu Z.; Wang X.; Han Z. G.; Ji T.; Chen W. T. Zou X. Oral Oncol 2017, 65, 94-101.

[13] Jiang, Q.; Wang J.; Wang Y.; Ma R.; Wu X. Li Y. Biomed Research International 2014, 2014, 317642.

[14] Kim, J. W.; Yang H. J.; Brooks M. J.; Zelinger L.; Karakulah G.; Gotoh N.; Boleda A.; Gieser L.; Giuste F.; Whitaker D. T.; Walton A.;

Villasmil R.; Barb J. J.; Munson P. J.; Kaya K. D.; Chaitankar V.; Cogliati T. Swaroop A. Cell Rep 2016, 17, 2460-2473.




13

IDDGC17-OP-102

USE OF IMMUNOHISTOCHEMICAL METHODS IN VETERINARY AND MEDICAL SCIENCES

Güngör ÇağdaĢ DĠNÇEL1, Oğuz KUL

2

Aksaray University, Eskil Vocational School, Laboratory and Veterinary Science, Aksaray, TURKEY contact: [email protected]

Kırıkkale University, Faculty of Veterinary Medicine, Department of Pathology, Kırıkkale, TURKEY

contact: [email protected]

Immunohistochemistry is a widely used method in the health sciences either for helping the diagnosis or for researches. Even now it is

used as verification method in many studies. And also very valuable molecular technique. The immunological role of the mechanism

of the pathology that have taken place in relation to many diseases in recent years has been determined with this method.

Immunohistochemical stainings are a function of the enzyme activity and are directly proportional to the number of enzyme

molecules bound to the and staining power. Importantly, the binding of avidin to biotin is almost irreversible. We commonly use

immunohistochemistry to detect the pathogenesis of neuropathology in viral and parasite related in neuropathological diseases. And

we have clarified many points with this method. Among the immunohistochemical methods most commonly used is the Avidin-Biotin

Complex method. A secondary antibody, an indicator molecule and with specificity against the primary antibody, plays a key role in

demonstrating enzyme localization in the primary antibody interaction with the specimen. A biotinylated secondary antibody is

incubated with the tissue sample to allow binding to the primary antibody. The indicator produces a colored reaction product at the

site of original epitope, allowing visualization. Another biotin-binding protein is streptavidin with each subunit binding one molecule

of biotin with affinity similar to that of avidin and much less soluble in water than avidin. Many unanswered questions have found

answers today with the highly sophisticated method of immunohistochemistry.

Keywords: immunohistochemistry, Avidin-Biotin Complex, pathology

mailto:[email protected]





14

IDDGC17-OP-103

DISTRIBUTION OF THE HUMAN GLUCOCORTICOD RECEPTOR GENE N363S

POLYMORPHISM IN A TURKISH POPULATION AND ITS RELATION WITH MAJOR

DEPRESSIVE DISORDER

Naciye Selcen Bayramcı1

1Department of Bioengineering, Faculty of Engineering and Natural Sciences, Gaziosmanpasa University, Tokat, Turkey

[email protected]

Text: Major depressive disorder (MDD) is a common mental disorder characterized by at least two weeks of low mood that is present

across most situations. Globally, an estimated 350 million people of all ages suffer from depression. Over 800.000 people die due to

suicide every year. Suicide is the second leading cause of death in 15-29 years old. [1]. Perturbations in hypothalamic pituitary

adrenal axis sensitivity to glucocorticoids implicated in the pathogenesis of major depression may result from functional alterations in

the glucocorticoid receptor gene. The human gene coding for glucocorticoid receptor, referred to as nuclear receptor subfamily 3,

group C, member 1 (NR3C1), is located on chromosome 5q31-32 [2].

Aims and Scopes: The aim of this study was to determine the frequency distribution of genotypes and alleles N363S polymorphism

of NR3C1 gene associated with major depressive disorder development in a Turkish population.

Materials and Methods: A total of 100 consecutive unrelated adult patients with documented medical records of MDD were from

outpatient Psychiatry Clinic in Gaziosmanpaşa University Research and Training Hospital, Tokat, Turkey by referral from the treating

physician, after obtaining initial verbal consent to participate in the study. In addition, 100 control subjects from the same area as the

patients, and comprising blood donors, healthy volunteers were enrolled this study. DNA was isolated from peripheral blood samples

using the High Pure PCR Template Kit (Roche Applied Science) and the N363S variant was screened by RT-PCR technique.

Results and Discussion: 99 out of the 100 MDD patients were found to be AA genotype at the N363S of NR3C1 (AA genotype

frequency 0.99; A-allele frequency 0.995). Also, 1 out of the 100 MDD patients was found to be AG genotype (AG genotype

frequency 0.01; G-allele frequency 0.005). No homozygote for the rare G-allele was seen. Significantly more frequent occurrence of

allele A in N363S polymorphism was observed in the group of the patients with MDD in comparison with the control group (OR:

4.061, 95% CI: 0.449-36.660, χ2: 1.823, p: 0.177). In the investigated N363S polymorphism of the NR3C1 gene, allele-G was

associated with lower probability of development of the MDD (OR: 0,242, 95% CI: 0,026-2,208, χ2: 1.823, p: 0.177). For genotype

AG versus AA, no significant correlation was demonstrated between patients and the control group with respect to the investigated

SNP (OR: 0.242, 95% CI: 0.027-2.208, χ2: 1.846, p: 0.174). The frequencies of genotypes in the group of patients with MDD in

comparison with the control group for N363S polymorphism of the NR3C1 gene were also analyzed demonstrating no statistically

significant correlation (p>0.05). No evidence was found for an association of the N363S polymorphism of the NR3C1 gene with

parameters related to the the severity of MDD.

Keywords: Glucocorticoid receptor, N363S polymorphism, NR3C1 gene, depression, RT-PCR

References:

[1] WHO Fact sheet: Depression (2016).

http://www.who.int/mediacentre/factsheets/fs369/en/

[2] Krishnamurthy, P.; Romagni, P.; Torvik, S.; Gold, P.W.; Charney, D.S.; Detera-Wadleigh, S.; Cizza, G. Glucocorticoid Receptor

Gene Polymorphisms In Premenopausal Women With Major Depression. Hormone and Metabolic Research 2008, 40, 194-198.

Acknowledgements: This study was supported by the Gaziosmanpaşa University Scientific Research Fund (GOÜ BAP2013/8)

awarded to N.S.Bayramcı.


http://www.who.int/mediacentre/factsheets/fs369/en/




15

IDDGC17-OP-104

ASSOCĠATĠON OF SĠNGLE NUCLEOTĠDE POLYMORPHĠSMS ĠN THE LEP, CAST, CAPN1, GHR,

FABP4 AND DGAT1 GENES WĠTH FATTENĠNG PERFORMANCE AND CARCASS TRAĠTS ĠN

SĠMMENTAL BULLS

Sena Ardicli1, Deniz Dincel

1, Hale Samli

1, Faruk Balci

1

1Uludag University, Veterinary Faculty, Department of Genetics, Bursa, Turkey

[email protected]

Aims and Scopes: LEP, CAST, CAPN1, GHR, FABP4 and DGAT1 have been shown to be candidate genes in regulating muscle and

fat metabolism of cattle. To the best of authors knowledge, there is limited information about the effects of these markers on fattening

performance in the Simmental breed. Therefore, the aim of the present study was to evaluate the association of A80V, S20T, G316A,

S555G, V110M and K232A polymorphisms in LEP, CAST, CAPN1, GHR, FABP4 and DGAT1 genes respectively, with fattening

performance and carcass traits in Simmental bulls.

Materials and Methods: A total of 81 purebred Simmental bulls were used in the study. The study was carried out under semi-open

stall conditions. The experiment began after 15 days of adaptation period, with the initial average body weight of animals 200.21 kg.

Initial weight (IW), final weight (FW), fattening period (FP), total weight gain (TWG) and average daily gain (ADG) were recorded

to evaluate fattening performance and 4 ml blood samples were collected from the vena jugularis of each of the bulls for genotyping.

ADG was calculated based on TWG and FP. Final weight (FW), hot (HCW) and chilled carcass weight (CCW), chilling loss (CL) and

the dressing percentage (DP) were recorded. In the present study, DNA extraction was performed by a phenol-chloroform method (1)

and genotyping was carried out using PCR-RFLP method. The Hardy–Weinberg equilibrium (HWE) was tested for all alleles and the

population genetic indexes including gene heterozygosity (He) and polymorphism information content (PIC) were evaluated (2). The

effects of genotypes on the traits studied were analysed by the least-squares method as applied in a general linear model (GLM)

procedure.

Results and Discussion: The results of our study showed that the population was determined to be compatible for either genotype in

the HWE, except for CAST S20T and GHR S555G polymorphisms. This disequilibrium can be a result of indirect selection for these

loci and inbreeding. In the association analysis, the S20T polymorphism at the CAST gene and the G316A polymorphism at the

CAPN1 gene were associated with variation in FW, FP, TWG and ADG (P<0.05). CAPN1 gene located to BTA29, and the specific

inhibitor of the calpain family, CAST gene, located to BTA7 are functional and positional candidate genes for carcass, meat quality (3,

4) and growth traits (5, 6) in beef cattle. Hence, evaluating these marker effects on fattening performance may be useful for selection

programs. The polymorphism of the LEP gene showed associations with variation of HCW, CCW and DP (P<0.05). LEP, performs

important roles in the regulation of body weight, fat deposition and feed intake (7, 8). However, no significant association was

reported between LEP A80V polymorphism and carcass weights in the literature. The existence of this novel association between

A80V polymorphism and carcass traits may be dependent on the overall fat content of the individual. There was no association

between GHR S555G, FABP4 V110M and DGAT1 K232A markers with the traits analyzed in the current study (P>0.05). Further

studies investigating these markers in larger populations need to be performed to confirm the present results before using them in

marker-assisted selection. However, the results of our study suggest that significant economic benefits can be achieved from selecting

for LEP, CAST and CAPN1 markers.

Keywords: Gene polymorphism, Fattening performance, Carcass traits, Cattle, Simmental

References:

[1] Green, M. R.; Sambrook, J. Molecular Cloning: A Laboratory Manual 2012, 47-48.

[2] Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. The American Journal of Human Genetics 1980, 32, 314-331. [3] Koohmaraie, M. Meat Science 1994, 36, 93−104.

[4] Curi, R.; Chardulo, L.; Mason, M.; Arrigoni, M.; Silveira, A.; De Oliveira, H. Animal Genetics 2009, 40, 456-462.

[5] Casas, E.; Shackelford, S.D.; Keele, J.W.; Koohmaraie, M.; Smith, T.P.; Stone, R.T. Journal of Animal Science 2003, 81, 2976-2983. [6] Pintos, D.; Corva, P. M. Animal Genetics 2011, 42, 329-332.

[7] Buchanan, F.C.; Fitzsimmons, C.J.; Van Kessel, A.G.; Thue, T.D.; Winkelman-Sim, D.C.; Schmutz, S.M. Genetics Selection Evolution 2002, 34, 105-116.

[8] Nkrumah, J.D.; Li, C.; Yu, J.; Hansen, C.; Keisler, D.H.; Moore, S.S. Journal of Animal Science 2005, 83, 20-28.




16

IDDGC17-OP-105

MERCURY CHLORĠDE-INDUCED DNA DAMAGE IN BLOOD CELLS EVALUATED BY THE

SINGLE-CELL ELECTROPHORESIS (SCGE) ASSAY

Fatih Oguz BEKDEMĠR1*, Ali DEMĠRBAĞ

2, SEDAT PER

2, Dilek PANDIR

2

1*Bozok University, Institue of Sciences, Department of Biology, Yozgat, Turkey

2Bozok University, Faculty of Arts and Science, Department of Biology, Yozgat, Turkey

e-mail: [email protected]

Aims and Scopes:

Mercury can exist in the environment as metal, as monovalent and divalent salts and as organomercurials, one of the most important

of which is mercuric chloride (HgCl2). Therefore, the aim of this study was to evaluate the HgCl2-induced blood oxidative stress with

DNA damage in human lymphocytes by using the comet assay method.

Materials and Methods:

The samples of lymphocytes were mixed in 0.65% low melting point agarose and then spread over 0.50% agar coated slides. The cells

were inserted at 4◦C for 20 minutes. Then the sample was lysed for 24 hours in alkaline conditions. The cells were treated at pH > 13,

25 V and 300 mA for 20 minutes by using electrophoresis. Sample was kept three times for 5 minutes in neutralization tampon. The

solution was stained with 50 μg ethidium bromide and covered with a cover slip

Results and Discussion:

The single cell gel electrophoresis test or comet assay technique is especially sensitive in detecting DNA single strand breaks, alkali

labile damage and excision repair sites in individual cells [1]. The comet assay has been widely applied in the radiation biology,

excisable DNA damage, DNA crosslinks, oxidative damage, genetic toxicology and apoptosis [2, 3]. In this study, the evaluation of

lymphocytes nuclei with the comet assay demonstrated that increasing application doses of HgCl2 treatment caused significantly

higher DNA damage in comparison with untreated control (P < 0.05). A higher percentage tail DNA% and tail lenght indicated at

higher level of DNA damage.

Keywords: Comet assay, HgCl2, toxicology, lymphocytes, DNA damage

References:

[1] Tafazoli, M., Volders, M.K., Mutat. Res. 1996, 371: 185–202.

[2] Fairbairn D.W., Olive P.L. O’Neill K.L. Mutat. Res. 1995, 339: 37–59.

[3] Tafazoli, M., Volders, M.K., Mutat. Res. 1996, 371: 185–202.




17

IDDGC17-OP-107

THE ROLE OF RhoA/ROCK PATHWAY ĠN THE CENTRAL NERVOUS SYSTEM ĠNJURY

Dilek Kuzay1

1Ahi Evran University Faculty of Medicine, KırĢehir, Turkey

[email protected]

Aims and Scopes: RhoA/ROCK pathway inhibits axon growth and sprouting. This pathway mediates the effects of myelin-

associated axon growth inhibitors—Nogo, myelin-associated glycoprotein (MAG), oligodendrocyte-myelin glycoprotein (OMgp), and

repulsive guidance molecule (RGM). In this review, I focus on the RhoA/ROCK signaling pathway in neurological disorders.

Therefore, this pathway is considered to be a potential therapeutic target for CNS diseases.

Materials and Methods: Several studies have demonstrated the involvement of the RhoA/ROCK pathway in the pathophysiology of

neurological disorders such as spinal cord injury (SCI), optic nerve injury, stroke, and inflammatory CNS diseases [1, 2].

Several studies have addressed whether axon regeneration can be induced by pharmacological treatments or genetic manipulations

that target inhibitory axon growth signals [3, 4, 5, 6].

Intravitreous injections of ROCK inhibitors also improve optic nerve regeneration [7, 8].

Further, involvement of RhoA/ROCK signaling has been sug gested in other neurodegenerative diseases, such as Parkinson‘s disease,

Huntington‘s disease, and amyotrophic lateral sclerosis (ALS) [9, 10,11,12,13].

These findings indicate that RhoA/ROCK could be a promising target for the treatment of axon degeneration.

Results and Discussion: The evidence obtained from animal models and clinical trials implicate that inhibition of the RhoA/ROCK

pathway would be an effective therapeutic approach for CNS disorders.

While thetreatment of neurons with MAG, Nogo, and Omgp inhibits neurite outgrowth in vitro, it is still under debate whether they

also inhibit axonal outgrowth in the CNS in vivo [3, 4, 5, 6].

Also unresolved problems should be addressed to achieve the therapeutic applications of RhoA/ROCK inhibitors. For example,

timing of administration and low drug selectivity needs to be discussed in more detail [14].

Keywords: RhoA/ROCK pathway, central nervous system injury, neurological disorders, neural regeneration, Nogo molecules

References:

[1]Mueller,B.K.,Mack,H.,andTeusch,N.Nat.Rev.Drug Discov.2005, 4, 387–398.

[2]Yiu,G.,andHe,Z.Nat.Rev. Neurosci. (2006).7, 617–627.

[3]Schnell,L.,andSchwab,M.E. Nature 1990, 343, 269–272.

[4]Bregman,B.S.,KunkelBagden,E.,Schnell,L.,Dai,H.N.,Gao,D.,andSchwab,M.E. Nature 1995, 378, 498–501.

[5]Brosamle,C.,Huber,A.B.,Fiedler,M.,Skerra,A.,andSchwab,M.E. J. Neurosci 2000, 20, 8061–8068.

[6]Merkler,D.,Metz,G.A.,Raineteau,O.,Dietz,V.,Schwab,M.E.,andFouad,K. J.Neurosci 2001, 21, 3665–3673.

[7]Lingor,P.,Teusch,N.,Schwarz,K.,Mueller,R.,Mack,H.,Bahr,M.,J. 2007 Neurochem. 103, 181–189.

[8]Lingor,P.,Tonges,L.,Pieper,N.,Bermel,C.,Barski,E.,Planchamp,V., etal. Brain 2008,131, 250–263.

[9]Tonges,L.,Frank,T.,Tatenhorst,L.,Saal,K.A.,Koch,J.C.,Szego,E.M.,etal. Brain 2012, 135, 3355–3370.

[10] Shao,J.,Welch,W.J.,Diprospero,N.A.,and Diamond,M.I. Mol.Cell.Biol 2008, 28, 5196–5208.

[11]Deyts,C.,GalanRodriguez,B.,Martin,E.,Bouveyron,N.,Roze,E.,Charvin,D., et al. PLoS ONE 2009, 15;4(12):e8287.

[12] Hu,J.H.,Chernoff,K.,Pelech,S.,and Krieger,C. J. Neurochem 2003,85, 422–431.

[13]Sunico,C.R.,Dominguez,G.,GarciVerdugo,J.M.,Osta,R.,Montero,F.,and MorenoLopez,B. BrainPathol 2011,21, 14-15.

[14]Rosenzweig,E.S.,andMcDonald,J.W. Curr.Opin. Neurol 2011, 17, 121–131.




18

IDDGC17-OP-108

ASSOCIATION OF CTLA-4 (+49 A/G) AND NOD2/CARD15 (N852S) POLYMORPHISMS WITH

TURKISH INFLAMMATORY BOWEL DISEASE PATIENTS 1Songül Budak Diler

1University of Ömer Halisdemir, Faculty of Science and Letters, Department of Biotechnology, 51240, Niğde, Turkey.

Abstract

Aims and Scopes: The inflammatory bowel diseases (IBD) are idiopathic chronic inflammatory disorders of the gastrointestinal tract.

Crohn's disease (CD) and ulcerative colitis (UC) are the principal types of inflammatory bowel disease which are similar to each other

for their clinical features and epidemiology. The cytotoxic T-lymphocyte antigen 4 (CTLA-4) gene is associated with various

immunopathologic diseases. The aim of this study were to analyze the association of the CTLA-4 gene +49 A/G polymorphism and

NOD2/CARD15 gene N852S polymorphism using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)

analysis in patients with Turkish inflammatory bowel disease.

Material and Method: In this study, we evaluated the frequency of CTLA-4 gene (+49 A/G) and NOD2/CARD15 gene (N852S) in

62 patients with CD, 76 patients with UC, and 152 healthy individuals. The gene variants CTLA-4 rs231775 and NOD2/CARD15

rs104895467 were genotyped by PCR followed by RFLP. The results of patients and control group were analyzed statistically.

Results and Discussion: According our results, the +49 A/G AA genotype was prevalent on patients and controls (29% vs 40%),

followed by genotypes AG (56% vs 51%) and GG (15% vs 9%) in CD. The prevalence of genotypes of AA (wild-type), AG

(heterozygous mutant) and GG (homozygous mutant) profiles for the +49 A/G polymorphism were 56%, 32% and 12% respectively

in UC patients, and 40%, 51% and 9% respectively in healthy control groups. Just one band of 151 bp was found in wild-type N852S

in all subjects and no other mutant bands (151+129+22 and 129+22 bp) of N852S were detected using PCR-RFLP fragment

electrophoresis. Any association were not found for CTLA-4 +49 A/G polymorphism and NOD2/CARD15 gene N852S

polymorphism between CD, UC patients and the control groups in Turkish population.

Keywords: Inflammatory bowel diseases, CTLA-4 gene, NOD2/CARD15 gene, PCR, RFLP




19

IDDGC17-OP-109

EFFECT OF SURFACTANT PROTEIN-B GENE INTRON 4 AND C/A-18 POLYMORPHISMS ON

INFANTS WITH ACUTE BRONCHIOLITIS

Ali Gul1,Buket Seyyah AltuntaĢ

2, ġahin Takçı

2, Ömer AteĢ

3, Resul Yılmaz

2, Sümeyye Deniz Çelik

3

1Gaziosmanpasa University School of Medicine, Department of Pediatrics, 60250, Tokat, Turkey, [email protected]

2Gaziosmanpasa University School of Medicine, Department of Pediatrics

3Gaziosmanpasa University School of Medicine, Department of Biology and Genetics, Tokat, Turkey

Aims and Scopes: The severity of acute bronchiolitis associate with degree of immune response. Patients with lower respiratory tract

(LRT) RSV infections were investigated for genetically susceptibility(1). We aimed to determine the association of surfactant B and

D gene polymorphisms with acute bronchiolitis in infants younger than 1 year of age.

Materials and Methods: One hundred and six patients diagnosed with acute bronchiolitis and 107 healthy children from outpatient

of pediatric polyclinics of Gaziosmanpasa University hospital between January 2015 and January 2016 were enrolled to the study.

Acute bronchiolitis was diagnosed with clinical symptoms and findings (2). Blood samples were collected from each subject, and

DNA was extracted from peripheral blood samples using a GeneAll® ExgeneTM Blood SV Genomic DNA Kit according to the

manufacturer‘s instructions. SP-B intron 4 and C/A-18 gene polymorphisms were analyzed by a polymerase chain reaction (PCR)-

based restriction fragment length polymorphism (RFLP) method.

Results and Discussion: A total of 106 infants with acute bronchiolitis were enrolled in this study and another 107 infants without

bronchiolitis were recruited for the control group. Forty-five (42.5%) of 106 patients diagnosed with bronchiolitis in the study were

female. In bronchiolitis patient group, ten infants were 1–3 months, and 96 were 3–12 months of age. The respective genotype

frequencies of the inv/inv, inv/(ins/del), ins/ins, and del/del genotypes of SP-B intron 4 were 93.3%, 4.7%, 0.9% and 0.9% in acute

bronchiolitis subjects and 84.1%, 15.8%, 0% and 0% in controls (p = .0111). SP-B C/A-18 polymorphisms did not influence the risk

of acute bronchiolitis (p > 0.05). The genotype frequencies of the CC, CA, and AA genotypes of SP-B C/A-18 were 22.1%, 48.0,

and 29.8% in acute bronchiolitis infants and 17.4%, 53.3%, and 29.1% in controls, respectively (p=0.6428). The allelic frequency of

the C allele and A allele were 46.3% in acute bronchiolitis subjects and 32.4% in controls (p = 0.3440).

There is a possible association between the SP-B gene and susceptibility to acute bronchiolitis infection. We did not be able to find

any research about SP-B and acute bronchiolitis. But, the A-allele of SP-C gene is suggested to associate with reduced pulmonary

function and may predispose to lower respiratory disease (3). Some variant of SP-B gene has been variably associated with increased

risk for ARDS, COPD, and newborn RDS, as well (4). Also, there was suggested that the SP-B gene variants may increase the

incidence or severity of disease in genetically vulnerable individuals. (5). The carriers of inv/inv homozygous genotype may have an

increased risk for acute bronchiolitis disease in comparison with carriers of inv/(ins/inv) heterozygote genotype.

Keywords: Acute bronchiolitis, surfactant protein B, gene polymorphism, surfactant, respiratory tract.

Acknowledgment: This work was supported by Gaziosmanpasa University Scientific Research Projects Fund.

References:

1. Yusen RD, Cohen AH, Hamvas A. Normal lung function in subjects heterozygous for surfactant protein-B deficiency. American journal of

respiratory and critical care medicine. 1999;159(2):411-4.

2. Bria M. Coates LEC. Wheezing in Infants: Bronchiolitis. In: Kliegman RM, editor. Nelson Textbook of Pediatrics. Twentieth ed. Canada:

Elsevier; 2016. p. 2044-50.

3. Drysdale SB, Prendergast M, Alcazar M, Wilson T, Smith M, Zuckerman M, et al. Genetic predisposition of RSV infection-related

respiratory morbidity in preterm infants. European journal of pediatrics. 2014;173(7):905-12.

4. Lin Z, Pearson C, Chinchilli V, Pietschmann S, Luo J, Pison U, et al. Polymorphisms of human SP‐A, SP‐B, and SP‐D genes: association

of SP‐B Thr131Ile with ARDS. Clinical genetics. 2000;58(3):181-91.

5. Hamvas A, editor. Inherited surfactant protein-B deficiency and surfactant protein-C associated disease: clinical features and evaluation.

Seminars in perinatology; 2006: Elsevier.





20

IDDGC17-OP-110

PHYLOGENETIC ANALYSIS OF ALOPECOSA SPIDERS (ARANEAE:LYCOSIDAE)

Derya Arslan, Adile Akpınar

Gaziantep University, Science and Art Faculty, Biology Department, Gaziantep

Corresponding Author: [email protected]

Aims and Scopes: The Lycosidae family is one of the most diverse spider families worldwide, comprising 2401 known species

belonging to 123 genera (World Spider Catalog, 2017) In Turkey, the Lycosids are represented by 85 species and the genus Alopecosa

Simon, 1885 contains 14 species (Bayram et al. 2017). In this study, Our main aim is to carry out phylogenetic analysis within the

Alopecosa genus and determine how well morphological characters fit the phylogeny. This report describes the first study to include

molecular analysis of the mitochondrial cytochrome c oxidase I gene alongside morphology to characterize arachnids in the research area.

Materials and Methods: Spiders were collected by different methods (catching by hand, aspiratory and sweeping) between the months

of April-October 2014-2015. Specimens were collected from 21 sites belonging to nine districts in Gaziantep and stored in 96% ethanol

at -20 ˚C. Morphological identifications were based on reference publications on the taxonomy of Palearctic region spiders with species

nomenclature following the World Spider Catalog (2017).Mitocondrial COI gene sequences were analysed by different methods and COI

sequences of Alopecosa genus were compared with registered in BOLD, using the species identification tool. Phylogenetic tree was

contructed by using Mega 6 programme.

Results and Discussion: Seventy-six Alopecosa specimens (13 adult female, 8 adult male and 55 sub-adult) from 21 localities were

processed. Morphological comparison of mature specimens was carried out and members of 4 different species were

identified.(Alopecosa aculeate (Clerck, 1757) , A. kuntzi (Denis, 1953), A. albofasciata (Brullé, 1832) and A. accentuata (Latreille,

1817). Moleculer studies were done on Alopecosa genus and were supported by morphological identification. In conclusion, in this study

morphological and sequence data belonging to 4 species were collected, and sequences were deposited in Genbank.

Keywords: Araneae, Lycosidae, COI (Cytochrome C oxidase I), Spiders, Alopecosa.

Acknowledgements: The authors are grateful to Gaziantep University, Department of Scientific Research Projects (Proj. No. F.E.F.

15.05) for financal support. We also thanks Aynur Erbaş (M.Sc) and Hasan Hüseyin Yaz who collected spider specimens.

References:

[1] .Bayram, A., Kunt, K.B. and DanıĢman, T. 2017. The Checklist of the Spiders of Turkey. Version 2017, Online at

http://www.spidersofturkey.info.

[2]. World Spider Catalog (2017). World Spider Catalog. Natural History Museum Bern, online at http://wsc.nmbe.ch, version 18.0, accessed on

{date of access}

[3]. Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. 2013. MEGA6: Molecular Evolutionary Genetics Analysis

Version 6.0. Molecular Biology and Evolution 30: 2725-2729.

http://www.spidersofturkey.info/




21

IDDGC17-OP-111

EVALUATION OF FOUR COMMERCIAL DNA EXTRACTION KITS FOR THE EXTRACTION

AND PURIFICATION OF DNA FOR THE DETECTION OF MICROSPORIDIA AND THE

IMPORTANCE IN DNA ISOLATION OF PRETREATMENTS

ÜLFET ÇETĠNKAYA1, ARZUV CHARYYEVA

2, EDA SĠVCAN

2, ESRA GÜRBÜZ

2

1Halil Bayraktar Health Vocational College, Erciyes University, Kayseri, Turkey

2Department of Parasitology, Faculty of Medicine, Erciyes University, Kayseri, Turkey. [email protected]

Aims and Scopes: Molecular based tests have high sensitivity and specificity in disease diagnosis. However these tests' performance

rely on the extraction of DNA in a good concentration. The standard procedures of commercial DNA extraction kits are insufficient

because of the tough walls of spores. This study aimed to investigate the significance of pretreatments with glass beads and freeze-

thawing processes in DNA extraction from microsporidia spores. Additionally, the effectiveness of DNA isolation kits produced by

different manufacturers is tested with and without any pretreatment.

Materials and Methods: The parasite was cultured in growing VERO cells and seven serial dilutions were prepared from the

collected spores. DNA purification was performed according to different tissue kits and stool kit procedures with and without any

pretreatment. Isolated DNA samples were evaluated by real-time PCR.

Results and Discussion: Real-time PCR analysis showed that according to the QIAamp DNA stool mini kit, the detectable number of

spores in stool samples is higher compared with tissue kits. Furthermore, pretreating spores with (1) freeze-thawing, (2) vortexing

with glass beads and (3) both processes can be more effective in disrupting the spore wall and extracting DNA of good quantity. The

stool kit is inadequate for DNA purification from E.intestinalis spores, while tissue kits on their cown are adequate. As a result of the

current study, it is clear that further pretreatments are extremely necessary process for DNA extraction from stool specimens in order

to avoid possible false negativity in the diagnosis of microsporidiosis.

Keywords: Microsporidia, DNA extraction, Freeze-Thawing, Glass beads, Pretreatment.

References:

[1] Ariefdjohan, M.W.; Savaiano, D.A.; Nakatsu, C.H. Comparison of DNA extraction kits for PCR-DGGE analysis of human intestinal microbial

communities from fecal specimens. Nutrition journal, 2010, 9, 23.

[2] Babaei, Z.; Oormazdi, H.; Rezaie, S.; Rezaeian, M.; Razmjou, E. Giardia intestinalis: DNA extraction approaches to improve PCR results.

Experimental parasitology, 2011, 128, 159-162.

[3] Weber, R.; Bryan, R. T.; Schwartz, D. A., Owen, R. L. Human microsporidial infections. Clinical microbiology reviews, 1994, 7, 426-461.

[4] Mirjalali, H.; Mohebali, M.; Mirhendi, H.; Gholami, R.; Keshavarz, H.; Meamar, A. R.; Rezaeian, M. Emerging Intestinal Microsporidia

Infection in HIV(+)/AIDS Patients in Iran: Microscopic and Molecular Detection. Iranian journal of parasitology, 2014, 9, 149-154.





22

IDDGC17-OP-112

CONSTRUCTION OF GP63 DNA VACCINE CANDIDATE AGAINST LEISHMANIASIS AND

DETERMINATION OF ANTIGENIC FRAGMENTS ARZUV CHARYYEVA

1, ÜLFET ÇETĠNKAYA

2, EDA SĠVCAN

1, SERKAN KARACA

1, EMRAH ERDOĞAN

1

1Department of Parasitology, Faculty of Medicine, Erciyes University, Kayseri, Turkey.

2Halil Bayraktar Health Vocational College, Erciyes University, Kayseri, Turkey.

[email protected]

Aims and Scopes: Leishmaniasis is a vector borne disease caused by Leishmania genus. Disease can be fatal if left untreated and

there is no effective vaccine available for human use. Surface glycoprotein 63 is one of the most promising immunogens to induce

immune response against infection due to its serious role in virulence of the parasite and with its presence in all stages of life cycle in

all species of Leishmania genus. In this study, it was aimed to establish Gp63 DNA vaccine candidate and to identify the antigenic

fragments within gene sequence.

Materials and Methods: Genomic DNA was extracted from the L.donovani promastigotes. Gp63 gene fragment was cloned into

pcDNA3.1 vector following the PCR amplification. The recombinant plasmid was transfected into HEK cells for the confirmation of

protein expression in eukaryotic cells. Additionally, the 3D structure of the protein was determined and the predicted immunogenic

fragments were identified by Geneious v.10.0.7 software.

Results and Discussion: Cloning reaction was confirmed by various techniques such as; Colony-PCR, Miniprep-PCR, Restriction

enzyme digestion and DNA sequencing. Recombinant plasmid encoding Gp63 was produced as endotoxin-free. The expression of

Gp63 protein in mammalian cells was confirmed by the transfection of pcDNA3.1+Gp63 into HEK cells. The product of this study

can be used for immunization not only as a single DNA vaccine, but also combined with other promising antigens against

leishmaniasis. Furthermore, this candidate has the potential to be used for synthesis of recombinant protein, which can be used for

vaccination studies and for diagnostic tests.

Keywords: Leishmaniasis, Leishmania donovani, Cloning, Gp63, DNA vaccine, Transfection

Acknowledgements: The work was supported by the Erciyes University Scientific Research Projects Unit, Turkey (Project No. TYL-

2015-6249).

[1]Yao, C.; Donelson, J. E.; Wilson, M. E.; The major surface protease (MSP or GP63) of Leishmania sp. Biosynthesis, regulation of expression,

and function. Molecular and biochemical parasitology, 2003, 132(1), 1-16.

[2]Jain, K.; Jain, N. K. Vaccines for visceral leishmaniasis: A review. Journal of immunological methods, 2015, 422, 1-12.

[2]Singh, O. P.; Singh, B.; Chakravarty, J.; Sundar, S. Current challenges in treatment options for visceral leishmaniasis in India: a public health

perspective. Infectious diseases of poverty, 2016, 5, 19.





23

IDDGC17-OP-113

ALKAPTONURIC OCHRONOSIS. Hıp arthropathy - A rare case treated with total hip replacement

Mehmet YetiĢ, Zafer Ünveren, Erdal Uzun, Mustafa Özçamdallı, Turan Bilge Kızkapan, Abdülhamit Mısır.

Ahi Evran Üniversitesi Tıp Fakültesi

Alkaptonuria (AKU) is a rare autosomal-recessive metabolic disease, resulting from excess homogentisic acid (HGA) due to an

autosomal recessive mutation of the homogentisate 1,2-dioxygenase (HGD) gene on chromosome 3. The human HGD gene is mapped

to chromozome 3q21-23 and is now completely sequenced. The HGD transcript is split into 14 exons and encodes the HGD protein

which is composed of 445 aminoacids. Northern blot hybridization shows expression of HGD in renal, liver and prostatic tissues. It is

also demostrated that AKU patients are homozygous or compound heterozygous for loss of function mutations in the HGD gene. The

first two mutations in the HGD gene have been discribed in two Spanish families in 1996. These are two missense mutations: P230S

(Pro230Ser) in exon 10 and V300G (Val300Gly) in exon 12. To date, more than 100 different mutations of HGD gene have been

identified in patients from many different countries and are described in the new online HGD mutation database (

http://hgddatabase.cvtisr.sk/).

It affects one in 100,000 to 250,000 individuals, although there is evidence that certain populations have a much higher incidence (as

Slovakia and Dominican Republic; 1:19,000). It results from partial or total deficiency of homogentisic acid oxidase, which is present

in the liver and kidneys. Homogentisic acid oxidase is responsible for the turnover of HGA in phenylalanine and tyrosine catabolism.

Circulating HGA pass into various tissues through-out the body, mainly in cartilage and connective tissues, where its oxidation

products polymerize and deposit as a melanin-like pigment. Gram quantities of HGA are excreted in the urine. AKU is a progressive

disease and the three main features, according the chronology of appearance, are: darkening of the urine at birth, then ochronosis

(blue-dark pigmentation of the connective tissue) clinically visible at around 30 yrs in the ear and eye, and finally a severe ochronotic

arthropathy at around 50 yrs with the spine and large joint involvements.

A 63-year-old male presented to our clinic, complaining of chronic knee pain that had worsened over the previous 3 years. On

physical examination, the right hip was neutrally aligned. There was a mild effusion, with tenderness over joint lines. The range of

movement was limited and painful. Radiographically, the right hip showed degenerative osteophytic changes and osteophytes with

narrowing and sclerosis of the joint space. The patient also had the darkly stained sclera and pinnae characteristic of ochronosis.

There was darkening of the urine and blue-dark pigmentation of the hip joint. A cementless right total hip replacement was

performed.

The patient progressed well postoperatively, maintaining a good range of motion and achieving independent ambulation 4 weeks after

surgery. At the 5-year follow-up, the patient had returned to full activities, reported no hip pain, and was very satisfied with the

outcome.

Arthroplasty is effective for treating severe arthritis of the knee ascribable to ochronosis.We report an excellent outcome with total hip

replacement in a patient with significant degenerative arthritis secondary to ochronotic arthritis. Alkaptonuria is an inherited disease

which can lead to severe consequences. Early diagnosis and new treatments can enhance the quality of life of patients suffering from

this disease.




24

IDDGC17-OP-114

INVESTIGATION OF IL–17 PROMOTER POLYMORPHISM IN ALOPECIA AREATA Omer ATES

1, Sumeyya Deniz CELIK

1, Saime SEZER SONDAS

1, Nihan BOZKURT

1, Emel ENSARI

1, Goknur

KALKAN2

1Department of Medical Biology, Medical Faculty, GaziosmanpaĢa University, Tokat,Turkey 2Department of Dermatology, Medical Faculty, Yıldırım Beyazıt University, Ankara, Turkey

[email protected]

Aims and Scopes: T helper 17 cells (Th17), which products interleukin (IL)–17, play an important role in the pathogenesis of

Alopecia areata (AA), which is a T-cell mediated autoimmune disease [1,2]. Some studies showed significantly increased expression

of IL–17 levels in AA patients compared to healthy controls [3,4]. The aim of our study was to investigate the effect of IL–17 -152

G/A polymorphism on the predisposition to AA.

Material and Methods: The present study analyzed the genotype distribution and allele frequency for the IL–17 -152 G/A promoter

polymorphism using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique in 188 AA

patients and 168 healthy individuals.

Results and Discussion: Genotype distribution of the IL–17 -152 G/A polymorphism was found to be significantly different while

allele frequencies of the IL–17 -152 G/A polymorphism were not found to be significantly different between patients and controls

(p=0.0300and p=0.160, respectively). Our results suggested that promoter region polymorphism -152G/A of IL–17 gene is an

important risk factor for AA .

Keywords: Alopecia Areata, Autoimmunity, IL–17, Genetic predisposition

Acknowledgements: This study was supported by Gaziosmanpaşa University Scientific Research Projects Fund 2013/16.

References: [1]Xing, L. ;Dai, Z.; Jabbari, A.; Cerise, J.E.; Higgins, C.A.; Gong ,W. et al. Alopecia areata is driven by cytotoxic T lymphocytes and is

reversed by JAK inhibition. Nat Med., 2014, 20(9),1043–1049.

[2]Chen, J.; Deng, Y.; Zhao, J.; Luo, Z.; Peng, W.; Yang, J. et al. The Polymorphism of IL-17 G-152A was Associated with Childhood

Asthma and Bacterial Colonization of the hypopharynx in bronchiolitis. J Clin Immunol, 2010, 30,539–545.

[3]Tojo, G.; Fujimura, T.; Kawano, M.; Ogasawara, K.; Kambayashi, Y.; Furudate, S. et al. Comparison of Interleukin-17- Producing Cells

in Different Clinical Types of Alopecia Areata. Dermatology, 2013, 227,78–82.

[4]Atwa, M.A.; Youssef, N.; Bayoumy, N.M. T-helper 17 cytokines (interleukins 17, 21, 22, and 6, and tumor necrosis factor-a) in patients

with alopecia areata: association with clinical type and severity. International Journal of Dermatology, 2016, 55, 666–672.




25

IDDGC17-OP-115

DETECTION OF PHYSIOLOGICAL AND DNA CHANGES IN THE GENOME OF SUNFLOWER

(Helianthus annuus L.) SUBJECTED TO COPPER STRESS

Ekrem Bolukbasi*1, Sumer Aras

2

1Amasya University, Science and Art Faculty, Department of Biology, Amasya, Turkey

2Ankara University, Science Faculty, Department of Biology, Ankara, Turkey

*[email protected]

Abstract

Heavy metal contamination is an important environmental problem in the world. It is known that high concentration of heavy metals

in soils and waters cause damage to most of the functional biomolecules and genotoxicity in living things. The aim of this study was

to determine the molecular changes in sunflower (Helianthus annuus L.) genome under heavy metal of copper stress. The effects of

copper on DNA that these can be the destabilization of the double helical structure of DNA mismatches of the bases on nucleic acids

on DNA, single DNA strand breaks, double DNA strand breaks and ion connections within strands. Sunflower seeds were treated

with different concentrations of copper (0, 20, 40, 80, 160, 320, 640, 1280ppm) for 3 weeks. The growth and development of

sunflower seedlings were inhibited by the increase of concentrations of copper stress. DNA band variations were revealed by RAPD

analysis. According to the RAPD analysis, changes in genomic template stability (GTS) were detected with RAPD profiles and results

were compared with the growth, dry weight and total soluble protein content of the seedlings grown at various copper concentrations.

Finally, a comparison between physiological and biochemical parameters show that RAPD analysis can be used to evaluate genotoxic

effect of copper on sunflower plants.

Aims and Scopes The aim of this study was to determine the molecular changes in sunflower (Helianthus annuus L.) genome under heavy metal of

copper stress.

Materials and Methods

Germination method, measurement of total soluble protein and length of root

Control group of the tray was treated with only 15mL of distilled water. The other groups of the trays were treated with 15 mL of 20,

40, 80, 160, 320, 640 and 1280ppm concentrations of copper solutions for each, respectively. Total soluble protein of the sunflower

seedlings were measured according to the Bradford method (Bradford 1976).

DNA extraction and RAPD procedures

The piece (200mg) of roots obtained from the seedlings after 21 days of growth procedure was grounded with liquid nitrogen in

eppendorf tubes, and total genomic DNA isolation was performed with the DNA isolation protocol of Lefort (1998). RAPD-PCR

study was performed with total 25μl of standard reaction volume for each sample. Optimum amplification conditions were obtained

with 200ng genomic DNA, 1× reaction buffer, 2.5mM MgCl2, 20μM dNTPs, 0.2mM primer, and 0,5U Taq DNA polymerase. 10 of

15 RAPD primers used in this study revealed polymorphic bands that are different from the control group of sunflower.

Calculating the genomic template stability (GTS)

After analysis of the RAPD profiles, genomic template stability (%) was calculated with the following formula: GTS= (1−a/n) ×100,

where letter of a; refers to polymorphic band number of each sample, which was treated with the different copper solutions and the

letter of n; refers to the total band number in the control.

Results and Discussion

In conclusion, serious changes were observed in sunflower plant both in the population level and molecular level when they were

exposed to copper heavy metal. Our results indicate that copper is a genotoxic agent for sunflower plant and it can be useful for

restoring copper contaminated areas with certain levels.

Keywords: Heavy metals, copper stress, RAPD, genotoxic effect, sunflower

References: [1] Aksoy D., Aras S. (2010): Evaluation of copper stress on eggplant (Solanum melongena L.) seedlings at molecular ve population levels using

various biomarkers. Mutation Research, 719/1-2; 29-34.

[2] Batir M.B., Candan F., Buyuk I., Aras S. (2015): The determination of physiological and DNA changes in seedlings of maize (Zea mays L.)

seeds exposed to the waters of the Gediz River and copper heavy metal stress. Environmental Monitoring and Assessment, 187: 169.

[3] Batir M.B., Candan F., Buyuk I. (2015): Determination of the DNA changes in the artichoke seedlings (Cynara scolymus L.) subjected to lead

and copper stresses. Plant Soil and Environment, 62; 3, 143-149.





26

IDDGC17-OP-116

EXPRESSION OF STRESS-RELATED GENES IN TOMATO (Solanum lycopericum L.) PLANTS

EXPOSED TO ZINC STRESS Mehmet Karakas

1, Ekrem Bolukbasi

2*, Sumer Aras1



*[email protected]

Abstract

Zinc is a microelement which should be taken in very less amounts by plants, animals and humans. In plants, zinc in low

concentration is essential for root and stem elongation, RNA levels, the cell‘s ribosome content and protein formation mechanism. But

at high concentrations, it is toxic for plants like cadmium, lead and copper. The toxic effect of zinc cause damages to the cell division

and it especially gives damages to the cell nucleus of meristematic stem cell. In this current study, the molecular response of tomato

(Solanum lycopericum L.) plants to zinc stress was examined by transcript accumulation analysis of two stress-related genes: (i) MT2

(metallothionein) gene, coding for a metal-binding protein and (ii) GR1 (glutathion reductase) gene, a marker of enzymatic ROS

scavenging mechanism. A quantitative real-time PCR experiment was performed with MT2 and GR1 genes using RNA isolated from

tomato roots or shoots treated for 24h with zinc at concentrations ranging from 20 to 1280ppm. Results showed that the genes were

over-expressed in zinc-stressed tomato. The highest relative fold change value was measured on GR1 for both root and shoot

indicating the activation of the oxidative stress enzyme to tolerate zinc stress.

Aims and Scopes In this current study, it was aimed to determine the effect of zinc heavy metal on tomato plants by the use of quantitative real-time

PCR analysis.


Tomato plants were grown in seedling trays were filled with sterilized perlite under greenhouse conditions with 16:8 h (light:dark)

photoperiod, 50-60% humidity, at 23-26 ⁰C. After 21 days of growth with hoagland solution containing macronutriens and

micronutrients, seedlings were exposed to 20, 40, 80, 160, 320, 640, 1280ppm zinc solution (ZnSO4·6H2O) for 24 h. Roots and

shoots were harvested and stored at -80⁰C. until RNA isolation. Total RNA of all root and shoot samples were extracted by using

Trizol reagent according to suggested procedures by manufacturer. Extracted RNA was dissolved in RNase-free water and stored at -

80 ⁰C. Real-time PCR was performed using Light Cycler Nano System. Gene-specific qRT-PCR primers for MT2, GR1 genes and

actin (ACT) were designed using Primer 3 software based on the sequence information of tomato genes available in the databank

(http://www.ncbi.nlm.nih.gov/). Amplifications of the PCR product were monitored via SYBR Green I dye. The qRT-PCR analysis

contained three biological replicates, consisting of three technical replicates


In this study, it was shown that the activation of MT2 and GR1 like protein transcripts under zinc stress. The accumulation increases

of zinc stress, the curve reflects a descending profile, revealing the disruption of mechanisms which regulates the cellular homeostasis

under high zinc level. The activation of these genes could be a protection mechanism to zinc stress, other than the transporter systems.

Keywords: Zinc stress, metallothionein, glutathion reductase, tomato, qRT-PCR.

References: [1] Apel, K., Hirt, H. 2004. Reactive oxygen species: metabolism, oxidative stress and signal transduction. Annu. Rev. Plant Biol. 55, 373-99.

[2] Brown, M.A., Zhu, L., Schmidt, C., Tucker, P.W. 2007. Hsp90 from signal transduction to cell transformation. Biochem. Biophys. Res.

Commun. 363.

241–246.

[3] Cervilla, L.M., Blasco, B., Rios, J., Romero, L., Ruiz, J. 2007. Oxidative stress and antioxidants in tomato (Solanum lycopericum) plants

subjected to boron toxicity. Ann. Bot. 100, 747-56.

[4] DalCorso, G., Farinati, S., Maistri, S., Furini, A. 2008. How plants cope with cadmium: staking all on metabolism and gene expression. J. Int.

Plant. Biol. 50, 1268-80.

[5] Rozen, S., Skaletsky, H.J. 2000. Primer3 on the WWW for General Users and for Biologist Programmers. In: Krawetz, S., Misener, S. (Eds.),

Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, pp.365-86.

[6] Soydam A.S., Gokce E., Buyuk I., Aras S. 2012. Characterization of stress induced by copper and zinc on cucumber (Cucumis sativus L.)

seedlings by means of molecular and population parameters. Mutation Research, 746: 49-55.


https://en.wikipedia.org/wiki/Hoagland_solution




27

IDDGC17-OP-117

PROBIOTIC CHARACTERIZATION AND GENOTYPIC IDENTIFICATION OF

Lactobacillus brevis ISOLATED FROM TRADITIONAL PICKLES

Esin Kiray1, Belgin Erdem

2, Ergin Kariptas

3

1,2

Ahi Evran University, Faculty of Science and Arts, Department of Biology, Kirsehir, Turkey 3Ahi Evran University, Faculty of Medicine, Department of Medical Microbiology, Kirsehir, Turkey

[email protected]

Aims and Scopes: The pickle, a traditional fermented vegetable product, is very popular in Kırşehir region of Turkey. Pickling has an

important role in Turkish lifestyle. The objective of this study was to investigate the probiotics characterization of Lactobacillus

brevis collected from traditional fermented pickle in Kırşehir region.

Materials and Methods: Identification of this strain was carried out by 16S rRNA gene sequence analysis using the BLAST

algorithm. Tolerance of L. brevis to simulating gastrointestinal tract conditions was evaluated in a consecutive exposure to

hydrochloric acid (pH 2, 2.5 and 3.0 for 3 h) and bile acids (0.3% for 3 h). Antimicrobial activity was measured by well diffusion

method. Antibiotic resistance was tested by agar disk diffusio assay.

Results and Discussion: Results showed that L. brevis was able to tolerate pH 2.5 and 3.0 for 3 h, and 0.3% bile salts for 4 h. This

strain also showed good antimicrobial activities against the tested pathogenic strains of humans, and most of them exhibited stronger

antimicrobial activity. The isolated strain was resistant to ciprofloxacin, gentamicin, vancomycin, teicoplanin, aztreonam, netilmicin

and ceftazidime antibiotics. Thus, L. brevis could be considered as potential antimicrobial probiotic strains against human pathogens

and should be further studied for their human health benefits.

Keywords: Probiotics, Lactobacillus brevis, traditional fermented pickle




28

IDDGC17-OP-118

TRANSCRIPTION FACTOR TFII-I INTERACTS WITH E2Fs AND REGULATES

STRESS RESPONSE ASSOCIATED GENE, ATF3

Rukiye Nar1, Yong Shen

2, Alex Xiucheng Fan

2, Mahmoud Aryan

2, Mir A. Hossain

2, Ming Tang

2, Jianrong Lu

2, John

Strouboulis 3, Jörg Bungert

2

1Department of Medical Biochemistry, College of Medicine, Ahi Evran University, Kirsehir, Turkey

2Department of Biochemistry and Molecular Biology, Center for Epigenetics, Genetics Institute, Shands Cancer Center, Powell-Gene

Therapy Center, University of Florida, USA 3Institute of Molecular Biology and Biotechnology, Foundation of Research and Technology-Hellas, Heraklion, Crete, Greece

Text

Aims and Scopes: Transcription factor TFII-I is a multifunctional protein implicated in the regulation of cell-cycle and stress

response genes (1). Previous studies have shown that TFII-I associated genomic sites contained DNA-binding motifs for E2F family

transcription factors. Like TFII-I, E2Fs have been implicated in the regulation of the cell-cycle as well as the stress- and DNA

damage-response (2). In the current study we analyzed interactions between the repressor E2Fs, E2F4 and E2F6, and TFII-I.

Materials and Methods: We analyzed the coassociation of TFII-I and E2Fs in more detail using bioinformatics, chromatin

immunoprecipitation, and co-immunoprecipitation experiments in K562 Human erythroleukemia cell line. To reduce expression of

TFII-I (GTF2i), K562 cells were transfected with the plasmid pGIPZ-shTFII-I. Single cell clones were expanded in the presence of 1

μg/ml puromycin. K562 cells, either expressing the SC shRNA or shRNA directed against the TFII-I mRNA, were subjected to ER

stress by incubation in 100 nM thapsigargin.

Results and Discussion: The data show that TFII-I and the repressor E2Fs, E2F4 and E2F6, interact and bind to several genes

implicated in the response to cellular stress, including ATF3 gene. ER-stress induced

up-regulation of ATF3 gene transcription was associated with a decrease in binding of the repressor E2Fs to an upstream element

bound by TFII-I. Inhibition of TFII-I expression led to a decrease in the association of E2F4 and E2F6 with the ATF3 gene locus in

K562 cells. The results uncover novel interactions between TFII-I and E2Fs and reveal that TFII-I may be important for the function

of E2Fs at specific gene loci.

Keywords: TFII-I, E2F, ATF3, Gene Regulation, Stress Response

References:

(1) Roy AL. Gene. 2001 Aug 22;274(1-2):1-13.

(2) Fan X, Papadopoulos G, Hossein MA, Lin IJ, Hu J, Tang TM, Kilberg MS, Renne R, Strouboulis J, Bungert J. Nucleic Acids Res.

2014 Jul;42(12):7625-41




29

IDDGC17-OP-119

Single nucleotide variations of the canine RAD51 domains, which directly binds PALB2 and BRCA2

Ozge Ozmen,1)

; Selim Kul2)

; Ali Risvanli3)

; Gozde Ozalp4)

; Ahmet Sabuncu5)

; Oguz Kul6)

1)Ankara University, Faculty of Veterinary Medicine, Department of Genetics, Ankara, Turkey.

2)Firat University, Faculty of Veterinary Medicine, Department of Animal Breeding, Elazig, Turkey.

3)Firat University, Faculty of Veterinary Medicine, Department of Obstetrics and Gynecology, Elazig, Turkey.

4)Uludag University, Faculty of Veterinary Medicine, Department of Obstetrics and Gynecology, Bursa, Turkey.

5)Istanbul University, Faculty of Veterinary Medicine, Department of Obstetrics and Gynecology, Istanbul, Turkey.

6)Kirikkale University, Faculty of Veterinary Medicine, Department of Pathology, Kirikkale, Turkey.

Abstract

Aims and Scopes: Tumors of the mammary glands are the most common tumors to affect entire female dogs representing between

50-70% of all tumors types, which is three times higher rate of incidence than humans. No other animal species has such high

probability of onset of mammary tumors. Homologous recombination is one of the mechanisms of DNA DSBs repair and the central

to DSB repair by HR is RAD51. The tumor suppressors BRCA2 and PALB2 act together to deliver RAD51 to chromosomal lesions

to initiate repair. BRCA2 and PALB2 mutations lead to destabilization of the genome and engender cancer risk. In this study we

investigate the genetic variations in RAD51 gene, which directly interactions with PALB2 and BRCA2 domains.

Materials and Methods: From a total of 64 canine patients with mammary tumors, 31 mammary tumors with benign and malign

carcinomas and the 3 normal mammary glands were used for the study. For this study, according to the canine sequence

(ENSCAFT00000014658) of RAD51 gene, three pairs of primers were designed to amplify for exon 6, exon 7, exon 8, intron 8 and

exon 9 in dog RAD51 gene. PCR samples were sequenced from both directions, following the purification of PCR products. Direct

sequencing was performed on 3100 ABI PRISM sequencer.

Results and Discussion: We have identified 9 SNPs in canine RAD51 exon 7 and exon 8 regions, among them 8 SNPs were detected

for the first time in this study. According to in silico analysis results three amino acid substitutions (N196D, H199D and T225S)

predicted to have damaging effect and these amino acid substitutions were located in the RAD51 gene PALB2 interaction domain.

The c.586A>G (N196D) was found to be the most probable disease associated nsSNP. Also, it may effect in RAD51 gene PALB2

interaction domain because, structural analysis results showed that these variant showed possible damage to protein stability and ion

ligand binding site.

Keywords: Dog, RAD51, SNVs, Mammary Tumors

Figure 1. Three-Dimensional (3D) modeling of single nucleotide polymorphism mutation in canine RAD51 gene by SNP-effect. a)

Molecular visualization of the WT (left) and variant (right) amino acid for N196D residue. The residues colored in red represents the

wild type (ASN) and variant residue (ASP), b) Molecular visualization of the WT (left) and variant (right) amino acid for T225S

residue. The residues colored in red represents the wild type (THR) and variant residue (SER).




30

IDDGC17-OP-120

VARICOCELE AND SPERM DNA FRAGMENTATION Sahin Bagbanci

1

1 Sahin Bagbanci, Department of Urology, Medicine Faculty of Ahi Evran University, Kirsehir, Turkey

[email protected]

Aim and Scope To review the importance of sperm DNA fragmentation in the infertile patients with varicocele disease.

Material and Method The recent literature was reviewed on the aspect of the importance of sperm DNA fragmentation in

the infertile patients with varicocele.


Varicocele Varicocele is defined as an abnormal increase in scrotal volume due to dilated veins in pampiniform plexus.

Fifteen percent of couples are infertile, and in half of the cases, a male factor is present thirty to forty-five percent of infertile men

have varicocele. Several theories have been formulated to explain the testicular impairment caused by varicocele, including hypoxia,

autoimmunity, elevated testicular temperature, reflux of catecholamine, and increased oxidative stress that may have a direct effect on

spermatogenic germ cells, altering metabolism. Over recent years, the interest of scientists and clinicians has focused on the role of

sperm DNA fragmentation in infertility, as this parameter may have a severe impact on fertilization and pregnancy.[1,2]

DNA Fragmentation DNA fragmentation is the separation or breaking of DNA strands into pieces. In a recent study, DNA

fragmentation rates were significantly increased in adolescents with grades 2 and 3 bilateral varicoceles. Elevated Sperm DNA

fragmentation (SDF) may affect fertility by hindering fertilization, early embryo development, implantation, and pregnancy. Surgical

varicocele repair was beneficial not only for alleviating oxidative stress-associated infertility but also to improve sperm nuclear DNA

integrity.

Test for evaluating DNA Fragmentation Acridine orange (AO) test, Aniline blue (AB) staining, Toluidine blue,

Chromomycin A3 (CMA3) staining, SCSA, Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL), Single cell gel

electrophoresis assay (comet) are the recent test for evaluating the DNA fragmentation.[3]

The Comet (single cell gel electrophoresis), the sperm chromatin dispersion test (SCD) and TUNEL (terminal

deoxynucleotide transferase-mediated dUTP gel electrophoresis) assay are both effective in detecting sperm DNA

damage. Using bright-field microscopy, the SCD test appears to be more sensitive than the TUNEL assay. Its main units of

measurement is the DNA Fragmentation Index (DFI). A DFI of 20% or more significantly reduces the success rates after ICSI. [4]

Clinical importance of DNA fragmentation in subfertile men The degree of DNA fragmentation can predict outcomes

for in vitro fertilization (IVF) and its expansion intracytoplasmic sperm injection (ICSI). By employing ART, abnormal, defective

spermatozoa, normally restrained by physiological selection barriers, namely the cervical mucus, uterine environment, cumulus

oophorous, zona pellucida or the oolemma, are enabled to enter the oocyte. This is particular importance in intracytoplasmic sperm

injection (ICSI), as this method of assisted reproduction bypasses all barriers, with the effect that genetically damaged spermatozoon

may fertilize an oocyte, which in turn may have an impact on the health and well-being of the offspring. Depending on the degree of

DNA damage, embryo development can be affected, and hence this may result in embryonic death.[5]

Key words Varicocele, Sperm DNA fragmentation

Acknowledgements None

References

[1] Ni K, Steger K, Yang H et al. A comprehensive investigation of sperm DNA damage and oxidative stress injury in infertile patients with

subclinical, normozoospermic, and astheno/oligozoospermic clinical varicocoele. Andrology. 2016 Sep;4(5):816-24. doi: 10.1111/andr.12210. Epub

2016 May 24.

[2] Tiseo BC, Esteves SC, Cocuzza MS. Summary evidence on the effects of varicocele treatment to improve natural fertility in subfertile men.

Asian J Androl. 2016 Mar-Apr;18(2):239-45. doi: 10.4103/1008-682X.172639.

[3] Esteves SC . Novel concepts in male factor infertility: clinical and laboratory perspectives. J Assist Reprod Genet. 2016 Oct;33(10):1319-1335.

Epub 2016 Jul 16.

[4] Agarwal A, Cho CL, Esteves SC. Should we evaluate and treat sperm DNA fragmentation? Curr Opin Obstet Gynecol. 2016 Jun;28(3):164-71.

doi: 10.1097/GCO.0000000000000271.

[5] Pabuccu EG, Caglar GS, Tangal S, Haliloglu AH, Pabuccu R. Testicular versus ejaculated spermatozoa in ICSI cycles of normozoospermic men

with high sperm DNA fragmentation and previous ART failures. Andrologia. 2017 Mar;49(2). doi: 10.1111/and.12609. Epub 2016 Apr 25.


https://en.wikipedia.org/wiki/DNA

https://en.wikipedia.org/w/index.php?title=Sperm_chromatin_dispersion&action=edit&redlink=1

https://en.wikipedia.org/wiki/TUNEL_assay

https://en.wikipedia.org/wiki/TUNEL_assay

https://en.wikipedia.org/wiki/Bright-field_microscopy

https://en.wikipedia.org/wiki/Units_of_measurement

https://en.wikipedia.org/wiki/Units_of_measurement

https://en.wikipedia.org/wiki/In_vitro_fertilization

https://en.wikipedia.org/wiki/Intracytoplasmic_sperm_injection

https://www.ncbi.nlm.nih.gov/pubmed/?term=Ni%20K%5BAuthor%5D&cauthor=true&cauthor_uid=27218783

https://www.ncbi.nlm.nih.gov/pubmed/?term=Steger%20K%5BAuthor%5D&cauthor=true&cauthor_uid=27218783

https://www.ncbi.nlm.nih.gov/pubmed/?term=Yang%20H%5BAuthor%5D&cauthor=true&cauthor_uid=27218783

https://www.ncbi.nlm.nih.gov/pubmed/27218783

https://www.ncbi.nlm.nih.gov/pubmed/?term=Tiseo%20BC%5BAuthor%5D&cauthor=true&cauthor_uid=26806080

https://www.ncbi.nlm.nih.gov/pubmed/?term=Esteves%20SC%5BAuthor%5D&cauthor=true&cauthor_uid=26806080

https://www.ncbi.nlm.nih.gov/pubmed/?term=Cocuzza%20MS%5BAuthor%5D&cauthor=true&cauthor_uid=26806080




https://www.ncbi.nlm.nih.gov/pubmed/?term=Agarwal%20A%5BAuthor%5D&cauthor=true&cauthor_uid=27054510

https://www.ncbi.nlm.nih.gov/pubmed/?term=Cho%20CL%5BAuthor%5D&cauthor=true&cauthor_uid=27054510



https://www.ncbi.nlm.nih.gov/pubmed/?term=Pabuccu%20EG%5BAuthor%5D&cauthor=true&cauthor_uid=27108915

https://www.ncbi.nlm.nih.gov/pubmed/?term=Caglar%20GS%5BAuthor%5D&cauthor=true&cauthor_uid=27108915

https://www.ncbi.nlm.nih.gov/pubmed/?term=Tangal%20S%5BAuthor%5D&cauthor=true&cauthor_uid=27108915

https://www.ncbi.nlm.nih.gov/pubmed/?term=Haliloglu%20AH%5BAuthor%5D&cauthor=true&cauthor_uid=27108915

https://www.ncbi.nlm.nih.gov/pubmed/?term=Pabuccu%20R%5BAuthor%5D&cauthor=true&cauthor_uid=27108915





31

IDDGC17-OP-121

THE BACTERIAL COMMUNITIES OF

Drosophila suzukii (Matsumura, 1931) (Diptera: Drosophilidae)

DAMAGED IN STRAWBERRY IN TURKEY

Elif TOZLU

1*, Nasibe TEKĠNER

1, Göksel TOZLU

1, Recep KOTAN

1, Hatice ÖĞÜTÇÜ

2

1 Ataturk University, Agricultural Faculty, Plant Protection Department, Erzurum/Turkey

2Ahi Evran Üniversity, Sciences and Arts Faculty, Biology Department, KırĢehir/Turkey

*Corresponding Author: [email protected]

Abstract

Drosophila suzukii (Matsumura, 1931) (Diptera: Drosophilidae) is an invasive species originating from Southeastern Asia and spreads

in a fast manner. It is among major threats in soft-shell fruit cultivation in the whole world. It was detected in 2014 in Turkey.

According to international criteria, it is considered that it has the potential of threatening the fruit cultivation in Turkey where garden

plants are grown widely. It is already known that resistance to harmful pests and other harmful elements emerges as a result of the use

of chemicals; and in addition, there appears soil pollution and residue problems as well as important environmental and health

problems. Studies are conducted to determine alternative and environment-friendly methods that will decrease the negative effects of

the chemicals used in agriculture to resolve these questions, and the importance of such studies is increasing.

In this context, isolations were made from 100 mature individuals and 39 bacteria isolates were obtained in the present study, which

was conducted to determine the employability of potential bacterial bioagents that may be used in biological fight against D. suzukii.

Among these isolates, 19 isolates were defined in MIS system with 40.00 and above similarity. It was determined that 47.36% of

these 19 bacteria were Paenibacillus, 10.52% were Bacillus, Gluconacetobacter and Proteus and 5.26% were Providencia, Rothia,

Brevundiomans and Staphylococcus. 12 isolates were defined with below-40.00 similarity, and 8 isolates could not be defined in MIS

system. The molecular analyses were made for the bacteria isolates, which were defined, according to 16S rRNA gen region.

According to moleculer identifications, bacteria isolates were determined Bacillus amyloliquefaciens (%60), Proteus myxofaciens

(%20), Bacillus atrophaeus (%6.67), Paenibacillus motobuensis (%6.67) and Staphylococcus epidermidi (%6.67). These bacterial

isolates obtained from D. suzukii were defined chitin activities and tried to investigation avaibility for biological control of this

important pest.

Keywords: Drosophila suzukii, microflora, bacteria, biological control





32

IDDGC17-OP-122

CLONING and CHARACTERIZATION of α-AMILAZ from Bacillus subtilis ATCC 6051 B. Serin

1, C.V. Wachenfeldt

2, Y. Al-Eryani

2, C. Öziç

3, N. Akcan

4, F. Uyar

1

1Dicle University, Diyarbakır, Turkey, [email protected], [email protected]

2Lund University, Lund, Sweden, [email protected], [email protected]

3Kafkas University, Kars, Turkey, [email protected]

4Siirt University, Siirt, Turkey, [email protected]

Aims and Scopes: Demand for industrial enzymes is constantly increasing due to the growing need for sustainable solutions [1]

Especially in recent years, using recombinant DNA technology, which is regarded as strategic area, enzyme production has reached to

great dimensions and its use has become widespread [2]. Bacillus subtilis ATCC 6051 was used in this study. Because of producing a

large amounts of α-amylase, known all genome structures and its being stable, it was used for cloning and purification. Although low

yield production of natural producer microorganism producing this enzyme uses recombinant DNA techniques that they are possible.

Materials and Methods: The genomic DNA of Bacillus subtilis ATCC 6051 was isolated and α-amylase gene was amplified by

PCR. The resulting PCR products were controlled in agarose gel and purity NanoDrop then was transferred to 3519 bp long pCR-

Blunt II TOPO cloning kit. pDG148 cloning vector plasmid was used in the 8274 bp long. PCR product from pCR-Blunt II TOPO

cloning kit cut with restriction enzymes HindIII and SphI and pDG148 cloning vector cut with the same enzymes to have been cloned.

Thus 10 244 bp long pDG148-Bs-amyE clone was obtained. For the gene expression, 6xhis tag relating pET16b was chosen as an

expression vector and amyE gene of the vector was transferred to Escherichia coli BL21(DE3) competent cells. Then the isolation

and purification of amylase protein was performed. For the purification, Ni-NTA agarose showed affinity of histidine was used. The

purified protein was confirmed to be correct protein with Western blot analysis. The estimated of three dimensional structure of

protein expressed by amyE gene responsible for amylase production was compared to amylase previously defined crystal structure

using SWISS-MODEL program.

Results and Discussion: Bioinformatics analysis of the cloned gene showed that 99% homology to Bacillus sp. amyE gene. These

result showed that targeted gene was cloned successfully. The molecular weight of purified protein was determined as 67 kDa by

SDS-PAGE. The estimated of amino acid sequence of protein expressed by AmyE gene was obtained using Genetool programme.

The protein was determined to consist of about 659 amino acid sequences. α-Amylase is the major enzyme with demand in starch

based industries, and therefore efforts should be made to explore biocompatible new microorganisms, plant, cereal etc. for the

efficient production of α-amylases at lower production cost and with high purity. The use of bacterial α-amylases has become more

widespread in recent years due to the highly optimised α-amylases constructed by means of protein engineering techniques. In this

study, Bacillus subtilis ATCC 6051 obtained from the α-amylase in today's enzyme which is suitable for industrial use in the existing

pool. It also will be the continuation of this work and activity tests industrial immobilization of the recombinant protein produced by

the operation biotechnology is thought to be an important place in the market.

Keywords: Bacillus subtilis, α-amylase, cloning, purification, western blot

References:

[1] Demain, A.L.; Adrio, J.L. 2008, 38: 41-45.

[2] Kıran, E.Ö.; Çömlekçioğlu, U., Dostbil N. 2006, 9(1): 12-19.

Acknowledgements: This study was financial supported by Dicle University Scientific Research Projects Coordination (Dicle

Üniversitesi Bilimsel Araştırma Projeleri Koordinatörlüğü, DÜBAP/13-FF-45)





33

IDDGC17-OP-123

CONTROLLED RELEASE OF DOXORUBICIN DRUG MOLECULES FROM CALIXARENE

INCLUSION COMPLEX STRUCTURE FOR CANCER THERAPY

Bahar YILMAZ, Berke Bilgenur KANDEMĠR, Tahir BAYRAÇ, Mevlüt BAYRAKCI

Bioengineering department,

Faculty of engineering, Karamaoğlu Mehmetbey University, TR-70100, Karaman, Turkey,

[email protected]

Aims and Scopes: Calixarenes (CLXs) are the supramolecules having different inner diameter cavity. These molecules are generally

water insoluble. Therefore, using of these compounds in biological applications is limited, but this problem can be dissolved by

addition of polar groups on calixarene skeleton. Phosphonated calixarenes (pCLX) are the most popular and water soluble molecules

for the biological applications. The aim of this study is to determine the molecular capsule effect of different water soluble calixarene

molecules with phosphate groups for the release of doxorubicin (DOX) antineoplastic drug from host-guest complex formation. (1, 2)


Synthesis

All compounds based on calixarene were synthesized according to the modified literature procedure. (2)

Cell culture applications

Breast cancer cell line MCF-7was grown in Dulbecco‘s modified Eagle medium (DMEM, Merck, 102568). For the determination of

viability, 10x103 cells were seeded in 96 well plates and allowed to grow for 48 hours. Then Alamar blue cell viability reagent (AB,

Thermo Fisher Scientific, DAL1100) was directly added to culture medium. The redox reaction, in which AB is reduced by the cells,

was measured by absorbance readings at 570 and 600 nm. The specific absorbance is calculated using the formula; (3)

Specific absorbance= OD570 – OD600


MCF-7 breast cancer cells were incubated with DOX loaded pCLX derivatives for 48 h. Cell viabilities were analyzed by AB

cytotoxicity test (Figure 1). While CLX derivatives alone showed slight decrease in cell viability, free DOX caused 80% inhibition.

DOX loaded pCLX derivatives showed slight decrease in viability because of the slow release nature of the CLX molecule. When

ATP was added to DOX loaded pCLXs, drug release was triggered and this caused a dramatic decrease in cell viability. Results reveal

that DOX loaded CLX derivatives could be used as controlled drug release system and this study has the potential to contribute to the

field of triggered controlled drug release system production.(3,4)

Figure 1: MCF 7 Alamar blue assay

Keywords: Phosphonated calixarene, Doxorubicin, MCF-7, Inclusion complex

References:

[1] Gutsche, C. D.; Lin, L. G. Tetrahedron 1986 42(6), 1633-1640.

[2] Bayrakcı, M.; Ertul, S.; Yilmaz, M. Journal of Chemical & Engineering Data 2011, 57(1), 233-239.

[3] Mikus, J.; Steverding, D. Parasitology international 2000, 48(3), 265-269.

[4] Abbott, A. Nature 2003, 424(6951), 870-872.




34

IDDGC17-OP-124

IMMUNOHISTOCHEMICAL DIAGNOSIS OF A DNA VIRUS (ILTV) IN NATURALLY INFECTED

LAYING HENS

Orhan YAVUZ

1, Özgür ÖZDEMĠR

2, Funda TERZĠ

2

1Aksaray University, Faculty of Veterinary Medicine, Department of Pathology Aksaray, TURKEY

[email protected] 2Selçuk University, Faculty of Veterinary Medicine, Department of Pathology, Konya, TURKEY

Aims and Scopes: In this study, naturally infected with a DNA virus, Infectious Laryngotracheitis Virus (ILTV) which causes

Infectious Laryngotracheitis (ILT) in laying hens to be diagnosed by pathological methods, and usability of immunohistochemical

(IHC) methods on diagnosis were investigated.

Materials and Methods: For this purpose, 60 pieces of hens were collected in 10 different commercial coops from Aksaray, Konya

and Afyonkarahisar province that is serologically positive with ILT. After necropsy, routine pathological processes were applied to

samples taken from larynx, trachea, sinuses, the lungs and air sacs [1]. All organs were also stained by the indirect immunoperoxidase

method and examined by light microscope [2].

Results and Discussion: Following the histopathological examination of the larynx and trachea, all cases were positive for ILT,

however in 47 cases (78.3 %) were positive by immunohistochemically. While 32 cases of sinuses and lungs have been found positive

by histopathology, in 17 cases was determined positive in air sacs. IHC results of these tissues, in 27 (45 %) cases of lungs, in 37

(61.6 %) cases of sinuses, in 30 (50 %) cases of air sacs were detected as positive. Positive reactions were observed, in mucous and

gland epithelia especially located at intracytoplasmic and rarely intranuclear. It was also observed in the cytoplasm of desquamated

and syncytial giant cell. Following these results, it is easily concluded that, immunoperoxidase method can usable for diagnose of the

ILT [3, 4]. So, firstly trachea and larynx, followed by sinus, air sacs and lungs can be examined for IHC diagnose. However, more

reliable diagnosis can be made using further molecular techniques such as PCR and in situ hybridization [5].

Keywords: DNA, ILT, immunohistochemistry, laryngotracheitis, laying hens.

Acknowledgements: This study funded by Aksaray University Scientific Research Projects Committee with project number 2015-045.

References:

[1] Luna, L. G. Manual of histologic staining methods of the armed forces institute of pathology, 3rd edn. McGraw-Hill, New York, NY, USA.

[2] Preis, I.S.; Fiúza, A.T.L.; Silva, C.C.I.; Braga, J.F.V.; Couto, R.M.; Martins, N.R. da S.; Ecco, R. Pathological, immunohistochemical, and

molecular findings in commercial laying hens and in backyard chickens naturally infected with the infectious laryngotracheitis virus, Rev. Bras.

Cienc. Avic, 2014, 16, 4, 359-366.

[3] Timurkaan, N.; Yılmaz, F.; Bulut, H.; Özer, H; Bolat, Y. Pathological and immunohistochemical findings in broilers inoculated with a low

virulent strain of infectious laryngotracheitis virus, J. Vet. Sci., 2003, 4, 2, 175-180.

[4] Abbas, F.; Andreasen Jr, J.R.Comparison of diagnostic tests for infectious laryngotracheitis, Avian Diseases, 1996, 40, 290-295.

[5] Crespo, R.; Woolcock, P.R.; Chin, R.P.; Shivaprasad, H.L.; Garcia, M. Comparison of diagnostics techniques in an outbreak of infectious

laryngotracheitis from meat chickens, Avian Diseases, 2007, 51, 4, 858-862.




35

IDDGC17-OP-125

AN ASSOCIATION BETWEEN TRP64ARG POLYMORPHISM OF THE B3 ADRENORECEPTOR

GENE AND FEMALE GENDER IN OBESE TURKISH CHILDREN AND ADOLESCENTS

Resul Yılmaz1, Ömer AteĢ

2, Ali Gül

1, Samet Özer

3, Emel Ensari

2

1Gaziosmanpasa University School of Medicine Department of Pediatrics, Tokat, Turkey

2 Gaziosmanpasa University School of Medicine Department of Medical Biology and Genetics, Tokat, Turkey

3Memorial Hospital, Clinic of Pediatrics, Kayseri, Turkey

Email of author for contact: [email protected]

Aims and Scopes: The obesity prevalence in childhood has increased dramatically worldwide over the past 30 years.[1] The β3-

adrenergic receptor is expressed in visceral adipose tissue and is thought to contribute to lipolysis, energy metabolism and regulation

of the metabolic rate. This mutation has been reported to be associated with diabetes mellitus abdominal, obesity, insulin resistance

and the basal metabolic rate. [2, 3] In this study, we aimed to investigate the association of W64R polymorphism of the β3-adrenergic

receptor gene (β-3AR) in children with obesity and related pathologies.

Materials and Methods: β-3AR gene W64R genotyping was carried out in 441 children aged 6-18 years. Of these subjects, 262 were

obese (103 boys) and 179 were normal-weight (81 boys). In the obese group, fasting lipids, glucose, insulin levels and blood pressure

were measured. MS was defined according to the modified WHO criteria adapted for children.[4, 5]

Results and Discussion: The frequency of W64R genotype was similar in obese and normal weight children. In obese children,

serum lipid, glucose and insulin levels, as well as homeostasis model assessment of insulin resistance (HOMA-IR) scores and

metabolic syndrome were not different between Arg allele carriers (W64R) and noncarriers (W64W). In 262 obese children, genetic

analysis results showed that Arg allele carriers had significantly higher in girls than boys (p=0.001). In normal weight group there is

no statistically significant difference between boys and girls (p=0,771).

W64R polymorphism of the β-3AR gene is not associated with obesity and metabolic syndrome in Turkish children and adolescents.

Although there were no relationships between the genotypes and lipid, glucose/insulin levels or HOMA-IR, the presence of W64R

variant is seen more frequent in obese girls, which has an unfavorable influence onset of weight gain and difficulty in losing weight in

women. [6, 7]

Keywords: Obesity, children, β3-adrenergic receptor gene polymorphism, gender, metabolic syndrome

References:

[1]Güngör NK. Overweight and obesity in children and adolescents. J Clin Res Pediatr Endocrinol. 2014;6(3):129-43.

[2]Tamaki S, Nakamura Y, Tabara Y, Okamura T, Kita Y, Kadowaki T, et al. Relationship between Metabolic Syndrome and Trp64Arg

Polymorphism of the beta3-Adrenergic Receptor Gene in a General Sample: The Shigaraki Study. Hypertension research. 2006;29(11):891.

[3]Mirrakhimov AE, Kerimkulova AS, Lunegova OS, Moldokeeva CB, Zalesskaya YV, Abilova SS, et al. An association between

TRP64ARG polymorphism of the B3 adrenoreceptor gene and some metabolic disturbances. Cardiovascular diabetology. 2011;10(1):89.

[4]Goodman E, Daniels SR, Morrison JA, Huang B, Dolan LM. Contrasting prevalence of and demographic disparities in the World Health

Organization and National Cholesterol Education Program Adult Treatment Panel III definitions of metabolic syndrome among

adolescents. The Journal of pediatrics. 2004;145(4):445-51.

[5]Sangun Ö, Dündar B, KöĢker M, Pirgon Ö, Dündar N. Prevalence of metabolic syndrome in obese children and adolescents using three

different criteria and evaluation of risk factors. J Clin Res Pediatr Endocrinol. 2011;3(2):70-6.

[6]Shiwaku K, Nogi A, Anuurad E, Kitajima K, Enkhmaa B, Shimono K, et al. Difficulty in losing weight by behavioral intervention for

women with Trp64Arg polymorphism of the β3-adrenergic receptor gene. International journal of obesity. 2003;27(9):1028-36.

[7]Masuo K, Katsuya T, Fu Y, Rakugi H, Ogihara T, Tuck ML. β2-and β3-adrenergic receptor polymorphisms are related to the onset of

weight gain and blood pressure elevation over 5 years. Circulation. 2005;111(25):3429-34.




36

IDDGC17-OP-126

CLONING and CHARACTERIZATION OF α-AMYLASE from Bacillus circulans ATCC 61

A.J. Tawfiq1, B. Serin

1, C. Öziç

2, N. Akcan

3, F. Uyar

1

1Dicle University, Diyarbakır, Turkey, [email protected], [email protected], [email protected]

2Kafkas University, Kars, Turkey, [email protected]

3Siirt University, Siirt, Turkey, [email protected]

Aims and Scopes: Amylases are one of the most important and oldest industrial enzymes [1]. The α-amylase gene cloning,

characteristics, high level production are made for enzyme engineering and expression [2]. For commercial purposes, α-amylases are

mainly derived from the genus Bacillus [3]. In this study using Bacillus circulans ATCC 61, it can produce an α-amylase, but the

amount of the enzyme is low. We increased amount of this enzyme by cloning and expressing its gene, will permit study of these

interesting characteristics and properties of amylase which is produced by the transformed bacterium.

Materials and Methods: In the present work, Bacillus circulans ATCC 61 for 𝛼-amylase production has been used. Because well

known as a good producer of 𝛼-amylase and its genome structures has been known, it was used for cloning for this purpose, the

genomic DNA of Bacillus circulans ATCC 61 was isolated and the gene encoding α-amylase enzyme was amplified with specific

primer by PCR consist of 1400 bp long. The specific primer was designed while detecting the gene belonging to Bacillus α-amylase

from gene library. The gel-purified PCR product was inserted into the pGEM®-T Easy vector 3015 bp long, which linearized vectors

with a single 3´-terminal thymidine at both ends. The T-overhangs at the insertion site greatly improve the efficiency of ligation of A-

tailing on the PCR products. Taq DNA polymerase independently generates single deoxyadenosine at both ends of PCR product.

Finally for the gene expression, the vector was transferred to JM109 high efficiency E. coli competent cells.

Results and Discussion: Bioinformatics analysis of the cloned gene showed that there is 100% similarity between this gene and

amylase gene of Bacillus sp. These results display that the target gene was cloned successfully. Various physiological and

biochemical characteristics of the different sectors with α-amylase enzyme with the demands of the new features requires the search

and development. α-amylase in recent years is widely used in large scale production of microorganisms. Although low yield

production of natural producer microorganism producing this enzyme uses recombinant DNA techniques that they are possible. This

study is the first record in term of the cloning α- amylase enzyme from Bacillus circulans ATCC 61 in the literature.

Keywords: Cloning, Characterization, Bacillus circulans ATCC 61, α- amylase

References:

[1] Gupta, R.; Gigras, P.; Mohapatra, H.; Goswami, V.K.; Chauhan, B. 2003, Microbial α- amylases: a biotechnological perspective. Process

Biochemistry, 38: 1599-1616.

[2] Pandey, A.; Nigam, P.; Soccol, C.R.; Soccol, V.T.; Singh, D.; Mohan, R. 2000. Advances in microbial amylases (review article). Biotechnology

and Applied Biochemistry, 31: 135-152.

[3] Hmidet, N.; Maalej, H.; Haddar, A.; Nasri, M. 2010. A novel α-amylase from Bacillus mojavensis A21: purification and biochemical

characterization. Applied biochemistry and biotechnology, 162(4), 1018-1030.






37

IDDGC17-OP-127

MONITORING THE MICROBIAL DIVERSITY OF SULUSARAY HOT SPRING BY NEXT

GENERATION SEQUENCING.

Bilge Hilal Cadirci, Huseyin Anil Diblen, Melis Cakdinleyen

Department of Bioengineering Gaziosmanpasa University, Tokat Turkey

[email protected]

Aims and Scopes: Sulusaray hot spring is one of the important balneotherapy center in Tokat. Even there are some studies with

culturable microbial diversity of the hot springs, it is well known that, it illustrates just 0.1 percent of the total diversity. In this study,

total microbial diversity was showed by metagenomics next generation sequencing.

Materials and Methods: Total isolated DNA was ampified by 16s universal Eubacterial primers. Amplicon are sequenced by using

next generation technology (bTEFAP®) which has been adapted for utilizing the Ion Torrent PGM chemistry following

manufacturer‘s protocols [1,2]. The Q25 sequence data derived from the sequencing process was processed using a proprietary

analysis pipeline. Operational taxonomic units were defined after removal of singleton sequences, clustering at 3% divergence (97%

similarity) [2-6]. OTUs were then taxonomically classified using BLASTn against a curated GreenGenes/RDP/NCBI derived database

[7]. Statistical analysis was performed using a variety of computer packages including XLstat, NCSS 2007, ―R‖ and NCSS 2010.

Alpha diversity analysis was conducted by using Qiime (www.qiime.org) [2-6]. Significance reported for any analysis is defined as

p<0.05.

Results and Discussion: After stringent quality sequence curation a total of 236186 sequences were parsed and 225220 were then

clustered. 225078 sequences identified within the Bacteria domain were utilized for final microbial analyses. The average reads per

sample was 112539. For alpha and beta diversity analysis samples were rarefied to 30000 sequences and bootstrapped at 25000

sequences. The Shannon-Wiener Index curve plot reaches a plateau at approximately 5000 sequences indicating that sequencing

depth was sufficient to capture the full scope of microbial diversity. Sequence analysis results revealed that the hot spring contains

bacteria from the classes Proteobacteria, Bacteriodes, Chloroflexi, Deinococcus-Thermus and Cyanobacteria and fungi from the

family Ascomycota.

Keywords: Next generation sequencing, Hot spring, Sulusaray

Acknowledgements: This project was supported by TUBITAK with 215M161 project number.

References:

[1] Callaway TR, Edrington TS, Brabban A, Kutter B, Karriker L, Stahl C, et al. Foodborne Pathog Dis. 2011, 8, 261–6

[2] Dowd, S.E., Sun, Y., Wolcott, R.D., Domingo, A., and Carroll, J.A. Foodborne Pathog. Dis, 2008, 5, 459– 472.

[3] Dowd, S. E., T. R. Callaway, et al. BMC Microbiol 2008, 8: 125.

[4] Edgar, R. C. Bioinformatics 2010, 26, 2460-2461.

[5] Eren, A. M., M. Zozaya, et al. PLoS One 2011, 6(10): e26732.

[6]Swanson, K. S., S. E. Dowd, et al. ISME J 2011, 5, 639-649.

[7] DeSantis, T. Z., P. Hugenholtz, et al. Appl Environ Microbiol 2006, 72, 5069-5072.

http://www.qiime.org/




38

IDDGC17-OP-128

ITS GENE REGION POLYMORPHISMS OF MALOPE MALACOIDES

L. (MALVACEAE)

Meltem MARAġ ATABAY1,Seçil TAN

2, Aysel KEKĠLLĠOĞLU

3, Kemal YILDIZ

2

1 Bülent Ecevit University, Faculty of Education ,Department of Mathematics and Science Education, Section of Science Education,

Kdz Ereğli, Zonguldak, Turkey,[email protected]

2 Celal Bayar University, Institute of Science, Department of Biology Manisa, Turkey;

3 NevĢehir Hacı BektaĢ Veli University, Institute of Science, Department of Biology, NevĢehir, Turkey,[email protected]

Email of author for contact

Aims and Scopes: This study, is a molecular research about perennial semi-woody[1] Malope malacoides L. (Malvaceae), as there

is no special study on DNA characteristics of this species in our country. Therefore, aim of the study, is to investigate ITS region of

DNA isolated from seed of M. malacoides.

Materials and Methods: Seeds to be used for DNA isolation were maturely collected in İzmir area, which is located to the west of

our country and is affected by Mediterranean climate. Nuclear ITS (Internal transcribed sequence) gene region was amplified from the

seed of Malope malacoides Nuclear ITS region of DNA was amplified using the polymerase chain reaction. Polymorphisms in ITS

gene were determined by sequence analysis method.

Results and Discussion: This gene region is about ITS1 250 bp, ITS2 250 bp, total 500 bp in length was determined by agarose gel

electrophoresis. ITS1 contributed 158 informative characters while ITS2 had 222. Sequences that did not have conserved regions

were considered to be pseudogenes .

Keywords: Malope malacoides, ITS1, ITS2, gene polymorphism.

References:

[1] García, P. E.; Schönswetter, P; Aguilar, J. F.; Feliner, G. N.; Schneeweiss, G. M. (2009) Five molecular markers reveal extensive morphological

homoplasy and reticulate evolution in the Malva alliance (Malvaceae) Molecular Phylogenetics and Evolution 50 226–239.




39

IDDGC17-OP-129

A study on the genetic diversity of Leiurus abdullahbayrami Yağmur et al. 2009 (Scorpiones: Buthidae)

from Turkey

Hüseyin Ayhan1, Erol Atay

2, Ahmet Çarhan

3, Ersen Aydın Yağmur

4, Özcan Özkan

5 & Bekir Çelebi

6

1 Yıldırım Beyazıt University, Vocational High School of Health Services Çubuk, Ankara, Turkey

e-mail: [email protected] 2Mustafa Kemal University, Faculty of Science, Biology Department, Zoology Section Hatay, Turkey

3Yıldırım Beyazıt University, Medical Faculty Ankara, Turkey : e-mail : [email protected]

4Celal Bayar University, Vocational High School AlaĢehir, Manisa, Turkey

5Karatekin University, Faculty of Science, Biology Department, Zoology Section Çankırı, Turkey

6Turkish Public Health Institute, Ankara, Turkey

Abstract

Mitochondrial DNA (mtDNA) has been widely employed in phylogeographic and phylogenetic studies. In the present study, the

genetic identification of the scorpion Leiurus abdullahbayrami Yağmur et al. 2009 was carried out by using the 16S mitochondrial

gene. The sequence data were compared with the data in GenBank. A phylogenetic tree was constructed based on nucleotide sequence

data. As regards the obtained nucleotide sequence, the morphologic-taxonomic studies of the species Leiurus abdullahbayrami were

confirmed by genetic data. Nucleotide variations found in the current work constitute the first descriptive report for L.

abdullahbayrami.

Keywords: L.abdullahbayrami, Genotype, Molecular phylogeny, Turkey


The scorpions were collected by digging their nests and under the stones during day time and by using UV lamps at night and they

were kept in 75-96% ethanol. The study was carried out on the mtDNA isolated from the leg tissue of the scorpions. The DNA was

isolated from the fresh leg muscle tissue preserved in 96% ethanol by using GeneAll genomic DNA extraction kit (Seoul, South

Korea) and standard phenol/chloroform method (Sambrook, Fritschi & Maniatis, 1982).

Figure: The color variations among populations in Leiurus abdullahbayrami: A. Hatay province, B. Şanlıurfa province, C. Adıyaman (Yağmur et

al., 2009).

References:

1. Yağmur, E.A., Koç H., Kunt K.B. 2009. Description of a New Species of Leiurus Ehrenberg, 1828 (Scorpiones: Buthidae) from

Southеastеrn Turkey. Euscorpius, No. 85.6. Kaestner, A. 1967. Invertebrate Zoology. Volume I. Interscience Publishers. A Division

of John Wiley and Sons. p. 597. New York, London, Sydney.

2. Sambrook, J., Fritschi E.F., Maniatis T. 1982. Molecular cloning: a laboratory manual. New York: Cold Spring Harbor Laboratory

Press: 545 p.

8 Sudhir K., Glen S., Koichiro T.; MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol Biol

Evol 2016; 33 (7): 1870-187410. Michalsen A, Roth M, Dobos G, Aurich M. Stattgurt, Germany: Apple Wemding; 2007. Medicinal

Leech Therapy.





40

IDDGC17-OP-130

Title: Association between allergic conjunctivitis and cytokine related genetic polymorphisms in a pediatric

population

Orders of Authors: Selim Demir,MD1; Raşit Kılıç,MD

2; Ömer Ateş, PhD

3; İsmail Benli,PhD

4; Sait

Alim,MD1; Tülay Karacan Erşekerci,MD

5; Alper Güneş,MD

1

Institution of the Authors: Gaziosmanpaşa University Faculty of Medicine, Department of Ophthalmology1,

Department of Medical Biology3, and Department of Biochemistry

4, Tokat, Turkey.

2Ahi Evran University Faculty of Medicine, Department of Ophthalmology, Kırşehir, Turkey.

5Darende State Hospital, Department of Ophthalmology, Malatya, Turkey.

Financial support: This study was supported by the academic research foundation of Gaziosmanpaşa

University, Tokat, Turkey (project no: 2013-07).

Corresponding author:

Assist. Prof. Dr. Selim Demir

Gaziosmanpasa University Faculty of Medicine, Department of Ophthalmology, Tokat, Turkey

Phone: +903562129500/ 1082 Fax:+903562133179 e-mail: [email protected]

Abstract

Objectives: Cytokines play important role in inflammatory and allergic diseases. Recent studies have

demonstrated that IL-4 and IL-10 single nucleotide polymorphisms (SNPs) are associated with allergic diseases

such as asthma or allergic rhinitis. Therefore, we aimed to evaluate the possible association between these SNPs

and allergic conjunctivitis including seasonal allergic conjunctivitis (SAC) and vernal keratoconjunctivitis

(VKC) in a pediatric population.

Material and Methods: A case-control association study of 108 patients with allergic conjunctivitis (69 SAC

and 39 VKC) and 95 controls were recruited. IL-4-590C/T (rs2243250), IL-10-592C/A (rs1800872), IL-10-

819C/T (rs1800871), and IL-10-1082G/A (rs1800896) SNPs were evaluated by real-time polymerase chain

reaction-based DNA analysis. The frequency of alleles and distribution of genotypes were assessed by the chi-

squared test.

Results: All studied polymorphisms satisfied Hardy-Weinberg equilibrium. Age and sex distributions were

similar between the patients and control groups (p>0.05). There were no significant differences between

patients and controls in the distributions of genotype and allele frequencies of the studied SNPs (p>0.05).

Conclusion: In this study, there was no association of the analyzed SNPs located in IL-4 and IL-10 with

allergic conjunctivitis, suggesting that SNPs included in our study have no significant role in causing allergic

conjunctivitis in the pediatric population.

Keywords: Allergic conjunctivitis, interleukin 4, interleukin 10, single nucleotide polymorphism.




41

IDDGC17-OP-131

INVESTIGATION OF THE EFFECT OF BETATROPHIN HORMONE LEVELS ON

CARBOHYDRATE AND LIPID METABOLISM IN MICE WITH INDUCED INSULIN RESISTANCE

Funda Bulut Arıkan1, Mustafa UlaĢ

2, Yasemin Üstündağ

3, Hakan Boyunağa

4, Nermin Dindar Badem

5

1 Kırıkkale University, Faculty of Medicine, Department of Medical Biology, Kırıkkale

, Turkey.

2 Fırat University, Faculty of Medicine, Department of Physiology, Elazığ, Turkey. Email: [email protected]

3 Expert Veterinarian.

4,5 Kırıkkale University Faculty of Medicine, Medical Biochemistry Department, Kırıkkale

, Turkey.

Aims and Scopes: Betatrophin is a recently identified hormone that is produced in the liver and adipose tissue and its effects and

association with carbohydrate and lipid metabolism is yet undefined. This study aimed to investigate the effects and relationship of

this hormone with carbohydrate and lipid metabolisms by using key enzymes in the metabolic pathways.

Materials and Methods: Twenty C57BL6/J male mice that were 8 weeks old were included in the study. Subjects were split into

experimental and control groups each including 10 test subjects. Insulin resistance was induced with S961, which is as an insulin

antagonist was administrated subcutaneously via osmotic pump (10nm/week) in the experimental group, while control groups

received phosphate buffered saline using the same technique. One week after the administration of S961, blood and liver tissue

samples were collected from mice under general anesthesia. Serum samples that were obtained from collected blood were used for

enzyme linked immonusorbent assay (ELISA) and spectrophotometer tests to identify biochemical parameters such as serum

betatrophin, fasting blood glucose, postprandial blood glucose, insulin, triglyceride total cholesterol, HDL and LDL cholesterol.

Tissue samples were used for the identification of hepatic expression levels of betatrophin, lactate dehydrogenase 5 (LDH5), citrate

synthase and acetyl CoA carboxylase 1 (ACC1).

Data obtained from the control and experimental groups were evaluated statistically using independent samples t-test and Mann

Whitney U. Pearson and Spearman tests were used for the evaluation of correlations between betatrophin hormone levels and other

parameters.

Results and Discussion: Statistically significant increases were observed in the betatrophin expression, serum betatrophin, fasting

and postprandial blood glucose, total cholesterol and triglyceride levels in the experimental group when compared to control group.

Citrate synthase gene expression was determined to be significantly higher in the control group (p<0,05). High correlation was found

between betatrophin hormone expression and serum levels and serum triglyceride levels (betatrophin expression r=0,751; betatrophin

serum r=0,686; p<0,05).

It was concluded that betatrophin hormone levels may have an important role in the regulation of triglyceride. Also it may be inferred

that betatrophin hormone does not regulate carbohydrate and lipid metabolism via ACC1, LDH5 and citrate synthase. Additionally,

through the present study, foreknowledge was obtained regarding the relationship between betatrophin hormone levels and aerobic

and anaerobic respiration pathways.

Keywords: Betatrophin, Metabolism, Carbohydrate, Lipid.

http://tureng.com/tr/turkce-ingilizce/triglyceride

http://tureng.com/tr/turkce-ingilizce/independent%20samples%20t-test







42

IDDGC17-OP-132

Title: Association between Behçet‘s disease and genetic polymorphisms of mannose-binding lectin in a Turkish population

Orders of Authors:; Ayşe Kevser Demir,MD1; Ömer Ateş, PhD

2; Jülide Altunışık, PhD

3; Nihan Bozkurt,PhD

2; Saime Sezer,MD

2;

Selim Demir,MD4

Institution of the Authors: Gaziosmanpaşa University Faculty of Medicine, Department of Internal Medicine1, Department of Medical

Biology2, and Department of Ophthalmology

4 Tokat, Turkey.

3Balıkesir University Faculty of Medicine, Department of Medical

Biology3, Balıkesir, Turkey.

Objectives: Behçet‘s disease (BD) is a recurrent multisystem inflammatory disease characterized by oral and genital mucous ulcer,

skin and ocular lesions and less frequently arthritis, vasculitis and neurologic manifestations. Mannose-binding lectin (MBL)-2

genetic variations result low MBL serum levels and insufficient opsonization capacity and exon-1 allelic variants have been shown to

be associated with increased risk of infection. We aimed to investigate the MBL2 polymorphisms that may lead to innate immune

defense defects in Turkish BD patients.

Material and Methods: A case-control association study of 102 patients with BD and 102 controls were recruited. The MBL2

polymorphisms including exon 1 coding region (codon 52, codon 54, codon 57) and the promoter region (H/L, X/Y, and 5‘-UTR +4

P/Q polymorphisms) were studied by PCR analysis. Statistical anaysis was performed by OpenEpi Info software package program

(www.openepi.com). The frequency of alleles and distribution of genotypes were assessed by the chi-square or Fischer‘s exact test.

Results: The most common complaints of BD patients in our group were ocular involvement (38%), deep vein thrombosis (31%) and

mucocutaneous disease (31%). The distribution of PP, PQ, and QQ genotypes for the point mutation in the MBL gene 5‘ untranslated

(UT) region at position +4 (P/Q variants) was 42.1% (43), 56.8% (58) and 0.98% (1) in BD compared with 79.4% (81), 20.5% (21)

and 0% (0) in the controls. The allele frequency of P/Q was 70.5% (144), and 29.4% (60) in BD compared with 89.7% (183), and

10.2% (21) in the controls. A significant difference was found between genotypes (p=0.000) and alleles (p=0.0001) of MBL2 gene 5‘

untranslated (UT) region at position +4 (P/Q variants) in patients and controls (p<0.0001, OR 0.28; 95% CI 0.16-0.47 ). There were

no significant differences between BD and controls in the distributions of genotype and allele frequencies of the MBL promoter G-

550C (H/L variants), MBL promoter G-221C variant, MBL2 codon 52, MBL2 codon 54 or MBL2 codon 57 (p>0.05).

Conclusion: MBL2 genetic polymorphisms that have roles in immune responses to infections may give rise to the susceptibility to

BD. In the present study, except MBL2 C+4T (P/Q) genetic variation, no polymorphism of the MBL2 gene was found to be

associated with the presence of BD.

Keywords: Behçet‘s disease, Mannose-binding lectin 2, MBL2 C+4T (P/Q), single nucleotide polymorphism.




43

IDDGC17-OP-133

EFFECT OF WATER SOLUBLE CALIX[N]ARENE DERIVATIVES ON BIOFILM FORMATION

Berke Bilgenur Kandemir, Bahar Yılmaz, Abdullah Tahir Bayraç, Mevlüt Bayrakcı

Department of Bioengineering, Faculty of Engineering, Karamanoğlu Mehmetbey University, Karaman, Turkey

Aims and Scopes:

Most of the bacteria species live in a matrix enclosed bacterial populations named as biofilms [1]. These biofilms can become

hundreds of microns in depth, thus are difficult to be destroyed using antibiotics. Functionalized calixarene (CLX) derivatives were

shown to display antibacterial effect on both gram positive and gram negative bacteria [2]. In addition, due to 3D basket like shape of

them, water soluble Calixarene derivatives were being used in drug delivery studies for controlled drug release [3]. Doxorubicin

(DOX) is an anthracyclin antibiotic and it was reported to inhibit FtsZ functions of Escherichia coli (E. coli), thus cause failure in cell

division [4]. In this study, a controlled DOX release was aimed to be achieved using antibacterial CLX derivatives in order to inhibit

growth of E. coli and S. pneumoniae and their biofilm formation efficiency.


Phosphonate and sulfonate Calix[4,6,8]arenes (pCLX4, pCLX6, pCLX8 and sCLX4, sCLX6, sCLX8, respectively) were incubated

with DOX for 24 h in CLX:DOX; 50:1 (v/v) ratio. Liquid cultures were prepared from single colonies of E.coli and S. pneumoniae

(OD600=0.1). DOX loaded CLX derivatives (DOX-CLX: DOX, 20 µM; CLX, 1000 µM) were added separately into each culture.

Cultures were incubated for 11 h and OD600 were measured in every hour. Bacterial growth curves were constructed according to the

data. Inhibitory effect of DOX-CLX on S.pneumoniae biofilm formation was tested using methylene blue spectrophotometric assay.


For both DOX-CLX treated E.coli and S.pneumoniae cultures, bacterial growth inhibition was achieved in a longer range when

compared to direct DOX exposure (Figure 1). Among whole CLX derivatives CLX8 showed highest prolonged release, and inhibited

both bacterial growth and biofilm formation.

Figure 1: A) E.coli and B) S.pneumoniae growth curves in presence of DOX-CLX and empty CLX.

C) Biofilm formation of S.pneumoniae bacteria treated with various DOX-CLX and empty CLX.

Keywords: Calixarene, doxorubicin, antibacterial effect, biofilm formation

References:

[1] Pratt L.A.; Kolter R.; Molecular Microbiology 1998, 30(2), 285-293.

[2] Nimse, S. B., Kim, T. Chemical Society Reviews 2013, 42(1), 366-386.

[3] Zhou, Y.; Li, H.; Yang, Y. Chinese Chemical Letters 2015, 26.(7), 825-828.

[4] Panda, P.; Taviti A. C.; Satpati S. et al. Biochem. J. 2015, 471, 335-346.

Ab

sorb

an

ce (

λ=

600 n

m)

Time (h)

E.coli

Dox

pCLX8

DOX -

pCLX8

% B

iofi

lm

Fo

rma

tio

n

A B




44

IDDGC17-OP-134

GENOMIC SELECTION IN LIVESTOCK

Serdar GENC1, Ugur SEN

1, Emre SIRIN

1, Murat KARAAGAC

1

1Ahi Evran University, Department of Agricultural Biotechnology, Kirsehir, Turkey

Molecular biotechnology is constantly evolving and one of the most widely used methods in genetic studies in recent years.

Advances in this area have allowed identifying new gene regions and determining what features they have. Classical breeding of

economically important and desire production traits (meat, milk, egg etc.), which are quantitative character and affected by multiple

gene regions, have cost and takes a long time in most of species of farm animals. Additionally, the reliability of the statistical

assessment can be affected due to the high environmental impact on the quantitative characters. Recently, the animals to be used in

the breeding are not subjected to long breeding programs (progeny test) with determination of gene regions of productivity

characteristics in livestock and also studies on these applications is accelerating day by day. The selection process according to

genomic breeding value in farm animals is called "genomic selection". Using DNA markers to increase genetic gain progression in

livestock has existed for a long time and these methods have begun to become a part of animal breeding with developing technology.

The effects of genomic selection in livestock can be determined by methods such as QTL (quantitative trait locus), SNP (single

nucleotide polymorphism), Microarray Technique and Bayes Model. Genomic selection is thought to contribute significantly to

improvement of genetic gain in farm animals. As a result, with these methods, the genetic capacities of animals can be increased in a

shorter term and a significant contribution can be made to the national economy. This work was supported by the Ahi Evran

University Scientific Research Projects Coordination Unit. Project Number: ZRT.E2.17.016.

Key Words: Animal Breeding, Genomic Selection, Single Nucleotide Polymorphism, Microarray




45

IDDGC17-OP-135

PERFORMANCE COMPARISON OF STATISTICAL AND ARTIFICIAL INTELLIGENCE-BASED

METHODS ON PREDICTION OF COLON CANCER BY USING MICROARRAY GENE

EXPRESSION LEVELS

Mustafa Turan Arslan1, Derya Arslan

2

1Mustafa Kemal University, Kırıkhan Vocational School, Hatay, Turkey

2Iskenderun Technical University, Faculty of Engineering and Naturel Sciences, Hatay, Turkey

[email protected], [email protected]

Aims and Scopes:

A multidisciplinary science, which is called bioinformatics, has emerged as a result of the interaction of molecular biology and

computer science Owing to the technological developments in this field, DNA microarray technology has been developed in order to

help the process on diagnosing the diseases caused by genetic factors. In this study, we compare the performances of statistical and

artificial intelligence-based methods to predict colon cancer disease from microarray gene expression levels.


Colon Cancer Microarray Gene Expression Data: Colon cancer dataset, provided by Alon and his friends [1] contains the expression

levels of 2000 genes. This dataset contains totally 62 samples collected from colon cancer patients. Among them, 40 tumor biopsies

are from tumors (labelled as "negative") and 22 normal (labelled as "positive") biopsies are from healthy parts of the colons of the

same patients.

Artificial Neural Networks (ANN): Artificial Neural Networks, inspired by biological neural networks, consists of processors which

are linear or non-linear connected to each other. An artificial neuron basically composes of five parts as inputs, weights, total

function, transfer function and outputs [2-5].

Support Vector Machine (SVM): SVM, proposed by Vapnik [6] in the late 1960s, is a statistical algorithm. The working principle of

this algorithm is based on estimating the optimal decision function which can separate two group from each other.

Bayesian Network (BN): BN is a well-known probabilistic graphical model classifier based on Bayesian theorem. This method

consists of two parts such as estimator and search algorithm [7].


In this study, Bayesian Networks (BN) and Support Vector Machines (SVM) are used as statistical methods, and then the Artificial

Neural Networks (ANN) are preferred as an artificial intelligence-based method for the process on predicting colon cancer disease

from the microarray gene expression levels. According to obtained results, the success rates coming from BN and SVM are

respectively determined as 75.81% and 82.26%, and ANN has reached the performance of success as 83.87%. It has seen that ANN

which is artificial intelligence-based method is more successful than statistical methods such as BN and SVM on colon cancer.

Keywords: Microarray, gene expression levels, statistical methods, artificial intelligence-based methods

References:

[1] Alon, U.; Barkai, N.; Notterman, D. A.; Gish, K.; Ybarra, S.; Mack, D.; Levine, A. J. Proceedings of the National Academy of Sciences,

1999, 96(12), 6745-6750.

[2] Bishop, C.M. Neural Networks for Pattern Recognition, Oxford Unv. Press, NY, 1995.

[3] Duda, R.O.; Hart, P.E.; Stork, D.G. Pattern Classification, John Wiley& Sons, 2.edition, 2001.

[4] Hecht-Nielsen, R. Neural Networks, IJCNN International Joint Conference, 1: 445–448, 1989.

[5] Yu, C. C.; Liu, B. D. Proceedings of the 2002 International Joint Conference on, 2002, 2, 1218-1223.

[6] Vapnik, V. N.; Vapnik, V. Statistical learning theory, 1998, 1.

[7] Friedman, N.; Geiger, D.; Goldszmidt, M. Machine learning, 1997, 29(2-3), 131-163.






46

IDDGC17-OP-136

HOW TO CHOOSE WATER BOX TYPE WISELY IN MOLECULAR DYNAMICS SIMULATIONS

OF PROTEINS?

Mustafa Tekpinar1, Ibrahim Anbar

1

1Yuzuncu Yil University, Kampus, 65080, Van, Turkey

Email: [email protected]

Aims and Scope: Molecular dynamics simulations are widely used to understand dynamics of proteins in nanoseconds to

microsecond time regime. Number of atoms in a simulated system has a huge impact on computational performance. In explicit

solvent simulations, number of solvent atoms exceeds number of protein atoms. As a result, various water box types such as cubic,

rhombic dodecahedral, triclinic and octahedral box types have been proposed to reduce computational burden stemming from solvent

atoms. Since water box type is an important parameter on simulation wall-times, we investigated how water box type influences

computational performance of protein molecular dynamics simulations.

Materials and Methods: We used 25 protein pairs, each pair having a compact and an extended conformation. The test set includes

proteins from 100 residues to 1000 residues. These proteins were inserted into cubic, rhombic dodecahedral, triclinic, and octahedral

water boxes to understand influence of water box type on computation performance. Minimum distance between the solute and the

solvent was 10 Å. Gromacs 5.1.4 program package was used for all molecular dynamics simulations [1]. Amber99SB-ILDN force

field and TIP3P water model were preferred for all simulations [2, 3]. Particle Mesh Ewald (PME) method was employed for

electrostatic calculations [4]. All production simulations were carried out under NPT ensemble for 1 nanosecond with periodic

boundary conditions.

Results and Discussion: Our results show that both the number of residues and shape of a protein should be considered when

selecting water box type. We observed that water box type choice does not have a significant impact on computational performance of

small globular proteins. However, it has a serious impact on large proteins and, therefore, it should be selected wisely.

Keywords: Molecular dynamics, water box type, proteins.

References:

[1] Pall, S.; Abraham, M. J.; Kutzner, C.; Hess, B.; Lindahl, E. Solving Software Challenges for Exascale 2015, 8759, 3-27.

[2] Lindorff-Larsen, K.; Piana, S.; Palmo, K.; Maragakis, P.; Klepeis, J. L.; et al. Proteins-Structure Function and Bioinformatics 2010, 78, 1950-8.

[3] Jorgensen, W. L.; Chandrasekhar, J.; Madura, J. D.; Impey, R. W.; Klein, M. L. Journal of Chemical Physics 1983, 79, 926-35. [4] Darden, T.; York, D.; Pedersen, L. Journal of Chemical Physics 1993, 98, 10089-92.




47

IDDGC17-OP-137

MOLECULAR PHYLOGENY OF THREE NEW RECORDS OF MELANOLEUCA PAT. SPECIES IN

TURKEY

Ayten Dizkırıcı Tekpınar1, AyĢenur Kalmer

1, Ġsmail Acar

2, Yusuf Uzun

3

1Yuzuncu Yil University Department of Molecular Biology and Genetics, Van, Turkey

2Yuzuncu Yil University BaĢkale Vocational High School Department of Organic Agriculture, Van, Turkey

3Yuzuncu Yil University Faculty of Pharmacy Department of Pharmaceutical Sciences, Van, Turkey

[email protected]

Aims and Scopes: Melanoleuca Pat. (Tricholomataceae) is a character-poor genus with many macroscopically similar species. Therefore, in addition to

morphological characters, molecular data should be used to figure out phylogenetic relations and taxonomical positions of the species.

In the present study, three new records species of Melanoleuca (M. communis, M. dryophila and M. heterocystidiosa) were collected

from Hakkari province and characterized by using morphological characters. After that, DNA sequence data of the Internal

Transcribed Spacer (ITS) region was analysed to understand their phylogenetic positions.The main aim of the current study was to

understand phylogenetic relationships and taxonomic postions of newly reported three Melanoleuca species in Turkey. To increase

the interspecific sampling and be sure our outcomes, sequences from earlier investigations were retrieved from GenBank and added to

the analyses.


Total DNA was isolated from dried specimen by using the cetyltrimethylammonium bromide (CTAB) method [1]. ITS nrDNA region

was amplified with specific primer pair [2] and the amplicons were used to get clear DNA sequences. All sequences getting from

present study and downloaded from database were aligned together with the aid of the program ClustalX [3]. Phylogenetic tree was

constructed based on nucleotide variations in the sequences via the Maximum Likelihood (ML) method based on the Tamura-Nei

model and bootstrap analysis with 500 replications (MEGA 5; [4]).


ITS data matrix comprised a total of 33 sequences (including 30 from GenBank). DNA sequences of M. communis, M. dryophila and

M. heterocystidiosa were intentionally downloaded from GenBank to see evolutionary relationships with our species. The data set of

ITS region included about 690 base pairs, of which 428 were conserved, 255 were variable. Species were separated at the subgenus

and section levels in the tree. Two major clades, A and B, were distinguished in the phylogenetic tree with high bootstrap values.

Clade A was formed mainly by species located in subgenus Melanoleuca. Clades A1 included species found in subgenus Melanoleuca

/ section Melanoleuca. Sub-Clade A1.1 comprised all used specimens of M. communis including our sample. Melanoleuca

heterocystidiosa species was placed with representative sequences downloaded from GenBank in sub-clade A1.2. Clade B comprised

species found in subgenus Acystis (B1) and Urticocytis (B2). Melanoleuca dryophila grouped with M. rasilis and supported by 100%

bootstrap value. Uncertain taxonomic position of M. dryophila was clarified and decided to be found in subgenus Urticocystis based

on ITS data. Keywords: ITS, Melanoleuca, Phylogeny

References:

[1] Doyle, J.J., Doyle, J.L. Phytochemical Bulletin 1987, 19:11-15.

[2] Wen, J., Zimmer, E.A. Molecular Phylogenetics and Evolution 1996, 6: 167-177.

[3] Thompson, J.D., Higgins, D.G., Gibson, T.J. Nucleic Acids Res. 1994, 22: 4673-4680.

[4] Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S. Mol. Bio.and Evo. 2011, 28: 2731





48

IDDGC17-OP-138

A KARYOLOGICAL STUDY ON TWO SPECIES BELONGING TO WIEDEMANNIA GENUS

Sibel Ulcay1, Gülcan ġenel

2

1 Ondokuz Mayıs University, Science Faculty, Biology Department, Samsun

2 Ondokuz Mayıs University, Science Faculty, Biology Department, Samsun

[email protected]

Abstract Aims and Scopes: The Lamiaceae family has a large number of species known as medicinal plants since the ancient times, with a

majority of them spreading in the Mediterranean basin [1]. The family is a fairly large family with 200 kinds and 3200 species. In our

country, 546 species of 45 genera and 731 taxa are distributed. The rate of endemism is 42%. At the same time, our country is an

important gene center for Lamiaceae family [2; 3]. The genus Wiedemannia is a genus of the Lamiaceae family. It is represented by

only two species in Turkey. These species are Wiedemannia orientalis Fish. Mey. and Wiedemannia multifidi L. Genus-specific

species are single-year herbaceous plants. It spreads as weeds in field and road sides, wheat planting areas [4; 5]. W. orientalis, an

endemic species, is in the nt (rare or not at risk) group of IUCN's hazard categories. Genus-rich species are rich in essential oils. For

this reason, they are of economic importance. In a study of volatile oils in W. orientalis, it was shown that there are 31 kinds of

compounds in this product. It was found that 42% of the seeds had fixed oil [6]. Despite studies on the chemical content of

Wiedemannia species, no information about chromosome numbers has been identified. With this study, it is necessary to detect two

chromosome numbers. Materials and Methods: Active root tips used for chromosomal analysis have been obtained from germination of seeds or from their

natural environment. Seeds were incubated in different concentrations of sodium hypochlorite. After being poured in pure water, it

was placed between soaked drying papers. After the root tips reached 0,5-1 cm length, the paste was taken for preparation. In

karyological examinations, root tips are taken and preparations are prepared by the methods described by Elçi [7] and Smith [8].

Preparates were prepared by staining the root tips with Feulgen after pre-treatment, fixation, and hydrolysis steps. Photographs were

taken from suitable cells. [

Results and Discussion: As a result of our study, the number of W. orientalis chromosome was 2n = 14, and the number of

chromosome of W. multultida was 2n = 12. No studies have been done on the chromosome numbers of species. B-type chromosomes

are frequently observed in the Lamiaceae family. It is mentioned that pollen fertilization and germination rate are lowered in species

with high number of B chromosome which is specific to this family [9].

Keywords: Wiedemannia orientalis, Wiedemannia multifida, karyology

[1] Morgaris, N.; Koedam, A.; Vokou, D. Aromatic Plants 1982Vol: 7 265-269.

[2] Baytop, A; Farmasotik Botanik Ders Kitabı İstanbul Ecz.Fak. 1991. No:3687.

[3] Davis, P.H., , Flora Of Turkey And The East Aegaen Island 1982, 7, Edinburg Universty Press

[4] Baytop, T., 1984, Türkiye‘de Bitkiler İle Tedavi, İstanbul Üniversitesi Yayınları, No. 3255.

[5] Taştan, B., Erciş, A., 1994, Orta Anadolu Bölgesinde Buğday Ekim Alanlarında Gözlenen Yabancı Otların Yayılış Ve Yoğunlukları Üzerinde

Araştırmalar, Bitki Koruma Bülteni, 31: 1-4, 39-60, 12 Ref.

[6] Baser, K.H.C., Kirimer, N., Demirçakmak, B., 1996, Composition of Essential Oil of Wiedemannia Orientalis Fisch. Et. Mey. From Turkey.8:5,

543-544, 17 Ref.

[7] Elçi, Ş.; Sitogenetik Gözlemler ve Araştirma Yöntemleri Fırat Üni. Fen Edebiyat Fak Biyoloji Bölümü Yayınları 1982 ,3

[8] Smith L, Acetocarmine Smear Technic, stain technology, 194722:1, 17-31.

[9] Trudel, M., Morton, J.K., 1992, Pollen Morphology and Taxonomy İn North American Labiateae, Candian Journal of Botany 70: 5, 975-995.




49

IDDGC17-OP-139

FLEXIBLE AND FREESTANDING CATALASE-Fe3O4/REDUCED GRAPHENE OXIDE HYBRIDE

PAPER: ENZYMATIC HYDROGEN PEROXIDE SENSOR APPLICATIONS

Kader Dağcı KıranĢan

1, Mine Aksoy

1, Ezgi Topçu

1

1Department of Chemistry, Sciences Faculty, Atatürk University, Erzurum, 25240, TURKEY

([email protected])

Aims and Scopes: The determination of hydrogen peroxide (H2O2) is of great importance in virtue of the nature of H2O2 as a common

intermediate in many biological reactions catalyzed by oxidase enzymes such as cholesterol oxidase, lactose oxidase, glucose oxidase etc

[1]. Recently, graphene papers have been prepared due to their high chemical stability, mechanical flexibility and electrochemical

performance in various potential applications such as membranes, [2] Li-ion batteries, [3] supercapacitors, [4] and electrochemical

sensors [5]. Fe3O4 and some other semi-metallic materials have received large interest because of provides the active center for

attachment of the enzymes to the surface in the preparation of the enzyme immobilized surfaces. We proposed a new type of freestanding

Catalase (EC 1.11.1.6) (Cat) modified paper electrode based on Fe3O4 nanoparticles decorated free-standing reduced graphene oxide

(rGO) paper (Cat-Fe3O4/rGO) using a facile electrodeposition method. This hybride paper electrode was used for the specific

determination of H2O2. Materials and Methods: This the flexible and freestanding Cat- Fe3O4/rGO hybrid paper was fabricated as the following steps: The GO

suspension was vacuum filtered to obtain GO paper on a membrane and then peeled it off from the membrane. Then, GO paper was

reduced by both chemical and termal reduction. Cyclic voltammetry was applied for the template-free electrodeposition of Fe3O4 on rGO

paper. Finally, immobilization of catalase enzyme was achieved on Fe3O4/rGO paper by adsorption to form Cat-Fe3O4/rGO hybrid paper.

Results and Discussion: This flexible and free standing Cat- Fe3O4/rGO hybrid paper electrode was used for the specific determination

of H2O2. Structural, chemical, and morphological characterization of the Fe3O4 nanocrystals formed on rGO paper was investigated by (i)

using scanning electron microscopy (SEM), (ii) energy-dispersive X-ray spectroscopy (EDS), (iii) X-ray photoelectron spectroscopy

(XPS), (iv) X-ray diffraction spectroscopy (XRD), (v) Raman spectroscopy, (vi) electrochemical impedance spetroscopy (EIS) and (vii)

cyclic voltammetry (CV) techniques. The catalase enzyme was successfully adsorbed on the Fe3O4 nanoparticles surface which was

demonstrated by fluorescence microscopy. The Cat-Fe3O4/rGO paper electrode showed excellent electrocatalytic activity toward H2O2.

Keywords: Enzyme modified electrode, H2O2 electrochemical sensor, graphene paper

Figure 1: Schematic illustration of the fabrication of Cat-Fe3O4/rGO hybrid paper electrode and electrocatalytic reduction of H2O2.

Acknowledgements: This work has been supported by Ataturk University (Project: BAP2016/154).

References: [1] Suazo-Davila D.; Rivera-Melendez J.; Koehne J.; Meyyappan M. Appl Surf Sci. 2016,384,251.

[2] Wang M.; Duong L.D.; Mai N.T.; Kim S. Large-Area, Acs Appl Mater Inter.2014,6,1747-53.

[3] Liu Y.; Wang W.; Gu L.; Ying Y.L. Acs Appl Mater Inter. 2013,5,9850.

[4] Xiao F.; Yang S.X.; Zhang Z.Y.; Liu H.F.; Xiao J.W.Scientific reports. 2015,5.

[5] Dagci K.; Alanyalioglu M. ACS Appl Mater Interfaces. 2016,8,2713.





50

IDDGC17-OP-140

DISTRIBUTION OF β-LACTAMASE and CARBAPENEMASE GENES in Klebsiella pneumoniae

STRAINS ISOLATED FROM PATIENTS in KIRġEHĠR

Ali Sevim1, Elif Sevim

1, Ömer KarakamıĢ

2, Neslihan ġahin

2, Fikriye Milletli Sezgin

3

1 Ahi Evran University, Faculty of Engineering and Architecture, Genetic and Bioengineering, KırĢehir

2 Ahi Evran University, Faculty of Science and Arts, Department of Biology, KırĢehir

3 Ahi Evran University, Faculty of Medicine, Department of Medical Microbiology, KırĢehir

Cooresponding author: [email protected]

Aims and Scopes: The spread of the members of Enterobacteriaceae, primarily Klebsiella pneumoniae, producing KPC, VIM, IMP,

and NDM carbapenemases is very common problem in infection control. The strains of Klebsiella pneumoniae producing

carbapenemase (KPC) are a group of emerging highly drug-resistant Gram-negative bacilli causing infections associated with

significant morbidity and mortality. In this study, we attempt to describe the microbiological, genetical and epidemiological

characteristics of Klebsiella pnemoniae strains producing carbapenemase and to present in a critical manner the available data

regarding the antimicrobial treatment and infection control practices used to combat infections caused by these bacteria.

Materials and Methods: Sixty-seven strains of K. pneumoniae were isolated from various clinical specimens at Ahi Evran

University Hospital of Kırşehir between 2014 and 2015. The genomic DNA of K. pneumoniae isolates was obtained using the boiling

lysis procedure [1]. The presence of TEM, SHV, OXA, CTX-M1, CTX-M2, KPC, VIM, IMP and NDM genes in the isolates were

investigated by PCR using specific primers. The plasmid isolation of K. pneumoniae isolates was performed using Plasmid DNA

Isolation Kit (Thermo Scientific). The conjugation method was used to determine the existence of transferable plasmids carrying

resistance gene. All of the beta-lactamases and carbapenamases genes were explored by PCR in plasmids that were isolated from

transconjugants.

Results and Discussion: According to PCR results, it was determined that 11 strains (16%) carriyed OXA-48 and 3 strains (4%)

carryied NDM-1. No other carbapenemase genes were identified in any strain. Thirty-six (%54) strains carried a TEM type β-

lactamase, and some carried SHV (51%) and CTX-M- 1-like (46%) β-lactamases. Additionally, we determined that 15 strains (22%)

carried Class-I integron . According to the conjugation assay, it was determined that eight strains carried conjugative plasmids. We

also determined that the conjugative plasmids carried TEM, SHV, CTX-M1, CTX-M2 and Class-I integron genes.

Keywords: beta lactamases, carbapenamases, Klebsiella pnemoniae, antibiotic resistance.

References: [1] Copur Cicek, A.; Ozgumus, O.B.; Saral, A.; Sandallı, C. Annals of Laboratory Medicine 2014, 34, 139-144.




51

IDDGC17-OP-141

DETERMINATION OF INTEGRON GENE CASETTES IN MULTI DRUG RESISTANCE Escherichia

coli STRAINS IN KIRġEHIR, TURKEY

Fikriye Milletli Sezgin1, Ali Sevim


3, Neslihan ġahin

3, Elif Sevim

2

1Ahi Evran University, Faculty of Medicine, Department of Medical Microbiology, KirĢehir

2Ahi Evran University, Faculty of Engineering and Architecture, Genetic and Bioengineering, KırĢehir

3 Ahi Evran University, Faculty of Science and Art, Department of Biology, KırĢehir

Corresponding e-mail: [email protected]

Aims and Scopes: Although E. coli isolates are present in normal human fecal flora, some strains of this bacterium can cause

gastroenteritis and food born diseases. In addition, E. coli isolates are also the causative agents of the blood-stream infection, lower

respiratory tract infection, wound and abscess infection. The goal of the present study was to screen the the presence of Class 1 and

Class 2 integron gene casettes in 151 E. coli isolates showing multi drug resistance obtained from clinical samples in Kırşehir,

Turkey.

Materials and Methods: Multi drug resistance E. coli isolates were collected between 2014 and 2015 from clinical samples in Ahi

Evran University Hospital of Kırşehir. The genomic DNA of E. coli isolates was obtained using the boiling lysis procedure [1]. The

presence of Class 1 and Class 2 integron gene casettes in E. coli isolates were investigated by PCR using primers given in table 1. The

plasmid isolation of E. coli isolates was performed using Plasmid DNA Isolation Kit (Thermo Scientific). The conjugation method

was used to determine the existence of transferable plasmids carrying on Class 1 and Class 2 integron gene casettes. The Class 1 and

Class 2 integron gene casettes were explored in plasmids that were isolated from transconjugants by PCR.

Table 1. Primers used in this study.

Primers Sequences (5‗-3‗) Amplicon size

(bp) Reference

Class-I

İntegron

5‘-CS- Fw: GGCATCCAAGCAGCAAG

3‘-CS- Rw: AAGCAGACTTGACCTGA Variable [2]

Class-II

İntegron

hep51: GATGCCATCGCAAGTACGAG

hep74: GGGATCCCGGACGGATGCACGATTTGTA Variable [3]

Results and Discussion: The Class 1 integron was determined in 71 (47.01%) of 151 E. coli isolates and Class 2 integron was

determined in 4 (2.64%) of E. coli isolates. The results of conjugation experiment showed that 38 isolates (24.16%) contained

conjugative plasmid and 6 of these conjugative plasmids carried Class 1 integron gene casettes. The sequencing results of Class 1

integron gen cassettes showed that dfrA1 gene was the most frequent gene among integron gene cassettes (41 of 71 class 1 integron

positive isolates).

Keywords: Class 1 and Class 2 integron, E. coli, dfrA1 gene, multi drug resistance

Acknodlegments: This work was supported by the Ahi Evran University Scientific Research Projects Coordination Unit. Project

Number: MMF. E2. 17. 006.

References:

[1] Copur Cicek, A.; Ozgumus, O.B.; Saral, A.; Sandallı, C. Annals of Laboratory Medicine 2014, 34, 139-144.

[2] Levesque, C.; Piche, L.; Larose, C.; Roy, P.H. Antimicrob. Agents Chemother. 1995, 39, 185-191.

[3] White, P.A.; McIver, C.J.; Rawlinson, W.D. Antimicrob. Agents Chemother. 2001, 45, 2658-2661.





52

IDDGC17-OP-142

USE OF RECOMBINANT DNA TECHNOLOGY IN CROP PRODUCTION

Sevil Sağlam

Ahi Evran University, Faculty of Agriculture, Department of Agricultural Biotechnology, 40100, Kirsehir/Turkey

Recombinat DNA technology is a technology that involves DNA molecules that are not able to spontaneously form in nature and that

are obtained from different biological species by genetic engineering technology and combining different DNA fragments.

Recombinant DNA is also known as rDNA. This technology allows genetic recombination to be artificially performed and to replicate

any desired gene or product [1]. The gene to be amplified is first extracted from the original chromosome with restriction

endonuclease enzyme, and then integrated in a vector. After that this vector is transformed into a bacterium or yeast and then cultured

in these microorganisms to obtain the desired gene or protein. The use of recombinant DNA technology in agriculture is becoming

increasingly important [2]. With recombinant DNA technology, hybridization barriers between different taxonomic groups can be

removed, herbicides, harmful and disease resistant varieties can be developed, vitamins and protein quality can be increased, and

indirectly contributing to areas such as health, environment and industry. As with any technology, there are concerns about the use of

recombinant DNA technology. In terms of consumer rights, transgenic varieties have not been yet used in the European Union, in

Turkey, and in many other countries [3]. Today, however, in most countries, especially in the USA, the area of transgenic soybean,

corn, cotton and cola planting has reached approximately 180 million hectares. In Turkey, biotechnology and plant biotechnology, an

important subspecialty, are still in their infancy, and the use of recombinant DNA technology in agriculture will enable the

commercial production of transgenic plants carrying genes with an agricultural precaution.

Keywords: Recombinant DNA, agriculture, transgenic plant

References:

[1] Watson, J.D.; Tooze, J.; Kurtz, D. T. (eds): Recombinant DNA, A Short Course, Scientific American Books, W.H. Freeman Company, New

York. 1983, pp. 58-90.

[2] Berg, P.; Singer, M. F. The recombinant DNA controversy: Twenty years later, Proc. Natl. Acad. Sci. USA Vol. 92, pp. 9011-9013.

[3] Özgen, M.; Ertunç, F.; Kınaci, G.; Yıldız, M.; Birsin, M.; Ulukan, H.; Emiroğlu, H.; Koyuncu, N.; Sancak, C. Tarım Teknolojilerinde Yeni

Yaklaşımlar Ve Uygulamalar: Bitki Biyoteknolojisi 2005. Türkiye Ziraat Mühendisliği 6. Teknik Kongresi, 315-346.




53

IDDGC17-OP-143

DETERMINATION OF HEPATITIS C VIRUS GENOTYPE DISTRIBUTION IN WESTERN BLACK

SEA PROVINCE Umut Safiye ġay CoĢkun

GaziosmanpaĢa University Faculty of Medicine, Department of Medical Microbiology, Tokat

Aim and Scope: The hepatitis C virus (HCV) is a major public health problem and leading cause of chronic liver disease [1]. An

estimated 180 million people are infected with hepatitis C virus in worldwide [2]. In a significant number of those who are

chronically infected develop liver cirrhosis or liver cancer. The most affected regions are Africa, Central and East Asia. The diagnosis

of chronic hepatitis C is based on the detection of both anti-HCV antibodies and HCV RNA. The hepatitis C virus can be classified

into at least 6 major genotypes (genotypes 1 to 6) [3]. Genotyping of hepatitis C virus is important because each genotypes have

different infectivity and influencing the rate of progression of HCV infection to cirrhosis and hepatocellular carcinoma. Besides

various HCV genotypes would also result different responses to anti-viral treatment [4]. The aim of this study is to determine the rates

of infection with Hepatitis C in our region and contribute to the planning of the treatment by determining the genotype of the HCV.

Material and Method: In this study, 13.223 patients suspected of being infected with HCV at Gaziosmanpaşa University Medical

Faculty Research and Practice Hospital were examined retrospectively between January 2016 and January 2017. Anti-HCV antibodies

were studied by the kemiluminesans immunoassay method with Cobas E-601 (Roche Diagnostics). For the detection of serum HCV-

RNA; sample was mixed with proteinase K and RNA isolation was carried out with protocol no 202 by the isolation device

Magnesia 16 (Anatolia Geneworks, Turkey). Then PCR Master Mix and sample RNA were mixed and real-time PCR was used with

Bosphore Ultra HCV Quantitation / Detection Kit by Montania 4896 (Anatolia Geneworks Turkey) device. After RNA isolation for

HCV genotyping, PCR Master Mix and sample RNA were mixed and real-time PCR was carried out with Bosphore® HCV

Genotyping Kit v3 thermal protocol Montania 4896 (Anatolia Geneworks Turkey) device.

Results and Discussion: In this study, Anti-HCV was positive in 359 (2,7%) of 13.223 cases. HCV RNA was detected in 211

(58.8%) of the anti HCV positive specimens. HCV genotypes was also detected in 134 (%63.5) of the HCV RNA positive specimens.

HCV-positive patients were detected %98.5 genotype 1B, 3.7% genotype 3, 2.2% genotype 1A, 0.7% genotype 2 and 0.7% genotype

4. Most areas of the Americas, Western and Central Europe, and Southeast Asia have HCV prevalence rates lower than 2.5%. The

distribution of HCV genotypes varies according to the geographical region. Genotypes 1-3 are widely distributed all over the world

[5]. We found that the prevalence of hepatitis C was found to be 2.7% and 98.5% of patients were found to have genotype 1B. This

study showed that HCV genotype 1B was the most prevalent HCV type in Western Black Sea region. Accurately identifying specific

hepatitis C virus genotypes and subtypes is helpful in defining the epidemiology of hepatitis C and in making recommendations

regarding treatment.

Keywords: Hepatitis C Virus,HCV RNA, Genotype.

References: [1]. Williams R. Global challenges in liver disease. Hepatology 2006;44: 521-526.

[2]. Centers for Disease Control and Prevention. Hepatitis C FAQs for Health Professionals. 2012. http://www.cdc.gov/hepatitis/hcv/hcvfaq.htm#d4.

Accessed November, 2013.

[3]. Simmonds P, Bukh J, Combet C, Deleage G, Enomoto N, Feinstone S, et al. Consensus proposals for a unified system of nomenclature of

hepatitis C virus genotypes. Hepatology 2005;42:962-973.

[4]. Mohd Hanafiah K, Groeger J, Flaxman AD, Wiersma ST. Global Epidemiology of Hepatitis C Virus Infection; New Estimates of Age-Specific

Antibody to HCV and Seroprevalence. Hepatology. 2013; 57:1333–1342.

[5]. Chayama K, Hayes CN. Hepatitis C virus: How genetic variability affects pathobiology of disease. J Gastroenterol Hepatol 2011; 26 Suppl 1:83-

95. 7.

http://tureng.com/tr/turkce-ingilizce/all%20over%20the%20world




54

IDDGC17-OP-144

DETECTION OF VACCINE STRAIN BRUCELLA MELITENSIS REV-1 BY PCR- RFLP

Zeki Aras1, Orhan Yavuz

2

1Department of Microbiology, Faculty of Veterinary Medicine, Aksaray University, Campus, 68100, Aksaray, Turkey.

[email protected] 2Department of Pathology, Faculty of Veterinary Medicine, Aksaray University, Campus, 68100, Aksaray, Turkey.

Aims and Scopes: Brucellosis in small ruminants is mainly caused by Brucella (B.) melitensis and rarely by B. abortus and B. ovis. A

live B. melitensis Rev-1 vaccine has been used successfully in many countries to immunize sheep and goats against B. melitensis

infection [1]. However, vaccine strain B. melitensis Rev-1 can occasionally cause infection in animals. The aim of this study was to

investigation B. melitensis Rev-1 vaccine strain in field isolated strains by PCR-RFLP.

Materials and Methods: A total of 40 B. melitensis strain isolated from aborted sheep fetuses were evaluated by PCR-RFLP. The

Brucella specific primer pairs were used in PCR for amplification of the omp2 gene. The sequence of forward primer was 5'- TGG

AGG TCA GAA ATG AAC -3' and reverse primer was 5'- GAG TGC GAA ACG AGC GC -3'. Pst I restriction enzyme was used for

digestion of PCR product and DNA fragments were separated by electrophoresis [2].

Results and Discussion: The PCR assay was performed with reference strain and 40 field isolated strains. Omp2 gene was amplified

from all isolates and a PCR product nearly 282 bp was observed on agarose gel after amplification. Digestion of the amplified

fragments with PstI restriction endonuclease gave different bands. Commercial vaccine strain B. melitensis Rev-1 and one field

originated strain were revealed tree bands as 282, 238 and 44 bp. However, other field strains were shown two bands on agarose gel

as 238 and 44 bp. One of the field isolates was confirmed as vaccine strain B. melitensis Rev-1 by PCR-RFLP.

In conclusion, B. melitensis Rev-1 can be diagnosed by conventional biotyping tests [1] or PCR-RFLP method [2]. The conventional

tests of identification require a minimum of 4-7 days to identify a strain to Brucella species and biovar level. However, PCR-RFLP

method distinguished Rev-1 vaccine strain from other B. melitensis field isolates in 24 hours. Thus, PCR-RFLP assay can be

recommended for use in studies on Brucellosis eradication programs.

Keywords: Brucellosis; B. melitensis Rev-1; Genotyping; PCR-RFLP.

References:

[1] Alton, G.G., Jones, L.M., Angus, R.D., Verger, J.M. Techniques for the brucellosis laboratory. INRA, Paris, 1988, pp. 11-60.

[2] Alton, G.G., Jones, L.M., Angus, R.D., Verger, J.M. Techniques for the brucellosis laboratory. INRA, Paris, 1988, Bardenstein, S., Mandelboim,

M., Ficht, T.A., Baum, M., Banai, M. Journal of Clinical Microbiology 2002, 40, 1475-1480.




55

IDDGC17-OP-145

ISOLATION AND CHARACTERIZATION OF ENTOMOPATHOGENIC FUNGI FROM WALNUT

FIELDS

Elif Sevim1, Fikriye Milletli Sezgin

2, Songül Gürlek

1, Ali Sevim

1

1Genetic and Bioengineering, Faculty of Engineering and Architecture, Ahi Evran University, KırĢehir-Turkey.

[email protected] 2Department of Microbiology, Faculty of Medicine, Ahi Evran University, KırĢehir-Turkey

Aims and Scopes: Entomopathogenic fungi (EPFs) play an important role for regulating insect pest populations and they can be

found in many different ecosystems. Within these fungi, Beauveria and Metarhizium spp. genera include species which are the most

commercially important [1]. The aim of this study was to determine the diversity and distribution of Beauveria and Metarhizium spp.

in walnut fields of Kırşehir, Turkey.

Materials and Methods: A total of 90 soil samples were collected from walnut fields of Kırşehir between 2015-2016 years.

Beauveria and Metarhizium spp. were isolated from these soils using selective media [2]. The isolated fungi were characterized based

on their morphological and molecular characteristics including Bloc (the nuclear intergenic region) and β-tubulin gene sequences [3,

4].

Results and Discussion: Twenty-one soil samples (23.3 %) were positive with regards to the presence of entomopathogenic fungi.

Among the isolated 21 fungi, eleven isolates were identified as B. pseudobassiana and seven isolates were identified as B. bassiana.

In terms of Metarhizium spp., three isolates were identified as M. majus based on their morphological and molecular characteristics.

Consequently, Beauveria and Metarhizium spp. are the common component of soils collected from walnut fields and some of fungi

obtained from this work might be beneficial in the future biological control programs of walnut pests.

Keywords: Walnut, soil, entomopathogenic fungi

Acknowledgements: This work was supported by the Ahi Evran University Scientific Research Projects Coordination Unit. Project

Number: MMF.E2.17.007, MMF.A4.17.002.

References:

[1] Goettel, M.S.; Eilenberg, J.; Glare, T. Entomopathogenic fungi and their role in regulation of insect populations. 2005. In L.I. Gilbert, K. Iatrou,

& S.S. Gill (Eds.), Comprehensive Molecular Insect Science (pp 361-405). Amsterdam: Elsevier.

[2] Goettel, M.S.; Inglis, G.D. Fungi: Hyphomycetes. 1997. In L.A. Lacey (Ed), Manual of Techniques in Insect Pathology (pp 213-249). San Diego:

Academic Press.

[3] Bischoff, J.F.; Rehner, S.A.; Humber, R.A. A multilocus phylogeny of the Metarhizium a nisopliae lineage. Mycologia, 2009, 101, 512-530.

[4] Rehner, S.A.; Minnis, A.M.; Sung, G.H.; Luangsa-ard, J.J.; Devotto, L.; Humber, R.A. Phylogeny and systematics of the anamorphic,

entomopathogenic genus Beauveria. Mycologia, 2011, 103, 1055-1073.




56

IDDGC17-OP-146

EVALUATION OF PCR METHODS FOR DETECTION OF BRUCELLA STRAINS FROM

CULTURE AND TISSUES

Alper ÇĠFTCĠ1,*, Tuba ĠÇA

2, Serap SAVAġAN

3, BarıĢ SAREYYÜPOĞLU

4, Mehmet AKAN

4, Kadir Serdar DĠKER

4

1Department of Microbiology, Faculty of Veterinary Medicine, University of Ondokuz Mayıs, Samsun;

2Department of Art and

Sciences, Faculty of Biology, University of Dumlupınar, Kütahya; 3Department of Microbiology, Faculty of Veterinary Medicine,

University of Adnan Menderes, Aydın; 4Department of Microbiology, Faculty of Veterinary Medicine, University of Ankara, Ankara,

TURKEY.

*[email protected]

Aims and Scopes: The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves and

neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize

and evaluate PCR assays used for the diagnosis of Brucella infections.

Materials and Methods: In PCR optimization studies, control strains and field isolates were used to determine specifities and

sensitivities of primers. PCR trials were performed with Ba148/928 (800 bp) [3], 31ter/sd (881 bp) [7], IS711, Ba, Bm, Bo, Bs (731

bp for B. melitensis, 498 bp for B. abortus, 285 bp for B. suis, 976 bp for B. ovis) [1], JPF/JPR (193 bp) [4], F4-R2 (905 bp) [6],

BruP6-P7 (678 bp) [5] and Eri1-Eri2 (178 bp) [2] primers for Brucella strains.

For the optimization of PCR with tissue, the logarithmic phase cultures of B. melitensis strain were precipitated and sheep tissues

were added to pellet and mixed. The DNAs from blood, serum, gastric content, semen, milk and blood inoculated with Brucella were

extracted using commercial DNA extraction kits according to the manufacturer‘s recommendations. The target DNA‘s extracted from

tissue samples inoculated with B. melitensis were amplified using Ba148/928, 31ter/sd, IS711, Eri1-Eri2, JPF/JPR and F4-R2 primers

according to the original and modified PCR protocols.

To determine the reliability of optimized PCR protocols for diagnosis of clinical or subclinical Brucellosis, the field samples were

collected. The bacteriological examinations of field materials except serum samples were performed. Also, the optimized PCR

protocols were used to examine the clinical materials collected from field. For the blood, semen and milk samples, PCR was

performed at the conditions in which F4-R2 primer were used. For the sera and aborted fetus, PCR was performed at the conditions in

which Ba148/928 primer were used.

The number of Brucella strains isolated from clinical materials and the number of positiveness detected by PCR were compared in

respect of animal species and types of material.

Results and Discussion: All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In

spiked blood, milk and semen samples, F4-R2 primer oriented PCR assays detected minimal numbers of Brucella. In spiked serum

and fetal stomach content, Ba148/928 primer oriented PCR assays detected minimal numbers of Brucella. Field samples collected

from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall sensitivity of PCR assays was

found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0 and 8.0 % of aborted fetus,

blood, milk, semen and serum samples by PCR assays, respectively.

In conclusion, PCR assay in optimized conditions were found to be valuable in sensitive and specific detection of Brucella infections

of animals.

Keywords: Brucella, PCR, detection, sheep, cattle

References: [1] Bricker, B.J.; Halling, S.M. Journal of Clinical Microbiology 1994, 32, 2660–2666.

[2] Bricker, B.J.; Halling, S.M. Journal of Clinical Microbiology 1995, 33, 1640–1642.

[3] Herman, L.; de Ridder, H. Applied and Environmental Microbiology 1992, 58, 2099–2101.

[4] Navarro, E.; Escribano, J.; Fernandez, J.A.; Solera, J. FEMS Immunology and Medical Microbiology 2002, 34, 147–151.

[5] Rijpens, N.P.; Jannes, G.; Van Asbroeck, M.; Rossau, R.; Herman, L.M.. Applied and Environmental Microbiology 1996, 62, 1683–1688.

[6] Romero, C.; Gamazo, C.; Pardo, M.; Lopez-Goni, I. Journal of Clinical Microbiology 1995, 33, 615–617.

[7] Vizcaino, N.; Verger, J.M.; Grayon, M.; Zygmunt, M.S.; Cloeckaert, A. Microbiology 1997, 143, 2913–2921.

Acknowledgements: This study was supported by the Scientific and Technological Research Council of Turkey (TUBITAK) (Project

No: VHAG-1902).

mailto:*[email protected]




57

IDDGC17-OP-147

SOME CHARACTERISATION OF COAGULASE POSITIVE STAPYLOCOCCI ISOLATED FROM

RAW MILK SAMPLES*

Belgin SIRIKEN1, Gökhan ĠNAT

2, Ceren YAVUZ

3, Tuba YILDIRIM

3, Alper ÇĠFTCĠ

4, Ġrfan EROL

5

Departments of 1Aquatic Animal Diseases ([email protected]; [email protected]),

2Food Hygiene and Technology,

4Microbiology, Faculty of Veterinary Medicine, Ondokuz Mayis University, 55200, Samsun, Turkey;

3Department of Biology, Faculty

of Science, Amasya University, 05100, Amasya, Turkey; 5Ministry of Food, Agriculture and Livestock, Republic of Turkey, Lodumlu,

6530, Ankara, Turkey.

ABSTRACT

Generally, staphylococcal infections are treated with penicillin. However, over the years, these pathogens have developed resistance

to penicillin associated with production of ß-lactamase. Methicillin was developed to counteract this resistance mechanism; however,

methicillin-resistant Staphylococcus aureus (MRSA) strains have appeared [1], which have phenotypic resistance to methicillin and

related ß-lactam antibiotics [2]. MR in S. aureus is primarily mediated by overproduction of the penicillin-binding protein (PBP) 2a,

an altered PBP with extremely low affinities for ß-lactam antibiotics. The mecA gene encodes it [3]. Today, MRSA is among the most

important causes of antimicrobial-resistant health care–associated infections worldwide [4]. Increasing frequency of MRSA infections

and changing patterns in antimicrobial resistance have led to renewed interest in the use of macrolide lincosamide – streptogramin B

(MLSB) antibiotics to treat such infections. However, their widespread use has led to an increase in the number of Staphylococcus

strains resistant to MLSB antibiotics [5].

Material and Methods: In the study, 50 coagulase positive staphylococci (CPS) isolates recovered from raw cow milk samples were

determined some characterization. For this, the isolates were analyzed for nuc, mecA, present of Panton Valentine Leucosidine toxin

(lukS-PV) and resistant to MLSB antibiotics using PCR assay.

Results and Dscussion: mecA was determined 4 CPS isolates as well as nuc gene. Therefore, the 4 isolates evaluated as MRSA. In

contrast, lukS-PV was not present in the MRSA isolates. The erm was present in total 3 MRSA isolates and ermB was predominate

gene among erm genes. There have been reports according to MRSA in milk, Turkey and different countries [6,7,8,9,10]. MLSB

antibiotics are widely used in the treatment of staphylococcal infections. Resistance to macrolides (such as erythromycin) and

lincosamides (such as lincomycin and clindamycin) is prevalent among staphylococci [6]. Resistance against streptogramins remains

infrequent [7]. A number of genes conferring resistance to this group of antibiotics via a variety of mechanisms have been identified

in staphylococci. Three related determinants, ermA, ermB, and ermC, have been identified which confer resistance to MLS type B by

target site alteration of the ribosome [8]. There have been studies according to MLSB in milk [9,10]. One of them, MRSA was

detected in 10.2%, but ermA and ermC were not detected in the MRSA isolates [10]. In conclusion, raw cow milk samples have

potential health risk for MRSA. However, the isolates not virulence properties in term of Panton Valentine Leucosidine toxin. In

addition, infection caused MRSA can be difficult treatment because of also the resistance to MLSB.

Keywords: raw milk, coagulase positive staphylococci, S. aureus, methisilline resistance, PVL and MLSB

Referenses

[1]Jevons, M. P.; Coe, A.W.; Parker, M.T. Lancet, 1963, i(7287),904–907.

[2]David, M. Z.; Daum, R.S. Community-associated methicillin-resistant Staphylococcus aureus: epidemiology and clinical

consequences of an emerging epidemic. Clin. Microbiol. Rev, 2010, 23,616–687.

[3]Ma, X. X.; Ito,T.; Tiensasitorn, C.; Jamklang,M.; Chongtrakool,P.; Boyle-Vavra, S.; Daum,R.; Hiramatsu,K. Antimicrobial

Agents and Chemotherapy, 2002, 46,1147–1152.

[4] Moellering, R. C., Jr. 2012. MRSA: the first half century. Journal of Antimicrobial Chemotherapy, 67,4–11

[5] Saiman, L.; O'Keefe, M.; Graham, P.L.;Wu, F.; Saïd-Salim, B.; Kreiswirth, B.; LaSala, A.; Schlievert, P.M.; Della-Latta, P.

Clinical Infectious Diseases, 2003, 37(10),1313-9.

[6] Chang, S.-C.; Chen, Y.-C.; Luh, K.-T.; W.-C. Hsieh, W.-C. Diagnostic Microbiology and Infectious Disease, 1995, 23,147–154.

[7] Loncle, V.; Casetta,A; Buu-Hoi,A.; El Solh,N. Antimicrobial Agents and Chemotheraphy. 1993, 37,2159–2165

[8] Leclercq, R.; Courvalin,P. Antimicrobial Agents and Chemotheraraphy, 1991, 35,1267–1272.

[9] Siriken, B.; Yıldırım, T.; Erol, I.; Durupınar, B.; Ciftci, A.; Onuk, E.E. Journal of Aquatic Food Product Technology, 2013; 22 (4),

339-352.

[10] Kumar, R.: Yadav, B.R.; Singh, R.S. Current Microbiology, 2010,60(5),379-86

Acknowledgements: *This study was supported by Scientific Research Project Program of Ondokuz Mayis University (Project Nr:

PYO. VET.1901.16.001).





58

IDDGC17-OP-148

THE USE OF BIOINFORMATICS APPLICATIONS IN THE ANALYSIS OF DISEASES RELATED

HOMOCYSTEINE METABOLISM PROTEIN PATHWAY

Akın Tekcan1, Serbülent Yiğit

2

1Ahi Evran University, Faculty of Medicine, Dept. of Medical Biology, KirĢehir, Turkey, [email protected]

2 GaziosmanpaĢa University, School of Medicine, Dept. of Medical Biology, Tokat, Turkey

Aims and Scopes: Genome-wide association studies (GWAS) aim to discover a subset of single-nucleotide polymorphisms (SNPs)

that are associated with the onset and progression of complex disease phenotypes at a genome-wide scale [1]. As a reflection of

genetic alterations, the alterations of the activity of several biological pathways may cause complex diseases. Bioinformatic

applications are important to determine the effects of mutations on the structure and function of proteins [2]. The aim of this study,

using bioinformatic techniques, was to analyze homocysteine metabolism protein pathways leading to many diseases.

Materials and Methods: Data on the human protein pathways were collected from the Uniprot Protein Database, Ensembl database

(release 84), National Centre for Biological Information Protein database, KEGG PATHWAY database, PANTHER-Pathway and

Reactome Pathway Database. Bioinformatic analysis was then performed [2]. In the bioinformatics analysis of disease-related SNPs

of genes, two algorithms, the Predictor of human Deleterious Single-Nucleotide Polymorphisms (PhD-SNP) and Predicting Human

Disease-related Mutations in Proteins with Functional Annotations (SNPs&GO), were used [2].

Results and Discussion: Twenty seven different gene that involved homocystein metabolism were determined. 100 %, 29.62 %,

11.11 % and 11.11 % of these genes take a role amino acid metabolisms, biosynthesis of amino acids, carbon metabolism and

metabolism of cofactors and vitamins, respectively. It is found that the genes involved in homocysteine metabolism were highly

conserved. Also, the protein-protein interactions results revealed a high degree of association between the genes involved in

homocystein metabolism and the metabolic synthesis process. This is the first study to analyze all genes of homocystein metabolism

pathways. We think that this analysis using bioinformatics methods would help in the understanding of the molecular basis of the

diseases that arise due to homocysteine metabolism dysfunction.

Keywords: Bioinformatics, Homocysteine, Protein, Pathways, Gene

References:

[1] Abo Alchamlat S, Farnir F. KNN-MDR: a learning approach for improving interactions mapping performances in genome wide association

studies. BMC Bioinformatics. 2017 Mar 21;18(1):184.

[2] Tekcan A. In Silico Analysis of FMR1 Gene Missense SNPs. Cell Biochem Biophys. 2016 Jun;74(2):109-27.





59

IDDGC17-OP-149

DETERMINATION OF WASTE PAPER PULP BLEACHING CAPACITY OF THREE

LIGNINOLYTIC ENZYMES PRODUCED SIMULTANEOUSLY

Ali Osman BELDÜZ1, AyĢegül ÖZER

1,Uğur UZUNER

2,Halil Ġbrahim GÜLER

2, Ġlhan DENĠZ

3,Sabriye ÇANAKÇI

1

1 Karadeniz Technical University, Faculty of Sciences, Department of Biology, 61080, Trabzon, TURKEY, [email protected] 2 Karadeniz Technical University, Faculty of Sciences, Department of Molecular Biology and Genetics, 61080, Trabzon, TURKEY 3Karadeniz Technical University, Faculty of Forestry, Department of Forest Industrial Engineering, 61080, Trabzon, TURKEY

Aims and Scopes: The paper consists of natural polymers such as hemicellulose, cellulose and lignin. Lignin is removed during pulp

production and bleaching because it is an undesirable substance in the pulp[1]. As an alternative to toxic and mutagenic chemical

applications the eco-friendly enzymatic applications in the paper and pulp industry have begun after the 1980s. The most extensively

studied ligninolytic enzymes are: lignin peroxidases, manganese-dependent peroxidases, laccases. In this study, GSTase, lignin

peroxidase and laccase genes, which have ligninolytic activity, were cloned into a Bacillus expression vector in operon form. Then,

the bleaching properties on paper pulp were examined. Waste paper pulps were treated with these enzymes in triple combination and

then TCF bleaching sequence was performed. With this study, it is aimed to reduce the risk of threatening human health and

environment of toxic and carcinogenic substances formed during paper bleaching and to contribute to the elimination of these threats

by spreading biological bleaching processes using enzymes in this area.

Materials and Methods: The GST gene of Klebsiella pneumoniae G1, the lignin peroxidase gene of Rhodococcus jostii RHA1 and

the laccase gene of Bacillus megaterium O1 were cloned into Bacillus expression vector pMA0911 in operon form and expressed in

Bacillus subtilis WB800 [2]. After that the waste paper pulp was treated with the triple enzyme combination (GST-Lignin

peroxidase-Laccase) and then the bleaching sequence was carried out. All bleaching experiments were carried out in polyethylene

bags by examining different bleaching sequence. The TCF bleaching sequence performed in this study was ―XOQP‖. X refers to the

enzymatic treatment with GST, lignin peroxidase and laccase, O illustrates the oxygen delignification stage, Q represents the

chelation treatment, and P exemplifies the bleaching with hydrogen peroxide. Washed and oven-dried Kraft pulp was filled into dry

polyethylene bags and pretreated with triple enzyme combination under optimized experimental conditions. Then, the pulp was

subjected to the bleaching sequence for downstream analyses.

Results and Discussion: As a result of TCF bleaching sequence, the delignification rate of enzyme treated waste paper pulp increased

from 60.89% to 74.65%. The ISO brightness values of the papers obtained from waste paper pulps treated with enzymes was

increased from 53.89% to 64.67%. The pulp fibers which were exposed to a bleaching sequence were imaged by SEM. When

compared to control pulp samples, noticeable morphological changes on enzyme treated-pulp fibers such as formation of fibrillation,

pores, flakes and loose streaks were also identified upon lignin removal. Herewith, enzymes tested as triple combination (GST + Lac

+ LiP) have been worked in a coordinated way to provide efficient bleaching sequences and are marketed and potentially used by the

paper industry.

Keywords: Waste paper pulp, operon, pulp bleaching, GST, laccase, lignin peroxidase

References: [1] Karademir, A.; Akgül, M., Tutuş, A. K.S.Ü. Fen ve Mühendilik Dergisi 2002, 5,1.

[2] Yasbin, R.E., Wilson, G.A., Young, F.E., Journal of Bacteriology 1975, 121, 296-304.

Acknowledgements: This work was supported by the The Scientific and Technological Research Council of Turkey (TUBITAK,

Project No: 113Z741). Authors are thankful to Lindsay D. Eltis (University of British Columbia, Canada) for providing Rhodococcus

jostii RHA1 and S. L. Wong (University of Calgary, Canada) for providing Bacillus WB800 cell lines and Dr. Yu Xia (Jiangnan

University, China) for providing pMA0911 plasmid.




60

IDDGC17-OP-150

THE ASSOCIATION OF MIF GENE RS755622 (-173G/C) AND RS 5844572 (−794 CATT)

POLYMORPHISMS WITH THE ALZHEIMER DISEASE

Aydın Rüstemoğlu1,*

, Kübra ġahin

1, Betül Çevik

2, Dürdane Aksoy

2

1- Gaziosmanpasa University, Medical Faculty Department of Medical Biology, TOKAT/TURKEY

2- Gaziosmanpasa University, Medical Faculty Department of Neurology, TOKAT/TURKEY

*- Gaziosmanpasa University, Medical Faculty Department of Medical Biology, TOKAT/TURKEY, [email protected]

Abstract

Dementia is a disease group that is becoming increasingly widespread all over the world, which has a significant place in health care

costs, and Alzheimer's disease (AD) is the most common cause of neurodegenerative dementia. AD is a chronic neurodegenerative

and inflammatory disorder, in which many inflammatory mediators are detected in the affected brain regions.

Macrophage migration inhibitory factor (MIF) is a proinflammatory cytokine which found in many tissues and cells, such as

monocytes and macrophages. The polymorphisms which identified in the promoter of the MIF gene have been shown to play a role in

the pathogenesis of diseases such as rheumatoid arthritis (RA) and systemic lupus erythematosus (SLE). The aim of this study was to

investigate the relationship between MIF gene -173 G / C (rs755622) and -794 CATT (rs 5844572) promoter polymorphisms and AD.

We have investigated 170 patients with AD diagnosed and 87 healthy control samples. The MIF rs755622 polymorphism were

investigated by Real_Time PCR method, and rs 5844572 polymorphism by PCR, which confirmed by sequencing. The results were

analyzed with SPPS 16.0 and Arlequin3.5 programs.

We identified three different genotypes for MIF rs755622 polymorphism, and five for rs5844572 polymorphism. In terms of genotype

and allelic distribution for both studied regions there was no statistical difference between the patient and control groups. Although

the frequencies of some genotypes differ significantly between patients and control groups, there is no statistical significance,

probably due to the relatively small number of control samples. Only the 5/5 genotype of rs5844572 polymorphism were detected

limitedly statistical significantly lower in the patient group (p=0.052; OR = 0.43, 95% CI = 0.19-0.96).

On the other hand, we have found significant differences between the patient and control group in the binary genotype and haplotype

studies. Especially, the GC-5/5 binary genotype, which was not detected in the patient group, was found at 5.75% in the control group

(p = 0.004; OR = 0.04, 95% CI = 0.00-0.80). The GG-6/6 binary genotype was significantly higher in the patient group (p = 0.026;

OR = 2.07, 95% CI = 1.10-3.87). For the haplotype study, the C-5 haplotype was significantly higher in control group (p = 0.003; OR

= 12, 95% CI = 0.03-0.58), othervise the G-6 haplotype was higher in patients (p = 0.025; OR = 1.54, 95% CI = 1.07-2.22).

Our results have shown that polymorphisms in the MIF gene may be associated with AD. Especially when we evaluate the rs755622

and rs5844572 polymorphisms together, this relationship becomes more meaningful. These demonstrate once again the importance of

evaluating different changes together. Results shown that, the different binary genotypes and haplotypes of studied MIF gene

polymorphisms may have an effect on AD. Repeating similar studies in the future with a larger number of samples will help to show

this relationship more precisely.

Keywords: Alzheimer disease, MIF gene, rs755622, rs5844572, polymorphism.





61

IDDGC17-OP-151

THE POSSIBLE EFFECTS OF CCAR AND BLDG REGULATORY GENES IN THE EXPRESSION

OF TUNICAMYCIN GENE CLUSTER IN STREPTOMYCES CLAVULIGERUS

Aslıhan KURT-KIZILDOĞAN, Lokman BAġ, Çiğdem OTUR

Ondokuz Mayıs University, Agricultural Biotechnology Samsun TURKEY

[email protected]

Aims and Scopes: Tunicamycin is a nucleoside-type antibiotic targeting the formation of Lipid I, peptidoglycan precursor, involved

in peptidoglycan synthesis. It also inhibits protein N-glycosylation in eukaryotes. Although tunicamycin gene cluster has been

identified in Streptomyces clavuligerus, there have been no reports yet regarding to transcriptional regulation of this biosynthetic gene

cluster. In this study, the possible effects of bldG pleiotropic and ccaR cluster-situated regulatory genes in the regulation of

tunicamycin biosynthesis in Streptomyces clavuligerus were investigated with the aim of deciphering regulatory mechanisms acting

on this antibiotic biosynthesis. For this purpose, the expression levels of tunicamycin biosynthetic gene cluster were compared

between bldG and ccaR mutants of S. clavuligerus with that of the wild type by qRT-PCR. In addition their tunicamycin productions

were compared by bioassay.

Materials and Methods: bldG null mutant [1] and ccaR-disrupted mutant [2] of S. clavuligerus strains were used. 24 h TSB (Oxoid)

grown pre-cultures were used as seed cultures for fermentation. They were grown in TSBY [3] supplemented with glycerol (0.5%) for

five days at 28 C and 220 rpm. Samples taken for 12 h intervals were used in tunicamycin extraction [3] for bioassay [4], growth

determination via DNA quantification [5] and RNA isolation [6] for qRT-PCR analyses. Bacillus subtilis 6633 was used as indicator

organism in the bioassay experiments [3]. hrdB gene was used as reference gene in qRT-PCR studies. Comparative Ct method was

used to evaluate qRT-PCR data [7]. Two biological and three technical replicates as well as negative controls were used in qRT-PCR.

Results and Discussion: Both mutants exerted higher growth profiles than the wild type. The expression of tunicamycin biosynthetic

gene cluster was found to be much lower than the wild type. In contrast, a considerably higher expression levels of tunicamycin gene

cluster were obtained in the absence of an intact ccaR gene in S. clavuligerus. The bioassay experiments showed that bldG null

mutant of S. clavuligerus was unable to produce tunicamycin as much as the wild type. However, in the ccaR-disrupted mutant,

tunicamycin production was very high especially after 24 h of incubation. The gene expression analyses and bioassay data confirmed

that the absence of bldG pleiotropic regulator gene adversely affected tunicamycin biosynthesis indicating a possible positive

regulation. While ccaR seems to have a negative regulation over tunicamycin. Ongoing studies will be conducted with EMSA to

support the present data.

Keywords: Streptomyces clavuligerus, tunicamycin gene cluster, bldG, ccaR, qRT-PCR, bioassay

Acknowledgements: This study was partially supported by TUBITAK project number KBAG113Z461 and OMÜ

PYO.ZRT.1905.14.005. In addition, this study was also supported by TUBITAK 2210-C Scholarship Program for Domestic MSc

Studies as the thesis of Lokman BAŞ.

References:

[1] Bignell, D. R.; Tahlan, K.; Colvin, K. R.; Jensen, S. E.; Leskiw, B. K.. Antimicrobial Agents and Chemotherapy 2005, 49(4), 1529-1541.

[2] Pérez-Llarena, F. J.; Liras, P.; Rodriguez-Garcia, A.; Martin, J. F. Journal of Bacteriology 1997, 179(6), 2053-2059.

[3] Chen, W.; Qu, D.; Zhai, L.; Tao, M.; Wang, Y.; Lin, S.; Price, N. P.; Deng, Z. Protein & Cell 2010, 1(12), 1093-1105.

[4] Romero, J.; Liras, P.; Martín, J. F. Applid Microbiology and Biotechnology 1984, 20, 318–325.

[5] Burton, K. Methods in Enzymology 1968, 12, 163-166.

[6] Kurt, A.; Álvarez-Álvarez, R.; Liras, P.; Özcengiz, G. Applied Microbiology and Biotechnology 2013, 97(13), 5869-5880.

[7] Livak, K. J.; Schmittgen, T. D. Methods 2001, 25, 402–408.




62

IDDGC17-OP-153

INTERACTIONS BETWEEN COMT, CNR2, IL-17 AND UCP2 GENE VARIANTS AND

SUBSTANCE USE DISORDERS

Selin Kurnaz1, Ahmet Bülent Yazıcı

2, Pınar Çetinay

3, Ayça Öngel Atar

3, Nazan Aydın

3, Zeliha Kıncır

3, Sacide Pehlivan

1

1Department of Medical Biology, Ġstanbul University, Ġstanbul Faculty of Medicine, Ġstanbul, Turkey

2Psychiatri Department, Sakarya University Education and Research Hospital, Sakarya, Turkey

3Psychiatri Department, Bakırköy Prof Dr. Mazhar Osman Mental Health and Neurological Disorders Education and Research

Hospital, Ġstanbul, Turkey

Aims and Scopes: Substance use disorders (SUD) are the one of the most important public health problem in our country as well as

all over the world[1,2]. SUD alters levels of neurotransmitters such as dopamine and its systems play a prominent role in drug reward

[3,4]. Studies reported that lots of genes are candidate in SUD. We aimed to compare clinical parameters and gene variants of COMT

(Val158-rs4680/108Met-rs6269), CNR2 (rs2501432 and rs2229579), UCP2 (rs659366) and IL-17 (rs763780) which are possible

candidate genes in SUD.

Materials and Methods: 100 control group and 136 SUD group were included in the study. DNA isolated from peripheral blood

cells. The genotypes of the study variant were determined using the PCR-RFLP method and agarose gel was used for analysis.

Reseults analysed in statistically using χ2 and Fisher Freeman Halton tests, p<0,05 was considered statistically significant.

Results and Discussion: Mean age was 29,17±7,99 for group SUD and 31,01±10,77 for control group. Mean age to start using

substance was 16,95±6,7 for the group has SUD and it was associated with having psychosis. It was not determined any significant

difference between the groups regarding genotype/allele frequency of COMTs, IL-17, UCP2 and CNR2-rs2501432 variants. However

CNR2-rs2229579 variant TT genotype and T allel frequency were significantly higher in group SUD than controls. It was detected

that COMT Val158/108Met Val/Val genotype and Val allele frequencies were significantly different between polysubstance users and

only one substance users (p<0,05). COMT enzyme activities are play important role in polysubstance use disorders and Val can be

key allele.

In conclusion, this study suggested that high-activity of COMT may be associated with susceptibility to polysubstance uses while

low-activity of COMT may play a role in protection aganist polysubstance use disorders. CNR2-rs2229579 variant of T allele may be

risk factor in SUD.

Keywords: Substance use disorders, COMT, CNR2, IL-17 and UCP2.

References: [1] Levran, O; Peles, E. 2015,16,1329-42.

[2] Di Marzo, V; Stella, N. 2015, 16, 30–42.

[3] Zammit, S; Owen, M. J. 2011, 199, 380–385.

[4] Christoffersen, D.J; Damkier, P, 2016, 119, 381–388.

Acknowledgements: This study was supported by Istanbul University BAP thesis project (No: TYL-2016-20431) support programe.

http://www.nature.com/nrn/journal/v16/n1/pdf/nrn3876.pdf#auth-1

http://www.nature.com/nrn/journal/v16/n1/pdf/nrn3876.pdf#auth-2




63

IDDGC17-OP-154

THE EFFECTS OF POPULAR DIETS ON METABOLISM

Cansu Teke1, Akın Tekcan

2

1 Ahi Evran University, Health Sciences Institute, Department of Molecular Medicine, Kırşehir, Turkey

[email protected] 2 Ahi Evran University, Faculty of Medicine, Department of Medical Biology, KırĢehir, Turkey

[email protected]

Aims and Scopes: Obesity is the exceeding body weight according to height as a result of excessive increase of body fat mass

relative to lean mass. There are many diets under the title of popular diets as much reduced in calories, starvation diets and single food

diets by consuming applied. Although the majority of this type dietary recommendations provide rapid weight loss, the effects of this

diets are not fully known on the body and metabolism and these suggestions mostly aren‘t based on any scientific data [1]. This study

is aimed to revealing the effect of popular diets on body metabolism.

Materials and Methods: Data about the effect of popular diets were collected from the PubMed and Google Scholar databases using

some keywords as ―popular diets, metabolism and popular weight loss diets‖.

Results and Discussion: The literature information related to popular diets pointing when they are leaven, the lost weıghts are usually

taken back. And, after these process, the weight lost becomes more difficult than before for persons [1]. In the formation of obesity,

the major reason is to get more energy from the spent energy for a long time. In addition to impairment in energy balance, it is also

known that differences in daily physical activity, genetic factors and urbanization, socio-economic status, educational status,

occupational conditions, marital status, and consciousness levels also pave the way for the formation of obesity [1, 2]. Diet is a

person-specific nutrition program that is planned in consideration of many factors such as the health status of the person, diet, social

and psychological state, physical activity level. Healthy weight loss is up to 0.5-1 kg per week. Popular diets that have been put on the

market for commercial reasons and that affect people's aesthetic concerns with a minimum effort and look and feel better are short-

lived and long-term popularized diets that adversely affect the weight and health of most people, leading to increased weight gain [3].

Since most of these diets contain low calories, they can weaken people when applied, but they are usually not maintained with these

diets [4].

Keywords: Popular diet, hunger, calorie, healthy weight, obesity, diet

References:

[1] Çiftçi H. (2009). Obezitede Tıbbi Beslenme Tedavisinde Öğün Sayısının Vücut ağırlık Kaybı, Vücut Kompozisyonu ve Bazı

Biyokimyasal Bulgulara Etkisi. Hacettepe Üniversitesi. Sağlık Bilimleri Enstitüsü, Beslenme ve Diyetetik Programı, Doktora tezi,

Ankara.

[2] Ayar, K. (2009). Normal Kilolu, Kilolu ve Obez Bireylerin Obezite ve Obezite İlişkili Hastalıklar Hakkındaki Bilgi Düzeylerinin

Değerlendirilmesi ve Karşılaştırılması. Uludağ Üniversitesi Tıp Fakültesi. İç Hastalıkları Ana Bilim dalı, Uzmanlık Tezi, Bursa.

[3] Bryngelsson S, Asp NG. Popular diets, body weightandhealth: What is scientifi cally documented? Scand J Nutr

2005;49(1):1520.

[4] Williams L, Germov J, Young A. Preventing weight gain: A population cohort study of then ature and effectiveness of mid-age

women‘s weight control practices. Int J Obes (Lond) 2007;31(6):978-86.





64

IDDGC17-OP-155

Role of Nigella sativa on TIGAR-Autophagy and Apoptotic Pathway in Human Prostate Cancer Cell Line

Merve Kıvrık

1, Yusuf Toy

1, Aryan Mahmood Faraj

2, Ġbrahim Halil Geçibesler

3, Seda Karabulut

3, Can Ali Ağca

1* 1 Department of Molecular Biology And Genetics, Faculty of Science and Art, Bingol University, 12000 Bingol, Turkey,2017,

[email protected] 2 Department of Food industry, Technical college of Applied science, Sulaimani Polytechnic University, Iraq, 2017

3 Department of Chemistry, Faculty of Science and Art, Bingol University, 12000 Bingol, Turkey,2017

Aims and Scopes: The adenocarcinoma of the prostate is the development of cancer in the prostate which starts from gland cells, the

most common cancer and the third most common cancer cause of death among men. Nigella sativa is a plant belonging to the

wedding flowers (Ranunculaceae) family. Different 12 species of Nigella genus are grown in the Turkey. Extracts from black seeds

and seeds are still used today in many diseases such as colds, headache and asthma in the general population in the Middle East and

Asian countries. N.sativa and its components have been found to have many pharmacological activities such as anti-tumor activity,

anti-bacterial activity, anti-inflammatory activity, antioxidant activity and immunity enhancer. Autophagy means self-eating as a

word. Autophagy is the mechanism by which intracellular macromolecules and organelles are taken into a vesicle and disintegrated

through lysosomal organelles. Apoptosis is a self-destructive activity in the name of protecting the internal balance of an organism

and removing undesired cells. The aim of this study investigated the apoptosis and autophagic effect of N.sativa methanol extract in

cultured human prostate cancer cell line.

Materials and Methods: PC3 cell treated with N. Sativa different concentration (10, 25 and 50 µg/ml) and 10 µg/ml DMSO

(Negative Controls) for 24 hours, then MTT assay was performed for developing anti-cell viability affect. Agarose gel electrophoresis

was performed to indicate apoptosis. Clonogenic assay to demonstrate the effect of N. Sativa on the colony-formation ability of cancer

cells. Western blot was performed for some apoptosis and autophagic marker (TIGAR, LC3, p53 and caspase-3) proteins.

Results and Discussion: The result of this study demonstrated, N. Sativa extracts, dose-dependent manner, inhibits PC3 cell

proliferation. N. Sativa extracts, increases caspase-3 and p53 protein expression and decreased the expression of TIGAR protein, also

modulates the conversion of LC3 protein type-I to LC3 protein type-II. The also, clonogenic assay result shows that N. Sativa

decreases PC3 cell colony formation. Consequently, N. Sativa took away PC3 cell to DNA fragmentation and apoptosis in a dose-

dependent manner. In conclusion, our finding indicates that N. Sativa play a significant role as PC3 cell proliferation inhibitor and

based on DNA fragmentation and p53-dependent activated caspase-3, up-regulated apoptosis.

Keywords: PC3, Nigella sativa, Autophagy, Apoptosis

REFERENCES [1]- Jemal A, Murray T, Ward E, Samuels A, Tiwari RC, Ghafoor A, et al. Cancer statistics, 2005. CA Cancer J Clin 2005;55:10-30.

[2]- Tuna B, Patoloji Dernekleri Federasyonu, Dokuz Eylül Üniversitesi, Tıp Fakültesi Patoloji Anabilim Dalı, 2005, İzmir [3]- Türker L, Bayrak A, Çörek otu(Nigella sativa)‘nın Sabit ve Uçucu Yağ Kompozisyonunun Araştırılması Standart, 1997;430:128-137.

[4]- Swamy SM, Tan BK. Cytotoxic and immunopotentiating effects of ethanolic extract of Nigella sativa L. seeds. J Ethnopharmacol 2000;70(1):1-7.

[5]- Medenica R, Mukerjee S, Huschart T, Koffskey J, Corbit W. Nigella sativa plant extract increases number and activity of immune component cell in humans. Exp Hematol

1993;21(8):1186.

[6]- Arslan, D.Ö., Korkmaz, G., Gözüaçık, D. (2011). Otofaji: Bir HücreselStres Yanıtı ve Ölüm Mekanizması. Acıbadem Universitesi Sağlık Bilimleri Dergisi, 2 (4), 184-194.

[7]- Xie, Z.,Klionsky, D.J. (2007). Autophagosome formation: core machinery and adaptations. Nature Cell Biology, 9 (10), 1102-1109.

[8]- Kuma A, Mizushima N. Physiological role of autophagy as an intracellular recycling system: with an emphasis on nutrient metabolism. Semin. Cell Dev.Biol. 2010 21, 683

[9]-Hızel N. Apoptoz (Programlanmış Hücre Ölümü). Sürekli Tıp Eğitimi Dergisi 1997; 6:196-7. [10]-Barisic K, Petrik J, Rumora L (2003): Biochemistry of apoptotic cell death Acta Pharm, 53:151-16





65

IDDGC17-OP-156

NEW rRNA PRIMERS FOR THE DETECTION OF VIBRIO ANGUILLARUM

Meriç Lütfi Avsever

Aksaray University, Eskil Vocation of High School, Laboratory and Veterinary Sciences, Aksaray, Turkey

Aims and Scopes: In this study we aimed at diagnosis with a new primer couple on V. anguillarum isolates which were previously

identified with amiB gene specific universal primers and investigation of the sensitivity and specificity of these new primers.

Materials and Methods: In this study, 51 V. anguillarum isolates (MC1-51, 42/51 were O1 serotype, 9/51 were O2) obtained from

cultured marine fish, and identified/confirmed with conventional microbiological methods and amiB gene specific universal primers

by Avsever and Ün (2015) were used. Isolates were obtained from 6 different locations in the Aegean region (Milas, Dikili, Urla,

Çeşme, Karaburun, Didim), and from 5 different fish species (sea bass, sea bream, sharpsnout sea bream, meagre and turbot). The

strains used to investigate sensitivity of primers were taken from the Culture Collection of the laboratory (Fish Diseases NRL,

Turkey).

Results and Discussion: New primers were observed to confirm 51 V. anguillarum isolates (42/51 were O1 serotype, 9/51 were O2)

accurately (100 %) and no cross-reactions with other strains were found. The DNA detection limit was 12.5 ng (0.92 x104 CFU).

Many primer couples have been reported for V. anguillarum. But the sensitivity and specificity rates of these primers may be low.

Also there may be errors or lack of reliability in primer sequences. Thus, it is a recommended solution for researchers to design their

own primers. However, the sensitivity and specificity of newly designed primers should be established.

Keywords: Listonella (Vibrio) anguillarum, detection, new RNA primers.

References:

Avsever M.L.; Ün C. 2015. Distribution of hemolysin genes in Turkish Vibrio anguillarum isolates. Bull Eur Ass Fish Pathol., 35 (3): 74-83.

Hong G.E.; Kim D.G.; Bae J.Y.; Ahn S.H.; Bai S.C; Kong I.S. 2007. Species-specific PCR detection of the fish pathogen, Vibrio anguillarum,

using the amiB gene, which encodes N-acetylmuramoyl-L-alanine amidase. Source Department of Biotechnology and Bioengineering, Pukyong

National University, Busan, Korea, 608-737p.

Dorsch M.; Lane D.; Stackebrandt E. 1992. Towards a phylogeny of the genus Vibrio based on 16S rRNA sequences. Int J Syst Bacteriol, 42: 58-

63.

González S.; Osorio C.R.; Santos Y. 2003. Development of a PCR-based method for the detection of Vibrio anguillarum in fish tissue and blood

samples. Dis Aquat Organ, 55: 109-115.




66

IDDGC17-OP-157

BABY’S DNA IN MOTHER’S BLOOD: AN EARLIER LOOK AT BABY’S

GENES

Ebru Dündar Yenilmez1, Abdullah Tuli

1

1Çukurova University, Faculty of Medicine, Department of Medical Biochemistry, Adana, Turkey

[email protected]

Aims and Scopes: Prenatal diagnosis is testing for detection of diseases in a fetus before it is born

[1]. The discovery of cell-free fetal DNA (cffDNA) in maternal plasma/serum and the

demonstration of the relative ease and reliability with which it can be detected have opened up

new possibilities for noninvasive prenatal diagnosis [2-4]. This study aimed to investigate the sex

determination of fetal derived Y-chromosomal sequence using cffDNA in maternal blood at 6-12

weeks of gestation.

Materials and Methods: Fetal DNA of 104 pregnant women at 6 and 12 weeks of gestation

included in the study. Maternal blood samples centrifuged to seperate the plasma [5,6]. Fetal DNA

extracted from maternal plasma. Gender determined region Y (DYS14) gene expression with the

housekeeping gene (beta-actin) as internal control examined with qRT-PCR using specific primers

and probes [6].

Results and Discussion: The accuracy of sex determination with DYS14 genes using qRT-PCR in

6-12 weeks of pregnancy were 100%. The gender of baby‘s confirmed after delivery. Fetal sex

determination using fetal DNA with qRT-PCR is a reliable method in early pregnancy for

noninvasive prenatal diagnosis of X-linked disorders. Also the detection of cffDNA in maternal

plasma and serum has led to clinical applications for the identification of fetal aneuploidies, pre-

eclamptic pregnancies, noninvasive diagnosis of fetal Rhesus D genotype and some single gene

disorders. The detection of fetal DNA sequences is a reality and could reduce the risk of invasive

techniques for certain fetal disorders in the near future.

Keywords: Cell-free fetal DNA, noninvasive prenatal diagnosis, DYS14, qRT-PCR

References:

[1] Yenilmez ED, Archives Medical Review Journal 2013; 22(3): 317-34.

[2] Lo YMD, Chiu RWK. Nat Rev Genet 2007; 8:71-7.

[3] Bianchi DW Placenta, 2004; 18: 93-101

[4] Chiu RWK, Cantor CR, Lo YMD. Trend Genet 2009; 25: 324-31.

[5] Yenilmez ED, Prenatal Diagnosis 2013; 33: 1054-62.

[6] Yenilmez ED, International Journal of Current Medical Research 2015; 4(2): 344-47.




67

IDDGC17-OP-158

EVALUATION OF THE RELATIONSHIP BETWEEN HLA-B27 / IL-23R POLYMORPHISM IN

ANKYLOSAN SPONDYLITIS

Hülya Deveci1, Ayla Çağlıyan Türk2, Köksal Deveci3 1Department of Physical Medicine and Rehabilitation, GaziosmanpaĢa University School of Medicine, Tokat, Turkey

2 Department of Physical Medicine and Rehabilitation, Hitit University Çorum Training and Research Hospital, Çorum, Turkey

3Department of Biochemistry, GaziosmanpaĢa University School of Medicine, Tokat, Turkey

Aims and Scopes:Ankylosing spondylitis is a major subtype of a group of chronic inflammatory diseases known as

spondyloarthropathies (1). Ankylosing spondylitis (AS) is a complex disease involving multiple risk factors, both genetic and

environmental. HLA-B27 has been known to be the major AS-susceptibility gene for more than 40 years (2). Despite advances made

in the past few years, progress in the search for non-human leukocyte antigen susceptibility genes has been hampered by the

heterogeneity of the disease (3). IL-23R is a key factor in the regulation of a newly defined effector T-cell subset, TH17 cells (4). The

aim of this study was to demonstrate a potential functional role of HLA-B27 positivity and IL23R polymorphism in AS.

Materials and Methods: Blood samples were collected from 105 AS patients (78 males and 27 females, mean age 39.4 ± 11.7 years)

who were diagnosed with AS according to the modified New York criteria in the study. The disease activity was assessed by the

Turkish version of BASDAI and the functional status was measured by BASFI. The clinical status was evaluated by BASMI. Venous

blood was collected in EDTA tubes from patients with AS. Genomic DNA was isolated in venous whole blood using the Exgene

Clinic SV kit (GeneAll Biotechnology, Korea). DNA samples were amplified by PCR using forward (5

'CTTTCATTAACAGAGGAG 3') and reverse (5 'TAAGCCTCATTTAAGTCACC 3') primers designed specifically for RS11209026

and RS4131362 SNPs in the IL-23R gene (Sentegen Biotech, Turkey). PCR products were purified using the Expin Cleanup kit

(GeneAll Biotechnology, Korea). DNA sequencing was performed by the sanger method using a Hitachi 3130xl genetic analyzer

(Applied Biosystems, USA) with POP-7TM polymer. Chromatograms were visualized with sequencing analysis software v5.3.1 and

evaluated using SeqScape software v2.6.0. HLA-B27 genotyping was performed on a Fluorion Detection System (Iontek, Turkey)

using Real-Time PCR method using HLA B27 QLP 1.0 (Iontek, Turkey) commercial kit.

Results and Discussion: The genotype of p.Arg381Gln variant (allele A) was present in 3.7% of AS patients. The allele G/A was

also expressed in rs41313262. The genotype of p.Val362Ile variant (allele A) was present in 8.3% of AS patients. In the group as a

whole, there was no significant difference the clinic parameters (BASDAI, BASFI, BASMI) examined in patients with the IL-

23R minor (heterozygous; IL-23R 362Val/Ile ) genotype as compared with the major genotype (IL-23R 362Val/Val). HLA-B27 was

positive in 64 of 105 AS patients (61%). The genotype of p.Arg381Gln variant (allele A) was present in 3.7% of HLA-B27(+) group

and 2.5% of HLA-B27(-) group [p = 0.490, odds ratio (OR) = 0.366]. The genotype of p.Val362Ile variant (allele A) was present in

14.1% of HLA-B27(+) group and 2.4% of HLA-B27(-) group [p = 0.044, odds ratio (OR) = 4.660]. When the mean values of

BASDAI in the HLA-B27(+)/IL-23R rs41313262 minor group as compared with the HLA-B27(-)/IL-23R rs41313262 major group,

there was found significantly down the values of BASDAI in minor group (p=0.018). A functional study of IL23R variants has not

been reported so far. It is not yet clear how the IL23R variation affects susceptibility to disease and how much it spreads to the

mechanisms, in studies that target IL-23(4,5). Our findings showed that the IL23R variant rs4131362 in HLA-B27(+) patients was

seen more frequently than the IL23R variant rs11209026. This is an interesting finding for us. Because previous studies have focused

on the IL23R variant rs11209026 and have been linked to the pathogenesis of the disease. In addition, the low level of BASDAI

values in HLA-27(+) patients with this variability suggested that this genotypic association might be a determining factor in disease

activity.

Keywords: Ankylosing spondylitis, HLA-B27, IL-23R

References: 1. Elias, D.; Jaypal, R.; Fernando, L.V.; Juan, S.U. ANKYLOSING SPONDYLITIS. A review of the pathogenesis of ankylosing spondylitis.

Neurosurgical Focus January 2008, 24, E2

2. Tsui, F.W.; Tsui H.W.; Akram, A.; Haroon, N.; Inman, R.D. The genetic basis of ankylosing spondylitis: new insights into disease pathogenesis.

Appl Clin Genet. 2014, 22, 105-115.

3.Chaoqun, Y.; Peipei, D.; Qingkai, W.;, Long, Z.; Xin, Z.; Jianquan, Z.; Enjie,X. Inhibition of Complement Retards Ankylosing Spondylitis

Progression. Scientific Reports 6:1. . Online publication date: 2016.

4. Burton, P.R.; Clayton, D.G.; Cardon, L.R. Wellcome Trust Case Control Consortium; Australo-Anglo-American Spondylitis Consortium (TASC).

Association scan of 14,500 nonsynonymous SNPs in four diseases identifies autoimmunity variants. Nat Genet 2007, 39, 1329–1337

5. Di Meglio, P.; Di Cesare, A.; Laggner, U.; Chu, C.C., Napolitano, L.; Villanova, F., Nestle, F.O. The IL23R R381Q gene variant protects against

immune-mediated diseases by impairing IL-23-induced Th17 effector response in humans. PLoS ONE, 2011, 6, 2.




68

IDDGC17-OP-159

FUNCTIONIONAL EVALUATION OF ERF GENE CLONED FROM SALT TOLERANT COMMON

BEAN IN TRANSGENIC TOBACCO PLANT

ġafak Esra ASLAN1, Zafer SEÇGĠN

1, Gökhan GÖKDEMĠR

1, Musa KAVAS

1

1Ondokuz Mayıs Üniversity, Faculty of Agriculture, Department of Agricultural Biotechnology, 55139 Kurupelit/Samsun

(E-Posta: [email protected])

Aims and Scopes: The ubiquity of abiotic stresses such as drought, soil salinity and temperature extremes has driven plants to evolve

a variety of survival strategies. A common mechanism includes the regulation of transcription of genes involved in the response to

stress [1-3]. AP2/ERF is one of the most important transcription factors families that are involved in plant response to biotic and

abiotic stresses [4]. Based on the presence of the AP2/ERF DNA binding domain, 180 genes encoding putative AP2/ERFs have been

identified in Phaseolus vulgaris [5]. Aim of this study to determine the function of the PvAP2-ERF100 gene cloned from the common

bean plants in transgenic tobacco plant.

Materials and Methods: In silico analysis of transcriptome data obtained from salt tolerant common bean genotype (ispir) revealed

that some of the AP2-ERF transcription factor genes were differerentially upregulated during salt stress response. Within the scope of

this study, PvAP2-ERF100 gene determined as differentially expressed by bioinformatics analysis was cloned from salt tolerant

common bean plant and transferred to tobacco plant by Agrobacterium tumefaciens. In this context, the target gene was amplified

with the help PCR by using cDNA from roots exposed to salt stress. Cloned gene was transferred into the pENTR/D-TOPO to

generate gateway cloning system compatible entry vector. The generated entry vector was transferred to competent E. coli cells and

the colonies carrying the gene were determined using PCR. Vectors isolated from positive colonies were sent for sequence analysis

and the gene sequence was verified. To create the plant expression vector carrying the gene PvAP2-ERF100, recombination was

carried out between the entry vector and the plant expression vector (pIPKb0004) using the LR clonase enzyme. The final plant

expression vector isolated from the positive colonies were transferred to competent A. tumefaciens cells by electroporation. Four

weeks old tobacco (Nicotiana tabacum L. cv., Petite havana) leaves were inoculated with A. tumefaciens. Transient transgenic tobacco

plants were obtained by incubation for 8 weeks on MS media includeding BA (1mg/l), NAA (0.1mg/l), Hygromycin (50mg/l) and

Timentin (160mg/l). The regenerated tobacco plant was transferred to the growth chamber. Molecular and functional characterization

experiments will be performed on germinated T1 plants.

Results and Discussion: PvAP2-ERF100 was cloned using PCR-based cloning techniques and transferred to tobacco plants. The

presence and function of the gene transcribed in the candidate transgenic plants will be confirmed by molecular and biochemical

techniques.

Keywords: PvAP2-ERF100, Common bean, A. tumefaciens, Gateway cloning

References:

1. Dong, W., et al., Isolation and characterization of a bread wheat salinity responsive ERF transcription factor.

Gene, 2012. 511(1): p. 38-45.

2. Munns, R. and M. Tester, Mechanisms of salinity tolerance. Annu. Rev. Plant Biol., 2008. 59: p. 651-681.

3. Mizoi, J., K. Shinozaki, and K. Yamaguchi-Shinozaki, AP2/ERF family transcription factors in plant abiotic

stress responses. Biochimica et Biophysica Acta (BBA)-Gene Regulatory Mechanisms, 2012. 1819(2): p. 86-96.

4. Zhu, Q., et al., The Arabidopsis AP2/ERF transcription factor RAP2. 6 participates in ABA, salt and osmotic

stress responses. Gene, 2010. 457(1): p. 1-12.

5. Kavas, M., et al., Genome-wide investigation and expression analysis of AP2-ERF gene family in salt tolerant

common bean. EXCLI journal, 2015. 14: p. 1187.




69

IDDGC17-OP-160

OPTIMIZATION OF TISSUE CULTURE AND REGENERATION PARAMETERS OF TOMATO

(LYCOPERSICON ESCULENTUM MILL.)

Derya SANCAK1, Zafer SEÇGĠN,

1Musa KAVAS

1

1Ondokuz Mayıs University, Faculty of Agriculture, Department of Agricultural Biotechnology, 55139 Kurupelit/Samsun


Aims and Scopes: There are many tissue culture studies with different purposes are carried out in tomatoes. One of the application

areas of tissue cultures is the transfer of foreign genes into plants by genetic engineering techniques [1, 2]. Tomato is accepted as a

model plant for the transfer of agriculturally important genes in dicotyledons. The first requirement of successful genetic

transformation is the development of an in vitro regerenartion system suitable for that plant species [3]. For this reason, it is important

to optimize in vitro culture techniques for that plant species or for certain genotypes [4]. Aim of this study is to evaluate the effects of

different plant growth regulators and culture conditions on the plant regeneration efficiency in Rio Grande hybrid cultivar of tomato.

Materials and Methods: Tomato seeds will be germinated in half-strength (½) Murashige-Skoog (MS) medium and cotyledon leaves

(5x5 mm) and hypocotyls (5 mm) of 10-day sterile seedlings was used as an explant. The 10 day explants was cultured in semi-solid

MS medium containing plant growth regulators (IAA, NAA, BAP, Kinetin, TDZ) at different concentrations with combinations and

incubated at 25 ° C for 8-16 hours at photoperiod for 20 days. Forty days after the first incubation, callus induction and shoot

formation of the plants was determined. By using statistical analysis, a suitable medium was determined.

Results and Discussion: In the photoperiodic condition, 3 mg/l of kinetin + 0.1 mg/l IAA and 2 mg/l BAP + 0.1 mg/l IAA hormone

concentrations were evaluated as the best medium for successful tomato regeneration by cotyledon leaves.

Keywords: Lycopersicon esculentum Mill, Regeneration, Tissue culture

References:

1. Yılmaz, E. and B. Bürün, İn Vitro Koşullarda Domates (Lycopersicon esculentum Mill.) Bitkisinde Hipokotil ve

Kotiledon Eksplantlarından Kallus ve Sürgün Oluşumu. Süleyman Demirel Üniversitesi Fen Bilimleri Enstitüsü

Dergisi, 2014. 18(3).

2. Babaoğlu, M., M. Yorgancılar, and M. Akbudak, Doku kültürü: temel laboratuar teknikleri. Bitki Biyoteknolojisi

I, Özcan, S., Gürel, E., Babaoğlu, M., SÜ Basımevi, 2001.

3. Osman, M.G., E.A. Elhadi, and M.M. Khalafalla, Callus formation and organogenesis of tomato (Lycopersicon

esculentum Mill, CV Omdurman) induced by thidiazuron. African Journal of Biotechnology, 2010. 9(28): p.

4407-4413.

4. Mohamed, A.-a.N., M.R. Ismail, and M.H. Rahman, In vitro response from cotyledon and hypocotyls explants in

tomato by inducing 6-benzylaminopurine. African Journal of Biotechnology, 2010. 9(30): p. 4802-4807.




70

IDDGC17-OP-161

ROLE OF HISTONE MODIFICATION PROFILE IN GASTRIC CANCER DEVELOPMENT

Seda Orenay-Boyacioglu 1, Elmas Kasap

2, Emre Gerçeker

3, Hakan Yuceyar

2, Ufuk Demirci

4, Fahri Bilgic

4,

Mehmet Korkmaz 5.

Department of Medical Genetics, Medical Faculty, Adnan Menderes University, Aydın, Turkey1

Department of Gastroenterology, Medical Faculty, Celal Bayar University, Manisa Turkey2

Department of Gastroenterology, Gazi Hospital, Izmir Turkey3

Department of Internal Medicine, Medical Faculty, Celal Bayar University, Manisa Turkey4

Department of Medical Biology, Medical Faculty, Celal Bayar University, Manisa Turkey5

[email protected],[email protected], ,[email protected]

,[email protected],[email protected],[email protected],[email protected]

Abstract

Aims and Scopes: Atrophic gastritis (AG), Intestinal Metaplasia (IM) and Helicobacter pylori (HP) are risk factors for the

development of gastric cancer (GC)1. Histone modifications are one of the epigenetic mechanisms that may have key roles in the

carcinogenesis of GC) 2-4. We aimed in the present study to investigate the alternations in the defined histone modification gene

expression profiles in patients with AG, IM, and GC.

Material-Methods: Prospectively, 100 cases including 28 gastric cancer, 25 intestinal metaplasia, 27 atrophic gastritis, and 20

control subjects were included in the study. Expressions of 8 key genes responsible for histone phosphorylation (PAK1, NEK6,

AURKA) and histone deacetylation (HDAC 1-2-3-5-7) in GC, IM, and GA, were evaluated by Real Time qPCR assay method. GC

patients were divided into subgroups according to tumor localization and presence of metastasis, which have prognostic significance

and reflects tumor burden. Gene expression analysis was performed in the AG and IM groups after dividing the patients into

subgroups according to to the presence of Helicobacter pylori (HP) in gastric mucosa, which is a risk factor for developing GC in

patients with AG and IM. Data were analyzed using Real Time qPCR primer assay data analysis software

(http://www.sabiosciences.com/pcrarraydataanalysis.php). A p value under 0.05 was regarded as statistically significant.

Results and Discussion: PAK1 gene was significantly over expressed in AG compared to GC group (p=0.0004). NEK6 and AURKA

genes were significantly upregulated in IM than in GC (p=0.034 and p=0.004, respectively). AURKA was also significantly

upregulated in IM compared to AG (p=0.005). AURKA and PAK1 genes were significantly over expressed in AG HP(-) group

compared to the IM HP(-) group (p=0.049 and p=0.038, respectively). No significant differences were observed between the AG

HP(+) and IM HP(+) groups regarding the expression levels of these eight genes. In conclusion, this study suggests that expressions

of AURKA, NEK6, HDAC2, and PAK1 may be considered as diagnostic markers to be used for GC screening in AG and IM patients.

Aims and Scopes: Atrophic gastritis (AG), İntestinal Metaplasia(IM) and Helicobacter pylori (HP) are risk factors

for the development of gastric cancer (GC) 1. Histon modifications are one of the epigenetic mechanisms that may have key roles in

the carcinogenesis of GC 2-4. We aimed in the present study to investigate the alternations

in the defined histon modification gene expression profiles in patients with AG, IM and GC.

Keywords: Gastric cancer, Intestinal metaplasia, atrophic gastritis, histone modification, epigenetics

References:

1 Tsugane S, Sasazuki S. Diet and the risk of gastric cancer: review of epidemiological evidence. Gastric Cancer 2007; 10:75.

2 Kang C, Song JJ, Lee J, Kim MY. Epigenetics: an emerging player in gastric cancer. World J Gastroenterol. 2014 Jun

7;20(21):6433-47.

3 Yang WY, Gu JL, Zhen TM. Recent advances of histone modification in gastric cancer. J Cancer Res Ther. 2014 Dec;10

Suppl:240-5.

4 Shi J, Qu YP, Hou P. Pathogenetic mechanisms in gastric cancer. World J Gastroenterol. 2014: 20(38): 13804-13819






http://www.sabiosciences.com/

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kang%20C%5BAuthor%5D&cauthor=true&cauthor_uid=24914365

http://www.ncbi.nlm.nih.gov/pubmed/?term=Song%20JJ%5BAuthor%5D&cauthor=true&cauthor_uid=24914365

http://www.ncbi.nlm.nih.gov/pubmed/?term=Lee%20J%5BAuthor%5D&cauthor=true&cauthor_uid=24914365

http://www.ncbi.nlm.nih.gov/pubmed/?term=Kim%20MY%5BAuthor%5D&cauthor=true&cauthor_uid=24914365

http://www.ncbi.nlm.nih.gov/pubmed/24914365

http://www.ncbi.nlm.nih.gov/pubmed/?term=Yang%20WY%5BAuthor%5D&cauthor=true&cauthor_uid=25693927

http://www.ncbi.nlm.nih.gov/pubmed/?term=Gu%20JL%5BAuthor%5D&cauthor=true&cauthor_uid=25693927

http://www.ncbi.nlm.nih.gov/pubmed/?term=Zhen%20TM%5BAuthor%5D&cauthor=true&cauthor_uid=25693927


http://www.ncbi.nlm.nih.gov/pubmed/?term=Shi%20J%5BAuthor%5D&cauthor=true&cauthor_uid=25320518

http://www.ncbi.nlm.nih.gov/pubmed/?term=Qu%20YP%5BAuthor%5D&cauthor=true&cauthor_uid=25320518

http://www.ncbi.nlm.nih.gov/pubmed/?term=Hou%20P%5BAuthor%5D&cauthor=true&cauthor_uid=25320518





71

IDDGC17-OP-162




72

IDDGC17-OP-163

DETERMINATION OF MUTAGENIC EFFECTS OF ALUMINIUM ACETATE BY AMES TEST

Dilek Akyıl1, Arzu Özkara

1, Yasin Eren

2, Sevim Feyza ErdoğmuĢ

3

1Department of Molecular Biology and Genetic, Faculty of Arts and Sciences, Afyon Kocatepe University, Afyonkarahisar/TURKEY

2Department of Science, Faculty of Education, Suleyman Demirel University, Isparta/TURKEY

3Department of Laboratory and Veterinary Health, Technical Vocational School of Bayat, Afyon Kocatepe University, 03780,

Afyonkarahisar, Turkey

Corresponding author; [email protected]

Aims and Scopes: Aluminum acetate is a chemical which is extensively used for medicinal purposes. In this study we aimed to

determine that mutagenic effects of aluminium acetate by using a short term mutation assay in Salmonella typhimurium with both

TA98 and TA100 strains in the presence or absence of S9 mix, respectively.

Materials and Methods: Mutagenicity of aluminum acetate was determined using the standard plate incorporation assay. Salmonella

typhimurium strains TA98 and TA100 were used with or without S9 mix in this test [1, 2]. The tester strains were tested for the

presence of strain-specific markers as described by Maron and Ames [2]. Five different concentrations (62.5, 125, 250, 500, and 1000

µg/plate) of aluminum acetate was tested by Ames test. The S. typhimurium strains were incubated in nutrient broth at 37°C for 16 h

with shaking. The positive controls also were used in each tester strains. All test plates were incubated for 72 h at 37°C and then the

revertant colonies on each plate were counted. Experiments were run in triplicate for each concentration and all results from two

independent parallel experiments were used for the statistical analysis.

Results and Discussion: According to Ames test results, all concentrations were not mutagenic on TA98 and TA100 strains of

Salmonella typhimurium in the presence or absence of S9 mix except 1000 µg/plate of aluminium acetate. At this concentration of

aluminium acetate caused significantly (p≤0.05) revertant bacterial colonies on S. typhimurium strain TA 100 with S9 mix.

Mutagenicity and genotoxicity test systems are divided into two groups, including cytogenetic and bacterial methods. Bioassays with

prokaryotes give information about the gene mutations and primary DNA damage caused by an agent. On the other hand, analyses

with eukaryotes give information varying from gene mutations to chromosome damage and aneuploidies [3]. Even when test

compounds cross the bacterial cell wall; they cannot interact directly with DNA. In addition, even if their concentrations increase to

high levels in the cytoplasm, they cannot form complexes with specific binding sites in the bacterial genome [4]. The compounds

which were tested with different test methods can be genotoxic or not genotoxic depending on a lot of factors such as chemical

structure and biological activity of substances, rings in the structure of the chemicals and the positions of the binding location [5].

Keywords: Aluminium acetate, Ames test, mutagenicity, toxicity

References: [1] Ames, B.; McCann, J.; Yamasaki, E. Methods for detecting carcinogens and mutagens with the Salmonella/mammalian microsome mutagenicity

test, Mutation Research, 1975, 31, 347–364.

[2] Maron, D. M.; Ames, B. N. Revised methods for the mutagenicity test, Mutation Research, 1983, 113, 173–215.

[3] Leme, D. M.; Marin-Morales, M. A. Allium cepa test in environmental monitoring: A review on its application, Mutation Research, 2009, 682,

71–81.

[4] Kayaalp, O. Tıbbi Farmakoloji, Hacettepe Taş Yayınları, Ankara, 1995.

[5] Kutlu, M.; Öztaş, E.; Aydoğan, G.; Işıkdağ, İ.; Özkay, Y. An investigation of mutagenic activities of some 9- substitued phenanthrene derivatives

with Ames/Salmonella /Microsome test, Anadolu University Journal of Science Technology-C Life Science Biotechnology, 2011, 1, 83-94.

http://myo.metu.edu.tr/




73

IDDGC17-OP-164

Triticum aestivum Modulates p53/TIGAR Protein Expression in Human Colon Cancer HT-29 Cell Line

Busra Cimen1 Mahinur Kırıcı


3, Ġbrahim Halil Gecibesler

4, Can Ali Agca

1*

1Department of Molecular Biology and Genetics, Faculty of Arts and Sciences, Bingol University, Bingol, Turkey.

2Department of Chemistry, Faculty of Arts and Sciences, Bingol University, Bingol, Turkey.

3Department of Food industry, Faculty of Technical applied science, Sulaimani Polytechnic University, Iraq.

4Laboratory of Natural Product Research, Faculty of Health Sciences, Bingöl University, Bingöl, Turkey.

[email protected]

Aims and Scopes: Colon cancer is a type of cancer caused by polyps in the large intestine and the third most common cancer type in

the world and in our country [1]. Triticum aestivum (wheat grass root) has anti-ulcer, antioxidant and anti-cancer activity, but its

molecular mechanism of action has not yet been fully elucidated [2,3]. The tumor suppressor P53 protein is activated by a variety of

stress signals [4]. Recently discovered, TIGAR protein is an important regulator of glycolysis and apoptosis in cellular events [5]. In

this study, the effects of Triticum aestivum methanol root extract, by a different concentration (50, 100 and 200 µg/ml) on cell

proliferation and p53/TIGAR pathway protein expression, in HT-29 colon cancer cell line were established after 24 hours incubation.

Materials and Methods: HT-29 cells were treated with Triticum aestivum methanol root extract (50, 100 and 200 µg/ml) for 24h.

Cell proliferation were detected by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) analysis. p53 and TIGAR

proteins expression were checked by Western blot.

Results and Discussion: MTT assay result shows cell proliferation inhibition in a dose-dependent manner, but the effective doses

were 100 and 200 μg / ml after 24 hours about 30%. Unexpectedly, expression levels of p53 and TIGAR protein inhibited dose-

dependent manner. The results of this study demonstrate that Triticum aestivum has an anti-proliferative effect on the HT-29 cell line

and down-regulated the p53 / TIGAR pathway protein expression. According to these findings, may be induced p53 / TIGAR

dependent apoptosis.

Keywords: Triticum aestivum, HT-29, TIGAR, p53

References

1]Ayhan B. Effect of emodın ın human colon cancer cell lınes through the mıtochondrıal sıgnalıng pathway. Adnan Menderes University Institute Of

Science Sciences M.Sc. Thesis, Department of Biology, 2008, 4-10

2]Ben-Arye E, Goldin E, Wengrower D, Stamper A, Kohn R, and Berry E., Wheat grass juice in the treatment of active distal ulcerative colitis:a

randomized double-blind placebo-controlled trial. Scand J Gastroenterol, 2002, 444–449

3]Chiu LC, Kong CK, Ooi VE; The chlorophylli-induced cell cycle arrest and apoptozis in human breast cancer MCF-7 cells is associated with ERK

deactivation and cyclin D1 depletion. Int J Mol Med, 2005, 16 (4), s:735-740

4]G. Song, Y.B. Mao, Q.F. Cai, L.M. Yao, G.L. Ouyang, S.D. Bao. Curcumin induces human HT-29 colon adenocarcinoma cell apoptosis by

activating p53 and regulating apoptosis-related protein expression, Braz J Med Biol Res, December 2005, Volume 38(12) 1791-1798

5]Bensaad K, Tsuruta A, Selak M, Vidal M, TIGAR, a p53-inducible regulator of glycolysis and apoptosis, Cell. 2006 Jul 14;126(1):107-20.

This study was supported by TÜBİTAK (The Scientific and Technical Research Council of Turkey) (Project Numbers:

1919B011600937)






74

IDDGC17-OP-165

Molecular Typing of Actinomadura, Agromyces and Geodermatophilus Soil Samples Isolated From

Burgazada, Buyukada and Kinaliada

Salih Sarıcaoğlu1, Hilal Ay

1, Ahmet Rıdvan Topkara

1, Talha Gençbay

1, Kamil IĢık

1

1Ondokuz Mayıs University, Faculty of Arts and Sciences, Biology Department, Samsun

Aims and Scopes: Islands have been attractive habitats for biodiversity studies because they are land parts separated from mainland

at the end of long-lasting geomorphological processes. In this study, it was aimed to determine Actinobacteria diversity of Burgazada,

Büyükada and Kınalıada using soil samples of different localities.

Materials and Methods: After pre-treatments of soil samples with dilution plate [1] and 1.5 % phenol [2], microorganisms were

isolated using humic acid-vitamin agar [3], Bennett‘s agar [4] and tryptone-yeast extract-glucose agar [5] (TYGA) which are selective

isolation media for actinomycetes. After genomic DNA isolation of test strains, PCR amplification of 16S rRNA gene region was

conducted and the amplicons were sequenced. Sequence data was analysed on EzTaxon server [6] and phylogenetic dendrograms

were constructed on the basis of 16S rRNA gene sequences of test strains with the most closely related type species.

Results and Discussion: According to the phylogenetic analysis of test strains based on 16S rRNA gene sequences, the strains have

different similarity levels to different type species of Actinomadura, Agromyces and Geodermatophilus. These strains isolated from

Burgazada, Büyükada and Kınalıada soils are considered to have high potential to be novel taxa.

Keywords: Prince Islands, Actinomadura, Agromyces, Geodermatophilus

Acknowledgements: This study was supported by Ondokuz Mayis University (PYO. FEN. 1904.13.004).

References:

[1] Sivakumar, K. 2008. Actinomycetes. In Centre of Advanced Study in Marine Biology Annamalai University. [2] Istıanto Y., Koesoemowıdodo R. S. A., Saputra H., Watanabe Y., Pranamuda H., And Marwoto B. 2012. Application of Phenol Pretreatment for the Isolation of

Rare Actinomycetes from Indonesian Soil, Microbiology Indonesia, 6,42-47.

[3] Yamamura H., Hayakawa M., Limura Y., 2003. Application of sucrose-gradient centrifugation for selective isolation of Nocardia sp. from soil, Journal of Applied Microbiology, 95, 677–685.

[4] Jones, K.L., 1949. Fresh isolates of actinomycetes in which the presence of sporogenous aerial mycelia is a fluctuating characteristic. Journal of Bacteriology 57:

141-145. [5] Bower, C. S., Hucker, G. J., 1930. Tech. Bull. Geneva: New York State Agricultural Experiment Station, No: 228.

[6] Kim, O.S.,Cho, Y-J., Lee, K., Yoon, S.H., Kim, M., Na, H., Park, S.C., Jeon, Y.S., Lee, J.H., Yi, H., et al. 2012. Introducing EzTaxon-e: a prokaryotic 16S rRNA

gene sequence database with phylotypes that represent uncultured species. Int J Syst Evol Micr 62: 716–721.




75

IDDGC17-OP-166

DETERMINATION of BIOFILM FORMATION by Pseudomonas aeruginosa ISOLATED from RAW

MILK SAMPLES

Tuba YILDIRIM1, Ceren YAVUZ

1, Belgin SIRIKEN

2

Department of Biology, Faculty of Arts and Sciences, Amasya University, 05100, Amasya, Turkey

Departments of Aquatic Animal Diseases, Faculty of Veterinary Medicine, Ondokuz Mayıs University,

55200, Samsun, Turkey

Aims and Scopes: Due to complex biochemical structures and high water activity, the raw milk is extremely

suitable nutrient medium for pathogenic microorganisms [1]. The presence of the Pseudomonas aeruginosa,

which has clinical relevance among the microorganisms in milk, is one of the major health problems [2]. The

interaction of the intracellular signaling molecular consists biofilm and resistance genes transferred varies

antibiotic resistance profile. Biofilm is very important because of the effects on health in the food industry [3].

This study aims to investigate the Pseudomonas aeruginosa isolated from raw milk in terms of virulence factors

that is, biofilm capability.

Materials and Methods: Pseudomonas aeruginosa were isolated using classic culture technique [5] from

different raw milk samples consumed in Amasya province, and identified using Analytical Profile Index (API

20 NE) and Vitek System (bioMerieux Vitek Hazelwood). Antibiotic sensitiveness of isolated strains was

determined by disc diffusion and capacity of biofilm formation by microtitration tests. Moreover, Kongo Red

Agar method was used in the study of slime factor formation. N-acylhomoserine lactone was determined by

using cross-feeding test. The expressions of LasI, lasR, RhII ve RhIR genes under the control of biofilm were

identified by PCR [6].

Results and Discussion: In our study, 23 Pseudomonas aeruginosa were isolated from 50 raw milk samples.

Biofilm formation was determined in 11 Pseudomonas aeruginosa isolates. Furthermore, The slime factor was

determined in 11 Pseudomonas aeruginosa isolates. lasI gene was analysed in 7 of 23 isolates, lasR gene in 5

of 23 isolates, RhlI gene in 5 of 23 isolates, RhlR in 7 of 23 isolates.

In conclusion, Pseudomonas aeruginosa which isolated from raw milk displayed virulent properties. This is an

extremely important point when considering the pathogenic potential of a biofilm formation.

Keywords: Raw milk, Pseudomonas aeruginosa, virulence factor, biofilm.

Acknowledgements: This study was supported by the Amasya University Research Foundation (Project Code: FMB-BAP 15-0123).

References:

[1] Chambers, V.J. Dairy microbiology Handbook: The Microbiology of Milk and milk Products, 2002, ISBN:0-471-38596-4, 39.

[2] Arruda, E.A.G.; Marinho, I.S.; Boulos, M. Nosocomial infections caused by multiresistant Pseudomonas aeruginosa. Infect Control Hosp

Epidemiol 1999, 20, 620–623.

[3] Fuqua, C.; Winans, S.C.; Greenberg, E.P. Quorum sensing in bacteria: the LuxR-LuxI family of cell density-responsive transcriptional

regulators, Journal of Bacteriology, 1994, 176, 269–275.

[4] Food and Drug Administration U.S. (FDA) (2001). Staphylococcus aureus, Chapter 12. In Bacteriological Analytical Manual Online.

http://www.cfsan.fda.gov. EriĢim Tarihi: 20 Ocak 2009.

[5] Schaber, J.A.; Hammond, A.; Carty, N.L.; Willıams, S.C.; Colmerhamood, J.A.; Burrowes, B.H.; Dhevan, V.; Grđswold, J.A.; Hamood,

A.N. Diversity of biofilms produced by quorum-sensing-deficient clinical isolates of Pseudomonas aeruginosa. J Med Microbiol, 200756, 738-

748.

http://www.cfsan.fda.gov/




76

IDDGC17-OP-167

INVESTIGATION OF CLONAL RELATIONSHIP OF OXA-48 and NDM-1-PRODUCING Klebsiella

pneumoniae STRAINS

Azer ÖZAD DÜZGÜN 1, AyĢegül SARAL

2

1 GümüĢhane University, Faculty of Engineering and Natural Sciences, Department of Genetics and Bioengineering, Gumushane,

Turkey 2Artvin Çoruh University, Faculty of Health Sciences, Department of Nutrition and Dietetics, Turkey

[email protected]

Aims and Scopes: Metallo-β-lactamases are the most important factors of the resistance to β-lactams, in the last 50 years and they are

able to hydrolyze all β-lactam antibiotics, except aztreonam (1). In particular, the recently discovered NDM-1-type-MBL shows a

very broad-spectrum activity against antibiotics, such as carbapenems, cephalosporins and penicillins (2). The aim of this study is to

determine the transferability of blaNDM-1 and blaOXA-48 genes between different species.

Materials and Methods: Transferability of the antibiotic resistance was carried out using already defined protocol. The rifampin-

resistant E. coli K-12 strain J53-2 was used as a recipient (3). The transconjugants obtained from mating experiments were selected on

Eosin-methylene blue (EMB) agar. Transconjugants were identified using the API 32GN system (bioMerieux, Marcy-l‘Etoile,

France). Minimal inhibitory concentration values were determined by VITEK. The following antibiotics were tested: Ampicillin

sulbactam, piperacillin, piperacillin/tazobactam, ceftazidime, cefoperazone /sulbactam, cefepime, imipenem, meropenem, amikacin,

gentamycin, netilmicine, ciprofloxacin, levofloxacin, tetracycline, tigecycline. Genomic DNA isolation and Plasmid DNA isolation

were performed from the transconjugants. Transconjugants were screened for blaNDM-1 and blaOXA-48 genes by PCR.

Results and Discussion: Conjugation experiments were performed to determine whether the existing antibiotic resistance in K.

pneumoniae carrying blaNDM-1 / blaOXA-48 and blaNDM-1 genes was transferred. It has been determined that only 3 (from 7 strains)

strains of antibiotic resistance can be transferred. Resistance to ampicillin/sulbactam, piperacillin, piperacillin/tazobactam,

cefoperozone/sulbactam, imipenem and meropenem was found to be transferable. However, no blaNDM-1 gene was detected in

transconjugants by PCR. But blaOXA-48 gene was found in one of three transconjugants. The spread of MBLs among Gram-negative

pathogens are a very serious problem (4). More importantly, MBLs are carried with other resistance genes which restricted treatment

options with the formation of multi-resistance (5).Rapid spread of MBL are because of the mobile genetic elements such as plasmids,

transposable elements and ISC relationship between MBL genes (4,5). Spread of earned MBLs is a very crucial for infection control

and the treatment of patients

Keywords: Conjugation, NDM-1, OXA-48, plazmid

References:

[1] Palzkill, T. Ann N Y Acad Sci. 2013, 1277,91-104.

[2] Yong, D.; Toleman, M.A.; Giske, C.G.; H.S. Sundman, Cho, K.; Lee, K.; Walsh ,T.R. Antimicrob Agents Chemother 2009, 53,

5046–54.

[3] Cicek, A.C.; Duzgun, A.O.; Saral, A.; Sandalli, C. J Basic Microbiol 2014,54,1030-5.

[4] Cornaglia, G.; Giamarellou, H., Rossolini, G.M. Lancet Infect Dis, 2011,11, 381–393.

[5] Walsh, T.R.; Toleman,M.A.; Poirel, L.; Nordmann, P.Clin. Microbiol Rev, 2005,18, 306–325.




77

IDDGC17-OP-168

CA-IX AND CA-XII ISOENZYMES: BIOMARKERS OF CANCER?

Beyza Ecem Oz1, Ender Simsek

1, Ozen Ozensoy Guler

1

1 Department

of Medical Biology, Faculty of Medicine, Ankara Yildirim Beyazit University, Bilkent Campus, Ankara, Turkey,

[email protected]

Aims and Scopes: Carbonic anhydrases (CAs, EC 4.2.1.1) are one of the zinc enzymes which catalyze the reversible hydration of

carbon dioxide to bicarbonate ion and proton [1]. Carbonic anhydrase-IX (CA-IX) and Carbonic anhydrase-XII (CA-XII) are

transmembrane tumor-associated isoenzymes because their extracellular enzyme domains are highly active and their expressions are

induced by hypoxia [2] which is an important predictor of cancer progression and is associated with aggressive growth, metastasis,

and poor response to treatment [3]. These enzymes are highly expressed in many tumors which are involved in critical processes

related to the response to treatment and cancer process [2]. The aim of this study is to analyze activities of CA-IX and CA-XII

isoenzymes from biological samples in several type of cancers.

Materials and Methods: Activities of the CA-IX and CA-XII isoenzymes are measured by using a stopped-flow kinetic instrument

or elisa techniques. Stopped-flow spectroscopy which is a technique used to measure kinetic changes in solutions over millisecond-

second intervals [4]. There are commercial elisa kits for the activities of CA-IX and CA-XII are also determined by elisa technique.

Results and Discussion: The overexpression of CA-IX and CA-XII has been found in many types of solid tumors [5, 6]. Due to the

importance of these two tumor-associated isoenzymes in the cancer process, specific inhibitors for these isoenzymes have been

developed. It has been demonstrated that these inhibitors can be used to reduce proliferation and invasion capacity of cancer cells [7].

Besides, CA-IX and CA-XII regulate intracellular pH to provide survival of tumor cells, suggesting that these enzymes are important

challenges in the development of new anticancer drugs. As a conclusion, these isoenzymes are considered to be capable of introducing

new approaches to treatment in some clinical applications including cancer.

Keywords: Cancer, Carbonic anhydrase, Carbonic anhydrase-IX, Carbonic anhydrase-XII References:

[1] Alterio, V.; Di Fiore, A.; D’Ambrosio, K.; Supuran, C. T.;, De Simone, G. Chemical Reviews, 2012, 112, 4421-4468.

[2] Monti, S. M.; Supuran, C. T.; De Simone, G. Expert Opinion on Therapeutic. Patents, 2013, 23, 737-749.

[3] Wykoff, C. C.; Beasley, N. J.; Watson, P. H.; Turner, K. J.; Pastorek, J.; Sibtain, A.; Wilson, G. D.; Turley, H.; Talks, K. L.; Maxwell, P.

H.; Pugh, C. W.; Ratcliffe, P. J.; Harris, A. L. Cancer Research, 2000, 60, 7075-7083.

[4] http://www.chem.agilent.com/Library/applications/uv75.pdf

[5] Benej, M.; Pastorekova, S.; Pastorek, J. Subcell Biochem. 2014;75:199-219.

[6] Pastorekova, S.; Zatovicova, m.; Pastorek, J. Current Pharmaceutical Design, 2008, 14, 685-698.

[7] Parkkila, S.; Rajaniemi, H.; Parkkila, A. K.; Kivela, J.; Waheed, A.; Pastorekova, S.; Pastorek, J.; Sly, W. S. Proceedings of the National

Academy of Sciences, 2000, 97, 2220-4.

http://www.chem.agilent.com/Library/applications/uv75.pdf

https://www.ncbi.nlm.nih.gov/pubmed/?term=Benej%20M%5BAuthor%5D&cauthor=true&cauthor_uid=24146381

https://www.ncbi.nlm.nih.gov/pubmed/?term=Pastorekova%20S%5BAuthor%5D&cauthor=true&cauthor_uid=24146381

https://www.ncbi.nlm.nih.gov/pubmed/?term=Pastorek%20J%5BAuthor%5D&cauthor=true&cauthor_uid=24146381





78

IDDGC17-OP-169

A NEW APPROACH: LIQUID BIOPSY

(DETECTING CIRCULATING TUMOUR CELLS)

Tugba Kevser UYSAL1, Ender SIMSEK

1, Ozen Ozensoy GULER

1

1Department of Medical Biology, Faculty of Medicine, Ankara Yildirim Beyazit University, Bilkent Campus, Ankara, Turkey.

[email protected]

Aims and Scopes: Liquid biopsy is a non-invasive blood test detecting circulating tumour cells (CTCs) that are shed into the blood

from the primary tumour and from metastatic sites. The detection of CTCs may be useful in cases such as early diagnosis of cancer

patients, simultaneous monitoring of treatments, recurrence and prediction of prognosis [1, 2]. There are technical approaches that

maintain to identify CTCs from whole blood have demonstrated the potential value of CTC detection as a liquid biopsy especially in

those tumors where tissue accessibility is often challenging issue as in lung cancer [3, 4]. The aim of this study is to determine CTCs

in peripheral blood samples obtained from several cancer patients using a method which is modified by our research group.

Materials and Methods: Our modified method is used for the detection of CTCs [5]. We performed a ficoll density gradient

centrifugation and CD45 negative selection with magnetic micro-bead for the enrichment of CTCs. We determined CTCs using a

multi-parameter flow cytometry.

Results and Discussion: The results showed that CTCs can be detected with our modified method. Especially in recent years, CTCs

have been suggested as the most appropriate molecular markers for cancer diagnosis. As a new approach, CTCs have become crucial

in clinical condition such as the determination of metastasis, the risk of tumor recurrence, the orientation of patients to chemotherapy,

the identification of new therapeutic targets, and the monitoring of systemic cancer treatments.

Keywords: Liquid biopsy, circulating tumor cells, cancer, metastasis.

References:

[1] Rolfo, C.; Castiglia, M.; Hong, D.; Alessandro, R.; Mertens, I.; Baggerman, G.; Zwaenepoel, K.; Gil-Bazo, I.; Passiglia, F.; Carreca, A.

P.; Taverna, S.; Vento, R.; Santini, D.; Peeters, M.; Russo, A.; Pauwels, P. Biochim Biophys Acta., 2014, 1846, 539-546.

[2] Alix-Panabières, C.; Pantel, K. Clin Chem., 2013, 59, 110-118.

[3] Hou, J. M.; Krebs, M.; Ward, T.; Sloane, R.; Priest, L.; Hughes, A.; Clack, G.; Ranson, M.; Blackhall, F.; Dive, C. Am J Pathol., 2011,

178, 989-996

[4] O'Flaherty, J. D.; Gray, S.; Richard, D.; Fennell, D.; O'Leary, J. J.; Blackhall, F. H.; O'Byrne, K. J. Lung Cancer, 2012, 76, 19-25.

[5] Simsek, E.; Guler, O. O.; Carhan, A.; Ersan, B.; Arkan, T. K.; Dilek, Y.; Ercan, E.; Oz, B. E.; Terzi, E.; Calisir, E.; Tiryaki, M.; Pinarli,

F. A.; Korkmaz, M. H. Niche, 2016, DOI:10.5152/niche.2015.246.




79

IDDGC17-OP-170

CYTOGENETICS AND CYTOTAXONOMY OF THE CERAMBYCIDAE (COLEOPTERA)

Atılay Yagmur Okutaner1, Yavuz Kocak

2

1Ahi Evran University, Faculty of Arts and Sciences, Department of Anthropology, Kirsehir, Turkey. [email protected] 2Ahi Evran University, Faculty of Engineering and Architecture, Department of Environmental Engineering, Kirsehir, Turkey

Aims and Scopes: The systematics of cerambycid beetles has been mostly based on morphological structures. Cytogenetic studies in

Cerambycidae were undertaken in the hope that those might assist in problems of identification and classification. Since,

cytogenetical analyses are essential for correct taxonomic identifications. Furthermore, comparative studies of chromosome features

exhibit considerable contributions to the interpretation of cerambycid phylogeny and evolution. An interesting example of this was

recently provided by karyotyping of Vesperus xatarti (Cerambycidae: Vesperinae). V. xatarti exhibited very unusual diploid

karyotype with 53(♂)-54(♀) chromosomes (one of the highest chromosome number found in beetles) while the chromosome numbers

in long-horned beetles ranged from 10 to 36 and the most common is 2n=20. This characteristic karyotype take deservedly attention

for further systematic revision of Vesperinae [Dutrillaux et al., 2007]. The present work is therefore aimed to deal with cytogenetics

and cytotaxonomy of beetles and is particularly confined to chromosome studies in the family Cerambycidae. For this purpose, an

annotated compilation of all chromosomal works on the Cerambycidae is presented, covering roughly 250 taxa corresponding to 0.5%

of the identified long-horned beetles worldwide [Giannoulis et al., 2014; Li-Juan et al., 2013; Dutrillaux et al., 2007; Cesari et al.,

2004; Smith and Virkki, 1978].

Materials and Methods: The data assembled here includes karyological studies of long-horned beetles previously reported. All the

findings were considered to evaluate the differentiation level and phylogenetic relationships between taxa of the family.

Results and Discussion: A perusal of the literature shows that papers published hitherto on the karyology of cerambycid beetles are

still inadequate. On the other hand, it is clearly seen that cerambycid cytotaxonomy employs the comparative chromosomal studies to

resolve relationship and phylogenetic placement of these beetles. The useful informative cytogenetic characters studied are of great

value in cerambycid cytotaxonomy. Among these, the number of chromosomes and sex-determining system are the most widely

quoted characters. The diploid chromosome number 2n=20 and sex chromosome systems XX/XY and Xyp are appeared the most

frequent cytogenetic results in the studied long-horned beetles. Consequently, the documentation of karyological analysis serve as a

unique source of information for both long-horned and remain beetle taxonomy, systematics and phylogeny.

Keywords: Cytogenetics, Cytotaxonomy, Coleoptera, Cerambycidae, Long-horned Beetles

References:

[1] Giannoulis, T.; Dutrillaux, A. M.; Touroult, J.; Sarri, C.; Mamuris, Z.; Dutrillaux, B. Insecta Mundi, 2014, 335, 1-10.

[2] Li-Juan, S.; Hong-Fei, Z.; Wei, X.; Xin-Ming, Y.; Jing, L.; Xin-Hao, G. Acta Entomologica Sinica, 2013, 56(3), 299-305.

[3] Dutrillaux, A. M.; Moulin, S.; Dutrillaux, B. Ann. Soc. Entomol. Fr. (n.s.), 2007, 43(1), 81-86. [4] Cesari, M.; Marescalchi, O.; Francardi, V.; Mantovani, B. Journal of Zoological Syst. and Evolutionary Research, 2004, 43(1), 1-7.

[5] Smith, S. G.; Virkki, N. Animal Cytogenetics, Insecta 5: Coleoptera, 1978, Gebruder Borntraeger, 366 pages.




80

IDDGC17-OP-171

THE FIRST KARYOLOGICAL ANALYSIS OF THE LONGHORNED BEETLE CHLOROPHORUS

VARIUS (COLEOPTERA: CERAMBYCIDAE) FROM TURKEY

Miyase Aslantas1, Atılay Yagmur Okutaner

2

1Ahi Evran University, Graduate School of Natural and Applied Sciences, Department of Biology, Kirsehir, Turkey.

[email protected] 2Ahi Evran University, Faculty of Arts and Sciences, Department of Anthropology, Kirsehir, Turkey

Aims and Scopes: The genus Chlorophorus Chevrolat, 1863 comprise around 200 species worldwide and is represented by 18

species in Turkey. The Chlorophorus beetle, viz. C. varius (Müller, 1766), is widely distributed and includes 2 subspecies, namely C.

varius damascenus Chevrolat, 1854 and C. varius varius (Müller, 1766), in Turkey. Chlorophorus damascenus was newly suggested

as a separate species due to its distribution and morphological patterns [Ozdikmen and Cihan, 2016]. This is why it is necessary to

focus on karyological investigations of this genus. Since, karyological studies have been used to clarify the taxonomy of species and

understanding the diversification of taxa. In the present work, the chromosome number of C. varius was determined in order to

contribute to the karyological aspects of above mentioned beetles whose taxonomic position appears controversial.

Materials and Methods: The beetles used in the present study were collected by the author in the vicinity of the province Sakarya in

June 2016. Only adult males were subjected to the karyotypic studies. The gonads of males were dissected and used as material for

squashes. Metaphasic plates were obtained by squashing testes. The main chromosomal technique applied already described [Rozek,

1994].

Results and Discussion: The karyotype of C. varius is reported here for the first time. Karyological analysis of this longhorned beetle

revealed the presence of 2n♂=20 chromosomes. This new data compared with previous chromosomal information of the genus.

Moreover, the new karyological information was discussed in a taxonomic context. Although Chlorophorus is remarkable for species

richness, these beetles still remain poorly investigated from a karyological standpoint. Thus, this study is of importance in the analysis

of karyotypic evolutionary trends, classification and taxonomy of the genus Chlorophorus and better understanding of the karyotype

diversity and chromosome evolution processes. As a result, further studies are needed to reconsider the taxonomic status and the

evolutionary relationships of Chlorophorus taxa and remain longhorned beetles.

Keywords: Cerambycidae, Chlorophorus varius, chromosome, Turkey

Acknowledgements: The data were derived from the MSc Thesis of Miyase Aslantas.

References:

[1] Ozdikmen, H.; Cihan, N. Pakistan J. Zool., 2016, 48(2), 365-376.

[2] Rozek, M. Chromosome Research, 1994, 2, 76-78.




81

IDDGC17-OP-172

QUANTITATIVE IDENTIFICATION OF EXPRESSION LEVELS OF ODORANT BINDING

PROTEIN (OBP) GENES IN AEDES CRETINUS

Meryem Senay SENGUL

Gaziosmanpasa University, Department of Molecular Biology and Genetics, Tokat, Turkey

[email protected]

Aims and Scopes:

Mosquitoes are vectors for human diseases such as malaria, dengue fever, yellow fever, West Nile fever and encephalitis. Mosquitoes

rely heavily on ―olfactory cues‖ to identify their human hosts [1, 2]. Odorants enter the antennal sensillar lymph from the air through

cuticular pores and are captured by Odorant Binding Proteins (OBPs) that transport them through the sensillar lymph to odorant

receptors (ORs) to transduce the signals to downstream effector molecules [3]. OBPs are the first proteins to interact with the

odorants; thus, it is important to identify OBPs in mosquitoes in order to disrupt mosquito odorant reception.

The aim of this study is to identify female, antennal specific OBPs in Aedes cretinus, a mosquito species that is morphologically very

similar to Aedes albopictus. The genome sequence of Aedes cretinus species is not available. Thus, with the help of molecular and

structural knowledge about OBPs in other mosquito species (e.g. An. gambiae, Ae. aegypti), orthologus genes were identified and

checked for gene expression levels in the olfactory and non-olfactory organs of male and female Aedes cretinus mosquitoes.

Identification of antennal and female biased OBPs in mosquitoes are ideal candidates to combat with the transmission of vector-borne

diseases.


Total RNA was isolated from antennae and body only tissues from 3-5-days-old female and male mosquitoes. cDNA was synthesized

using oligo (dt) primers and Superscript III reverse transcriptase (Invitrogen). Real-time PCR was performed using Maxima Hot Start

SYBR Green Mix (Thermo Scientific, USA) with the Stratagene Mx3000P system (Stratagene, La Jolla, CA). Briefly, 2μl of cDNA

was used with 8.95 μl nuclease-free water, 12.5 μl Maxima SYBR Green qPCR Master Mix (2X) with ROX, 0.75 μl of each primer in

a 25 μl PCR total volume. Ribosomal protein S7 is used as the internal control gene for quantitative analysis. All test samples and the

controls were performed in triplicates, each from independent collections.


This study represents the first and the only molecular work about OBPs in Aedes cretinus. Two OBP genes (AcretObp1 and

AcretObp2) in Aedes cretinus (GenBank accession numbers: KX056476, KX056475) was identified. AcretObp1 and AcretObp2

showed a significantly higher, approximately 30-fold and 5-fold, respectively, gene expression in the female antennae when compared

to male antennal tissues. We observed no significant gene expression levels in body samples. Quantitative real-time PCR results

indicated that both genes are exclusively expressed in the antennae of Aedes cretinus mosquitoes and both genes are more abundantly

in female antennae compared to that of males. We propose that AcretObp1 and AcretObp2 are two genes that may play an important

role in female perception of odorants that could mediate female mosquito host-seeking behavior.

Keywords: Aedes cretinus, Gene expression, Olfaction, Odorant Binding Protein, Real-time PCR

Acknowledgements: This work was supported by a grant (113Z436) from the Scientific and Technological Research Council of

Turkey (TÜBİTAK).

References: [1] Takken, W., Knols, B.G.J. 1999. Annu Rev Entomol 1999, 44, 131-157.

[2] Zwiebel, L.J., Takken, W. Insect Biochem Mol Biol 2004, 34, 645-652.

[3] Hallem, E.A., Dahanukar, A., Carlson, J.R. Annu Rev Entomol 2006, 51, 113–135.




82

IDDGC17-OP-173

IMPROVEMENT EFFECT OF STATIN DRUGS ON CHROMOSOMAL DNA DAMAGE

AyĢe Nur CoĢkun-Demirkalp1, Hamiyet Dönmez-AltuntaĢ

2,Fahri Bayram

3

1Kapadokya Vocational College, Cappadocia Campus, Health Programs,

Mustafapasa, Urgup / Nevsehir, Turkiye, [email protected] 2 Erciyes University, Faculty of Medicine, Department of Medical Biology,

Kayseri, Turkiye, [email protected] 3 Erciyes University, Faculty of Medicine, Department of Endocrinology and Metabolism Diseases,

Kayseri, Turkiye, [email protected]

Aims and Scopes: Dyslipidemia is a metabolic disorder characterized by an increase in various lipid parameters (cholesterol,

triglyceride, low-density cholesterol, LDL-C) or decrease (high-density lipoprotein (HDL)). Statins are the most important and most

frequently used drugs in addition to lifestyle changes in the treatment of dyslipidemia. In this study, it was aimed to investigate the

possible genotoxic effects of statin in peripheral blood lymphocytes of dyslipidemia patients with statin therapy by using cytokinesis-

block micronucleus cytome (CBMN cyt) method.

Materials and Methods: Fifteen patients who applied to the Department of Endocrinology and Metabolic Diseases of Erciyes

University Faculty of Medicine, who did not have any endocrine disease and did not use any medicines that affect lipid parameters,

and fifteen healthy subjects of similar age and sex with patients were included in the study group. An acceptable dose of statin therapy

was then started according to the lipid levels and characteristics of the patients. Blood samples taken before and after treatment from

the patients were cultured for 72 hours according to the CBMN cyt method. Micronucleus (MN) values from CBMN cyt method

parameters were scored in the prepared slides.

Results and Discussion: MN values in patients with dyslipidemia were found to be significantly higher than controls (P <0.01).

When MN values of dyslipidemia patients after treatment were compared their before treatment, MN values after treatment were

found to be significantly decreased (P <0.01). Statins are an important group of medicines that are used to reduce the levels of lipid in

the blood and are sometimes controversial. Our results have shown that statin drugs have a therapeutic effect and cholesterol-

regulating, as well as a improvement effect on increased chromosomal DNA damage in dyslipidemia patients. Our work is a need to

support with larger patient groups.

Keywords: Dyslipidemia, DNA Damage, Micronucleus, Statin therapy.

Sources of Research Support: This work was supported by Erciyes University Scientific Research Projects Units (Project Number:

TYL-2014-5400).

References:

1. Stone NJ, Robinson J, Lichtenstein AH, et al. 2013 ACC/AHA Guideline on the Treatment of Blood Cholesterol to Reduce Atherosclerotic

Cardiovascular Risk in Adults: A Report of the American College of Cardiology/American Heart Association Task Force on Practice

Guidelines. J Am Coll Cardiol. 2014; 63 (25 Pt B):2889-2934.

2. Ersanlı M. Dislipidemi tedavisinde statinlerin önemi (Importance of statins in the treatment of dyslipidemia).Türk Kardiyol Dern Arş -

Arch Turk Soc Cardiol. 2007; 35 Suppl 1: 1-7.

3. Lloyd-Jones DM, Goff D, Stone NJ. Statins, risk assessment, and the new American prevention guidelines. Lancet. 2014; 383(9917): 600-

602.

4. Fenech M. Cytokinesis-block micronucleus cytome assay. Nature Protocols 2007; 2: 1084-1104.

5. Donmez-Altuntas H, Bitgen N. Evaluation of the genotoxicity and cytotoxicity in the general population in Turkey by use of the

cytokinesis-block micronucleus cytome assay. Mutat Res 2012; 748: 1-7.




83

IDDGC17-OP-174

DETERMINATION OF CYTOCHROME P450-MEDIATED DETOXIFICATION RESISTANCE

GENE (CYP6a14) IN TRIBOLIUM CASTANEUM (COLEOPTERA: TENEBRIONIDAE) ADULTS

EXPOSED TO BOLANTHUS TURCICUS (CARYOPHYLLACEAE) EXTRACT

Fahriye Sümer Ercan1, Serap Yalçın Azarkan

2, Nuri Ercan

3, Murat Koç

4

1Department of Genetics and Bioengineering, Faculty of Engineering and Architecture, Ahi Evran University, Kırşehir,

Turkey, e mail: [email protected] 2 Department of Molecular Biology and Genetic, Faculty of Science and Art, Ahi Evran University, Kırşehir, Turkey

3 Faculty of Agriculture, Ahi Evran University, Kırşehir, Turkey

4 Animal Production High School, Bozok University, Yozgat, Turkey

Aims and Scopes: The aim of the study is to determine the insecticidal effect of Bolanthus turcicus extract on an important stored

product pest, Tribolium castaneum and to detect the changes in regions of resistance gene in the insect.

Materials and Methods: Tribolium castaneum adults were obtained from Ahi Evran University, Faculty of Agriculture, Department

of Plant Protection. Bolanthus turcicus is an endemic species and spreads on the Hasan Mountain above Karkın town (Turkey,

Aksaray province) [1]. The plant species was collected from June to July with the field study to be carried out in this region.

Obtained extract of plant was analyzed by gas chromatography mass spectrometry (GC-MS) method. The dose was defined during the

study and the concentration that kill 50% of the population was determined after applications. After 24 h, DNA was isolated from live

and dead individuals that obtained from LC50 concentration application and analyzed for Cytochrome P450-mediated detoxification

resistance gene, CYP6a14 gene region, by polymerase chain reaction (PCR).

Results and Discussion: CYP genes in insects are known to be rapidly regulated when exposed to insecticides. However, limited

information has been obtained on the relationship between regulation of CYP genes and insecticide type, concentration and duration

of application [2]. In the study, in order to screen for 353 bp fragment of CYP6a14 gene in T. castaneum adults was amplified using

specific primers. DNA direct sequencing was performed on each template using the forward primer. When compared to the control, it

is believed that mutation differences in live and dead individuals according to the sequencing results obtained from survival and dead

adults, may allow CYP6a14 gene to play a protective role against the toxic effect of B. turcicus extract.

Keywords: CYP6a14 gene, Tribolium castaneum, Bolanthus turcicus, detoxification, DNA direct sequencing

References:

[1] Koç, M.; Hamzaoğlu, E. PhytoKeys, 2015, 52, 81-88.

[2] Liang, X.; Xiao, D.; He, Y.; Yao, J.; Zhu, G.; Zhu, K.Y. Int. J. Mol. Sci., 2015, 19; 16(1): 2078-98.

This work was supported by the Ahi Evran University Scientific Research Projects Coordination Unit. Project Number: MMF.A3.16.003




84

IDDGC17-OP-175

Curcumin and 5-fluorouracil on e-cadherin protein expression in PC3 cell line

Gökçe Sahin1, Mahinur Kırıcı


3, Can Ali Agca

1*

1Department of Molecular Biology and Genetics, Faculty of Arts and Sciences, Bingol University, Bingol, Turkey.


3Sulaimani Polytechnic University, Technical College of Applied Science, Food Industry Department

Aims and Scopes: Prostate cancer is the most common type of cancer in men today and the second most common cancer-related to

death. Curcumin is a potent bioactive compound with versatile properties such as anti-inflammatory, antioxidant properties, inhibit

inflammatory cytokines, carcinogenic enzymes and kinases. Many studies show that curcumin is a powerful anti-cancer agent and that

it suppresses tumors of the skin, breast gland, stomach, intestine, colon, lung and liver with different mechanisms[1,2,3]. The

antimetabolite, 5-Fluorouracil (5-FU), acts on the enzymes involved in cell growth and replication. It effects the S phase of DNA

synthesis and inhibits the use of the thymidylate synthase enzyme also disrupts the DNA structure. Cadherins are calcium-dependent

transmembrane proteins, in the start of intercellular adhesion events have the important task of tissue morphogenesis and tumor

suppression[4,5]. The synergistic effect of 5-FU and curcumin on the molecular mechanism of prostate cancer has not yet been fully

elucidated. In this research, the effects of the synergistic action between curcumin and 5-FU together on prostate cancer cells were

investigated.

Materials and Methods: The cell proliferation assay performed to PC3 cell line treated with curcumin (10, 25 and 50 μM) and 5-FU

50 μM together after 24 hours incubation were determined by MTT assay. The expression level of E-cadherin protein was determined

by western blotting for harvested PC3 cell line.

Results and Discussion: The result of MTT assay indicates curcumin low dose with 5-Fu significantly inhibited PC3 cell

proliferation about 25% and high dose curcumin with 5-FU inhibit 75%. In another hand, Curcumin and 5-FU together decrease the

expression levels of E-Cadherin protein. In conclusion, curcumin and 5-FU combination treatment caused synergistic cytotoxicity in

cultured PC3 cell line and detected reducing E-cadherin protein expression levels. As a result of this study, it seems that curcumin and

5-FU combination support the in vivo potential application for prostate cancer.

Key Words: Curcumin, 5-fu, e- cadherin, PC3

References

1. Aggarwal B, Bhatt ID, Ichikawa H, Ahn KS, Sethi G, Sandur SK et al. Curcumin — Biological and MedicinalProperties. 7034_book. fm 2006: p. 297-367.

2. Sharma RA, Ireson CR, Verschoyle RD, Hill KA, Williams ML, Leuratti C et al. Effects of dietarycurcumin on glutathione S-transferase and malondialdehyde-DNA

adducts in ratliver and colonmucosa: relationshipwithdrug levels. ClinCancerRes 2001; 7 (5): 1452-1458. 3. Aggarwal BB, Shishodia S, Takada Y, Banerjee S, Newman RA, Bueso-Ramos CE et al. Curcuminsuppressesthepaclitaxel-ınduced NF-ĸBpathway in

breastcancercells and ınhibitslungmetastasis of humanbreastcancer in nudemice. ClinCancerRes 2005; 11 (20): 7490-7498.

4. Güç D. Adezyon Molekülleri, Ankem Dergi 2004; 18(Ek2):158-163. 5. Hazan RB, Qiao AR, Keren BR, Badano AI, Suyamaa K. Cadherin Switch in Tumor Progression, Anın NY Acad Sei 2004;1014: 155-163.




85

IDDGC17-OP-176

DETERMINING CYTOSOLIC CARBONIC ANHYDRASE ENZYME LEVELS DURING

PREGNANCY TERMS

Emine Terzi1, Ender Simsek

1, Ayse Filiz Yavuz

2,3, Ozen Ozensoy Guler

1

1Ankara Yildirim Beyazit University, Medical Faculty, Medical Biology Department, Bilkent Campus, Ankara, TURKEY,

[email protected] 2 Ankara Yildirim Beyazit University, Medical Faculty, Department of Obstetrics and Gynecology, Bilkent Campus, Ankara, TURKEY

3 Ankara Atatürk Research and Training Hospital, Deparment of Obstetrics and Gynecology, Bilkent, Ankara, TURKEY.

Aims and Scopes: Carbonic anhydrase (CA) is a zinc containing metalloenzyme and responsible for reversible hydration of CO2 to

H+ and HCO3

- [1]. This enzyme involved in electrolyte secretion, biosynthetic reactions (gluconeogenesis, lipogenesis, ureagenesis

etc.), bone resorption, calcification, tumorigenecity and many other physiologic and pathologic processes [2]. CA-I and CA-II are two

major cytosolic isoenzymes that found in mammalian red blood cells [3]. The expression of CA has been reported in human placenta

and reproductive system. In pregnancy, CA may have a role for ion exchanging and CO2 transport between maternal and cord blood

[4]. In this study, we determined CA-I and CA-II enzyme levels in the first three months (1st trimester), the second three months (2nd

trimester) and the last three months (3rd trimester) of the pregnancy. Our aim was to find the relationship between enzyme activity

levels in pregnant/non-pregnant group and differences among trimesters.

Materials and Methods: Peripheral blood samples (5 mL) were taken from 33 non-pregnant volunteer women and 94 pregnants. The

hemolysates were used to determine the activity of CA. CA activity was measured by the hydration of CO2 according to the method of

Wilbur and Anderson which is based on the determination of the time required for the pH of solution decreasing from 10.0 to 7.4 due

to the hydration of CO2. Assays were performed at least twice on each lysate and the mean value was determined to the formula:

EU=(to-tc)/tc [5,6].

Results and Discussion: CA enzyme levels were lower in pregnant group compared to non-pregnant group (p<0,001). There were no

statistically significant differences among the 1st trimester, 2nd trimester and 3rd trimester. According to these results, CA may have

a role in pregnancy, but has not any effect among trimesters.

Keywords: Pregnancy, trimester, carbonic anhydrase

References:

[1] Karim, K; Giribabu, N; Muniandy, S; Salleh, N. Syst Biol Reprod Med. 2016 ,62(1), 57-68.

[2] Supuran, C.T; Scozzafava, A. Expert Opinion on Therapeutic Patents. 2000, 10(5), 575–600.

[3] Innocenti, A; Hilvo, M; Scozzafava, A; Parkkila, S; Supuran, C.T Bioorg Med Chem Lett. 2008, 18(12), 3593-6.

[4] Chiang, W.L; Liu, J.Y; Liao, C.Y; Yang, S.F; Hsieh,Y.S; Chu, S.C. Fertil Steril. 2004, 82(3), 1095-100.

[5] Anderson Wilbur, K.M; Anderson, N.G. J Biol Chem 1948, 176, 147-154.

[6] Ozensoy, O; Kockar, F; Arslan, O; Isik, S; Supuran, C.T; Lyon, M. Clin Biochem 2006, 39, 804-809.




86

IDDGC17-OP-177

Effect of Vıtıs Vınıfera on P53 and Caspase-3 Proteın Expressıon in Cultured Mcf-7 Cell

Sedanur Özbolat1 Beyzanur Turan

1, Mahinur Kırıcı


3, , Can Ali Agca

1*

1Department of Molecular Biology and Genetics, Faculty of Arts and Sciences, Bingol University, Bingol, Turkey


3Sulaimani Polytechnic University, Technical College of Applied Science, Food Industry Department

Aims and Scopes: Breast cancer is an adenocarcinoma, usually originates from epithelial cell, the most common and various type of

cancer among women all over the world [1]

. Vitis Vinifera considered as a nutritional food, which contains a high amount of sugar. It

has been reported to be effective in treatment of liver diseases, anaemia, stomach and intestinal systems[2]

. Vitis Vinifera has an

antioxidant property related to Resveratrol compound. Caspases are a family of protease enzyme, has been playing an essential roles

in first programmed cell death apoptosis. P53 is a tumor suppressor protein, cell cycle regulator and specific caspase activator. The

goal of this study was to elucidate the effects and the roles of Vitis Vinifera on p53 and Caspase-3 proteins expression in cultured

MCF-7 cell.

Materials and Methods: MCF-7 cells cultured and treated with Vitis Vinifera in different concentrations (25, 50, 100 and 200 µg/ml)

for 24 hours. The result of cell proliferation has been developed by MTT assay. Also, caspase-dependent apoptotic pathway and anti-

tumor activity of Vitis Vinifera on MCF-7 cell line were investigated by western blotting of caspase-3 and p53 proteins.

Results and Discussion: The MTT assay result indicated which Vitis Vinifera (25, 50 and 100 µg/ml) inhibited MCF-7 cell

proliferation about 25%, however, 200 µg/ml dramatically decreased the cell proliferation rate about 50%. Surprisingly, all

concentrations of Vitis Vinifera increased the expression of caspase-3 and p53 proteins in dose-dependent manner. These results

illustrated that V. Vinifera extract has the ability to inhibit the proliferation of breast cancer cell line. In another hand, western blot

results demonstrated the of MCF-7 cell line growth inhibition by increasing the expression of tumor suppressor p53 protein, and

induced caspase-3-dependent apoptosis.

Key Words: Breast cancer, Vitis Vinifera, Caspase-3, P53

This study was supported by TÜBİTAK (The Scientific and Technical Research Council of Turkey) (Project Numbers:

1919B011601246)

References

[1] Aslan, F. E.; GÜRKAN, A. 2007, Meme Sağlığı Dergisi, Cilt 3, Sayı 2.

[2] Canbaş A.; Ünal Ü.; Deryaoğlu A.; Erten H.; Cabaroğlu T. 1995, Elazığ Yöresi Şaraplık Öküzgözü Ve Boğazkere

Üzümleri Üzerinde Teknolojik Araştırmalar I.1988 Ve 1989 Yılı Derlemeleri/ / 20 (5) 281-288




87

IDDGC17-OP-178

A GENOSENSOR DESIGN FOR DETECTION OF FETAL CELL-FREE DNA

Umut KÖKBAġ, Kezban KartlaĢmıĢ, Abdullah Tuli, Levent Kayrın

Cukurova University Faculty of Medicine Department of Biochemistry, Adana, Turkey

[email protected]

Aims and Scopes: Prenatal diagnosis of invasive and noninvasive tests can be done in a way (NIPT), but because of the invasive

methods have risks of infection and abortion, diagnosing non-invasive procedure increasing day by day.[1]

One of the widespread cell

free fetal DNA in maternal blood test (cff DNA) that is increasing in clinical use has been drawing attention.[2]

The incidence of

genetical anomaly of the kind in which all live births is 3 %.[3]

Because of the high mortality and morbidity, it is vital that genetical

anomalies should be diagnosed in prenatal period. Genetically testing for pregnant women early weeks of pregnancy in terms of the

blood sample is taken and free fetal DNA in maternal plasma is based on the measurement of the relative amount.[4]

In this study, it is aimed to a genosensor design for detection of fetal Cell-Free DNA that will be able to one of the prenatal diagnostic

methods of cff DNA test.

Materials and Methods: For this study, whole maternal blood, which was obtained cell free fetal DNA. These cell free fetal DNA

were detected directly by using a quartz crystal microbalance.[5]

We immobilized with a single oligonucleotide probe with Poly

Hema-Mac nanopolymer. Than we compare the results with gel electrophoresis.

Results and Discussion: The frequency changes after hybridization of the PCR products amplified from a representative sample of

normal, heterozygote, and homozygote of sickle cell disease fetal cell free DNA were 98±6, 168±3, and 206±5 Hz, respectively.

The biosensor was evaluated through an examination of 3 blind specimens. It could accurately discriminate between normal and

sickle cell disease samples, which suggests that this biosensor system is a promising alternative technique to detect sickle cell disease

because of its specificity and less hazardous exposure as compared with conventional methods. This technique is faster and cheaper

than other techniques.

Keywords: Genosensor, Cell-Free DNA, Non-invazive prenatal diagnostic, Biosensor, Fetal DNA.

References:

[1] W. Tang, Y. Wu, J. Liu, W. Ren, Taiwanese journal of obstetrics & gynecology 2017, 56, 114-115.

[2] aP. E. Lau, S. Cruz, C. I. Cassady, A. R. Mehollin-Ray, R. Ruano, S. Keswani, T. C. Lee, O. O. Olutoye, D. L. Cass, Journal

of pediatric surgery 2017, 29, 73-79.

[3] C. Guissart, C. Dubucs, C. Raynal, A. Girardet, F. Tran Mau Them, V. Debant, C. Rouzier, A. Boureau-Wirth, E. Haquet, J.

Puechberty, E. Bieth, D. Dupin Deguine, P. Khau Van Kien, M. P. Brechard, V. Pritchard, M. Koenig, M. Claustres, M. C.

Vincent, Journal of cystic fibrosis, 2017, 16, 198-206.

[4] M. Parks, S. Court, B. Bowns, S. Cleary, S. Clokie, J. Hewitt, D. Williams, T. Cole, F. MacDonald, M. Griffiths, S. Allen,

European journal of human genetics : EJHG 2017, 25, 416-422.

[5] S. N. Ovchinnikova, A. Z. Medvedev, Russ J Electrochem+ 2015, 51, 287-293.




88

IDDGC17-OP-179

Phylogenetic Relationship Of Endemic Astragalus L. Species And Their Link With Ecological Variables

Mine Turktas

1, Melda Dolarslan

1, Ebru Gul

2, Tugba Gurkok

3, Emine Acar

1

1 Cankiri Karatekin University, Faculty of Science, Biology Department, Cankiri, Turkey [email protected]

2 Cankiri Karatekin University, Faculty of Forestry, Cankiri, Turkey

3 Cankiri Karatekin University, Eldivan Vocational School of Health Services, Cankiri, Turkey

Aims and Scopes: Astragalus L. (Fabaceae) is one of the largest genera of flowering plants with an estimation of approximately

3000 species divided into more than 250 sections. It comprises the largest genus in Turkey. So far, 425 species have been recorded in

Turkey, of which 48% is endemic. Thus, Turkey is considered as an important center for diversification of the genus. In this study, we

applied phylogenetic approach to assess the impact of environmental adaptation on Astragalus L. spp.

Materials and Methods: Phylogenetic relationships of the eight endemic and four common Astragalus L. spp. based on rDNA region

sequences and 28 morphological characters were examined. Furthermore, the soil characteristics of the samples were determined.

Phylogenetic trees based on molecular and morphological data were constructed using Maximum Parsimony (MP), Neighbor Joining

(NJ) and Bayesian Inference (BI) methods. The phylogenetic positions of the 12 taxa were also examined comparing with all 431

Astragalus L. spp. sequences available in database. The data was further evaluated together with ecological traits of the districts.

Results and Discussion: It appears that the use of molecular and morphological data is crucial to provide a better understanding of

the relationships among Astragalus L. ssp., The majority-rule consensus trees obtained from NJ, MP and BI methods were found to be

highly consistent with each other. In all analyses, 12 Astragalus L. spp. were divided into three clades. Comparison of molecular

sequence- and morphology-based trees revealed certain dissimilarities. However, the differences between trees constructed using

morphological data and molecular data could be explained by ecological properties of the species. Based on the similarities between

the patterns of ecological properties and phylogenetic diversity, the data implies that ecological adaptation to environmental

conditions significantly influences the phylogeny of Astragalus L. spp.

Keywords: Adaptation Astragalus, ecology, phylogeny




89

IDDGC17-OP-180

In silico Identification of Differentially Expressed Transposons Against Biotic Stress in Brachypodium

distachyon Tugba Gurkok

1, Mine Turktas

2


2 Cankiri Karatekin University, Faculty of Science, Biology Department, Cankiri, Turkey

Aims and Scopes: Transposable elements (TEs) are mobile genetic components of living organisms representing large portions of

eukaryotic genomes. Recent studies have showed that TEs can affect not only the host gene regulation but also they actively

transcribed or silenced in several environmental conditions. One of the important plant model plant organism Brachypodium

distachyon serves advantages with its small genome size to examine molecular mechanisms. In this current study we detected the

differentially expressed transposon encoding transcripts in B. distachyon inoculated with Panicum mosaic virus (PMV) and its

satellite virus (SPMV).

Materials and Methods: Mock, PMV and PMV+SPMV inoculated plants RNA-seq analysis were performed previously. Sequenced

reads were downloaded from NCBI and reads aligned to the B. distachyon whole genome. Repetitive sequences were homology based

in silico identified via RepeatMasker. Using PGSB the classification of TEs were performed. The comparison of read numbers

between three libraries was evaluated. Differentially expressed TEs were observed between control and inoculated plants with

Epicenter program. TEs representing at least two fold alterations between libraries were considered as differentially expressed.

Differentially expressed transcripts were annotated with BLAST.

Results and Discussion: The higher number of TE reads was detected in mock inoculated plants. In libraries RNA transposon

encoding transcripts were higher than DNA TEs. Approximately 15% of the TE transcripts were found to be differentially regulated.

Amongst them almost 90% of TEs showed up-regulation. Increased expressions of TEs revealed that these TEs might have a role in

response to biotic stress in B. distachyon. Synergism increased the transposon transcription activity. The most up-regulated transcript

against virus infection was belongs to MuDR transposon family.

Keywords: Brachypodium, pathogen stress, transcriptome, transposons




90

IDDGC17-OP-182

Is There Any Relationship Between Human Foamy Virus Infections and Familial Mediterranean Fever? Melek Yüce

1, Hasan Bagci

2, Kuddusi Cengiz

3

1Melek Yüce, Ondokuz Mayıs University, Department of Medical Services and Techniques

55139, Samsun, TURKEY, [email protected] 2Hasan Bağcı, Ondokuz Mayıs University, Faculty of Medicine, Department of Medical Biology,

55139, Samsun, TURKEY

3Kuddusi Cengiz, Ondokuz Mayis University, Faculty of Medicine, Department of Nephrology, 55139, Samsun, TURKEY

Aims and Scopes: Familial Mediterranean Fever (FMF), has been defined as an autosomal recessive disease, characterized by the

automatic activation of innate immune system in the absence of a detectable pathogenic stimulant [1,2]. Innate immune system forms

the first defense system against pathogens [3]. We hypothesize that the pathogenic factors, besides the genetic causes, may affect the

development of FMF symptoms. This study aimes at examining the effects of Human Foamy Virus (HFV) positivity on the occurence

of the clinical symptoms of FMF.

Materials and Methods: 222 patients with definitive diagnosis according to Tel-Hashomer criteria and carrying two of the 12

mutations commonly seen in MEFV (MEditerranean FeVer) gene, 205 symptomatic FMF patients who had definitive diagnosis

according to the same criteria but did not carry any of the 12 mutations tested and a control group were included in the study. HFV

positivity was tested by amplifying the HFV bel1 gene sequence with polymerase chain reaction (PCR) technique.

Results and Discussion: HFV positivity shows significant differences between study groups (χ2= 12.56; p=0.002). The difference

between the FMF patients with mutations group and the control group was statistically highly significant [χ2= 12.50; p=0.000; OR=

2.96 (1.53-5.80)]. When symptomatic patients who showed clinically FMF characteristics but who did not carry mutations and the

healthy controls were compared, the difference between the two grpous was statistically significant [χ2= 7.163; p=0.007; OR= 2.37

(1.19-4.74)].

HFV is one of the complex retroviruses and retrovirus infections are indicated as among possible etiological factors for autoimmune

rheumatic diseases. In one study, the presence of HFV proviral genome was analyzed by PCR from the thymus samples of four

patients with Myastenia Gravis and the results showed the presence of DNA fragments which represented gag and bel2 sequences in

all samples. These findings show the potential role of HFV in autoimmunity. However, researchers have stated the need for further

studies [4].

Although FMF is a monogenic disease, our results indicate that not only MEFV gene mutations but also viral factors may play a role

in development of the symptoms of FMF.

Keywords: Familial Mediterranean Fever, MEFV Gene, Trim20, Human foamy viruses, bel1 gene

References: [1] Chae, J.J.; Cho, Y.H.; Lee, G.S.; Cheng, J.; Liu, P.P.; Feigenbaum, L.; Katz, S.I.; Kastner, D.L. 2011, Gain-of-function Pyrin mutations

induce NLRP3 protein-independent interleukin-1β activation and severe autoinflammation in mice, Immunity, 34:755-68.

[2] Hesker, P.R.; Nguyen, M.; Kovarova, M.; Ting, J.P.; Koller, B.H. 2012,Genetic loss of murine pyrin, the Familial Mediterranean Fever

protein, increases interleukin-1β levels. PLoS One.;7:e51105.

[3] Mohammad Hosseini, A.; Majidi, J.; Baradaran, B.; Yousefi, M. 2015, Toll-Like Receptors in the Pathogenesis of Autoimmune Diseases.

Adv Pharm Bull;5: 605-14.

[4] Liu, W.T.; Kao, K.P.; Liu, Y.C.; Chang, K.S. 1996, Human foamy virus genome in the thymus of myasthenia gravis patients. Chin J

Microbiol Immunol.; 29:162–65.

Acknowledgements:We would like to thank the patients, researchers and laboratory technicians, and especially Prof. Dr. Dirk

Lindemann (Dresden Technical University, Virology Institute, Germany) who donated the plasmid DNA which includes HFV

genome that was used as positive control in our study and we also thank laboratory workers for their contributions to DNA isolation.

This work was supported by Ondokuz Mayıs University Scientific Research Funding (PYO.TIP.1904.12.002) and Ondokuz Mayıs

University Ethical Board approval was taken.




91

IDDGC17-OP-183

Key Words: Circadian clock, Lung Cancer, Metastasis

Acknowledgment: This study was supported by TUBITAK (Project Number: 115S915 )




92

IDDGC17-OP-184

THE EFFECT OF WILD-GROWN Ganoderma lucidum ON Xpf GENE EXPRESSION IN CHICKEN

EMBRYOS OCCURRED DNA DAMAGE INDUCED BY CYCLOPHOSPHAMIDE

Ġlkyaz YILMAZ, Emine ARSLAN, Haluk OZPARLAK

Selçuk University, Faculty of Science, Department of Biology, Campus Selçuklu, Konya/TURKEY. [email protected]

Aims: Due to the therapeutic benefits of Ganoderma lucidum (Curtis) P. Karst, also known as "reishi mushroom" and have a wide

use, clinical investigations have been carried out on it. Cyclophosphamide (CP), one of the alkaline agents, binds to DNA via covalent

bonds and damages DNA, causing double chain breakage. Unrepaired double chain fractures can cause cell death, so repair is

important. The Xpf gene is the most common and effective known among repair mechanisms. In this study, it was aimed to determine

the effect of the aqueous extract of G. lucidum on the expression of the Xpf gene, which is thought to be related to the repair of DNA

damage caused by cyclophosphamide in chick embryos.

Materials and Methods: In this study, 77 fertilized hen‘s eggs, obtained from the same rootstock and classified in 12 groups were

used. The aqueous extract of wild-grown G. lucidium from Turkey at three different doses was injected into eggs on day 8 of

incubation together with CP as genotoxic agent. Also ascorbic acid (AsA) as anti-genotoxic agent was used. Liver tissues of chick

embryos on day 11 of the incubation were stored at -80°C until RNA was isolated. cDNA was synthesized from the obtained RNA

and expression level of Xpf gene was quantitatively determined by Real Time PCR. The data were analyzed by the t-test to determine

the differences between the control group and CP group or the other groups.

Results and Discussion: The CP group showed a significant difference (p<0.05) compared to the control group. The result of CP

administration together with G. lucidum extract did not show a significant difference in gene expression (p>0.05). The mushroom

extract did not induce the expression of the Xpf gene by suppressing CP, which increases the expression of the repair gene alone, such

as AsA shown anti-genotoxic effect. This suggests that mushroom extract protects DNA against CP and the gene is not stimulated for

repair. Similarly, it was reported that G. lucidum extract provided protection against DNA breaks caused by ultraviolet rays and

hydroxyl radicals [1]. In another study, it was stated that G. lucidum contains biologically active compounds that protect cellular DNA

against oxidative damage [2].

Keywords: Ganoderma lucidum, cyclophosphamide, chick embryo, Xpf, qRT- PCR

. References:

[1] Kim, K. C.; Kim, I. G. 1999. Int J Mol Med., 1999, 4(3), 273-277.

[2] Shie, Y.; James, A. E.; Benzie, I. F. F.; Buswell, J. A. Teratogenesis, Carcinogenesis and Mutagenesis, 2002, 22(2), 103-111.





93

IDDGC17-OP-185

+45T>G SINGLE NUCLEOTIDE POLYMORPHISM OF ADIPONECTIN GENE- IS IT A FACTOR

IN CHILDHOOD OBESITY?

Tuba Kasap1, Ömer Ateş

2, Ali Gül

1, Resul Yılmaz

1, Emel Özsoy

2

1Department of Pediatrics, GaziosmanpaĢa University School of Medicine, Tokat, Turkey

2Department of Medical Biology, GaziosmanpaĢa University School of Medicine, Tokat, Turkey

Aims and Scopes: Childhood obesity is increasing in incidence and is strongly associated with obesity in adulthood1. Obesity is

defined as excess accumulation of white adipose tissue which is considered as not only an energy storage site, but also an active

endocrine organ secreting a variety of proteins from adipocytes known as adipokines2. Adiponectin is one of these adipokines. Blood

levels of adiponectin are reduced in obese people compared with lean individuals3. One of the important single nucleotide

polymorphisms (SNP) of adiponectin gene is +45T>G (rs2241766) in exon 2. There are some studies which found different results

about the effect of this SNP for obesity risk. So we aimed to search about this relation in a prospective, cross-sectional designed case-

control study.

Materials and Methods: 268 obese and 185 healthy (control) children and adolescents aged 6-17 years were enrolled. Laboratory

tests including fasting glucose, insulin levels and lipid profiles have been drawn only from the obese participants. The +45T>G SNP

in adiponectin gene was analyzed by a polymerase chain reaction (PCR)-based restriction fragment length polymorphism (RFLP)

method.

Results and Discussion: The genotype frequencies of adiponectin gene for +45 locus in exon 2 were 77.9, 19.1 and 3% in obese

subjects and 72.1, 23.5 and 4.4% in control group for TT, TG and GG respectively (p=0.357), with the allelic frequency of the G

allele 12.5% in obese subjects and 16.1% in controls (p=0.129). Among obese subjects; frequency of GG genotype was higher in

females than in males (p=0,016). When we compare different adiponectin genotypes, there wasn‘t any significant difference in

frequencies of TT genotype (wild type) and non-TT (TG+GG) genotypes between obese and control groups (p=0,162). Also

comparing GG genotype and non-GG (TG+TT) genotypes revealed no significant difference between obese and control groups

(p=0,439). Similar comparisons were done for GG/non-GG and TT/non-TT genotypes in combination with the gender and showed

lack of relation between obese and control groups, too. Among obese subjects there were no significant relations between different

genotypes and clinical characteristics such as presence of hypertriglyceridemia, low high density lipoprotein (HDL-C), hypertension

and insulin resistance. Also there were no significant relations between the mean of body mass index, leves of triglycerids, HDL-C,

insulin, glucose, homeostasis model assessment of insulin resistance index (HOMA-IR) and different genotypes of adiponectine gene.

Our results were similar with Bouatia-Naji et al4

who also pointed out that there was no association between +45T>G SNP of

adiponectine gene and childhood obesity. In contrast another study found that this SNP may act through decreased adiponectin

expression, which may in turn cause increased body weight5. The reasons for this discrepancy may be related to variation across

studies in ethnic background, environmental factors, sample size and other factors.

Keywords: Childhood obesity, adiponectin, single nucleotide polymorphism

References: 1. Cieslak, J.; Skorczyk, A.; Stachowiak, M. Polymorphisms in 5‘-flanking regions of genes encoding adiponectin, leptin and resistin are not

associated with obesity of Polish children and adolescents. Mol Biol Rep 2011, 38:1793-98.

2. Aktaş, G.; Şit, M.; Tekçe, H. New adipokines: Leptin, adiponectin and omentin. Abant Med J 2013, 2:56-62.

3. Oh, D.K.; Ciaraldi, T.; Henry, R. R. Adiponectin in health and disease. Diabetes Obes Metab 2007, 9:282-9.

4. Bouatia-Naji, N.; Meyre, D.; Lobbens, S. et al. ACDC/Adiponectin polymorphisms are associated with severe childhood and adult obesity. Diabetes 2006, 55: 545-50.

5. Stumvoll, M.; Tschritter, O.; Fritsche, A. et al. Association of the T-G polymorphism in adiponectin (exon 2) with obesity and insulin

sensitivity: interaction with family history of type 2 diabetes. Diabetes 2002, 51:37–41.




94

IDDGC17-OP-186

DETECTION OF EXPRESSION OF PPARβ/δ IN HUMAN PTERYGIUM

Sumeyya Deniz CELIK

1,Omer ATES

1, Emel ENSARI

1, Selim DEMIR

2, Helin Deniz DEMIR

2

1Department of Medical Biology, Faculty of Medicine, Gaziosmanpasa University, Tokat, Turkey 2Department of Ophthalmology, Faculty of Medicine, GaziosmanpaĢa University, Tokat, Turkey

[email protected]

Aims and Scopes: Pterygium is a triangular-shaped ocular surface disease characterized by cell proliferation, invasion, and

antiapoptosis which is think as a disorder like tumor rather than degeneration [1,2]. Retinoic acid (RA) is carried into the nucleus by

the cytosolic cellular retinoic acid-binding protein-II (CRABP-II) and cytosolic fatty acid-binding protein 5 (FABP5). CRABP-II and

FABP5 target RA to nuclear retinoic acid receptor (RAR) and orphan nuclear receptor peroxisome proliferator- activated receptor β/δ

(PPARβ/δ), respectively. In cells that express a high CRABP-II/FABP5 ratio, RA is ‗‗channeled‘‘ to RAR, leading to cell growth

inhibition. Conversely, in the presence of a low CRABP-II/FABP5 expression ratio, RA is targeted to PPARβ/δ, resulting in

stimulation of cell proliferation and inhibition of apoptosis [3,4]. We evaluated the expression of PPARβ/δ, can stimulate cell

proliferation, which characterize pterygia.

Material and Methods: In this study, it was assessed the mRNA expression of PPARβ/δ by quantitative real-time polymerase chain

reaction (qRT-PCR) in 12 of pterygium tissue samples and 12 of uninvolved conjunctiva samples were obtained from the same eye of

patients undergoing surgery. Expression level of PPARβ/δ was measured by Delta–Delta Ct method. Statistical analyses were

performed using the SPSS 16.0 software.

Results and Discussion: The results of our study indicated that expression of PPARβ/δ downregulated by more than 1 fold in

pterygium tissue than normal conjunctiva. This is the first study to analyzed expression levels of PPARβ/δ in pterygium. For

understand of pathogenesis of pterygium needs to further investigation.

Keywords: Retinoic acid signaling, pterygium, PPARβ/δ

Acknowledgements: This work was supported by The Scientific and Technological Research Council of Turkey (TUBITAK) 1001

Grant number: 215S692

References: [1] Riau, A.K.; Wong, T.T.; Finger, S.N.; Chaurasia, S.S.; Hou, A. H.; Chen, S.; Yu, S.J.; Tong, L. Aberrant DNA Methylation of Matrix

Remodeling and Cell Adhesion Related Genes in Pterygium. PLoS ONE, 2011, 6(2),e14687.

[2]Kim, K.W.; Park, S.H.; Wee, S.W.; Kim , J. C. Overexpression of Angiogenin in Pterygium Body Fibroblasts and Its Association With

Proliferative Potency. Invest Ophthalmol Vis Sci., 2013, 54, 6355–6362.

[3] Wolf, G. Retinoic acid as cause of cell proliferation or cell growth inhibition depending on activation of one of two different nuclear

receptors. Nutrition Reviews, 2008, 66(1), 55–59.

[4] Schug, T. T.;Berry,D. C.; Shaw, N. S.; Travis, S. N.; Noy, N. Opposing Effects of Retinoic Acid on Cell Growth Result from Alternate

Activation of Two Different Nuclear Receptors. Cell, 2007, 129, 723–733.




95

IDDGC17-OP-187

THE EFFECT OF CATECHOL-O-METHYLTRANSFERASE (COMT) VARIANTS ON ACUTE

POSTOPERATIVE MORPHINE REQUIREMENTS: A CLINICAL PILOT STUDY

Meltem Savran Karadeniz1, Hayriye Senturk Ciftci

2, Rusdu Oguz

2, Sedat Tanju Karadeniz

3, Evren Aygun

1, Sacide

Pehlivan2, Mert Senturk

1, Kamil Mehmet Tugrul

1

1 Istanbul University, Istanbul Medical Faculty, Anesthesiology Department, Istanbul

2 Istanbul University, Istanbul Medical Faculty, Medical Biology Department, Istanbul

3 Kadir Has University, Bioinformatics and Genetics Department, Istanbul

Aims and scopes: Genetic variability in the COMT gene may contribute to differences in pain sensitivity and response to opioid

analgesics. The purpose of this study was to investigate whether COMT gene (VAL158/108MET=missense mutations) variants

contribute to the variability in response to morphine infusion used for acute post nephrectomy analgesia.

Materials and Methods: After having ethics committee approval and written informed consent, 25 patients were given intravenous

morphine by Patient-Controlled Analgesia (PCA) device for post nephrectomy analgesia. Pain scores, sedation scores, the severity of

nausea and vomiting, the incidence of pruritus, and the total intravenous morphine consumption were recorded for the first 24

postoperative hours. Genotyping of molecular variants (rs4680/rs6269) was performed by PCR-RFLP.

Results and Discussion: We evaluated Val158Met in relation to the postoperative pain score. Demographic data were not

significantly different between genotypes (p>0.05). Patients with Val/Val genotype for Val158Met had higher postoperative pain

scores compared with the Val/Met and Met/Met genotypes at the time of discharge from the post anesthesia care unit (p=0.041).

Total morphine dose requirement was also higher in patients with Val/Val genotype (18.76±6.23 mg) compared with the Val/Met and

Met/Met (17.50±5.52/15.54±6.68) genotypes. There were no differences in the severity of nausea and vomiting and the incidence of

pruritus between all genotypes (p>0.05).

Genetic factors are involved in individual differences in sensitivity to pain and the use of analgesics. The present study demonstrated

that Val158Met polymorphism is related with the amount of morphine required for pain control in the postoperative period. The

Val158Met which is highly expressed in brain cells, affects the activity of morphine. Further studies will be needed for patient

specific pain control regimens in the future.

Keywords: Postoperative pain, morphine, COMT, analgesis

References:

[1] Reyes-Gibby CC, Shete S, Rakvag T, Bhat SV, Skorpen F, Bruera E, Kaasa S, Klepstad P. Exploring joint effects of genes and the

clinical efficacy of morphine for cancer pain: OPRM1 and COMT gene. Pain 2007; 130:25-30.

[2] Henker RA, Lewis A, Dai F, Lariviere WR, Meng L, Gruen GS, Sereika SM, Pape H, Tarkin IS, Gowda I, Conley YP. The associations

between OPRM 1 and COMT genotypes and postoperative pain, opioid use, and opioid-induced sedation. Biol Res Nurs 2013; 15:309-317.




96

IDDGC17-OP-188

ASSOCĠATĠON BETWEEN TNF-β VARĠANT (rs909253) AND RĠSK OF TEMPOROMANDĠBULAR

DĠSORDERS

Serbulent Yigit1, Ayse Feyda Nursal

2, Mehmet Kemal Tumer

3, Akın Tekcan

4

1Gaziosmanpasa University, Faculty of Medicine, Department of Medical Biology, Tokat, Turkey

2Hitit University, Faculty of Medicine, Department of Medical Genetics, Corum, Turkey

3Gaziosmanpasa University, Faculty of Dentistry, Department of Oral Surgergy, Tokat, Turkey

4Ahi Evran University, Faculty of Medicine, Department of Medical Biology, Kirsehir , Turkey

Abstract

Aims and Scopes:Temporomandibular disorders (TMD) are a group of conditions that cause chronic orofacial pain [1]. The tumor

necrosis factor β (TNF-β) is a proinflammatory cytokine that is involved in the various aspects of the inflammatory process including

organization and maintenance, and in the arrangement of cells at the inflammation site [2]. The purpose of this study was to evaluate

the correlation between TNF-β +252A/G (rs909253) variant and suspectibility to TMD in a Turkish sample.

Materials and Methods: The study included 104 patients (26 males, 78 females; mean age± SD years 34.7813.110) with TMD and

126 healthy controls (44 males, 82 females; mean age± SD years 36.5210.903). The TNF-β +252A/G variant analysis was based on

Polymerase Chain Reaction (PCR) and included following steps: DNA extraction from blood, PCR and Restriction Fragment Length

Polymorphism (RFLP).

Results and Discussion: With regard to the TNF-β +252A/G variant, there was significant difference in genotype and allele

frequencies between patient group and control group (OR: 1.69, 95% CI: 1.12-2.56, p=0.010 and p=0.012, respectively). The

patients had apparently higher frequencies in genotype AG of TNF-β +252A/G variant compared with the control group (p<0.05) and

this might be the risk factor for TMD. AA genotype and A allele have a protective effect for TMD. A more statistically significant

association was observed when the patients were compared with the controls according to AA genotype versus AG+GG genotypes

(p=0.003, OR: 2.24, 95% CI: 1.32-3.82). There was no deviation from Hardy Weinberg Association (HWA) for TNF-β +252A/G

variant in both patient and control groups. It was found that TNF-β +252A/G genotype distribution is associated with age and eating

disorders (p=0.003 and p=0.046, respectively). The mean age of patients with GG genotype was higher than the mean age of patients

with AA and AG genotypes. Furthermore, the homozygous AA genotype frequency was found to be higher in patients with eating

disorders. Our results strongly demonstrate an association between TNF-β +252A/G variant and susceptibility to TMD in a Turkish

sample. Further studies are needed to confirm this observation.

Key words: Temporomandibular disorders, tumor necrosis factor β, +252A/G, variant.

References

[1] Wadhwa S Kapila S. TMJ Disorders: future innovations in diagnostics and therapeutics. J Dent Educ 2008; 72: pp. 930-947.

[2] Bazzoni F, Beutler B. The tumor necrosis factor ligand and receptor families. N Eng J Med 1996; 334(26): 1717-25.




97

IDDGC17-OP-189

HIGH YIELD BACTERIAL EXPRESSION of mCherry RED FLUORESCENT PROTEIN USING

INDUCIBLE E.coli EXPRESSION SYSTEM IN BIOREACTOR

Hülya Kuduğ1, Duygu Düzgün

2, Rizvan Ġmamoğlu

3, Ġsa Gökçe

4

1,2,3,4

Gaziosmanpasa University, Faculty of Engineering and Natural Sciences,

Department of Bioengineering, Tokat, Turkey

[email protected]

Aims and Scopes:

Monomeric fluorescent proteins are often ideal for fusions as they tend to be the least disruptive to the function of the protein to which

it is fused. Fusion proteins have been expressed successfully in a wide variety of organisms and used for imaging techniques.

mCherry is a red monomeric fluorescent protein derived from the tetrameric Discosoma protein DsRed. mCherry peaks

absorption/emission at 587 nm and 610 nm, respectively. It is resistant to photobleaching and is stable. It matures quickly, with a

t0.5 of 15 minutes, allowing it to be visualised soon after translation [1]. Aim of this study is production of recombinant red fluorescent

protein (mCherry) in a large scale in E.coli expression system using bioreactor.


E.coli pBAD expresion vector that inserted mCherry gene transformed to E.coli BL21-AI competent cells by heat shock for

expression of target protein. Transformed cells cultured in bioreactor includes 3L LB triple medium. Protein expression induced with

arabinose and induction time optimized. Purification of recombinant mCherry was performed with affinity chromatography. The

protein is engineered with 6xHis-tag on the N-terminus, which can be used for purification by using Ni++ beads easily. Recombinant

protein analyzed by SDS-PAGE and UV spectroscopy.


mCherry is sometimes preferred to other fluorophores due to its colour, as well as its photostability compared to other monomeric

fluorophores. mCherry was produced recombinantly in bioreactor in high yield (20 mg/L). It is observed that at optimized arabinose

concentration (0.04 %) for 5 hours induction resulted high levels of fluorescent protein expression. Therefore, this method provides a

quick, high-yield production route for any soluble fluorescent protein that is needed for imaging purposes in biophysical research.

Keywords: Fluorescent proteins, mCherry, Recombinant protein.

References:

[1] Shaner, N. C; Campbell, R. E.; Steinbach, P. A.;Giepmans, B. N. G.; Palmer, A. E.; Tsien, R.Y. Improved monomeric red, orange and yellow

fluorescent proteins derived from Discosoma sp. Red fluorescent protein. Nature Biotechnology. 2004, 22 (12): 1567–72.

Acknowledgements: This work was supported by the Scientific and Technological Research Council of Turkey (TÜBİTAK), Grant

No: 114Z956




98

IDDGC17-OP-190

ROBUST AND RIGOROUS CLASSIFICATION OF TISSUE SPECIFIC GENES

Hatice BüĢra Konuk1,2

, Alper Yılmaz1

1 Bioengineering Department, Yıldız Technical University, Ġstanbul, Turkey

2 Bioengineering Department, Gebze Technical University, Kocaeli, Turkey.

[email protected]

Aims and Scopes: Tissue-specific gene expression plays a fundamental role in multi-cellular biology. An understanding of the tissue-

specific pattern of gene expression can help elucidate the molecular mechanisms of gene function, transcriptional regulation of

biological processes, tissue development, tissue physiology and also pathogenesis of tissue-associated diseases [1,2]. Different

transcripts are expressed in diverse tissues or cell types, as well as in different developmental stages or diseases and used as an

indicator for many complex diseases like different cancers and their subtypes [1,3,4]. For these reasons, identification of tissue-

specific genes is crucial for understanding cellular mechanisms. There are several methods for classification of tissue specific genes,

each differ in their assumptions and their scale. These methods can be divided in two groups. First group summarizes in a single

number whether a gene is tissue specific or wide expressed (Tau, Gini, TSI, Counts and Hg), and the second group calculates, for each

tissue separately, how specific the gene is to that tissue (z-score, SPM, EE and PEM) [5]. The former group is poor in per gene per

tissue decision and provides coarse results. The latter group struggles in broad and weak expression cases. On top of that different

methods conflict among each other for tissue-specific gene lists. Tau (τ) appears consistently to be the most robust method in different

studies [5] and more significant than other methods. However, limitations exist in this method. In this study, we aim that to generate

rigorous classification using τ calculation and additional new approach. As a result, we assign genes to multiple tissues with τ score

and statistical distance.

Materials and Methods: We used RNA-seq data (E-MTAB-1733) [6] from 27 different human tissues downloaded from

ArrayExpress. The detection process of the tissue specific genes not only includes tau calculation, but also requires a set of methods to

eliminate common genes. The first step is determining the lower bound of the gene expression level. After calculation of tau score for

each gene, statistical distance of the upper bound is established separately for each single gene in 27 tissues. Specific expression of a

gene in a tissue was calculated using statistical distance and τ score.

Results and Discussion: After filtering out lowly expressed transcripts, 18326 transcripts were assessed for specific expression in

tissues. We successfully assigned genes to multiple tissues for specificity oppose to assignment to single tissue by original tau study.

Also we used our approach to assign tissue specificity on published differentially expressed gene (DEG) lists for various cancers. We

observe that many genes differentially expressed in a cancer type might contain genes specific to another tissue. These results suggest

that cancer tissue samples might be heterogeneous and cancer network might have complex interplay with tissue-specific gene

expression. On the other hand, tissue-specific genes may provide insight about tumor heterogeneity, malignancy and metastasis to

other tissue.

Keywords: Tissue specific genes, RNA-seq, tau score, statistical distance, differentially expressed genes (DEGs)

References: [1] Song, Y.; Ahn, J; Suh, Y.; Davis, M.E.; Lee, K. Plos one, 2013, 8(5),1-17.

[2] Xiong, M.; Heruth, D.P.; Zhang L.Q.; Qing Ye S. FEBS Open Bio., 2016, 6, 774–781.

[3] Slaugenhaupt, S.A.; Blumenfeld, A.; Gill, S.P.; Leyne, M.; Mull, J.; et al. Am. J. Hum. Genet., 2001, 68.

[4] Zhu, J.; Chen, G.; Zhu, S.; Li, S.; Wen, Z.; Li, B.; Zheng, Y.; Shi, L. Scientific Reports, 2016, 6.

[5] Kryuchkova-Mostacci, N.; Robinson-Rechavi, M. Briefings in Bioinformatics, 2016, 1–10.

[6] Fagerberg, L.; Hallstrom, B.M.; Oksvold, P. et al., Mol. Cell. Proteomics, 2014, 13, 397–406.





99

IDDGC17-OP-191

The Effects of Calcium Silicate Application on the Expressions of MdSOS1 and MdNHX1 Genes in Apple

Plant Under Salt Stress

Merve KILIÇ1, Emine ARSLAN

1, Servet ARAS

2, Ahmet EġĠTKEN

3

1Selcuk University, Faculty of Science, Department of Biology, Campüs Selçuklu, Konya, Türkiye

2Bozok University, Faculty of Agriculture, Department of Horticulture, Erdoğan Akdağ Campüs, Yozgat, Türkiye

3Selcuk University, Faculty of Agriculture, Department of Horticulture, Campüs Selçuklu, Konya, Türkiye

[email protected]

Aims and Scopes:

Salt stress is one of the important stress factors limiting crop yield and quality, especially affecting the growth of plants in arid and

semi-arid regions. Increased salt concentration as a result of decreased water potential in the soil lowers the osmotic potential of plant

cells. By applying various chemical substance, plants can tolerate a certain extent of salt. To investigate calcium silicate (CaSiO3)

chemical, which are not yet known effects on fruit trees under stress conditions has been important. In this study, it was aimed to

determine effects of CaSiO3 chemical applied first time in apple plants on the expression levels of MdSOS1 and MdNHX1 genes

which play an important role in resistance to various stresses, especially salt stress.


Three doses of CaSiO3 chemical were applied to fuji variety grafted onto M9 rootstock. Total RNA was isolated obtained from leaf

samples obtained as a result of 1 month application and 3 months application and cDNA was synthesized. The expression levels of

MdSOS1 and MdNHX1 genes were quantitatively determined by Real Time PCR. The data were analyzed by the Duncan test of

SPSS programme.


There was a decrease in the expression of both SOS and NHX genes at 2mM CaSiO3 dose in the M9 seedlings for 1 month. At the end

of 4 months, the expression of both the SOS gene and the NHX gene in the M9 seedlings increased in all doses except 2mM CaSiO3

dose, thus the salt tolerance of the plant has increased. The highest dose of CaSiO3 (2 mM) after 4 months was significantly reduced

expressions of both genes according to both controls. This suggests that this dose may have been toxic for plant. Similarly many

studies reported that CaSiO3 have provied durability against many abiotic stress for plant [1, 2].

Keywords: Salt stress, Fuji Apple Seedling, MdSOS1, MdNHX1, CaSiO3

References:

[1] H. F. W. Taylor, 1990, Cement Chemistry, Academic Press, , ISBN 0-12-683900-X, p 33-34.

[2]A.I. Lopez-Carrıon, R. Castellano, M.A. Rosales, J.M. Ruiz,L. Romer, 2008, Role of nitric oxide under saline stress: implications on proline

metabolism, Biologia Plantarum 52 (3): 587-591.




100

IDDGC17-OP-192

ANALYSIS OF RELATIONSHIP BETWEEN ACUTE BRONCHIOLITIS AND IL-8 GENE

POLYMORPHISM

Cisem Nildem Dogan1, Omer Ates

1, Sahin Takcı

2

1Department of Medical Biology, Medical Faculty, GaziosmanpaĢa University, Tokat, Turkey, [email protected]

2Department of Neonatology. Medical Faculty ,GaziosmanpaĢa University, Tokat,Turkey

Aims and Scopes: Bronchiolitis is the most common lower respiratory tract infection in children under two years of age and is the

leading cause of hospitalization in young children aged six months. It can create a life-threatening condition especially in children

with having heart and lung problems. The disease is mostly epidemic in winter months. The most important cause of this disease is

respiratory viruses especially Respiratory syncytial virus (RSV). According to many studies, nasal sections of infants who have acute

bronchiolitis provides high level of IL-8 chemokines, and the level of IL-8 is positively correlated with disease severity. Airway cells

in culture that was infected by RSV induces expression of IL-8. Also there are some research showed that identical twins are more

prone than fraternal twins in terms of RSV infection. Because of these there are some research have done about the relationships

between acute bronchiolitis and IL-8 gene polymorphism. In this study, we investigated whether IL-8 781 C / T gene polymorphisms

are associated with acute bronchiolitis.

Materials and Methods: 104 bloods were taken from infants who has acute bronchiolitis disease and 104 blood were taken from

infants who came to hospital for rutin controls. DNA extraction have been done on these bloods and then we have used polymerase

chain reaction-restriction fragment length polymorphism (PCR-RFLP) to find genotype distribution and allele frequency of IL-8

781C/T.

Results and Discussion: The genotype and allele distribution of IL-8 781 C/T polymorphism have not been associated with acute

bronchiolitis (P=0.5723, P= 0.149 respectively). IL-8 781C/T gene polymorphism was investiagted in some studies [1,2,3]. Among

those studies, one of them has showed that there is an association between IL-8 781C/T and acute bronchiolitis [1]. On the other hand

our study result shows that there is no relationship between IL-8 and acute bronchiolitis in Turkish infants. More blood samples could

have been increasing the precision of the study. It has been thought that appropriate sampling size can increase the the chance of

success in sunsequent studies.

Keywords: Acute bronchiolitis, IL-8, 781 C/T, polymorphism

References: [1] Hull J., Ackerman H., Isles K., Usen S., Pinder M., Thomson A., Kwiatkowski D. 2001. Unusual haplotypic structure of IL8, a susceptibility locus for a common

respiratory virus. Am J Hum Genet, 69:413-9. [2] Hull J., Thomson A., Kwiatkowski D. 2000. Association of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families. Thorax,

55:1023–1027

[3] Heinzmann A., Ahlert I., Kurz T., Berner R., and Deichmannv K.A., 2004. Association study suggests opposite effects of polymorphisms within IL8 on bronchial asthma and respiratory syncytial virus bronchiolitis. J ALLERGY CLIN IMMUNOL, 114 (3): 671-676.





101

IDDGC17-OP-193

MOLECULAR VARIATIONS in Cinara (Aphididae, Lachninae) SPECIES on Cedrus spp.

Hayal Akyıldırım Beğen1, Gazi Görür

2

1Artvin Coruh University, Forestry Faculty, Department of Forest Engineering, Artvin

2Ömer Halisdemir University, Science and Art Faculty, Biotechnology Department, Niğde

E-mail: [email protected]

Aims and Scopes: There is accumulating information about how molecular and morphological features of aphid affected by

environmental factors including host plant features and ecological conditions. The Cedrus aphids are important pest in forestry around

the world, Cinara species living on different part of Cedrus spp. (trunks, branches or roots). It is often difficult to identify aphid

species accurately by traditional methods due to their unique properties including partenogenetic reproduction, telescopic generation

and the occurrence of multiple morphs within single species. As genus Cinara are very large group that consist of a lot of species

differed from each other only with small morphological features, having complex life cycle and close relationships with their host

plants, it is difficult to identify them accurately by performing traditional identification keys based on morphology. In this study, we

aimed to estimate the population structure of Cinara species, genetic distance between intraspecies that were determined in Inner

West Anatolian Part of Turkey and Niğde province.

Materials and Methods: 260 Cinara specimens were collected from Afyonkarahisar, Kütahya, Uşak and Niğde provinces, during the

summer period of 2012-2014. Collected samples preserved in 96% ethanol and voucher specimens were deposited in Biotechnology

laboratory of Ömer Halisdemir University. Only one Cinara individual from same colony was used for DNA extraction A 279 bp the

mitochondrial cytochrome oxidase subunit I (COI) gene region of 18 individuals were sequenced and analyzed. We used COI

sequences available from GenBank for Cinara (Cinara) and Pineus armandicola (EF073106) and Adelges cooleyi (EU785272),

belonging to Aphididae as out groups.

Results and Discussion: Among the 18 populations, we defined 4 haplotypes for COI genes. COI sequences showed small genetic

distances among haplotypes. There were low levels of nucleotide diversity among all the populations. The average intraspecific

divergence was about 0.70 %. This is a preliminary DNA barcoding study in Cinara and comprehensive sampling is needed to test

and confirm the usefulness of DNA barcoding in this subfamily

Keywords: Cedrus, Cinara, COI, Turkey.

Acknowledgements: We are thankful to TUBİTAK (project number 111T866) and scientific research project unit of Ömer Halisdemir

University (project number FEB2013/37-DOKTEP)




102

IDDGC17-OP-197

ANALYSĠS OF RARα GENE EXPRESSION IN HUMAN PTERYGIUM

Emel ENSARI

1,Omer ATES

1, Sumeyya Deniz CELIK

1, Selim DEMIR

2, Helin DENĠZ DEMIR

2

1Department of Medical Biology, Faculty of Medicine, Gaziosmanpasa University, Tokat, Turkey 2Department of Ophthalmology, Faculty of Medicine, Gaziosmanpasa University, Tokat, Turkey


Aims and scopes: Pterygium is a common degenerative disease of the ocular surface in which wedge-shaped ingrowth of

conjunctival tissue invades the peripheral cornea [1]. Although previously thought to be a solely degenerative disease, new evidence

has demonstrated the role of cell proliferation and inflammation in the pathogenesis of pterygium [2].Retinoic acid (RA) is a

metabolite of vitamin A (retinol), which performs essential functions in normal cell growth and differentiation [3]. RA functions as

the ligand for retinoic acid receptors (RARs), and can regulate several developmentally important genes. At these RA regulated

genes, heterodimers of RARγ and retinoid X receptor α (RXRα) recognize and bind to RA responsive DNA elements (RAREs) [4]. It

is well known that ocular surface epithelia have an absolute requirement for vitamin A to maintain their wet-surfaced phenotype, and

Vitamin A deficiency leads to abnormal differentiation of the ocular surface epithelia resulting in keratinization of both conjunctival

and corneal epithelia [5]. In this study, we have investigated pterygium specimens for detection RARα mRNA level

Materials and methods: To detect the expression of RARα mRNA, SYBR Green-based real-time PCR (qPCR) was performed in 12

specimens of pterygium from 12 eyes were examined, together with normal conjunctival tissue from the same eyes and measured by

Delta–Delta Ct method. Statistical analyses were performed using the SPSS 16.0 software.

Resulting and discussion: According to our data results that the mRNA expression of RARα was lower in the pytergium tissue

compared with the normal conjunctiva. By the way, our study findings need to be supported by other studies.

Keywords: Pterygium, Retinoic Acid Signaling Pathway, RARα, qPCR

Acknowledgements: This work was supported by The Scientific and Technological Research Council of Turkey (TUBITAK) 1001

Grant number: 215S692

References: [1]Engelsvold, D. H.; Utheim, T. P.; Olstad, O.K.; at al. miRNA and mRNA expression profiling identifies members of the miR-200 family

as potential regulators of epithelialemesenchymal transition in pterygium. Experimental Eye Research 115 (2013) 189e198.

[2]Kheirkhah, A.; Nazari, R.; Safi, H.; at al. Effects of intraoperative steroid injection on the outcome of pterygium surgery. Eye (2013) 27,

906–914; doi:10.1038/eye.2013.142

[3]Brown, G.T.; Cash, B.G.; Blihoghe, D.; et al.The Expression and Prognostic Significance of Retinoic Acid Metabolising Enzymes in

Colorectal Cancer.,2014. PLoS ONE 9(3): e90776. doi:10.1371/journal.pone.0090776

[4]Urvalek, A.; Laursen, K.B.; Gudas, L. J.; The Roles of Retinoic Acid and Retinoic Acid Receptors in Inducing Epigenetic Changes.

Subcell Biochem. 2014 ; 70: 129–149. doi:10.1007/978-94-017-9050-5_7.

[5]Hori, Y.; Spurr-Michaud, S. J.; Russo, C. L., et al.; Effect of Retinoic Acid on Gene Expression in Human Conjunctival Epithelium:

Secretory phospholipase A2 mediates retinoic acid induction of MUC16. Invest Ophthalmol Vis Sci. 2005 November ; 46(11): 4050–4061.





103

IDDGC17-OP-198

THE DETERMINATION OF DNA DAMAGE ON IRRADIATED FRESH VEGETABLES BY DNA

COMET ANALYSIS

Nurcan Cetinkaya

Ondokuz Mayis University, Faculty of Veterinary Medicine, Department of Animal Nutrition and Nutritional Diseases. Kurupelit, TR-

55139, Samsun, Turkey. E-mail:[email protected]

Aims and Scopes:

Consumers concern about the safety of fresh vegetables due to the presence of bacteria such as Salmonella, Escherichia coli O157:H7

and Listeria monocytogenes. Irradiation is a non-thermal process that has been used to improve the microbiological safety of these

foods in many countries. In general, doses of 2 kGy reduce the number of bacteria by 3 to 4 log cycles and yeasts by 1 or 2 log cycles.

Up to 2 kGy doses were effective in reducing the initial microflora as well as extending the shelf life of the products without adverse

effect on their sensory characteristics[1]. However, some consumers don‘t want to consume the irradiated foods and want to know

while purchasing the foods irradiated or not. Analytical detection of radiation treatment of food is an important to implement such

control, once the food items have left the irradiation facility. Hence, food safety authorities of countries should provide necessary

information about marketed food safety to their consumers. One of the commonly used method is the DNA Comet Assay EN

13784[2] which has been described as a rapid and inexpensive screening test to identify radiation treatment of food. Turkish

Standardization Institute published the standard in Turkish, 2004 [3].The DNA Comet laboratory was established by Turkish Atomic

Energy Authority (TAEA) for market checking of irradiated foods whether labelled correctly or not. The objective of the present

study was to determine irradiated fresh dometos, lettuce, parsley and rocket by using of DNA Comet Assay.


Vegetables (n=10) were freshly collected and transferred to laboratory. Fresh vegetables were irradiated with 1-2 KGy doses at Co-

60 Gama Irradiation Facility (Gammacell 60-Co, does rate 1.31 kGy/h) at Saraykoy Nuclear Research and Training Center, TAEA,

Turkey. DNA damage analysis of fresh vegetable samples were carried out by the method of CEN-EN 13784 Foodstuffs - DNA

Comet Assay for the detection of irradiated foodstuffs - screening method-European Committee for Standardization. Test was

carried out under neutral conditions. 0.25 g from each of irradiated and non-irradiated fresh vegetable samples were lysised for 30 min

and prepared for gel electrophoresis. After micro gel electrophoresis, stained slides were evaluated with a standard transmission

microscope (Olympus BX 51 model) at 20X and photos of comets were taken by digital color video camera (Pixera).


DNA fragmentation were occurred with applied radiation dose on irradiated fresh samples. Non-irradiated cells appeared as intact

nuclei without tails, while irradiated cells showed long and wide tails or separated tails from the head of the comet by typical DNA

fragmentation for fresh tomatoes, lettuce, parsley and rocket. In conclusion, intensive DNA damages were observed on irradiated

fresh tomatoes, lettuce, parsley and rocket with 1-2 KGy applied doses. DNA Comet analysis may be used for detection of irradiated

fresh tomatoes, lettuce, parsley and rocket.

Key words: DNA Comet Analysis, DNA Damage, Irradiated Fresh Vegetable,

References

[1] Basbayraktar,V., Halkman,H., Yucel,P.,and Cetinkaya, N. Use of irradiation to improve the safety and quality of minimally processed fruits and

vegetables. In Use of irradiation to ensure the hygienic quality of fresh, pre-cut fruits and vegetables and other minimally processed food of plant

origin. 2006, IAEA-TECDOC,Vienna: International Atomic Energy Agency, pp.243–272.

[2] CEN-EN 13784 Foodstuffs - DNA Comet Assay for the Detection of Irradiated Foodstuffs - Screening Method-European Committee for

Standardization.2001.

[3] TS EN 13784, ICS 67.050, Turk Standardi, Gida Maddeleri – Isinlanmis Gida Maddelerinin Belirlenmesi İcin DNA Komet Deneyi – Eleme

Yontemi. TS EN 13784/Aralik 2004.

Ackowledgements

Dedection of Irradiated Foodstuffs Project was supported by TAEA. Technical Report 2010/30 for all studied plant and animal

orginated foodstuffs was published by TAEA.




104

IDDGC17-OP-199

DO CLIMATE-DRIVEN ALTITUDINAL RANGE SHIFTS EXPLAIN THE INTRASPECIFIC

DIVERSIFICATION OF A NARROW RANGING MONTANE MAMMAL, TAURUS GROUND

SQUIRRELS?

Hakan Gür1, Utku PerktaĢ

2, Mutlu Kart Gür

1

1Department of Biology, Faculty of Arts and Sciences, Ahi Evran University, KırĢehir, Turkey

2Department of Biology, Faculty of Science, Hacettepe University, Ankara, Turkey

Aims and Scopes: Understanding how species have responded to strong climatic fluctuations accompanying glacial-interglacial

cycles is critical to predicting their likely responses to future climate change, and therefore can help guide conservation strategies.

Using molecular phylogeography and ecological niche modelling, we aimed to understand how a newly recognized cryptic montane

mammal (Spermophilus taurensis, Taurus ground squirrels) has responded to global climate changes through the Late Quaternary

glacial-interglacial cycles as a means to better predict their likely responses to future climate change.

Materials and Methods: 51 cytochrome b mitochondrial DNA sequences from throughout the known distribution of Taurus ground

squirrels were used to investigate the intraspecific diversification. Besides molecular phylogeography, ecological niche modelling was

also employed to get insights into possible climate-driven altitudinal range shifts in the past (the Last Glacial Maximum, 22 kya and

the Mid-Holocene, 6 kya) and in the future (2050).

Results and Discussion: Taurus ground squirrels survived the Late Quaternary glacial-interglacial cycles by altitudinal migrations

without large geographical displacements. As warming occurred from the Last Glacial Maximum to the Mid-Holocene to the present,

the potential distribution of Taurus ground squirrels shifted towards higher altitudes, resulting in a smaller range in the present. As

warming continues, the potential distribution of Taurus ground squirrels will continue to shift towards higher altitudes, resulting in a

much smaller range in the future. Particular sources of concern are the synergistic effects of future climate change and anthropogenic

impacts on Taurus ground squirrels and their montane environments.

Keywords: Glacial-interglacial cycles, Quaternary, range shifts, Spermophilus taurensis

Acknowledgements: This study was supported by the Ahi Evran University Scientific Research Projects Coordination Unit (Project

Number: PYO-FEN.4001.15.008).




105

IDDGC17-OP-200

THE EFFECTS ON OXIDATIVE STRESS OF AMYGDALIN AND LEUPROLIDE IN RECURRENCE

ENDOMETRIOSIS IN RATS

Zeliha Cansel Ozmen1, Hatice Yılmaz Dogru

2

1Department of Biochemistry, GaziosmanpaĢa University Faculty of Medicine, TOKAT

2Department of Obstetrics & Gynecology, GaziosmanpaĢa University Faculty of Medicine, TOKAT.

[email protected]

Aims and Scopes: Endometriosis is a disease where endometrial tissue grows outside the uterus, causing pain and infertility (1).

Inflammation is important that play a crucial role in the establishment and growth of endometriotic lesions (2). Free radicals have

been implicated in the pathogenesis of endometriosis (3). GnRH agonists (leuprolide) are one of the most commonly used treatments

for severe endometriosis. While GnRH agonists cause regression of endometriotic lesions their use is associated with frequent adverse

effects (4). Amygdalin is derived from the fruit kernels of the Rosaceae family, which includes peach, apricot and bitter almond (5).

Amygdalin has been used as a traditional drug because of its wide range of medicinal benefits, including curing or preventing cancer.

In addition, amygdalin has been shown to have anti-inflammatory effect (6). In our study, we aimed whether a relationship exists

between amygdalin and leuprolide and oxidative stress in recurrence endometriosis in rats.

Materials and Methods: A total of 12 Wistar-albino female rats were enrolled in this experimental study. Initially the abdominal

cavity was irrigated with five ml of saline and two ml of fluid was aspirated to establish as a control group for both groups.

Endometriosis was provided using autotransplantation technique to rats. Amygdalin to group 1 and leuprolide to group 2 were given.

The abdominal cavity was irrigated by five ml of saline and two ml of the fluid was aspirated. All medications were terminated and

were established recurrence endometriosis. Two ml of saline was aspirated in both groups. In the study, peritoneal fluid (PF) levels of

8-hydroxy-2-deoxyguanosine were determined using the Rat DNA Damage (ADI-Eks-350) ELISA kit (Enzo Life Sciences, Cat No.

YHB1298Ra). After calculation of the assay results, PF concentrations of 8-OHdG were expressed in nanograms per milliliter.

Results and Discussion: In the present study, the 8-OHdG levels in amygdalin treated rats were significantly decreased compared to

untreated rats. In addition, the 8-OHdG levels in rats with endometriosis recurrence were higher than untreated rats (p<0.0026). The

8-OHdG level in rats in amygdalin group was 6.596 as median (6.068-7.110) ng/ml, a median value of 8.356 (7.589-8.877) ng/ml in

rats with recurrence endometriosis, and a median value of 7.397 (5.863-7.740) ng/ml in untreated rats. The 8-OHdG level in rats in

leuprolide treated rats was significantly decreased compared to untreated rats and the 8-OHdG levels in rats with recurrence

endometriosis were unchanged compared to untreated rats (p<0.0234). The 8-OHdG level in rats in leuprolide groups was 7.034 as

median (6.452-7.521) ng/ml, a median value of 7.856 (7.521-8.288) ng/ml in rats with recurrence endometriosis, and a median value

of 7.836 (4.945-8.712) ng/ml in untreated rats.

The present study demonstrated that 8-OHdG levels, which is a an indicator of free radical induced DNA damage, is decreased in rats

treated with amygdalin and leuprolide acetate. However, the 8-OHdG level was found to be higher in amygdalin group compared to

untreated rats, after establishing recurrence endometriosis by the termination of amygdalin and leuprolide treatment. In contrast, the 8-

OHdG level was unchanged in leuprolide group than untreated rats. These findings revealed that widely used agent leuprolide has no

effect on DNA damage, and further studies are required to show amygdalin as an alternative therapy to leuprolide due to increased

oxidative stress in recurrence endometriosis.

Keywords: 8-OHdG, Endometriosis, Leuprolide, Amygdalin

References: [1] Down-regulation of 8-Hydroxydeoxyguanosine and Peroxiredoxin II in the Pathogenesis of Endometriosis-associated Ovarian

Cancer. Sova1 H, Kangas J, Puıstola U, Santala M, Lıakka A and Karıhtala P. Antıcancer Research 2012 32: 3037-3044 [2] Diagnostic potential of peritoneal fluid biomarkers of endometriosis. Rižner TL. Expert Rev. Mol. Diagn. 2015 15(4), 557–580

[3] Increased levels of oxidative stress markers in the peritoneal fluid of women with Endometriosis. Polak G, Wertel I, Barczyński B, Kwasśniewski

W, Bednarek W, Kotarski J. European Journal of Obstetrics & Gynecology and Reproductive Biology. 2013 168:187–190

[4] A comparison of progestogens or oral contraceptives and gonadotropin-releasing hormone agonists for the treatment of

endometriosis: a systematic review. Jeng CJ, Chuang L & Jenta Shen J. Expert Opin. Pharmacother. 2014 15(6):767-773

[5] Amygdalin blocks the in vitro adhesion and invasion of renal cell carcinoma cells by an integrin-dependent mechanism. Juengel E, Afschar M,

Makarevıć J Rutz J, et al. Internatıonal Journal Of Molecular Medıcıne. 2016 37: 843-850

[6] Inhibitory Effect of Amygdalin on Lipopolysaccharide-Inducible TNF-α and IL-1β mRNA Expression and Carrageenan-Induced Rat Arthritis.

Hwang HJ, Lee HJ, Kim CJ, et al. J. Microbiol. Biotechnol. 2008 18(10), 1641–1647

http://www.acog.org/About-ACOG/Green-Journal-Info


http://www.enzolifesciences.com/ADI-EKS-350/pdf




106

IDDGC17-OP-201

KARYOLOGICAL SURVEY OF THE LONGICORN BEETLE,

PURPURICENUS BUDENSIS (GOTZ, 1783) (CERAMBYCINAE: PURPURICENINI) FROM

TURKEY

Yavuz Kocak1, Elmas Yagmur

2

1Ahi Evran University, Faculty of Engineering and Architecture, Department of Environmental Engineering, Kirsehir, Turkey.

[email protected] 2Ahi Evran University, Graduate School of Natural and Applied Sciences, Department of Biology,

Kirsehir, Turkey

Aims and Scopes: Approximately 650 taxa are known from Turkish Cerambycidae fauna [Löbl and Smetana, 2010]. Many genera of

this family still require more intensive taxonomic studies. Among them, the genus Purpuricenus Dejean, 1821 is noteworthy as being

a taxonomically confused group. For instance, Purpuricenus budensis (Götz, 1783) is represented by 3 (or 4) subspecies in Turkey

and the taxonomic position of some, viz. P. budensis bitlisiensis Pic, 1902 and P. budensis caucasicus Pic, 1902, is controversial. The

real status of these taxa, thus, needs to be revised [Özdikmen, 2007]. The karyotype defines the structural organization of the genome.

Genome studies at the chromosome level in both the genus Purpuricenus and its family Cerambycidae have been based primarily on

chromosome counts and morphology. Despite information on the chromosomes is important to resolve taxonomic discrepancies, very

few Purpuricenus species have been karyotyped. To date, the karyotypic analyses have been directed to only 3 species, corresponding

to 1.5% of all karyotyped longicorn beetles [Karagyan and Kalashian, 2016; Okutaner, 2011; Smith and Virkki, 1978]. The limited

cytogenetic information prompted us to further explore the chromosomal similarities and differences between longicorn beetles.

Therefore, we have aimed to investigate the karyotype of P. budensis to add data on cytogenetic knowledge of this group and

contribute to the understanding of chromosomal diversity in the family.

Materials and Methods: The specimens were collected from Antalya province in May 2016. Chromosomal preparations were

obtained from the gonads of the adult male individuals. The testicular material was pretreated, fixed, stained and squashed according

to the method described earlier [Rozek, 1994]. Observations and photographs were made using an Olympus light microscope.

Results and Discussion: The diploid chromosome number was found to be 2n♂=28 (13AA+Xyp). All Purpuricenus species that have

been karyotyped so far show closely similar or identical karyotypes, viz. P. budensis; 2n=28, P. indus; 2n=28 (13+Xyp) and P.

spectabilis; 14II [Okutaner, 2011; Smith and Virkki, 1978]. The studied species present different distribution patterns worldwide.

Although notable similarities exist between the karyotypes of the Purpuricenus species, the chromosome numbers in cerambycids

vary at least from 2n=10 to 2n=36 with the modal karyotype 2n=20. The most frequent sex chromosome determining system is

XX/XY, mainly of the Xyp type. This study endeavors to clarify the taxonomy of Purpuricenus species occurring in Turkey. Of

course it is not possible to say much about from these limited studies. In the course of a general investigation of the chromosomes of

Cerambycidae, Purpuricenus species remains more or less neglected. Hence, further chromosomal surveys are needed. This work,

thus, will possibly contribute the data required on the cytotaxonomic studies in the genus. Consequently, controversial taxonomic

position of longicorn taxa still provokes questions concerning karyotypes, and emphasise the need to augment additional data.

Keywords: Coleoptera, Cerambycidae, Purpuricenus budensis, karyotype, Turkey

Acknowledgements: The data were derived from MSc Thesis work of Elmas Yagmur.

References:

[1] Löbl, I.; Smetana, A. Catalogue of Palaearctic Coleoptera, Vol. 6., 2010, Stenstrup: Apollo Books, 924 pp.

[2] Okutaner, A. Y. MSc Thesis in Gazi University Graduate School of Natural and Applied Sciences, 2011.

[3] Özdikmen, H. Munis Entomology & Zoology, 2007, 2(2), 179-422. [4] Rozek, M. Chromosome Research, 1994, 2(1), 76-78.

[5] Smith, S. G.; Virkki, N. Animal Cytogenetics, Insecta 5: Coleoptera, 1978, Gebruder Borntraeger, 366 pages.

[6] Karagyan, G. H.; Kalashian, M. Y. VI Intern. Con. on the Karyosystematics of the Invertebrates, 27-30 August 2016, Saratov, Russia.




107

IDDGC17-OP-202

THE MYSTERY OF THE DOG GENOME: THE DOG AND THE SHADOW Bengi ÇINAR KUL

1

1Ankara University, Faculty of Veterinary Medicine, Department of Genetics, Diskapi 06110, Ankara, Turkey

[email protected]

Aims and Scopes: Although the domestication goes back 15,000 years ago, most of the dog breeds, which have seen around us, are

resulted in a short period of 200 years. At the end of this process, more than 200 breeds have domesticated from the wolf [1, 2]. The

differentiation triggered by the mutation continues to shape today's breeds with the direction of natural and human selection [2, 3].

While obtaining pure breed, the proportion of undesirable variants due to linkage has increased as well as variants of the desired

feature increased with raising the breed, resulting in race predispositions such as cancer, heart diseases, epilepsy, diabetes, deafness

and even some behavioral disorders [4, 5]. These conditions are common to human beings and have similar genetic mechanisms.

From this point of view, dogs exposed to the same environment as humans are becoming a better model organism [6]. Therefore, it is

an important organism in genomic studies since it is the leading organism in revealing the genetic mechanism of many hereditary

characters [4, 6]. However, the dog genome is still in its third version, which causes problems in genome studies and even Single

Nucleotide Polymorphism (SNP) array studies due to ghost sequences or missing regions in the reference genome [8].

Materials and Methods: The whole genome sequence (WGS) data produced by Next Generation Sequencing (NGS) from one dog

and SNP array data obtained from 30 dogs were evaluated by comparing with CanFam3.1 reference genome [7] through the several

bioinformatics tools.

Results and Discussion: In this context, examples of dogs being used as genomic model organism will be given and the problems

encountered with the dog reference genome during the analysis of WGS and SNP array data obtained under the TÜBİTAK-112O844

project will be discussed in this presentation.

Keywords: Canine genome, dog, NGS, SNP array, WGS.


No: TOVAG-112O844.

References:

[1]. Zeder, M. A. 2006. Univ of California Press.

[2]. Larson, G., Karlsson, E. K., Perri, A., Webster, M. T., Ho, S. Y., Peters, J., ... & Comstock, K. E. Proceedings of the National Academy of

Sciences, 2012, 109(23), 8878-8883.

[3]. Ostrander, E. A., & Ruvinsky, A. (Eds.), 2012, CABI.

[4]. Karlsson, E. K., & Lindblad-Toh, K. Nature Reviews Genetics, 2008, 9(9), 713-725.

[5]. Kirkness, E. F., Bafna, V., Halpern, A. L., Levy, S., Remington, K., Rusch, D. B., & Venter, J. C. Science, 2003, 301(5641), 1898-1903.

[6]. Parker, H. G., Shearin, A. L., & Ostrander, E. A. Annual review of genetics, 2010, 44, 309-336.

[7]. Kent W.J., Sugnet C.W., Furey T.S., Roskin K.M., Pringle T.H., Zahler A.M., Haussler D, Genome Res. 2002, 12(6):996-1006.

[8]. Dreger, D. L., Rimbault, M., Davis, B. W., Bhatnagar, A., Parker, H. G., & Ostrander, E. A. Disease Models & Mechanisms, 2016, 9,12:

1445–1460.




108

IDDGC17-OP-203

MOLECULAR EPIDEMIOLOGICAL ANALYSIS OF BACILLUS SPP. PSEUDO OUTBREAK BY

USING ARBITRARILY- PRIMED POLYMERASE CHAIN REACTION

Nergis AĢgın1, Elçin Kal Çakmaklıoğulları

1, BarıĢ Otlu

2, Betül Çelik

2, Ömer Faik Ersoy

3,

Ahmet BaĢustaoğlu4

1 Karabuk University, Medical Faculty, Medical Microbiology Department, Karabuk, Turkey, [email protected]

2Inonu University, Medical Faculty, Medical Microbiology Department, Malatya, Turkey 3Karabuk University, Medical Faculty, General Surgery Department, Karabuk, Turkey

4Girne American University, Faculty of Health Sciences, Girne, KKTC.

Aims and Scopes: Bacillus species (spp.) are aerobic gram positive spored bacteria which are commonly found in nature and spores

are resistant to heat and disinfectants. Bacillus spp isolated in cultures (etc. blood, wound) are usually considered as

contaminations. However Bacillus spp. may cause serious infections such as sepsis and meningitis in immunocompromised

patients [1]. In the last decade, several outbreaks and pseudo-outbreaks caused by Bacillus spp. have been reported [2]. In this

study, it was aimed molecular epidemiological analysis of Bacillus spp. pseudo-outbreak in our hospital by using AP-PCR.

Materials and Methods: Bacillus spp. were isolated surprisingly high rate from wound cultures of inpatients between January 2015

and - March 2015. Therefore, environmental and staff nasal cultures were performed. Bacillus spp. was isolated from some of

them. At the same time, Bacillus spp. are also isolated as pure culture from some of outpatient‘s throat.They were not

immunsupressed. It was unexpected situation. So, it was thought that it could be a contamination caused culture tubes. Aerobic

cultures were performed from cotton swap and transport medium of sterile culture tubes. Bacillus spp. was isolated in transport

medium of some culture tubes. There was no growth on the cotton swab. All of culture tubes were recalled. Another brand culture

tubes were dispensed to hospital after microbiological control. Then there was no bacillus spp growth in the wound samples. In this

study 47 of bacillus strains were included. Identification of the strains was performed by MALDI-TOF method. (Biomeriux). AP-PCR

method was used for determination of the clonal relationship between strains [3]. Strains with over 95% similarity to each other were

considered the same clone.

Results and Discussion: Twenty of the 47 Bacillus strains were Bacillus firmus and 27 were Bacillus megaterium. B. firmus strains

were isolated from environmental samples (n=10), wounds (n=7), culture tube mediums (n=2), and staff nasal sample (n=1). B.

megaterium strains were isolated from wounds (n=11), environmental samples (n=9), staff nasal samples (n=5) and culture tube

mediums (n=2). Eight different genotypes were detected among B.firmus strains. Strains consisted of five different clusters. Seventeen

of 20 are within any cluster and the clustering rate is 85%. The largest cluster Group III contains five strains. Ten different genotypes

were detected among B.megaterium strains, and they consisted of six clusters.Twenthy three of 27 are included in any cluster and the

clustering rate is 85%. The largest cluster is the Group I contains seven strains. Although expiry date and storage conditons of culture

tubes are appropriate, Bacillus spp. isolated from only one series of this brand tubes. Besides two strains isolated from the transport

medium and two environmental strains isolated from coroner intensive care unit were same cluster. Another brand culture tubes are

dispensed to hospital Thereafter, no bacillus spp. growth in wound cultures. It was thought that the contaminated culture tubes are the

source of pseudo outbreak in our hospital. To prevent outbreaks, equipment and materials should be checked periodically.In this

study, the rate of clustering of strains is high.The discrimination power of AP-PCR method with M13 primers is low. Therefore,

clonal relationship among strains should be confirmed by PFGE method which is the gold standard.[3].

Keywords: Arbitrarily Primed-PCR, Bacillus spp., Pseudo- outbreak References: [1] Fekete T., Bacillus species (No anthracis). Clinical Microbiology Newsletter,2009,31, 87-92.

[2] L. Boix-Palop et al. Bacillus species pseudo-outbreak: construction works and collateral damage Journal of Hospital Infection, 2017,

95, 118-122.

[3] Ayan M, Durmaz R, Aktas E, Durmaz B J Bacteriological, clinical and epidemiological characteristics of hospital-acquired

Acinetobacter baumannii infection in a teaching hospital, Journal of Hospital Infection (2003) 54, 39–45.




109

IDDGC17-OP-204

Microsatellite Diversity of Blind Mole Rat’s Populations in Turkey

Tolga Kankılıç1, Teoman Kankılıç, Özgür Güçlü

3

1 Department of Biology, Faculty of Science and Letters, Aksaray University, Aksaray, Turkey

2 Department of Biotechnology, Faculty of Arts and Science, Ömer Halisdemir University, Niğde, Turkey

3Sultanhisar Vocational School, Adnan Menderes University, Aydın, Turkey

[email protected]

Aims and Scopes:

Blind mole rats living under extreme subterranean conditions have developed strong adaptation strategies for sustaining life. The most

important of these strategies is chromosomal rearrangement, which is one of the distinct features of these animals. Although

Anatolian populations have been the highest karyotypic diversity of the blind mole rats, to date, studies based on molecular techniques

related to population genetics have been insufficient. In the present work, we examined the genetic diversity, structure, and

relationships in the Anatolian blind mole rats.


A total of 18 Nannospalax cytotypes and 400 specimens were collected from 115 localities in Turkey. We surveyed 13 microsatellite

loci isolated from Nannospalax ehrenbergi [1]. PCR amplifications were conducted in a volume of 20 µl, following the procedures of

Karath et al. (2004). PCR products were sent for genotyping at Macrogen using the GeneScan 400HD ROX size standard. The

program micro-checker 2.2.0 was used to detect null alleles, genotyping errors and large-allele dropout [2]. Genetic diversity

measures, deviations from Hardy–Weinberg equilibrium and tests for linkage disequilibrium across all pairs of loci were conducted

using the program Genealex 6.5 [3]. Population differentiation was assessed with pairwise FST. We also performed cluster analyses of

the microsatellite genotypes, using the programs Structure 2.3.2 [4].


The highest number of alleles (47) was detected at the Sp4b1.1 locus, the lowest (14) at SpCA1.4. The average polymorphic

information content was very high (P = 97.5 %) over all thirteen used primer combinations. The average observed heterozygosity

(Ho) was 0.20. The average expected heterozygosity (He) was 0.601. The highest values for the mean number of alleles and gene

diversity obtained for 2n = 38, 2n = 50D, 2n = 52K, 2n = 60 cytotypes, N.ehrenbergi and N. leucodon species. Results indicate that

the 18 cytotypes fall in to seven major groups representing the species (N. xanthodon, N. leucodon, N. cilicicus, N. nehringi, N.

tuncelicus, N. ehrenbergi).

Keywords: Nannospalax, Karyotypic polymorphism, Microsatellite loci,, Genetic diversity, Turkey

Acknowledgements: This study was supported by TUBITAK (TBAG- 112T660).

References:

[1] Karanth, K.P.; Avivi A.; Beharav, A.; Nevo, E. Biological Journal of the Linnean Society, 2004, 83, 229–241.

[2] van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M; Shipley, P. Molecular Ecology Notes, 2004, 4, 535–538.

[3] Peakall, R.; Smouse P.E. Bioinformatics,2012, 28, 2537-2539.

[4] Pritchard, J.K.; Stephens, M.; Donnelly, P. Genetics, 2000, 155, 945–959.




110

IDDGC17-OP-205

THE INVESTIGATION OF INHIBITION EFFECTS OF HONEY, POLEN, PROPOLIS AND ROYAL

JELLY EXTRACTS ON THIOREDOXIN REDUCTASE ENZYME ACTIVITY

Gamze AKBULUT

1, Ebru AKKEMĠK

1,2

1Faculty of Engineering and Architecture, Food Engineering, Siirt University 56100, Siirt, Turkey 2Science and Technology Research and Application Center, Siirt University 56100, Siirt, Turkey

[email protected]

Abstract

Aims and Scopes: The thioredoxin reductase enzyme is an enzyme that prevents the mechanism of apoptosis from working and thus

triggers the formation of cancer. Therefore, Inhibition of thioredoxin reductase enzyme is thought to prevent or inhibit cancer. In this

study, the effects of extracts of Pine honey, chestnut honey, highland honey, pollen, propolis and royal jelly on thioredoxin reductase

enzyme activity were investigated.


Extraction was done according to the method used by Sahin and his friends [1]. The crude samples were stored at +4°C in refrigerator.

About 5 g of sample was weighed and added to 100 mL solvent (methanol, ethanol, hexane, DMSO and water). Then, each sample

was continuously stirred with a shaker at room temperature for 24 h. The suspension was removed by centrifuged at 10,000g for 15

min. Then, the supernatant was concentrated in a rotary evaporator under reduced pressure and the residue resolved in a minimal

volume of the same solvent and kept in 4°C until used. Mammalian thioredoxin reductase activity is determined with using DTNB as

the substrate [2,3]. Enzyme activities were measured at constant substrate and different inhibitor concentrations to calculate IC50

values. Seven and more different inhibitor concentrations were used for measuring the inhibition constant. The tube not containing

inhibitor was used as control and its activity considered as 100%. Each experiment was repeated three times.

Results and Discussion: DPPH and total antioxidant activity were investigated in order to compare the extracts used in the inhibition

study. The highest inhibitory effect was seen in the pollen methanol extract (IC50 = 2.44μg /mL). It was found that DMSO showed the

best solvent effect in the samples in which the inhibition effect was investigated.

Keywords: Royal Jelly, honey, pollen, propolis, Thioredoxin reductase

Acknowledgements: This study was partially supported by Scientific Research Projects Unit of Siirt University (2016-SİÜFEB-07).

References:

[1] Sahin, H.; Aliyazicioglu, R.; Yildiz, O.;. Kolayli, S.; Innocenti, A.; Supuran, C. T. J Enzym Inhib Med Chem 2010, 1–5,

[2] Holmgren, A. Annu Rev Biochem. 1985;54:237-271.

[3] Luthman, M.; Holmgren, A. Biochemistry. 1982;21(26):6628-6633.




111

IDDGC17-OP-206

EVALUATION MOLECULAR MODELING STUDIES AND INHIBITORY EFFECTS OF SOME

INDAZOLE DERIVATIVES ON HUMAN SERUM PARAOXONASE 1

Zuhal Alım1, Deryanur Kılıç

2, Yeliz Demir

2

1Ahi Evran University, Faculty of Science and Arts, Department of Chemistry, 40000, KırĢehir

2Ataturk University, Faculty of Sciences, Department of Chemistry, Biochemistry Division,

25240, Erzurum, Turkey

[email protected]

Abstract

Aims and Scopes: We aimed to evaluate the in vitro inhibition effects of some indazole derivatives , indazole, 4-bromo-1H-indazole,

6-bromo-1H-indazole, 7-bromo-1H-indazole, 4-chloro-1H-indazole, 6-chloro-1H-indazole, 7-chloro-1H-indazole, 4-fluoro-1H-

indazole, 6-fluoro-1H-indazole, 7-fluoro-1H-indazole, on the activity of human serum paraoxonase (hPON1).

Materials and Methods: PON1 was purified from human serum using simple chromatographic methods, including DEAE–Sephadex

anion exchange and Sephadex G-100 gel filtration chromatography [1]. After the purification process in vitro inhibition effects of the

indazole compounds on hPON1 were investigated. In adition molecular docking studies were performed for indazole, 7-bromo-1H-

indazole, 7-chloro-1H-indazole and 4-fluoro-1H-indazole compounds in order to assess the probable binding mechanisms into the

active site of hPON1.

Results and Discussion: The indazole compounds dose-dependently significantly decreased in vitro hPON1 activity. IC50 values

were found to be 0.358, 0.282, 0.249, 0.226, 0.331, 0.0864, 0.0729, 0.133, 0.154, 0.166 for indazole, 4-bromo-1H-indazole, 6-bromo-

1H-indazole, 7-bromo-1H-indazole, 4-chloro-1H-indazole, 6-chloro-1H-indazole, 7-chloro-1H-indazole, 4-fluoro-1H-indazole, 6-

fluoro-1H-indazole, 7-fluoro-1H-indazole, respectively. All indazole molecules exhibited competitive inhibition and molecular

modeling studies confirmed these results

Keywords: Paraoxonase 1, indazole, purification, enzyme inhibition, molecular modeling

References:

[1] Alim, Z.; Beydemir, S. Chem. Biol. Drug. Des. 2016, 88, 188-196.




112

IDDGC17-OP-207

A BIOANALYTICAL METHOD FOR DETERMINATION OF ALUMINUM IN DIALYSĠS FLUIDS

Harun Ciftci1, Cigdem Er

2

1Department of Biochemistry, Faculty of Medicine, Ahi Evran University,

KırĢehir, Turkey 2Mucur Vocational Training School, Ahi Evran University,

KırĢehir, Turkey

[email protected]

Aluminum has a lot of advantages due to its specific characteristics, and its use in the industry is increasing day by day.

Aluminum may assemble in the human body directly or indirectly, so it degenerates brain cells and causes Parkinson and

Alzheimer diseases. Therefore determination of trace amounts of aluminum in various samples has a great importance.

The atomic absorption spectrometry is the most common technique used for the trace metals determination in different

samples. But, there are some difficulties such as very complex matrix and trace levels of metals. Because of these

difficulties, a clean-up and preconcentration step is usually required to obtain more reliable data. Thus, solid phase

extraction (SPE) has become a preferred method for concentrating the analyte prior to its analysis by FAAS and other

techniques.

In the present work, a new solid-phase extraction method was developed for separation, removing, and preconcentration

of trace aluminum in dialysis fluids. The 4-(2-pyridylazo) resorcinol was used as a chelating agent for adsorption of

aluminum ions from aqueous solutions on Duolite XAD-761 polymeric resin. Various experimental parameters such as

pH of sample solution, volume, and concentration of eluent, flow rate of sample solution, sample and solution volume,

amount of adsorbent, matrix effects for preconcentration were investigated. The adsorbed Aluminum ions on polymeric

resin were eluted with 5 mL of 2 mol L-1

HCl solutions and their concentrations were determined by High-Resolution

Continuum Source Flame Atomic Absorption Spectrometry (HR-CS FAAS). The optimum pH value for quantitative

sorption of aluminum ions was found between 5.5 and 7.5. Under the optimum experimental conditions, preconcentration

factor was obtained as 100. In order to show the applicability of the proposed method, it was applied for the determination

of aluminum dialysis solutions for hemodialysis under optimal experimental conditions. The accuracy of the method was

checked by determining the percent relative error of spiked real samples.

Keywords: Separation; XAD-761; Aluminum; Dialysis fluids; Resorcinol

Acknowledgment: Authors would like to thank the Scientific and Technological Research Council of Turkey (TUBITAK Grant no.

110T111)





113

IDDGC17-OP-208

PROFILE AND FUNCTIONAL ANALYSIS OF SMALL RNAS DERIVED FROM

ASPERGILLUS FUMIGATUS INFECTED WITH DOUBLE-STRANDED RNA MYCOVIRUSES

Selin Özkan1,a

, Irina Mohorianu2, Ping Xu

2, Tamas Dalmay

2, Robert H.A. Coutts

1,b

1Department of Life Sciences, Faculty of Natural Sciences, Imperial College London, UK

2School of Biological Sciences, University of East Anglia, Norwich, UK.

aCurrent Address: Vocational School of Health Services, Ahi Evran University, KırĢehir, TURKEY

bCurrent Address: Geography, Environment and Agriculture Division, Department of Biological and Environmental Sciences, School

of Life and Medical Sciences, University of Hertfordshire, Hatfield, UK

[email protected]

Aims and Scopes: Mycoviruses are viruses that naturally infect and replicate in fungi. Aspergillus fumigatus, an opportunistic

pathogen causing fungal lung diseases in humans and animals, was recently shown to harbour several different types of mycoviruses.

A well-characterised defence against virus infection is RNA silencing. Active silencing of double-stranded (ds)RNA and the

generation of small RNAs (sRNAs) has been shown for several mycoviruses and it is anticipated that a similar mechanism will be

activated in A. fumigatus isolates infected with mycoviruses. Here we investigated A. fumigatus sRNAomes in the presence and

absence of three mycoviruses: Aspergillus fumigatus partitivirus-1 (AfuPV-1, PV), Aspergillus fumigatus chrysovirus (AfuCV, CV)

and Aspergillus fumigatus tetramycovirus-1 (AfuTmV-1, NK). Both AfuPV and AfuCV cause visible phenotypic alterations and

result in a decreased growth rate as compared to virus-free isolates; however they had no impact on fungal pathogenicity as assessed

in the murine model [1]. The effects of three different A. fumigatus mycoviruses on the pathogenicity of as assessed using larvae of

the greater wax moth Galleria mellonella and an uncharacterized A. fumigatus mycovirus shown to cause mild hypervirulent effect

[2]. Since alterations were observed in both virulence and phenotype, it was important to determine whether these differences could

be linked to the presence of virus derived siRNAs processed by the fungal RNA silencing machinery. The aim of this study was to

characterise the sRNA populations of virus-free and virus-infected A. fumigatus isolates.

Materials and Methods: To investigate the existence and nature of A. fumigatus sRNAs, sRNA-seq libraries of virus-free and virus-

infected isolates were created using Scriptminer adapters and sequenced using Illumina HiSeq2500. The sRNA sequencing output

files were delivered in FASTQ format. The sequencing was directional, single ended and the length of the reads was 50 nt. The data

was analysed on a Linux server, using Perl (version Strawberry Perl 5.18.2.1) and R (version 3.0.3) custom made scripts. The UEA

sRNA Workbench was used for the prediction of sRNA loci. Northern blotting was used to validate the presence of vsiRNAs. In order

to identify any potential target of virus-derived sRNAs, reads mapping to both the viral and fungal genome were further investigated

and qRT-PCR was performed to determine the expression level of any potential target gene.

Results and Discussion: Virus-derived sRNAs were detected and characterised in the presence of virus infection. The majority of the

virus-derived sRNAs were found to potentially target gene families that could be classified as MFS transporters, zinc/iron ion

transporters, secondary metabolites or DNA/RNA binding proteins by manual BLAST analysis The A. fumigatus pyrG gene is known

to have a role in pathogenesis (Weidner et al., 1998). The expression level of pyrG gene was found to be significantly lower in PV-

infected than PV-free samples (P= 0.000046). Differentially expressed A. fumigatus microRNA-like (miRNA-like) sRNAs and small

interfering RNAs (siRNAs) were detected and validated. Host sRNA loci which were differentially expressed as a result of virus

infection were also identified. To our knowledge, this is the first study reporting the sRNA profiles of A. fumigatus isolates.

Keywords: Aspergillus fumigatus, sRNA-seq, miRNA-like sRNA, differential expression, double-stranded RNA mycovirus,

vsiRNA, fungal sRNA

References:

[1] Bhatti, M. F.; Jamal, A.; Petrou, M. A.; Cairns, T. C.; Bignell, E. M.; Coutts, R. H. A. Fungal Genetics and Biology 2011, 48, 1071-1075.

[2] Özkan, S.; Coutts, R. H. A. Fungal Genetics and Biology 2015, 76, 20-26.

[3] Weidner, G.; d‘Enfert, C.; Koch, A.; Mol, P. C.; Brakhage, A. A. Current Genetics 1998, 33, 378-385.

Acknowledgements: Robert Coutts wishes to acknowledge the support of the Leverhulme Trust through a Leverhulme Emeritus

Research Fellowship. Selin Özkan thanks the Turkish Government Higher Education program for supporting her PhD investigations.





114

IDDGC17-OP-209

SOME CHARACTERISATION OF COAGULASE POSITIVE STAPYLOCOCCI ISOLATED FROM

CHEESE SAMPLES*

Belgin SIRIKEN1, Gökhan ĠNAT

2, Tuba YILDIRIM

3, Ceren YAVUZ

3, Alper ÇĠFTCĠ

4, Ġrfan EROL

5

1Departments of Aquatic Animal Diseases, Ondokuz Mayis University, 55200, Samsun, Turkey

2Food Hygiene and Technology, Ondokuz Mayis University, 55200, Samsun, Turkey

3Department of Biology, Faculty of Arts and Sciences, Amasya University, 05100, Amasya, Turkey

([email protected])

4Microbiology, Faculty of Veterinary Medicine, Ondokuz Mayis University, 55200, Samsun, Turkey

5Ministry of Food, Agriculture and Livestock, Republic of Turkey, Lodumlu, 6530, Ankara, Turkey.

Aims and Scopes: Staphylococcus aureus is one of the most frequent pathogens that cause both community and hospital-acquired

infections worldwide [1]. Antimicrobial resistance is an important public health concern worldwide. Today, Methicillin Resistant

Staphylococcus aureus (MRSA) is among the most important causes of antimicrobial-resistant health care–associated infections

worldwide [2]. Increasing frequency of MRSA infections and changing patterns in antimicrobial resistance have led to renewed

interest in the use of macrolide lincosamide – streptogramin B (MLSB) antibiotics to treat such infections. However, their widespread

usage has led to an increase in the number of Staphylococcus strains resistant to MLSB antibiotics [3]. MRSA strains have been found

among the S. aureus strains isolated from bovine mastitis milk and cheese samples. The aim of the study was to determine the MR

coagulase positive Stapylococci (CPS) and MR- Staphylococcus aureus (S. aureus-SA) in CPS isolates (cheese origin), and then

evaluted some characterisation of the isolates in term of antibiotic resistance and pathogenecity properties.

Materials and Methods: 50 coagulase positive Stapylococci (CPS) isolates recovered from cheese samples were firstly determined

for methicillin resistance properties. For this aim, the isolates were analysed for present of mecA gene using PCR assay. Then, the

MRCPS (methicillin-resistant coagulase-positive staphylococcus) isolates were analysed for S. aureus. After then, both MRCPS and

MRSA isolates were analysed for lukS-PV, erm (A, B and C) (for MLSB) and class 1 integron (int1) using PCR assay again.

Results and Discussion: The mecA was determined 11 out of 50 CPS (22%) isolates and the 11 isolates evaluated as MRCPS. The

nuc gene was determined in one of 11 MRCPS isolates. So, the isolate was evaluated as a MRSA (9.09%), and the remaining 10

(90.9%) isolates were evaluated as MRCPS. lukS-PV was present in 2 (18.18%) MRCPS isolates and one of two was MRSA. Among

the erm genes, only ermB was detected in 2 (18.18%) MRCPS isolates in contrast MRSA. Int1 was determined only two (18.18%)

MRCPS isolates and one of two was MRSA. In conclusion, cheese samples have potential health risk for MRSA or MRCPS, and their

virulent properties showed that the isolates have some risk for human as well as food industry.

Keywords: Cheese, Coagulase Positive Staphylococci, S. aureus, Methisilline Resistance, Biofilm, PVL and MLSB

Acknowledgements: *This study was supported by Scientific Research Project Program of Ondokuz Mayis University (Project Nr:

PYO. VET.1901.16.001).

References:

[1] Vivek, J.S.; Rajesh, G.N.; Mukesh, S.; Manpreet, K.; Misra, R.N; Matnani, G.B.; Ujagare, M.T.; Saikat, B.; Ajay, K.

Biomed Res. 2011, 22,465–9.

[2] Moellering, R.C. Jr. J. Antimicrob. Chemother, 2012, 67,4–11.

[3] Saiman, L.; O'Keefe, M.; Graham, P.L.; Wu, F.; Saïd-Salim, B.; Kreiswirth, B.; LaSala, A.; Schlievert, P.M.; Della-Latta,

P. Clin Infect Dis. 2003, 37(10),1313-9.




115

IDDGC17-OP-210

HISTORICAL DEMOGRAPHY OF THE SHARP-TAILED GROUSE

Utku PerktaĢ1,2

Hakan Gür3

1Department of Biology, Faculty of Science, Hacettepe University, Ankara, Turkey

2Department of Ornithology, American Museum of Natural History,

Central Park West at 79th

Street, New York, 10024, NY, USA

3Department of Biology, Faculty of Arts and Sciences, Ahi Evran University, KırĢehir, Turkey

Aims and Scopes: The climate change during the Quaternary affected the distribution of species. The times when the cold periods

prevailed, depending on the harshest decrease in temperature, caused the species to face in search of appropriate regions (= refugia).

On the other hand, warming due to the rise in temperature following the cold period caused the expansion of the distribution areas of

these species from the refugia. Over the past 1 million years, species experienced many periods in which the world was prevalent in

cooling and heating. The last of these periods had been experienced during the last 130 kilo years. Therefore, we focused on Sharp-

tailed Grouse, that is widely distributed throughout middle and north parts of North America, to understand the origins of its

distribution.

Materials and Methods: Mitochondrial DNA (mtDNA) control region sequences (n=111) from throughout the known distribution of

the Sharp-tailed Grouse were considered. In addition to this, ecological niche modeling was also performed to understand historical

range shifts from the Last Glacial Maximum to the Present.

Results and Discussion: MtDNA control region sequences of Sharp-tailed Grouse showed a clear sign of population expansion

during last 15 kilo years. Beside this result, ecological niche modeling had a concordant result that showed a refugium or refugia in

southern latitudes of North America. However, distribution of this species during the Last Glacial Maximum was out of its known

distribution in North America. Therefore, it is plausible to say that this species completely changed its distribution after the Last

Glacial Maximum.

Keywords: Phylogeography, glacial-interglacial cycles, Quaternary, range shifts, Tympanuchus phasianellus




116

IDDGC17-OP-211

Cotton microRNAs

Lütfi TUTAR1, Yusuf TUTAR

2, Esen TUTAR

3, ġengül KARAMAN

4

1Ahi Evran University, Art and Sciences Faculty, Molecular Biology and Genetics Department, BağbaĢı Campus, KırĢehir, Turkey

2Health Sciences University, Health Sciences Faculty, Nutrition and Dietetics Department, Üsküdar, Ġstanbul, Turkey

3KahramanmaraĢ Sütçü Ġmam University, Faculty of Science and Arts, KahramanmaraĢ, Turkey

4KahramanmaraĢ Sütçü Ġmam University, Faculty of Science and Arts, Biology Department, KahramanmaraĢ, Turkey

Aims and Scopes: Cotton is not only one of the most important crops in terms of fiber usage and economic value, but also a model

species for investigating complex genomes and microRNAs. MicroRNAs (miRNAs) are a class of small noncoding RNAs in length of

approximately 18-24 nt, negatively regulating gene expression by either mRNA degradation or translation inhibition. In this study,

microRNA profiles of developing seeds from cotton and non-gossypol cotton in Gossypium hirsutum, and those were compared with

G. hirsutum, G. arboreum, G. barbadense, G. raimondii, EST-GSS sequences and de novo transcriptome obtained from RNA

sequencing.

Materials and Methods: Small RNA Sequencing and RNA Sequencing performed on RNA libraries prepared from total RNAs

isolated from most active state on 15 and 30 DPA developing cotton seeds of ―Stoneville 468‖ and ―Non-Gossypol 86‖ cultivars. The

data obtained from NGS analyzed by bioinformatics pipelines including GO and KEGG analyses and these two cultivars were

compared with each other and all available cotton genomes, EST-GSS sequences and our de novo transcriptome.

Results and Discussion: When we analyzed small RNA sequences on our bioinformatics pipeline and mapped to different genome

sets of cotton, 1119 potential new miRNA candidates found on G. hirsutum (AD1; 2400 Mb) genome set, and respectively 782, 523,

813, 81, and 482 potential new miRNA candidates discovered on G. arboretum (A2; 1700 Mb), G. barbadense (AD2; 1778 Mb), G.

raimondii (D5; 880 Mb), De novo transcriptome and EST-GSS sequences of cotton on NCBI. Furthermore KEGG pathways including

gossypol were determined and related miRNAs, potentially responsible from gossypol formation, are confirmed. A potential new

miRNA candidate ghr-3p-7450_112 determined on G. arboreum genome set was targeted squalene epoxidase 3 gene located in

gossypol related KEGG pathways that ath01110; Biosynthesis of secondary metabolites and ath00909; Sesquiterpenoid and

triterpenoid biosynthesis. Furthermore ghr-3p-7450_112 may be responsible from gossypol formation since it was 2-fold expressed in

the non-gossypol library compared to gossypol library. Genome complexity and polyploidy of different cotton species was also

revealed by comparing shared miRNA numbers of different genome sets.

Keywords: Cotton, microRNA, bioinformatics, next generation sequencing, transcriptome

Acknowledgements: This study was partially supported by K.S.Ü BAP and National Science Foundation (USA) – DIAG [Data

Intensive Academic Grid (Maryland University)]

Project Numbers: 2013/4-27 M (K.S.Ü BAP) and MRI-R2 project #DBI-0959894




117

IDDGC17-OP-212

PREVALENCE AND CHARACTERIZATION OF FOODBORNE PATHOGENS

IN MILK AND MILK PRODUCTS

Esen TUTAR1*

, Kübra Sueda AKINCI2, Ġsmail AKYOL

2

1 KahramanmaraĢ Sütçü Ġmam University, Faculty of Science and Arts, KahramanmaraĢ, Turkey

2 KahramanmaraĢ Sütçü Ġmam University, Faculty of Agriculture, Department of Agricultural Biotechnology,

KahramanmaraĢ, Turkey

* [email protected]

Aims and Scopes: Foodborne pathogens are an important problem which causes financial detriments, illnesses and

deaths all over the world [1-3]. In order to prevent the food-borne diseases and their adverse effects, it is necessary to

identify the casual agents and to quantify their contamination accurately. Real Time PCR is a reliable technique used in

the diagnosis of food pathogens since it has the advantages of speed, specificity, sensitive quantification, low detection

limit and a dynamic wide-range [4]. This study aimed to investigate the prevalence and characterization of B. melitensis,

C. sakazakii and L. monocytogenes in milk and milk products.

Materials and Methods: In this study, we developed a novel Multiplex Real Time PCR assay for identification of B.

melitensis, C. sakazakii and L. monocytogenes. Furthermore, a total of 45 samples (25 milk and 20 cheese samples were

analyzed by the newly developed Multiplex Real Time PCR assay. The results of samples were calculated by regression

analysis.

Results and Discussion: Optimization of Multiplex Real Time PCR reactions were performed to determine the optimal

conditions by testing various combinations of primer and probe concentrations and different annealing temperatures. In

conclusion, Ct values are ranged from 11 to 25 while total viable count of microorganisms are varied from 2,4x105 to 3,4x

108 for target genes (BMEII0466 gene for B. melitensis, mms gene for C. sakazakii, hly gene for L. monocytogenes). The

correlation coefficients (r2 values) for B. melitensis, C. sakazakii and L. monocytogenes were 0.986, 0.995 and 0.997

respectively. According to results, 24 samples for B. melitensis (96 %), 25 samples for C. sakazakii (100 %) and 24

samples for L. monocytogenes (96 %) were positive in the milk samples. Moreover, B. melitensis (85 %), C. sakazakii (85

%) and L. monocytogenes (95 %) were determined in the cheese samples at different contamination levels. These

pathogens are commonly found in milk and milk products and cause foodborne diseases with a low infectious dose

(range, 101-10

3 cfu/g) [5-6]. The results were showed that many samples are contaminated by target pathogens.

Therefore, it is considered that these samples may pose a potential risk to the human health.

Keywords: Multiplex Real Time PCR, foodborne pathogens, milk and milk products

Acknowledgements: This work was supported by TUBITAK with 115O099 project number and TUBITAK BIDEB 2211-

C Domestic Doctoral Fellowship Program (Esen TUTAR).

References:

[1] López-Campos, G.; Martínez-Suárez, J. V.; Aguado-Urda, M.; López-Alonso, V. 2012, pp. 13–32.

[2] McKillip, J.,L.; Drake, M. 2004, 67(4), pp.823–32.

[3] Nannapaneni, R. 2012, pp. 45–55.

[4] Velusamy, V.; Arshak, K.; Korostynka, O.; Vaseashta, A.; Adley, C. 2012, pp. 149–158.

[5] Bhunia, A. K. 2008.

[6] Strydom, A.; Cawthorn, D. M.; Cameron, M.; Witthuhn, R. C. 2012, 27(1-2), 3-12.




118

IDDGC17-OP-213

EVALUATION OF LHβ GENE EXON 3 MUTATIONS IN FAILURED IVF PATIENTS

Yılmaz E.1, Ulubas H.

2 , Celik Z.B

1, Tural S.

1Guven D

2. Elbistan M.

1, Kara N.

1,

Ondokuz Mayis University Faculty of Medicine, Depatrment of Medical Biology, Section of Medical Genetics1

Ondokuz Mayis University Faculty of Medicine, Depatrment of Gnecology and Obstetrics2

Aims and Scopes: We aimed to evaluate the effect of LHβ gene variants on the cases of failured IVF during assisted

reproductive technics.

Material and Method: We evaluated 29 cases have failured IVF treatment in Ondokuz Mayis University Faculty of

Medicine, IVF Center and 30 cases have healthy pregnancy. DNA isolated from all the cases and LHβ gene analysed by

next generation DNA sequencing method. SPSS and Chi-Square analysis performed statistical analysis.

Results and Discussion: As a result of the study, there is no statistical significant difference between patients and control

groups for LHβ gene exon 3 rs1056917 and rs149579838 (p>0.005). When we investigate clinical findings according to

the genotype, we found that, GG genotype of rs149579838 (p=0.04, χ²=6.381) and AG genotype of rs1056917 (p=0.03,

χ²=6,75) was high in primary infertile cases.

Conclusion: Our results suggest that women have GG genotype for rs149579838 and AG genotype for rs1056917 are

under risk for primary infertility. These results should be confirmed by other researches groups.

Keywords: Gene mutation; infertility; LH gene; ovulation

Key words: Mutations, IVF, DNA sequence




119

IDDGC17-OP-214

Heat Shock Proteins in Toxoplasma gondii Survival Factors


2, Kübra Sueda AKINCI

3



3KahramanmaraĢ Sütçü Ġmam University, Faculty of Agriculture, Department of Agricultural Biotechnology, KahramanmaraĢ,

Turkey

Aims and Scopes: Toxoplasma gondii effect one out of three people in the world population. The disease is called Toxoplasmosis

and it is asymptomatic. Immune system suppresses the parasite. Weakend immune system especially at pregnant women is

problematic. Cats are primary host and warm bloded animals are intermediate hosts. Toxoplasma gondii has two interesting strains:

infective and non-infective. T. gondii must be transformed from bradyzoite to tachyzoite form to infect intermediate immuno-

competent host. Signaling involved in cell cycle control or stage differentiation requires certain proteins in their intact soluble form.

Therefore, Hsp40, 70, and 100 may help solubilization and refolding of signaling proteins and help T. gondii to infect the host.

Hsp100 coordinates and cooperates with Hsp70–Hsp40 complex and prevents protein aggregation. Invasion of the host by T. Gondii

creates stress and this lead substrate protein aggregation and therefore, Hsp100 along with Hsp70–Hsp40 may help survival of the

parasite. Therefore, Hsp structural properties can be utilized for drug development and targeting and may form a general mechanism

for pathogen destruction.

Materials and Methods: Infective and non-infective forms Heat shock proteins are elucidated by employing degenerative primers,

designed by bioinformatics estimations. The Open Reading Frames are cloned and subcloning of Hsps helped to overexpress the

proteins. Sequencing of the ORFs and bioinformatics comparison provided detailed information to distinguish infective and non-

infective Hsp forms.

Results and Discussion: Hsp40, and Hsp70 are useful for signaling pathways but Hsp100 is generally involved in substrate protein

aggregation. Coordination and cooperation of these proteins were studied. Biochemical properties of each protein revealed other key

factors involved in the mechanism but infective and non-infective strains employ a set of different coordinating proteins. This

property may be used to distinguish both proteins and help drug design studies.

Keywords: Toxoplasma, Heat Shock Proteins, Infective strain

Acknowledgements: This work is supported by Tubitak Grant No 110T928




120

IDDGC17-OP-215

Small Molecule Inhibition Strategy Among Coordinating and Cooperating Chaperones

Yusuf TUTAR1


Aims and Scopes: Client proteins fold to their native structure so that they can be functional. Small molecules may perform this

action simultaneously at lower concentrations but require the chaperoning action of Heat Shock Proteins (Hsps). Under stress

condition and under systematic diseases overexpression of client proteins need Hsps. Hsps coordinates and cooperates for their action.

Interface inhibitors provide basis for efficient inhibiton.

Materials and Methods: In silico methods were used to develop inhibitors for Hsp conformational changes and designed ligand

configuration changes. Designed and tested compounds predicted for synthesis. Once they are synthesized biochemical and cell

cytotoxicity experiments were performed.

Results and Discussion: Hsps coordinates and cooperates to be fully functional. Inhibition of one Hsp may complement other

isoforms and this cause futile cycles. Therefore, interface inhibitors completely inhibited Hsp function and this derived cancer cells to

apoptosis.

Keywords: Interface inhibitor, Heat Shock Proteins, apoptosis

Acknowledgements: This work is supported by Tubitak Grant No 114Z365




121

POSTER

PRESENTATIONS




122

IDDGC17-PP-101

Cytotoxic Effects of Fig Latexes Obtained in Aydin on Colon Cancer

Seda Orenay-Boyacioglu1, Mehmet Delibas

2, Azad Bahadir

2, Olcay Boyacioglu

3

1Department of Medical Genetics, Faculty of Medicine,

2Department of Agricultural Biotechnology, Faculty of

Agriculture, 3Department of Food Engineering, Faculty of Engineering, Adnan Menderes University, Aydin, Turkey

Abstract

Background and Aim: Fig is of crucial importance for the agriculture and economy of Aydin. Fig has been widely used

medically and it also has anticarcinogenic effects. However studies with fig latex are quite limited. For this purpose, it

was aimed in this study to investigate the anticarcinogenic effects of fig latex on colon cancer

Materials and Method: The study materials were obtained from the latex of the widely grown fig cultivars in Aydin;

Ficus carica cv sari lop and Bursa siyahi. Fig latex was collected drop by drop by slitting the leaves and the young

branches of the fig tree and kept at -20°C followed by lyophilization. The human colon cancer line HT-29 was maintained

in RPMI 1460 supplemented with 20% fetal bovine serum (FBS), and incubated under 5% CO2 at 37°C. The fig latex was

resuspended in deionized water and filter sterilized. Cells were treated with 25, 50, 75, and 100 µg/ml of fig latex with

deionized water as control for 24, 48, and 72 hours. The viability levels of the cells after the incubation period were

measured with MTT (3-{4,5-dimethylthiazol-2yl}-2,5-diphenyl tetrazolium bromide) assay. Experiments were performed

three times, each in triplicates. The results were analyzed via analysis of variance (ANOVA) test. Differences with a p

value of less than 0.05 were considered as significant.

Results: Fig latex obtained from Bursa siyahi had statistically higher (p<0.05) cytotoxic effects on HT-29 cells at doses

as low as 25 µg/ml for 24 h. However, this difference started to disappear as the fig latex concentration increased from 25

µg/ml to 100 µg/ml and the treatment duration increased from 24 h to 72 h.

Conclusion: With the cytotoxic effects reported here, it is expected that the fig latex may offer new opportunities in the

discovery of novel anticancer drugs.

Keywords: Fig latex, colon cancer, MTT, cytotoxicity




123

IDDGC17-PP-102

LACTATE BIOSENSORS IN MEDICAL AND FOOD INDUSTRY

Ozum OZOGLU

1*, Mehmet Altay UNAL

2, Evrim GUNES ALTUNTAS

1

1 Ankara University Biotechnology Institute Tandogan Campus, 06110, Ankara-Turkey 2 Ankara University Physics Engineering Tandogan Campus, 06110, Ankara-Turkey

Lactate (lactic acid), a key metabolite of the anaerobic metabolism pathway, is an important indicator for lots of reactions including

health of the organisms and some food processes. Lactate which is naturally produced by lactic acid bacteria is found in fermented

dairy products, fermented vegetable products and many other food and beverages. Therefore; lactate level in food industry is used to

determine freshness, stability and quality characteristics of the products. In another aspect, lactate production under anaerobic

conditions is a sign of human performance levels, fatigue and hydration. High lactate level is occurred from several medical

conditions such as congestive heart failure, hypoxia, diabetic ketoacidosis, and paralysis. Serial determination of blood lactate levels,

is a good predictor to follow the multiple system organ failure and death in septic shock patients.

Nowadays, electrochemical-biosensors are used commonly because of their features such as low cost, easy usage, perfect sensitivity

and high selectivity to detect lactate levels. In the literature, most of lactate biosensors are enzymatic amperometric biosensors.

Besides the approximately fifteen commercial biosensors, there is a great number of biosensors examined in laboratory conditions.

Examples of some lactate biosensors developed to date are a lactate amperometric biosensor, a bienzyme amperometric graphite-

teflon composite biosensor, a bioluminescent flow sensor, biosensors based on screen-printed electrodes and NAD+-dependent

dehydrogenases, an electrochemical paper-based microfluidic biosensor, fiber-optic biosensor based on luminol's

electrochemiluminescence, a tattoo electrochemical biosensor. While the studies focused on the development of new biosensors in

lab-scale, it is a necessity to gain them as commercial usage.

Keywords: lactate, health, food products, biosensor

*e-mail: [email protected]

REFERENCES [1] Avramescu, A; Noguer, T; Avramescu, M; Marty, JL. Screen-printed biosensors for the control of wine quality based on lactate and acetaldehyde determination.

Anal Chim Acta. 2002;458(1):203-213. [2] Bakker, J; Gris, P; Coffernils, M; Kahn, RJ; Vincent, JL. Serial blood lactate levels can predict the development of multiple organ failure following septic shock.

Am J Surg. 1996;171(2):221-226.

[3] Dungchai, W; Chailapakul, O; Henry, CS. <Electrochemical detection for paper-based microfluidics.pdf>. 2009;81(14):5821-5826. [4] Girotti, S; Muratori, M; Fini, F; et al. Luminescent enzymatic flow sensor for D-and L-lactate assay in beer. Eur Food Res Technol. 2000;210:216-219.

[5] Jia, W; Bandodkar, AJ; Valdés-Ramírez, G; et al. Electrochemical tattoo biosensors for real-time noninvasive lactate monitoring in human perspiration. Anal

Chem. 2013;85(14):6553-6560. [6] Lobo-Castañón, MJ; Miranda-Ordieres, AJ; Tuñón-Blanco, P. A bienzyme-poly-(o-phenylenediamine)-modified carbon paste electrode for the amperometric

detection of -lactate. Anal Chim Acta. 1997;346(2):165-174.

[7] Malhotra, BD; Chaubey, A. Biosensors for clinical diagnostics industry. Sensors Actuators; B Chem. 2003;91(1-3):117-127. [8] Mehrvar, M; Bis, C; Scharer, JM; Young, MM-; Luong, JH. Fiber-Optic Biosensors. Trends and Advances. Anal Sci. 2000;16(7):677-692.

[9] Nilam, C. Shah ; Lyandres, O; Walsh, J. T.; Glucksberg M.R. and; Van Duyne R.P.. Lactate and Sequential Lactate−Glucose Sensing Using Surface-Enhanced

Raman Spectroscopy. 2007;79(18):6927-6932.

[101] Pérez, S; Sánchez, S; Fàbregas, E. Enzymatic Strategies to Construct L-Lactate Biosensors Based on Polysulfone/Carbon Nanotubes Membranes.

Electroanalysis. 2012;24(4):967-974.

[11] Rassaei, L; Olthuis, W; Tsujimura, S; Sudhölter, EJR; Van Den Berg, A. Lactate biosensors: Current status and outlook. Anal Bioanal Chem. 2014;406(1):123-137.

[12] Rathee, K; Dhull, V; Dhull , R; Singh, S. Biosensors based on electrochemical lactate detection: A comprehensive review. Biochem Biophys Reports. 2016;5:35-

54. [13] Serra, B; Reviejo, AJ; Parrado, C; Pingarrón, JM. Graphite-Teflon composite bienzyme electrodes for the determination of L-lactate: Application to food

samples. Biosens Bioelectron. 1999;14(5):505-513.

[14] Sun, C; Wang, D; Zhang, M; et al. Novel l-lactic acid biosensors based on conducting polypyrrole-block copolymer nanoparticles. Analyst. 2015;140(3):797-802. [15] Thakur, MS; Ragavan, K V. Biosensors in food processing. J Food Sci Technol. 2013;50(4):625-641. doi:10.1007/s13197-012-0783-z.

[16] Tsai, YC; Chen, SY; Liaw, HW. Immobilization of lactate dehydrogenase within multiwalled carbon nanotube-chitosan nanocomposite for application to lactate

biosensors. Sensors Actuators; B Chem. 2007;125(2):474-481. [17] Ünal, MA. Farklı tasarımlarda qtf (quartz tunıng fork) sensör üretimi. 2016. Ankara Üniversitesi; Biyoteknoloji Enstitüsü; Doktora Tezi (Basılmamış Tez).

[18] Wilson, GS; Hu, YB. Enzyme Based Biosensors for in vivo Measurements. Chem Rev. 2000;100(7):2693-2704.




124

IDDGC17-PP-103

CRISPR-CAS9 APPLICATIONS IN PLANTS

Sevgi Marakli

Department of Biology, Faculty of Arts and Sciences, Amasya University, 05100 Amasya, Turkey

Aims and Scopes:

The aim of this review is to summarise CRISPR-Cas9 applications in plants. This system is one of the precise and targeted genome

editing technologies (GET), having enabled genetic improvement of agricultural crops. GETs have been improved to facilitate

targeted modifications with high efficiency. They could be divided into two groups: ZFN, TALEN and CRISPR-Cas9. Protein-guided

nuclease is used in the members of the first group when RNA/DNA-guided nuclease in CRISPR-Cas9 [1]. Cas9 nuclease can be

directed by a small non-coding RNA known as single guide RNA (sgRNA) designed any genomic region followed by a 5‘-NGG

PAM in this system [2]. The first applications of CRISPR-Cas9 in plants were reported in 2013 [3, 4, 5]. In these studies,

phytoene desaturase (PDS) gene knock-out analyses were performed in Arabidopsis thaliana and Nicotiana benthamiana, Oryza

sativa and Triticum aestivum. This gene encodes a phytoene desaturase enzyme which catalyses the desaturation of phytoene to zeta-

carotene during carotenoid biosynthesis and PDS mutant exhibits albino and dwarf phenotypes [6]. Therefore, this provides an

important observation for gene knock-out and then sequencing analyses have been carried out to determine indels. Moreover, other

genes found in different metabolic pathways have also been investigated in different plants in addition to PDS gene [1, 7]. CRISPR-

Cas9 system has commonly been used for identification of gene functions, accelerating molecular breeding studies and also more

intensive genome-engineering research in plants.

Keywords: Genom editing technologies, RNA/DNA-guided nuclease, targeted modifications

References:

[1] Zhang, K.; Raboanatahiry, N.; Zhu, B.; Li, M. Frontiers in Plant Science 2017, 8, 1-17.

[2] Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J.A.; Charpentier, E. Science 2012, 337, 816-821.

[3] Li, J-F.; Norville; J. E.; Aach, J.; McCormack, M.; Zhang, D.; Bush, J.; Church, G.; Sheen, J. Nature Biotechnology 2013, 31, 688-691.

[4] Nekrasov, V.; Staskawicz, B.; Weigel, D.; Jones, J.D.G.; Kamoun. S. Nature Biotechnology 2013, 31, 691-693.

[5] Shan, Q.; Wang, Y.; Li, J.; Zhang, Y.; Chen, K.; Liang, Z.; Zhang, K.,; Liu, J.; Xi, J. J.; Qiu, J-L.; Gao, C. Nature Biotechnology 2013, 31, 686-

688.

[6] Qin, G.; Gu, H.; Ma, L.; Peng, Y.; Deng, X. W.; Chen, Z.; Qu, L-J. Cell Research 2007, 17, 471-482.

[7] Lawrenson, T.; Shorinola, O.; Stacey, N.; Li, C.; Østergaard, L.; Patron, N.; Uauy, C.; Harwood, W. Genome Biology 2015, 16, 258.




125

IDDGC17-PP-104

Cyclic AMP HAS AN IMPORTANT ROLE IN AXONAL REGENERATION

Dilek Kuzay1

1Ahi Evran University Faculty of Medicine, KırĢehir, Turkey

[email protected]

Aims and Scopes: Cyclic AMP (cAMP) activates an intrinsic pro-regenerative program within the neuron. The effects of cAMP

dependents on the activation of protein kinase A (PKA). PKA induces the transcription factor cyclic AMP response element binding protein

(CREB). CREB leads to initiation of transcription by RNA polymerase II [1]. There are findings that cAMP may not only upregulate the

expression of growth-promoting genes, but also limit the expression of genes that negatively impact axonal regeneration. In this review, I

will highlight the effects of cAMP on axonal growth.

Materials and Methods: Myelin-associated glycoprotein (MAG), Nogo, and oligodendrocyte myelin glycoprotein have inhibitors effects

on neurite outgrowth in the axonal regeneration. Studies demonstrate that elevation of intracellular cyclic AMP (cAMP) levels through the

administration of dibutyryl cAMP (dbcAMP) reverses inhibition of neurite outgrowth by MAG and CNS myelin [2]. Another study was

shown that cAMP levels became elevated in dorsal root ganglia (DRG) in response to a sciatic nerve lesion, and injection of dbcAMP

directly into DRG replicated the effects of a conditioning lesion on dorsal column axon regeneration [3,4].

Results and Discussion: The most important implication of these findings was that cAMP activates an intrinsic pro-regenerative program

within the neuron that allows it to overcome MAG- and myelin-mediated inhibition at the molecular level. İnvestigating the effects of these

cAMP-regulated genes on axonal growth and developing methods to enhance endogenous repair mechanisms, for patients with spinal cord

injury provide clinical benefit.

Keywords: Axonal regeneration, Cyclic AMP (cAMP)

References:

[1] Mayr, B. and Montminy,M. Nat. Rev.Mol.Cell Biol 2001, 2, 599–609.

[2]Cai,D.,Shen,Y.,DeBellard,M.,Tang,S.,andFilbin,M.T. Neuron 1999, 22, 89–101.

[3] Neumann, S.,Bradke,F.,Tessier-Lavigne,M.,andBasbaum,A.I. Neuron 2002, 34, 885–893.

[4] Qiu, J.,Cai,D.,Dai,H.,McAtee,M.,Hoffman,P.N.,Bregman,B.S.,etal. Neuron 2002, 34, 895–903.




126

IDDGC17-PP-105

INNOVATIVE APPROACHES FOR THIRD GENERATION DNA SEQUENCING TECHNOLOGY

Ekrem Bolukbasi*1, Sumer Aras

2



*[email protected]

Abstract

New generation DNA sequencing technologies, especially second generation DNA sequencing (SGS) revolutionized the field of

genomics and has led to developments beyond surprisingly large number of scientific studies. It has been effective on the

understanding of whole living genome sequence, characterization of genomic DNA and DNA sequence variation and live genom

sequence encodes information of which part of genom sides, additionally detection of methylated regions of the genome, determining

the level of mRNA transcription and DNA characterized by different isoforms of determined existing genes. However a new

generation of DNA sequencing technologies has provided new opportunities to the current sequencing technologies by creating

innovative and fertile ground for the study of genome sequencing. Some approaches which are developed on the new generation of

single molecule sequencing which is also the third-generation DNA sequencing (TGS) technologies shows that an advanced level of

using technology and products provide to a rich and original information for researchers that cannot be obtained by experimental

method on DNA sequencing. Third generation DNA sequencing technologies are shown to be capable of working with a lot of studies

on whole genome of any organism, in less than a day, much less cost, complete, accurate and creating longer sequencing reads chains.

Aims and Scopes The aim of this study is to provide detailed information on innovative approaches to third-generation DNA sequencing technology.


The first and second generation of DNA sequencing technologies in DNA sequencing have led to very important developments and

have led to astonishing developments in many scientific studies [1, 2]. It has become much easier to understand the genome sequence

of life, to understand what information is encoded in the genome, and what information is carried or transmitted. Third generation

DNA sequencing technologies have offer new opportunities for genome sequencing study by creating an innovative, efficient and

cost-effective basis for existing sequencing technologies [3, 4]. While the new generation single-chain molecule sequencing

technology (3rd generation DNA sequencing technology) creates potential for longer sequencing and reading, at the same time it

reduces cost and all of this greatly reduces the time spent on current sequencing [5]. Approaches developed in three main areas, such

as DNA synthesis, through nano-pores and direct visual sequencing form the basis of third generation DNA sequencing technology

[6].


Technological approaches developed for the third-generation DNA sequencing technology have proved that this technology is

provable and applicable and brings much more innovations and facilities to second-generation DNA sequencing technology. Third

generation DNA sequencing technologies developed in parallel to rapidly devoloping technology can do everything that second-

generation DNA sequencing technology does. But third-generation DNA sequencing technology has capacity for sequencing a

genome of any organism with in less than a day and provide full, precise longer reading chains at much less cost.

Keywords: DNA sequencing, 2nd generation DNA sequencing, 3rd generation DNA sequencing

References: [1] Schadt, E. E., Turner, S., and Kasarskis, A. 2010. A window into third-generation sequencing. Human Molecular Genetics, Vol. 19, 227-40.

[2] Schatz, M.C., Delcher, A.L. and Salzberg, S.L. 2010. Assembly of large genomes using second-generation sequencing. Genome Res., Vol. 20,

1165-73.

[3] Whiteford, N., Skelly, T., Curtis, C., Ritchie, M.E., Lohr, A., Zaranek, A.W., Abnizova, I. and Brown, C. 2009. Swift: primary data analysis for

the Illumina Solexa sequencing platform. Bioinformatics, Vol. 25, 2194-99.

[4] Metzker, M.L. (2010). Sequencing Technologies-the next generation. Nat. Rev. Genet., Vol. 11, 31-46.

[5] Shendure, J. and Ji, H. (2008). Next-generation DNA sequencing. Nat. Biotechnol., Vol. 26, 1135-45.

[6] Eid, J., Fehr, A., Gray, J., Luong, K., Lyle, J., Otto, G., Peluso, P., Rank, D., Baybayan, P., Bettman, B. et al. 2009. Real-time DNA sequencing

from single polymerase molecules. Science, Vol. 323, 133-8.





127

IDDGC17-PP-106

FOLATE PRODUCTĠON BY Lactabacillus plantarum ISOLATED FROM

TRADITIONAL FERMENTED TURKISH PICKLES

Esin Kiray1, Belgin Erdem

2, Ergin Kariptas

3

1,2 Ahi Evran University, Faculty of Science and Arts, Department of Biology, Kirsehir, Turkey.

3Ahi Evran University, Faculty of Medicine, Department of Medical Microbiology, Kirsehir, Turkey.

[email protected]

Aims and Scopes: Folic acid, another form of which is known as folate, is one of the B vitamins. It is used as a supplement by

women to prevent neural tube defects (NTDs) developing during pregnancy. It is also used to treat anemia caused by folic acid

deficiency [1]. Folate is essential for the body to make DNA, RNA, and metabolise amino acids which are required for cell

division. As humans cannot make folic acid, it is required from the diet and the gut microbiota making it an essential vitamin [2]. It

has been demonstrated that folate synthesized by bacteria in the human intestine is absorbed and used by the host. Probiotic bacteria,

mostly belonging to the genera Lactobacillus and Bifidobacterium, confer a number of health benefits to the host, including vitamin

production. With the aim to produce folate-enriched fermented products and/or develop probiotic supplements that accomplish folate

biosynthesis in vivo within the colon, bifidobacteria and lactobacilli have been extensively studied for their capability to produce this

vitamin [3]. Although some authors have reported folate-productive lactobacilli strains isolated from radish, frozen peas, yogurt,

cheese and cow‘s milk strains isolated from sourdough and goat‘s milk [4], there are no data available concerning lactic acid bacteria

isolated from traditional Turkish pickles.

Materials and Methods: The present work investigated folate production by Lactobacillus plantarum isolated from traditional

fermented Turkish pickles. The L. plantarum strain was identified by 16S rRNA gene sequencing and characterized by biochemical

methods. The folate production ability of selected isolates was determined at 37 °C by inoculating single colony in folic acid assay

medium.

Results and Discussion: In our test experiment, L. plantarum was found to contain 180.3±2 ng/ml of folate after 24 h of incubation in

an MRS broth.

Keywords: Probiotics, Lactobacillus plantarum, folate production, Turkish pickles

References: [1] Kirsten B.D at al. JAMA. 2017, 317 (2): 183.

[2] Pommerville, Glendale Community College Jeffrey C, 2009, 511.

[3] Rossi M.; Amaretti A.; Raimondi S. Nutrients, 2011, 3(1):118-34.

[4] Masuda M.; IDE M.; Utsumı H.; Nııro T.; Shımamura Y., Murata M. Bioscience, Biotechnology, and Biochemistry, 2014, 1347-6947.

https://en.wikipedia.org/wiki/B_vitamins

https://en.wikipedia.org/wiki/Dietary_supplement

https://en.wikipedia.org/wiki/Neural_tube_defect

https://en.wikipedia.org/wiki/Pregnancy

https://en.wikipedia.org/wiki/Anemia

https://en.wikipedia.org/wiki/Folic_acid_deficiency

https://en.wikipedia.org/wiki/Folic_acid_deficiency

https://en.wikipedia.org/wiki/Essential_nutrient

https://en.wikipedia.org/wiki/DNA

https://en.wikipedia.org/wiki/RNA

https://en.wikipedia.org/wiki/Amino_acids

https://en.wikipedia.org/wiki/Cell_division

https://en.wikipedia.org/wiki/Cell_division

https://en.wikipedia.org/wiki/Essential_vitamin




128

IDDGC17-PP-107

MODEL ORGANISMS and MOLECULAR APPLICATIONS

Mehmet Karakas*1

, Ekrem Bolukbasi2



*[email protected]

Abstract

Model organism or model live which are also used for the investigation of certain biological processes. Some basic researches using

model organisms has taught us much of what we know about biology. This research has identified the fundamental properties of how

cells grow and divide, how inheritance works, and how organisms store and use energy. Model organisms are used to obtain

information about other species including humans that are more difficult to study directly. Any living thing which selected as a model

organism because it resembles the human genome in a very high degree and can reproduce/grow rapidly. Due to its similarity to the

human genome it help in the interpretation of the human genome sequence. Model organisms are very importance for the

investigation of development of treatment methods and the causes of the human diseases. Also, model organisms such as mouse,

nematode, E. coli and yeast have provided considerable benefit to knowing the mapping and sequencing of the human genome within

the human genome project in the 1990s. Model organism can distinguish three groups. Genetic, experimental and genomic model

organisms. Genetic model organisms are species that are amenable to genetic analysis. For example they breed in large numbers and

have a short generation time. Experimental organisms are species may not necessarily be genetically amenable i.e, they may have

long generation intervals and poor genetic maps, but they have other experimental advantages. An example for genomic organism is

the puffer fish which has a similar gene repertoire to humans but a much smaller genome.

Aims and Scopes The aim of this study is to provide detailed information on the use of model organisms and applications in molecular biology.


A model organism is a species that has been widely studied, usually because it is easy to maintain and breed in a laboratory setting

and has particular experimental advantages [1-2]. Therefore, when selecting living organisms as models to work with, certain criteria

are used depending upon the experimental purposes. 1) rapid development with short life cycles, 2) small adult size, 3) ready

availability and 4) tractability [3]. Model organisms are used to obtain information about other species including humans that are

more difficult to study directly. Research on bacteria, yeast, insects, worms, fish, rodents and plants has shown that the basic

operating principles are nearly the same in all living things. So a finding made in fruit flies can shed light on a biological process in

people. For example, C. elegans is a popular research organism as it possesses all the characteristics mentioned, yet shares many

essential biological properties with humans [4-5]. Other model organisms are; Saccharomyces cerevisiae, Drosophila melanogaster,

Escherichia coli, Drosophila sp. and Arobidobsis sp. etc. [6].


The natural course of a disease in a human may take dozens of years. Simple organisms that can develop a disease or some of i ts

symptoms make it possible for researchers to learn about the disease faster in a period of months to a few years. That would be nearly

impossible, and often unethical, to do in humans. When scientists discover that a particular gene is associated with a disease in

humans, one of the first things they typically do is find out what that gene does in a model organism. This often provides important

clues for understanding the cause of a disease and for developing potential diagnostic tests and treatments. In conclusion, model

organisms do play an important role in understanding many biological process.

Keywords: Model organism, Genetic and genomic model organisms, C. elegans

References: [1] Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics, 77, 71-94.

[2] Donald, D. L. (Ed.). (1997). C. elegans II. New York, NY: Cold Spring Harbor Laboratory Press.

[3] Flannery, C. M. (1997). Models in biology. American Biology Teacher, 59(Apr), 244-248.

[4] Jeszenszky, W. A. (1997). Managing the fruit fly experiment. American Biology Teacher, 59(5), 292-294.

[5] Bolker, J. A. (1995). Model systems in developmental biology. BioEssays, 17(5), 451-455.

[6] Botstein, D., & Fink, R. G. (1988). Yeast: an experimental organism for modern biology. Science, 240, 1439-1443


http://eol.org/pages/1029744/overview






129

IDDGC17-PP-108

MOLECULAR CHARACTERIZATION OF LEISHMANIA SPECIES

ISOLATED FROM CUTANEOUS LEISHMANIASIS IN KAYSERI

ÜLFET ÇETĠNKAYA1, BORA ÖZKAN

2, SERKAN ġAHĠN

3, ARZUV CHARYYEVA

4, NERMĠN YAPRAK

5

1HalilBayraktar Health Vocational College, Erciyes University,Kayseri, Turkey

2Department of Parasitology,Faculty of Medicine,Mustafa Kemal University,Hatay, Turkey.

3Department of Ġnfectious Disease Control Programs, Public Health Directorate, Kayseri, Turkey.

4Department of Parasitology, Faculty of Medicine, Erciyes University,Kayseri, Turkey.

516. Family Health Unit, Melikgazi Community Health Centers,Kayseri, Turkey.

[email protected]

Aims and Scopes: Leishmaniasis is a vector-borne disease transmitted to human by the bite of infected female sand flies. There are

three main clinicalforms of leishmaniasis, but the most common form is cutaneous leishmaniasis. Cutaneousleishmaniasis is common

in Syria, Brazil, Saudi Arabia, Iran, Afghanistanand Peru. Because of the civil war in Syria, Kayseri city, in Central Anatolia Region,

has received a large number of syrian refugees immigration. This study aimed to determine genetic characteristics of Leishmania

species in Kayseri based on these quencing of the ribosomal internal transcribed spacer 1 (ITS1) locus.

Materials and Methods: In this study, it was included the total 12 of Leishmania isolates collected from the patients with

leishmaniasis between January 2008 and January 2016. DNA was extracted from the parasites cultured in complete RPMI-1640

medium. ITS1 gene fragment was amplified by PCR for DNA sequencing and molecular characterization.

Results and Discussion: In this study, we report the characterization based on ITS1 of 12 isolates. The molecular characterization of

Leishmania species revealed Leishmania tropica as the causative agent of cutaneous leishmaniasis in Kayseri. However, this work is

preliminary study and also to be supported with the large number of parasite isolates.

Keywords:Cutaneous leishmaniasis, Molecular characterization, ITS1, Phylogenetic analysis

Acknowledgements:The work was supported by the Erciyes University Scientific Research Projects Unit, Turkey (Project No. TCD-

2016-6644).

References:

[1] Mogalli, N. M.; El Hossary, S. S.; Khatri, M. L.; Mukred, A. M.; Kassem, H. A.; El Sawaf, B. M.;Ramadan, N. F. Clinicoepidemiologicpattern

of cutaneousleishmaniasisandmolecularcharacterization of itscausativeagent in Hajjahgovernorate, northwest of Yemen. Acta Trop, 2016, 163, 130-

134.

[2] Amro, A.;Gashout, A.; Al-Dwibe, H.;Zahangir Alam, M.;Annajar, B.;Hamarsheh, O.;Shubar, H.;Schönian, G. First

molecularepidemiologicalstudy of cutaneousleishmaniasis in Libya.PLoSNegl Trop Dis, 2012, 6(6), e1700.

[3] Can, H.;Döşkaya, M.;Özdemir, H. G.;Şahar, E. A.;Karakavuk, M.;Pektaş, B.;Karakuş, M.;Töz, S.; Caner, A.;Döşkaya, A. D.;İz, S. G.;Özbel,

Y.;Gürüz, Y. Seroprevalence of Leishmania infection and molecular detection of Leishmaniatropica and Leishmaniainfantumin stray cats of İzmir,

Turkey. ExpParasitol, 2016, 167, 109-114.





130

IDDGC17-PP-109

GENEXPHARMA: SEARCH TOOL FOR GENE EXPRESSION ORIENTED DRUG REPOSITONING

Beste Turanli1,2

, Gizem Gulfidan2, Kazım Yalçın Arga

2

1Department of Bioengineering, Istanbul Medeniyet University, Istanbul, Turkey

2Department of Bioengineering, Marmara University, Istanbul, Turkey

[email protected]

Aims and scopes: Drug repositioning is an approach to expose new therapeutic effects of an existing drug for using in the treatment

of a different disease. This approach aims reducing the time, cost and risk through the all drug development process [1]. Despite the

existence of both computational and experimental methods, there is still gap in the field. Here, we present a gene expression based

pharmaceuticals search tool (geneXpharma), which is a web-accessible and free platform within user friendly interface that provides

statistically evaluated gene expressions and their drug interactions for 48 diseases under the seven different disease categories.

geneXpharma is organized to enable creating or testing the hypotheses for drug repositioning.

Materials and Methods: 120 independent high throughput microarray datasets comprising 48 different diseases from the Gene

Expression Omnibus (GEO) database [2] were downloaded to distinguish gene expression profiles. Each microarray dataset was

statistically analyzed to determine differential expressed genes (DEGs) according to the previously published the ‗omics‘ pipeline [3],

which applied RMA normalization [4] and linear models for microarray data (LIMMA) method [5] via R/Bioconductor software

(v.2.12) [6]. P-values and Fold changes (FC) were calculated for each gene in each dataset. DGIdb 2.0 [7] was used to acquire gene-

drug interactions comprising interactions from 15 publicly available sources. P-values were calculated for drugs in each dataset via

employment of a hypothesis test based on hypergeometric distribution. geneXpharma is designed as web accessible platform within a

MySQL-based database and PHP-based user interface. The database implemented with ID-based and standardized core data,

relational data tables of gene-drug and DEGs-datasets can be easily maintained or updated. The results are represented in a table and

subsequently might be exported into .csv file for further analysis, after creating a profile. The information about Dataset ID, Disease,

Gene Symbol, Entrez Gene ID, P-value (gene), Fold Change (gene), Drug and P-value (drug) is represented after each search.

Results and Discussion: geneXpharma is free and publicly available at the website: genexpharma.org which is also good at finding

previous announced drug repositioning candidates as well as new ones. For further progress, we aim to expand the datasets number

and expression profiles from the high throughput analysis such as array-based platforms and specially RNA sequencing. TCGA data

is planning to be analyzed and incorporate into the geneXpharma web site in the near future. Moreover, this type of research tools

may be applied for individualized healthcare plans.

Keywords: gene expression, drug repositioning, search tool, systems biomedicine

Acknowledgements: Support by Marmara University Scientific Research Projects Committee (BAPKO) in the context of the project

FEN-C-DRP-250816-0417, and TUBITAK BIDEB 2211-D Domestic Doctoral Fellowship Program (Beste Turanlı).

References:

[1] Shabana, K.M.; Abdul Nazeer, K.A.; Pradhan M.; Palakal M. BMC Bioinformatics 2015, 16(Suppl 17),S5.

[2] Barrett T.; Wilhite S.E.; Ledoux P.; Evangelista C; et al. Nucleic Acids Research, 2013, 41, 991-995.

[3] Calimlioglu B.; Karagoz K.; Sevimoglu T.; Kilic E.; et al. OMICS: A journal of integrative biology, 2015, 563-573.

[4] Bolstad B.M.; Irizarry R.A.; Speed T.P. Bioinformatics, 2003, 19(2), 185-93.

[5] Smyth G.K. Stat Appl Genet Mol Biol. 2004, 3, epublication.

[6] Gentleman R.C.;Carey V.J.; Bates D.M.; Bolstad B.; et al. Genome Biol. 2004, 5(10), epublication.

[7] Wagner A.H.; Coffman A.C.; Ainscough B.J.; Spies N.C.; et al. Nucleic Acids Research, 2016, 44,1036-1044.




131

IDDGC17-PP-110

THE HIGH POTENTIAL OF NETWORK ENTROPY BASED DIFFERENTIAL PROTEIN

INTERACTOME ANALYSIS FOR DIAGNOSTICS INNOVATION IN ONCOLOGY AND TUMOR

PATHOGENESIS: A CASE STUDY ON OVARIAN CANCER

Esra Gov1,2

, Dilara Ayyıldız1,3

, Kazım Yalcın Arga1

1Department of Bioengineering, Marmara University, Istanbul, Turkey

2Department of Bioengineering, Adana Science and Technology University, Adana, Turkey

3Department of Biomedical Sciences and Biotechnology, University of Udine, Italy

[email protected]

Aims and Scopes: Ovarian cancer is one of the most common cancers and has a high mortality rate due to insidious symptoms and

lack of robust diagnostics [1]. A hitherto understudied concept in cancer pathogenesis may offer new avenues for innovation in

ovarian cancer biomarker development. Cancer cells are characterized by an increase in network entropy and several studies have

exploited this concept to identify disease-associated gene and protein modules. We report here the changes in protein-protein

interactions in ovarian cancer within a differential network (interactome) analysis framework utilizing the entropy concept and gene

expression data.

Materials and Methods: A compendium of six transcriptome datasets that included 140 samples from laser micro-dissected

epithelial cells of ovarian cancer patients and 51 samples from healthy population was obtained from Gene Expression Omnibus [2],

and the high confidence human protein interactome (31465 interactions among 10681 proteins) [3] was employed. The uncertainties

of the up- or down-regulation of protein-protein interactions in ovarian cancer were estimated through an entropy formulation [4]

utilizing combined expression levels of genes, and the interacting protein pairs with minimum uncertainty were identified.

Results and Discussion: We identified 105 proteins with differential protein-protein interaction patterns scattered in 11 modules,

each indicating significantly affected biological pathways in ovarian cancer such as DNA repair, cell proliferation-related

mechanisms, nucleoplasmic translocation of estrogen receptor, extracellular matrix degradation, and inflammation response (Figure

1). In conclusion, we suggest several protein-protein interactions as biomarker candidates for ovarian cancer and discuss their future

biological implications as potential molecular targets for pharmaceutical development as well. Additionally, network entropy analysis

is a concept that deserves greater research attention for diagnostics innovation in oncology and tumor pathogenesis.

Keywords: Cancer biology, differential interactome, entropy minimization, protein-protein interaction, ovarian cancer.

Figure 1: Response map indicating differential protein interactions in ovarian cancer.

Acknowledgements: Support by Marmara University Scientific Research Projects Committee (BAPKO) in the context of the project

FEN-C-DRP-110915-0445.

References: [1] Gov, E.; Arga, K.Y. IET Syst Biol 2016, 10, 219-228.

[2] Barrett,T.; Wilhite. S.E.; Ledoux, P.; Evangelista, C.; Kim, I.F.; et al. Nucleic Acids Res 2013 41,D991-995.

[3] Karagoz, K.; Sevimoglu, T.; Arga, K.Y. J. Theor. Biol 2016, 403, 85–96.

[4] Varadan, V.; Anastassiou, D. PLoS Comput Biol 2006, 2, e68.




132

IDDGC17-PP-112

Antiproliferative Activity of 3,4-Dihydroxyphenyl Ethanol on Colon Cancer

Seda Orenay Boyacioglu1, Olcay Boyacioglu

2, Mehmet Delibas

3

1Adnan Menderes University, Faculty of Medicine, Department of Medical Genetics, AYDIN

2Adnan Menderes University, Faculty of Engineering, Department of Food Engineering, AYDIN 3Adnan Menderes University, Faculty of Agriculture, Department of Agricultural Biotechnology, AYDIN

ABSTRACT Background and Aim: Olive is the second most important agricultural product after fig for Aydın province. The olive mill waste water (OMWW),

which is a by-product of olive oil production process, is rich in polyphenolic compounds, and various biological activities such as antiproliferative,

antioxidant, antithrombotic, antiinflammation, hypocholesterolemic, antimicrobial, and antiviral have been revealed by scientific studies1-7.

However, studies on 3,4-dihydroxyphenyl ethanol (3,4- DHPEA), which is a phenolic compound in OMWW, on colon cancer are limited. For this

purpose, we investigated the cytotoxic effects of 3,4- DHPEA on the HT-29 colon cancer cell line.

Materials and Method: The human colon cancer line HT-29 was maintained in RPMI 1460 media supplemented with 10% fetal bovine serum

(FBS), and incubated under 5% CO2 at 37°C. When ready to be treated, 6,000 cells were placed into 96 well plates. Cells were treated with 0uM to

25uM of 3,4- DHPEA with PBS as control for up to 72 hours. The viability levels of the cells after the incubation period were measured with Cell

Titer-Glo Luminescent Assay. Experiments were performed three times, in triplicates. The results were analyzed via analysis of variance (ANOVA)

test. Differences with a P value of less than 0.05 were considered as significant.

Results and Conclusion: Results show that 3,4- DHPEA has antiproliferative effect on colon cancer cell line in a dose and time dependent manner.

Drug treatment time is found to be statistically significant (P0.05). In this study, we investigated the antiproliferative effect of 3,4- DHPEA, the

major phenolic compound of olive pitch in the human colon cancer cell line. Although the anticancerogenic effects of 3,4- DHPEA on breast,

prostate and heptocellular carcinomas are detected, its effects on colon cancer are not well known. Fabiani et al have suggested that has the 3,4-

DHPEA effect of pausing HL 60, HT-29 and HT-29 clone 19 cells in the G1 phase of cell cycle and inducing apoptosis 6.With the results of 3,4-

DHPEA treatment on cell lines of peripheral blood mononuclear cells (PBMC), breast (MDA and MCF-7), prostate (LNCaP and PC3), and colon

(SW480 and HCT116) cancer, Rosignoli et al. have come to the conclusion that 3,4- DHPEA abolished the H2O2-induced oxidative DNA damage

and thus may be an inhibitory chemical agent in the onset and progression stages of cancer 5.Fabiani et al. investigated to elucidate the role played

by H2O2 in chemopreventive activities of 3,4- DHPEA on breast (MDA and MCF-7), prostate (LNCaP and PC3), and colon (SW480 and HCT116)

cancer cell lines. It has been determined that the H2O2-inducing ability of 3,4- DHPEA is completely inhibited by pyruvate and that exposure of cells

to conditions that do not support the accumulation of H2O2 inhibits the antiproliferative effect of 3,4- DHPEA 7. With the antiproliferative effects

reported here, it is expected that the phenolic matter present in OMWW may offer new opportunities in the discovery of novel anticancer drugs. The

evaluation of the phenolic compounds contained in the OMWW as a natural anticancer drug source is very important in terms of environmental,

social, economic, and health points of view.

Keywords: Colon cancer, 3,4- DHPEA, antiproliferation, olive mill waste water (OMWW) phenolic

1. Artajo LS, Romero MP, Morelloä JR, Motilva MJ. Enrichment of refined olive oil with phenolic compounds:evaluation of their antioxidant

activity and their effect on the bitter index. J Agric Food Chem 2006; s.6079-6088.

2. Capasso R, Evidente A, Schivo L, Orru G, Marcialis MA, Cristinzio G. Antibacterial polyphenols from olive oil mill wastewaters. J Appl

Bacteriol 1995; s. 393-398.

3. Luo C, Li Y, Wang H, Cui Y, Feng Z, Li H, Li Y, Wang Y, Wurtz K, Weber P, Long J, Liu J. Hydroxytyrosol promotes superoxide production

and defects in autophagy leading to anti-proliferation and apoptosis on human prostate cancer cells. Curr Cancer Drug Targets.2013;s.625-39.

4. Rosignoli P, Fuccelli R, Sepporta MV, Fabiani R. In vitro chemo-preventive activities of hydroxytyrosol: the main phenolic compound present in

extra-virgin olive oil. Food Funct. 2016; s.301-307.

5.Sepporta MV, López-García MÁ, Fabiani R, Maya I, Fernández-Bolaños JG. Enhanced chemopreventive activity of hydroxytyrosol on HL60 and

HL60R cells by chemical conversion into thio derivatives. Eur J Pharm Sci 2013; s.790-798.

6. Fabiani R, De Bartolomeo A, Rosignoli P, Servili M, Montedoro GF, Morozzi G. Cancer chemoprevention by hydroxytyrosol isolated from virgin

olive oil through G1 cell cycle arrest and apoptosis. Eur J Cancer Prev 2002; s.351-8.

7. Fabiani R, Sepporta MV, Rosignoli P, De Bartolomeo A, Crescimanno M, Morozzi G.Anti-proliferative and pro-apoptotic activities of

hydroxytyrosol on different tumour cells: the role of extracellular production of hydrogen peroxide. Eur J Nutr 2012; s.455-64.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Luo%20C%5BAuthor%5D&cauthor=true&cauthor_uid=23597197


http://www.ncbi.nlm.nih.gov/pubmed/?term=Li%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=23597197


http://www.ncbi.nlm.nih.gov/pubmed/?term=Wang%20H%5BAuthor%5D&cauthor=true&cauthor_uid=23597197


http://www.ncbi.nlm.nih.gov/pubmed/?term=Cui%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=23597197


http://www.ncbi.nlm.nih.gov/pubmed/?term=Feng%20Z%5BAuthor%5D&cauthor=true&cauthor_uid=23597197

http://www.ncbi.nlm.nih.gov/pubmed/?term=Li%20H%5BAuthor%5D&cauthor=true&cauthor_uid=23597197




http://www.ncbi.nlm.nih.gov/pubmed/?term=Wang%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=23597197


http://www.ncbi.nlm.nih.gov/pubmed/?term=Wurtz%20K%5BAuthor%5D&cauthor=true&cauthor_uid=23597197


http://www.ncbi.nlm.nih.gov/pubmed/?term=Weber%20P%5BAuthor%5D&cauthor=true&cauthor_uid=23597197


http://www.ncbi.nlm.nih.gov/pubmed/?term=Long%20J%5BAuthor%5D&cauthor=true&cauthor_uid=23597197


http://www.ncbi.nlm.nih.gov/pubmed/?term=Liu%20J%5BAuthor%5D&cauthor=true&cauthor_uid=23597197








http://www.ncbi.nlm.nih.gov/pubmed/?term=Rosignoli%20P%5BAuthor%5D&cauthor=true&cauthor_uid=26469183


http://www.ncbi.nlm.nih.gov/pubmed/?term=Fuccelli%20R%5BAuthor%5D&cauthor=true&cauthor_uid=26469183


http://www.ncbi.nlm.nih.gov/pubmed/?term=Sepporta%20MV%5BAuthor%5D&cauthor=true&cauthor_uid=26469183


http://www.ncbi.nlm.nih.gov/pubmed/?term=Fabiani%20R%5BAuthor%5D&cauthor=true&cauthor_uid=26469183






https://www.ncbi.nlm.nih.gov/pubmed/?term=Sepporta%20MV%5BAuthor%5D&cauthor=true&cauthor_uid=23313620

https://www.ncbi.nlm.nih.gov/pubmed/?term=L%C3%B3pez-Garc%C3%ADa%20M%C3%81%5BAuthor%5D&cauthor=true&cauthor_uid=23313620

https://www.ncbi.nlm.nih.gov/pubmed/?term=L%C3%B3pez-Garc%C3%ADa%20M%C3%81%5BAuthor%5D&cauthor=true&cauthor_uid=23313620

https://www.ncbi.nlm.nih.gov/pubmed/?term=Fabiani%20R%5BAuthor%5D&cauthor=true&cauthor_uid=23313620


https://www.ncbi.nlm.nih.gov/pubmed/?term=Maya%20I%5BAuthor%5D&cauthor=true&cauthor_uid=23313620

https://www.ncbi.nlm.nih.gov/pubmed/?term=Fern%C3%A1ndez-Bola%C3%B1os%20JG%5BAuthor%5D&cauthor=true&cauthor_uid=23313620

https://www.ncbi.nlm.nih.gov/pubmed/?term=Fern%C3%A1ndez-Bola%C3%B1os%20JG%5BAuthor%5D&cauthor=true&cauthor_uid=23313620




https://www.ncbi.nlm.nih.gov/pubmed/?term=De%20Bartolomeo%20A%5BAuthor%5D&cauthor=true&cauthor_uid=12195161

https://www.ncbi.nlm.nih.gov/pubmed/?term=Rosignoli%20P%5BAuthor%5D&cauthor=true&cauthor_uid=12195161


https://www.ncbi.nlm.nih.gov/pubmed/?term=Servili%20M%5BAuthor%5D&cauthor=true&cauthor_uid=12195161

https://www.ncbi.nlm.nih.gov/pubmed/?term=Servili%20M%5BAuthor%5D&cauthor=true&cauthor_uid=12195161

https://www.ncbi.nlm.nih.gov/pubmed/?term=Montedoro%20GF%5BAuthor%5D&cauthor=true&cauthor_uid=12195161

https://www.ncbi.nlm.nih.gov/pubmed/?term=Montedoro%20GF%5BAuthor%5D&cauthor=true&cauthor_uid=12195161

https://www.ncbi.nlm.nih.gov/pubmed/?term=Morozzi%20G%5BAuthor%5D&cauthor=true&cauthor_uid=12195161










https://www.ncbi.nlm.nih.gov/pubmed/?term=Crescimanno%20M%5BAuthor%5D&cauthor=true&cauthor_uid=21805082








133

IDDGC17-PP-113

SULFONATE CALIX[8]ARENE; SYNTHESIS, DOUBLE STRANDED DNA-BINDING AND

CLEAVAGE STUDIES

Bahar YILMAZ, Mevlüt BAYRAKCI

Bioengineering department, Faculty of engineering, Karamaoğlu Mehmetbey University, TR-70100, Karaman, Turkey,

[email protected] Aims and Scopes:

Calixarene is versatile molecule for the design and synthesis of receptors and multivalent ligands that is able to mimic or effects

specific biological functions. A water soluble sulfonate calix[8]arene binds selectively to double-stranded DNA. DNA-binding is been

of medicinal significance because they constitute a large part of all anticancer drugs.(1,2,3)


Synthesis

The water-soluble calix[8]arene bearing sulfonate groups on the ‗upper rim‘ was synthesis by following the published literature

procedure.(1)

Biological studies

The DNA-binding and cleavage experiments were performed at room temperature by using UV measurements. The absorption of the

calixarene in buffer (5 mM Tris–HCl, 50 mM NaCl, pH 7.0) was recorded by using fixed solution containing calixarene and DNA.

DNA solutions were allowed to incubate for 5 min before recording of the absorption spectra. Electrophoresis is a technique used to

separate and sometimes purify macromolecules (especially proteins and nucleic acids) that differ in size, charge or conformation. The

cleavage of CT-DNA can be monitored by agarose-gel electrophoresis.(3,4)


The figure 1 gives information about sulfonate calix[8]arene effects on CT-DNA. Several cleavage and spectroscopic characteristics

indicate insertion into the major cavity. To explain the binding mechanism, we measured UV visible for various CT-DNA before and

after addition of the calixarene. Gel electrophoresis separate to mixtures of DNA with respect to the molecular density.(3,4)

Figure 1: (A) A comparison of time dependent decrease of DNA absorbance.

(B) Density of CT-DNA. Before binding(a,b) , after binding (c).

Keywords: Sulfonate calix[8]arene, CT-DNA, Biological study

References:

[1] Shinkai, S.; Araki, K.; Tsubaki, T.; Arimura, T.; Manabe, O.Transactions 1987 1, 2297-2299.

[2] Zadmard, R.; Schrader, T. Angewandte Chemie International Edition 2006 45(17), 2703-2706.

[3] Dudic, M.; Colombo, A.; Sansone, F.; Casnati, A.; Donofrio, G.; Ungaro, R. Tetrahedron2004 60(50), 11613-11618.

[4] Anbu S.; Kandaswamy M.; Suthakaran P.; Murugan V.; Varghese B. Journal of Inorganic Biochemistry 2008 401–410




134

IDDGC17-PP-114

DETERMINATION OF BENZOIC ACID-INDUCED MOLECULAR TOXICITY WITH PCR-RAPD

TECHNIUGUE

Fatih Oguz BEKDEMĠR1*, Ali DEMĠRBAĞ

2, SEDAT PER

2, Dilek PANDIR

2

1*Bozok University, Institue of Sciences, Department of Biology, Yozgat, Turkey

2Bozok University, Faculty of Arts and Science, Department of Biology, Yozgat, Turkey


Aims and Scopes:

Food additives are also used to protect moldering foods over the preparation of factory made nutrients or to raise nutrient value. In

this study, it was used for the first time with RAPD-PCR in A. cepa under BA stress. Therefore, the present study was aimed to

investigate the genotoxic and mutagenic alterations induced by BA toxicity in A. cepa roots.


Healty six onion bulbs for control and treatment groups were germinated into test tubes for 24, 48 and 72 h and 50, 100, 200 and 500

mg/L of application concentrations were transferred to the treatment groups for 24, 48 and 72 h under same laboratory conditions. 1–2

cm roots were collected. After BA treatment for increasing time, the genomic DNA extraction was obtained from A. cepa roots using

plant mini kit. Extraction of all treatment-groups and PCR amplification of genomic DNA were performed.


For the preservation of nutrient substances from the effects of yeast and bacteria, BA is frequently used as an antimicrobial substance

in many nutrient products such as fruit juice, biscuits and cake [1, 2]. These results suggest that BA at high concentrations could affect

the DNA much stronger than its lower concentrations. Based on the research performed in this study it could be stated that BA

presents genotoxic effect on the DNA from root meristem cells of A. cepa with clear correlation between BA concentration. PCR-

RAPD after optimization is a useful tool for genotoxicity estimations.

Keywords: RAPD, Allium, toxicology, benzoic acid, roots

References:

[1] Sarıkaya, R., Solak, K.. Gazi Üniversitesi Gazi Eğitim Fakültesi Dergisi 2003, 23: 19-32.

[2] Yılmaz S., Unal F., Yuzbasıoglu D. Cytotechnology, 2009, 60: 55-61.




135

IDDGC17-PP-115

INVESTIGATION OF THE NON-CULTIVABLE PROKARYOTIC MICROBIOTA OF

TURKISH TABLE OLIVE BRINE

Huriye Karaçay1, Hasan Demirci

1 , Günseli Kurt Gür

1, Emel Ordu

1*

1 Yildiz Technical University, Faculty of Arts and Sciences, Department of Molecular Biology and Genetics, Istanbul,

*emelbordumail.com

Fermented olive fruit (Olea europaea L.) is traditionally cultivated in Mediterranean countries and it is a fundamental food sector.

There is a direct correlation with microbiota and product quality of fermented foods. More than 99% of identified prokaryotes can not

be cultured in the laboratory. Metagenomics which is a culture-independent cloning approach, provide a wealth of genetic information

about the uncultured microbial world. Although shotgun sequencing applications are growing rapidly, analysis of 16S rRNA gene as a

conserved marker is a stil rapid and the most frequently used way to investigate the microbiota. In the literature, although there are

many studies to investigate the microbial ecosystems from different food fermentations by using culture-independent method, the

number of study with the table olive is limited. Therefore knowledge of 16S sequence profiles for olive brine is important either

product quality and taste or providing an insight about the functional gene source of the community. For these purposes we have been

investigating the natural crashed green olive brine, which has acidic pH (4 ± 2) and 8-12 % NaCl concentration, from the southern

region of Turkey. About 1500 bp lenght 16S rDNA regions have been amplified and sequenced. Early and partail results showed that

the microbiota of natural olive brine include members of Acinotobacter, Rhodococcus, Pseudomonas genus, and species from

Bradyrhyzobium genus as a different from reported in the literature before. Uncultured bacterium indicates that investigating brine

community may serve as a source for novel genes waiting to be defined.

Keywords: olive brine, 16S rDNA, microbial diversity, novel gene sources

Acknowledgements: This work was supported by Research Fund of the Yildiz Technical University. Project Number: 2016-01-07-

YL01




136

IDDGC17-PP-116

MINING THE NOVEL HALOTOLERANT ENZYMES FROM MICROBIAL COMMUNITIES OF

FOOD FERMENTATION

Günseli Kurt Gür1 ,

Hasan Demirci1, Emel Ordu

1

1 Yildiz Technical University, Faculty of Arts and Sciences, Department of Molecular Biology and Genetics, Istanbul, Turkey,

[email protected]

Metagenomic methodologies allow not only broader description of phylogenetic surveys but also functional gene information directly

from the DNA isolated from different non-cultivable microbial environments bypassing cultivation step. Therefore it is a significant

approach to investigate the novel enzymes from extremophilic microorganisms which are difficult to adopt in laboratory conditions.

In the course of increasing efforts to shift from chemical production to enzymatic processes, there is a large demand for salt or pH

tolerant enzymes to be used for various biotechnological applications. In this study, olive brine which has acidic pH (4.0 ± 2.0) and 8-

12 % NaCl concentration was selected as a metagenomic source to investigate novel halophilic enzymes. Although, shotgun next

generation DNA sequencing is a new and powerfull method, function based screening was preferred at the begining for the

bioprospecting of extracted olive brine metagenome because of the complicated analysis of the complex sequence data obtained from

NGS. "Epicentre CopyControl ™ Fosmid Library Production Kit" have been used to construct metagenomic library for functional

screening. In order to find novel halotolerant enzymes, functional screening of the library, based on the enzyme activity, is in

progress, Following to determination of the cellulase activity of clones on the solid media, supplemented with CMC, enzyme activity

of the positive clones will be analyzed in the buffers containing different concentrations of salts.

Keywords: metagenomics, novel halotolerant enzymes, functional screening

Acknowledgements: This research has been supported by Yıldız Technical University Scientific Research Projects Coordination

Department. Project Number: 2016-01-07-YL01




137

IDDGC17-PP-117

MEDICINAL LEECH THERAPY

Hüseyin Ayhan1, Ahmet Çarhan

2, Salih Mollahaliloğlu

2

1 Yıldırım Beyazıt University, Vocational High School of Health Services Çubuk, Ankara, Turkey

e-mail: [email protected] 2 Yıldırım Beyazıt University, Medical Faculty Ankara, Turkey

Abstract

Medical leeches have been parasitic organisms that have been used for medical treatment since years. There are several types of

medical leeches and it is known that H. medicinalis, H. verbana and H. sulukii live in Turkey. Salivary gland secretions of leech

contain over 100 different bioactive substances. These secretions have analgesics, anti-inflammators and anticoagulants, vasodilators,

to prevent circulation disorders, to reduce blood pressure, to eliminate edema, to have strong antioxidant effects, immunity and to

increase the bioenergetic state of the organism. However, infection is the most common complication of leeching and consist of in 2-

36% of the patients. The most common complications are developing infections, itching, blister forming, ulcerative necrosis, scar on

the skin and extended bleeding.In 2004, the Food and Drug Authority of the USA (FDA) allowed the sale of leeches, plastic surgery

and microsurgical use. It is very important to use precious leeches in medical treatment more effectively as supportive treatment in

modern medical applications.

Keywords: Hirudotheraphy, Medicinal leech, Hirudo, Complementary Medicine

Materials and Methods: Types of leeches used in medical treatment in our country; Hirudo medicinalis, Hirudo verbana and Hirudo

sulukii. These leeches are produced from the lakes they are in. Once the leeches from the coconut reach a certain size, they are passed

through the disinfection stage and applied to the disease. The leech applied to the patient is disposable. Leeches treat diseases with the

enzymes they give to the patient during blood sucking.

Figure: Medicinal Leech

References:

1. Whitaker IS, Rao J, Izadi D, Butler PE. Historical article: Hirudo medicinalis: Ancient origins of, and trends in the use of medicinal

leeches throughout history. Br J Oral Maxillofac Surg. 2004;42:133–7.

2. Yakışan, Maden, R.Ş., Varis Tedavisinde Rutin Tedaviler İle Tıbbi Sülük Tedavisinin Karşılaştırılması, Atatürk Üniversitesi Tıp

Fakültesi Aile Hekimliği Anabilim Dalı Uzmanlık Tezi, 2015. Erzurum.

3. Abdualkader, A.M., et all. Leech Therapeutic Applications, Indian J Pharm Sci. 2013 Mar-Apr; 75(2): 127–137.

4. Barnes, R. D. 1974. Invertebrate Zoology, W.B. Saunders Company, pp. 233-316.Philadelphia, Washington.

5. Davıes, R.W. 1991. Annelida, Leeches, Polychaetes and Acanthobdellids. Ecology and Classification of Nort American Freshwater

Invertebrate. pp. 437-479. Canada.

6. Kaestner, A. 1967. Invertebrate Zoology. Volume I. Interscience Publishers. A Division of John Wiley and Sons. p. 597. New

York, London, Sydney.

7. Sağlam, N. ve Sarıeyyüpoğlu, M. 1998. Tatlısu Sülüğü (Nephelopsis obscura)'nün Biyolojisi, Morfolojisi, Bazı Kimyasal

Maddelerle Kontrolü ve Alabalığa (Oncorhynchus mykiss) Olan Etkisi. F.Ü. Fen ve Müh. Bilimleri Dergisi, 10(2), 105-123. Elazığ.

8. Abbas Zaidi, S.M., et all., A Systematic Overview of the Medicinal Importance of Sanguivorous Leeches Alternative Medicine

Review Volume 16, Number 1.2011

9. ABD: Dünya Sağlık Örgütü; [9 Ekim 2011 tarihinde Atıf] 2011.. DSÖ. : Kullanılabilir Kardiyovasküler hastalıklar (CVDs)

http://www.who.int/mediacentre/factsheets/fs317/en

10. Michalsen A, Roth M, Dobos G, Aurich M. Stattgurt, Germany: Apple Wemding; 2007. Medicinal Leech Therapy.





138

IDDGC17-PP-118

METAGENOMIC APPROACH TO INVESTIGATE THE NOVEL ENZYMES DEGRADING PLANT

BIOMASS

Hasan Demirci1 , Günseli Kurt Gür

1, Emel Ordu

1

1 Yildiz Technical University, Faculty of Arts and Sciences, Department of Molecular Biology and Genetics, Istanbul, Turkey,

[email protected]

However global biofuel production has become quite a large sector there are still technological bottlenecks in the production process.

The pretreatment and bioconversion of plant biomass from polysaccharides to fermentable sugars such as pentose and hexose by

hydrolysis, is the most critical bottleneck during the bioethanol production process. Bioconversion can be performed by chemical

hydrolysis but it has some economical disadvantages such as high energy need and contaminants to be cleaned after the process.

These disadvantages can be eliminated by using biocatalysts. But the glucohydrolases currently employed for biomass conversion can

not meet the growing demand for biofuels due to their high cost, low activity, poor stability under the required operating conditions

and resistant structure of lignocellulosic material against hydrolysis. Fungi and bacteria are the main sources of plant biomass

degrading enzymes. However, because the majority of the microorganisms are uncultivable with traditional techniques, more than

99% of the microbial organisms in nature have not yet been cultured and employed in industrial demand. Metagenomics overcomes

the disadvantages of cultivation procedures of the traditional microbial method, and thus greatly broadens the space of microbial

resource utilization either for phyilogenetics or gene and enzyme researches. Compost soil is a rich source for fungi and bacteria

which degrade the plant biomass, consequently cellulase, xylanase, laccase and peroxidase enzymes which degrade plant biomass.

Therefore metagenomic DNA was isolated from compost soil from. Since the shotgun DNA sequencing is a new and powerfull but

complicated method due to analysis of the complex sequence data, function based and sequence based screening approaches both

applied for the bioprospecting of extracted soil metagenom. The commercial phosmid vector " Epicentre CopyControl ™ Fosmid

Library Production Kit" have been used to constract metagenomic library for functional screening. At the same time, to provide an

insight about the functional gene source of the community in the selected compost soil, 16S rRNA gene profiles have been sequenced

for the definition of microbial diversity. Sequencing and functional screening of librarly are in progress

Keywords: compost soil, metagenomics, cellulase, biofuel,

Acknowledgements: This work was supported by Research Fund of the Yildiz Technical University. Project Number: 2013-01-07-

KAP02




139

IDDGC17-PP-119

THE POTENCIAL BIOFILM FORMATION OF MICROORGANISMS ON BULK-FILL

RESTORATIVE MATERIAL

Burcu Türkmen1, Gülbike Demirel

2, Evrim GüneĢ AltuntaĢ

1

1Ankara University Biotechnology Institute System Biotechnology Advanced Research Unit Tandogan Campus, 06110, Ankara-

Turkey 2Ankara University Faculty of Dentistry Department of Restorative Dentistry, Ankara-Turkey

[email protected]

Aims and Scopes: Bacterial adhesion to the surface of composite resins is an important parameter in the aetiology of secondary caries

formation. Recently developed, bulk fill resin composites are growing trend amongst practitioners due to a more simplified procedure.

However, the lack of available literature on bacterial adhesion to the surface of bulk fill composites. The aim of the present study was

to investigate the biofilm formation on these composite material.

Materials and Methods: In the current study, eight bacterial strains isolated previously in a study from the oral cavity known to form

dental plaque on the teeth and Streptococcus mutans ATCC 25175 selected as a standard strain were developed on the appropriate

medium. Then the conditions necessary for biofilm formation on the dental filling material which prepared at the Faculty of Dentistry

of Ankara University have been provided. In the later stages, bacteria retained on the filler material were isolated and counted

(cfu/mL) after seeding on solid medium.

Results and Discussion: It was observed that S. mutans ATCC 25175 strain was approximately 2.5x106

cfu / mL (7.9 x 104

cfu/mm2)

and other isolates were counted in the range of 1.8 x 106 (5.7 x 10

4 cfu/mm

2) to 4.06 x 10

6 cfu/mL (1.3 x 10

5 cfu/mm

2) on the surface

of the dental composite materials. According to the results, it can be declared the amount of bacteria adhering to the surface of

conventional composites and bulk fill composites is similar and it may cause secondary caries.

Keywords: Streptococcus, biofilm, bulk-fill restorative material

References: Times New Roman 9, bold, left aligned, line spacing 1.0.

[1] Altun, Z. Kompozit Dolgu Materyallerinde Son Gelişmeler, Gülhane Tıp Dergisi, 2005, 47, 77-82.

[2] Altuntas, E.G.; Diani, M.; Badali, N.; Yener, B.; Akçelik, N.; Akçelik, M. Comparison of two different evaluation methods for biofilm formation of the bacteria isolated from teeth, ECCMID, 27-30 April 2013, Berlin, Almanya.

[3] Filiz, D.; Çakır, Y.; Gürgan, P.S.; Attar, P.N. Çürük Mikrobiyolojisi, Hacettepe DiĢ Hekimliği Fakültesi Dergisi, 2010, 78-91.

[4] Soygun, K.; Unal, M.; Ozer, A.; Gülnahar, E. Farklı akışkan Bulk-fill kompozitlerin mikrosertliklerinin araştırılması, Cumhur. Dent. J., 2013, 17, 64-69. [5] Zhou, H.; et al., Three dimensional biofilm properties on dental bonding agent with varying quaternary ammonium charge densities, J. Dent., 2016, doi:

10.1016/j.jdent.2016.07.014.




140

IDDGC17-PP-120

ANTI-TUMOR ACTIVITY ON GLIOBLASTOMA CELL LINES OF PROPOLIS SAMPLES,

PROVIDED BY GIRESUN CITY, A RAINY AND TEMPERATE REGION OF TURKEY

MELTEM MARAS ATABAY1, ORHAN SEZGIN

2, MEHMET TASPINAR

3, VEYSEL YUKSEL

4, AYSEL KEKĠLLĠOGLU

5

1Bülent Ecevit University, Faculty of Education ,Department of Mathematics and Science Education, Section of Science Education,

Kdz Ereğli, Zonguldak, Turkey,[email protected] 2Karadeniz Technical University, Department of Medical Biology, Institute of Health Sciences, Trabzon, Turkey,

[email protected] 3Yüzüncü Yıl University, Faculty of Medicine, Department of Medical Biology, Van, Turkey,

4Yüzüncü Yıl University, Department of Medical Laboratory Technicianary, Özalp Vocational School,

Van, Turkey 5NevĢehir Hacı BektaĢ Veli University, Institute of Science, Department of Biology, NevĢehir, Turkey,[email protected]

Aims and Scopes: Propolis is a sticky substance that is collected from plants by honeybees that has anti-mutagenic and anti-

carcinogenic properties with biological and therapeutic effects. Inducing apoptosis is one of the mechanisms proposed for the

therapeutic effects of propolis[1]. We investigated the anti-tumor activity of naturally occurring propolis extracts when applied to

Glioblastoma cell lines. Our study was related to verifying a working propolis concentration and determining how cell viability was

affected.

Materials and Methods: Glioblastoma cell lines were exposed to different concentrations of propolis, and the apoptotic levels were

determined using apoptosis assay. Additional cell viability and proliferation were analyzed by XXT assay. We used the XTT assay to

assess cellular proliferation and viability.

Results and Discussion: The results showed that the propolis extract 1 extracts at 25 µg/ml concentration induced apoptosis in

association with increased number of positive cells. propolis extract 5 extract at 400 µg/ml concentration was the most increased

appoptatic dose. Results showed that apoptotic cell population increased significantly in Glioblastoma cell lines exposed to increasing

concentrations of propolis extracts.

Turkish propolis sample exhibits interesting biological properties, correlated with its chemical composition and expressed by its

capacity to scavenge free radicals and to inhibit tumor cell growth. Propolis extracts exhibited a dose-dependent inhibition of cellular

growth and activation of apoptosis in the Glioblastoma cell line.

Keywords: Propolis, apoptosis, cell viability, XXT assay

References:

[1] A. Russo, V. Cardile, F. Sanchez, N. Troncoso and A. Vanella (2004). Chilean propolis: antioxidant activity and antiproliferative action in

human tumor cell lines, Life Sci. 76(5), 545-58.




141

IDDGC17-PP-121

BIOTECHNOLOGICAL METHODS IN MOSQUITOE CONTROL

FROM PAST TO TODAY

Erhan Koçak1, Mehmet Oğuz Yaman

1,

1Süleyman Demirel University

Faculty of Agriculture, Department of Biotechnology

Isparta- Türkiye

[email protected]

Mosquitoes are important vectors that carry disease agents such as malaria, dengue, chikungunya, filariasis, Japanese encephalitis and

zika. They are important vectors which cause to epidemics. So, they cause to both economic damages and health problems. That‘s

why different control methods have been applied but a complete success has not been achieved. The importance of mosquito control

has been increased, because of cannot be developed an effective vaccine against the mosquito borne diseases. Even if the vaccine is

developed, alternative control methods will be needed. Chemical control has a huge disadvantage because of insecticide resistance.

For this reason, genetic based control methods need to be improved and applied. These methods are divided into two main strategies

as Population Suppression and Population Replacement. The methods for Population Suppression are self-sustaining applications

[HEG (Homing Endonuclease Gene) I-Ppol and fsRIDL (Female-specific flightless RIDL)] and self-limiting applications [SIT

(Sterile Insect Technique), RIDL (Release of Insect with Dominant Lethality) and exogenous dsRNA treatment]. The methods for

population replacement are Refractory Insect, HEGs, ZFN ( Zinc Finger Nuclease), TALENs (Transcription Activator-like Effector

Nucleases), promising CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats/Associated Protein-9 Nucleases)

and miRNA-based RNAi. In this review, we tried to collect the studies on successful laboratory and field experiments of genetic-

based control methods that can be applied and applied to the control of mosquito populations until today.

Keywords: Mosquitoe, genetic control, HEG, RIDL, ZFN, RNAi, CRISPR/Cas9




142

IDDGC17-PP-122

A COMPARATIVE STUDY FOR THE PERFORMANCES OF FEATURE SELECTION METHODS

IN ANALYZING OVARIAN CANCER

Mustafa Turan Arslan1, Derya Arslan

2

1Mustafa Kemal University, Kırıkhan Vocational School, Hatay, Turkey

2Iskenderun Technical University, Faculty of Engineering and Naturel Sciences, Hatay, Turkey


Aims and Scopes:

Advances in gene technology provides development on microarray technology in order to diagnose hereditary diseases such as cancer.

Owing to this technology, thousands of genes analyzes can be done. Microarray data have a high dimensional structure because of

these thousands of genes analyzes. In high-dimensional microarray data, there exist many genes that are not related to hereditary

diseases. However, the unrelated genes in microarray data might lead to misleading results in diagnosing diseases. Hence, in order to

correctly diagnose hereditary diseases, it is vital to remove abundant and irrelevant genes from the high-dimensional microarray

structure. In this study, Correlation-Based Feature Selection (CFS) and Support Vector Machine- Recursive Feature Elimination

(SVM-RFE) methods, which are among feature selection methods, are used in order to analyze ovarian cancer with high performance.

The Random Forest algorithm, which is a decision tree, is preferred to compare the performances of these feature selection methods.


Ovarian Cancer Gene Expression Data: Ovarian cancer dataset, provided by Petricoin and his friends [1] contains the expression

levels of 15154 genes and one class label. This dataset contains totally 253 samples collected from ovarian cancer patients. Among

them, it includes 91 controls (Normal) and 162 ovarian cancers.

Support Vector Machine- Recursive Feature Elimination: SVM-RFE achieves attribute selection by repetitively training a SVM

classifier with the existed set of attributes and removing the fewest attribute reported by SVM [2].

Correlation based Feature Selection: CFS selects subsets containing features that are intensely correlated with the class label and

have low correlation with each other [3].

Random Forest: Random Forest, a promising classification algorithm proposed by Breiman, is an ensemble of decision trees [4].


According to the obtained analysis results, accuracy rate of 94.86% is achieved in classifying the ovarian cancer microarray gene

expression profile via random forest algorithm, without applying the feature selection methods. On the same dataset, accuracy rate of

99.21% is achieved using the CFS feature selection method, and then accuracy rate of 99.60% is achieved by SVM-RFE method.

Keywords: Feature selection, classification, gene expression profile, ovarian cancer

References:

[1] Petricoin, E. F.; Ardekani, A. M.; Hitt, B. A.; Levine, P. J.; Fusaro, V. A.; Steinberg, S. M.; Liotta, L. A. The lancet, 2002, 359(9306), 572-577.

[2] Schölkopf, B.; Tsuda, K.; Vert, J. P. Kernel methods in computational biology, 2004.

[3] Hall, M. A.; Holmes, G. IEEE Transactions on Knowledge and Data engineering, 2003, 15(6), 1437-1447.

[4] Breiman, L. Machine learning, 2001, 45(1), 5-32.






143

IDDGC17-PP-123

DNA BARCODING IN FOOD INDUSTRY

Remziye YILMAZ1, Mithat KURBAN2,

1Assoc.Prof.Dr. Remziye YILMAZ,Hacettepe University Food Engineering Departmant, Turkey, [email protected] 2PhD Student Mithat KURBAN, Hacettepe University Food Engineering Departmant,Turkey, [email protected]

Detection, identification and classification of food components and yeasts have undergone major changes in the last decade and a half following

application of gene sequence analyses and genome comparisons. Development of barcoding of easily determined DNA sequences of the nuclear

large subunit rRNA gene and ITS to identify food components and species quickly and accurately. This new approach of components and species

relationships has prompted a change of rules for naming and classifying yeasts and sources of food. The use of molecular methods for food sources

and species identification the impact of barcode changes on classification searched, especially in the context of food components and yeasts. In this

research we tried to put a barcode structure research for S. cerevisiae for this purpose. All the pre-experiments show us it can be used for this

purpose. As we see from the results we need more strain number and more strongest algorithms for more effective discrimination.

Aims and Scopes: As known microorganisms that find widespread using in food and other biotechnological fields. The main objective of this

research is to obtain Saccharomyces cerevisiae yeast strains from different sources and reveal DNA barcodes at the strain level effectively. Yeast

strains isolated and collected are pre-defined by classical methods. For comparison with standard controls the known yeast strains used. Universal

primer regions used for barcode structures that were investigated and revealed. If we can get enough successful results the next step aim is forming a

national culture collection and open source database for use of interested like researchers and producers.

Materials and Methods: Yeast isolations are provided from domestic and international yeast producers and from research laboratories of national

universities. Some original species isolated from different sources. For control uses S.cerevisiae strains will be provided from national and

international culture collection establishments. All the S.cerevisiae strains isolated and provided are identified by morphological and biochemical

tests[1][2][3]. After classic strain identification DNA extraction performed from the S. cerevisiae strains [4].The products obtained sequenced by

Sanger sequencing method[5][6][7]. Reference yeast strains and data for sequences of isolated and identified yeast strains will be processed further

analysis for comparative data analysis and databank formation [8]. The strains obtained are stocked under appropriate conditions.

Results and Discussion: In order to create DNA barcodes structures first of all morphological and biochemical identifications done on this two

strain which will be used. One of the strain gained from national culture collection, two of them gained from international culture collection, two of

them gained from commercial producers. Pre-research is done on two of this commercial strains.

Two strains of the commercial S. cerevisiae were used for the sequence comparison. After DNA extraction, Sanger Sequencing with the primers of

ITS1 and ITS4 we get the results of convergence and divergence. As we put the sequence data on NCBI Blast we get the result of strain included in

S. cerevisiae species. By individual sequence comparison we got the result of genetic convergence 0,714 and genetic divergence as 0,286 over the

total value one.The obtained pure cultures were stored at -80 ° C in 50% glycerol or under refrigeration condition at 4 °C on a YGC slant agar

medium.Morphological and biochemical identifications takes more time for yeast S. cerevisiae and they are not efficient enough or need more

professional persons to correct identification. As we see from the results we need more S.cerevisiae strain isolation for barcode structure comparison

and formation. Also there must be strong algorithmic approaches for more effective discrimination of species from strain level.

Acknowledge: We would like to express our special thanks of gratitude to undergraduate students Elif KOCATÜRK, and Burcu YURT ÇİTİL for

their effort and also for Humen Gebbari and UN Software Consulting. And Lab. Fog. Ltd. because of their technical support to our project.

Keywords: DNA barcoding, yeast Saccharomyces cerevisiae, food barcoding

References:

[1] Anonim, http://e-cografya.org/index.php/cografya/duenya-cografyas/uelkeler-cografyas/505-libya.,(March 2017)

[2] Temiz Ayhan.,Genel Mikrobiyoloji Uygulama Teknikleri, Hatipoğlu Yayınevi,ISBN 9789757527769,baskı 6, 2016

[3] Anonim., http://www.biomerieux-diagnostics.com/sites/clinic/files/9308960-002-gb-b-apiweb-booklet.pdf, (March 2017).

[4] Guillamón, José Manuel, et al. "Rapid identification of wine yeast species based on RFLP analysis of the ribosomal internal transcribed spacer

(ITS) region." Archives of Microbiology 169.5 387-392,1998.

[5] Stielow, J. B., C. A. Levesque, K. A. Seifert, W. Meyer, L. Iriny, D. Smits, R. Renfurm, et al. "One Fungus, Which Genes? Development and

Assessment of Universal Primers for Potential Secondary Fungal DNA Barcodes." [In eng]. Persoonia 35: 242-63, (Dec 2015).

[6] Paterson, A. H., J. E. Bowers, and B. A. Chapman. "Ancient polyploidization predating divergence of the cereals, and its consequences for

comparative genomics." Proceedings of the National Academy of Sciences of the United States of America 101.26, 9903-9908, 2004.

[7] Wilkins, Marc R., et al. "Guidelines for the next 10 years of proteomics." Proteomics 6.1 4-8,2006.

[8] Healy, Matthew D. "Using BLAST for performing sequence alignment." Current Protocols in Human Genetics 6-8, (2007).




144

IDDGC17-PP-124

DNA Barcoding in Plants

Elif CoĢkun Dağgeçen

1 & Selin Ceren Balsak

2

1 Kahramanmaras Sutcu Imam University, Agricultural Biotechnology Department, Turkey

2 Kahramanmaras Sutcu Imam University, Plant Protection Department, Turkey

Corresponding Author: [email protected]

"DNA barcode" is a DNA sequence based system that allows identification of species using one or more loci. It requires

standard region of DNA to be sequenced for the identification of species [1]. DNA barcodes (DNA taxonomy), determination of

biological diversity and species based on the use of standard DNA region it is emerging as a new and useful method [2]. For many

years biologists have been using a wide range of DNA fingerprinting techniques such as plastid and nuclear microsatellites, random

amplified polymorphic DNA, amplified fragment length polymorphisms and DNA sequencing tools in the study of population

analyses [3], hybridization [4]and evolutionary relationship [5].In the animal kingdom, mitochondrial cytochrome c oxidase is widely

used as a universal barcode. The COI barcode is not effective for identifying plants because it evolves too slowly. Today, different

plant work groups from the Life Barcode Consortium (CBOL) are testing different barcode region candidates in the nucleus and

plastid genome. Most of these tested regions are plastid genomic regions, e.g., matK, rbcL, rpoB, rpoC1 from the encoding regions,

the aTP-aTPH, trnH-psbA and psbK-psbI regions from non-coding regions. Especially, two gene regions in the chloroplast, matK and

rbcL, have been approved as the barcode regions for land plants. However, the Transcribed Internal Regions (ITS1 and ITS2) from

the core gene regions are widely used. It is expected that an ideal barcode region can be obtained with a single universal primer pair,

bi-directionally sequenced and maximum sorting power at maximum level.

Key Words: DNA barcode, plant, genome

References

[1]Hebert, P. D. N., Cywinska, A., Ball, S. L. & De Waard, J.R. 2003a. Biological identifications through DNA barcodes. Phil. Trans. Roy. Soc.,

Ser. B. 270: 313–321.

[2]Hebert, P. D. N., Ratnasingham, S. & De Waard, J. R.2003b. Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely

related species. Phil.Trans. Roy. Soc., Ser. B. 270: S96–S99.

[3]Fay, M. F. & Krauss, S. L. 2003. Orchid conservation genetics in the molecular age. Pp. 91–112 in: Dixon, K. W., Kell, S. P., Barrett, R. L. &

Cribb, P. J. (eds.), Orchid Conservation. Natural History Publications, Kota Kinabalu, Sabah.

[4]Clarkson, J. J., Knapp, S., Garcia, V. F., Olmstead, R. G., Leitch, A. R. & Chase, M. W. 2004 Phylogenetic relationships in Nicotiana based

on multiple plastid loci. Molec. Phylog. Evol. 33: 75–90.

[5]Savolainen, V. & Chase, M. W. 2003. A decade of progress in plant molecular phylogenetics. Trends Genet. 19: 717–724.





145

IDDGC17-PP-125

UNDERSTANDING MOLECULAR PHYLOGENY OF NINE ORCHIS L. SPECIES NATIVE TO

TURKEY USING NUCLEAR DNA SEQUENCE

Ayten Dizkiric1 Tekpınar

1, Sinan Isler

2, Oktay Yigit

1,

1 Department of Molecular Biology and Genetics, Yuzuncu Yil University, 65080, Van, Turkey

2 Faculty of Education, Science and Mathematics Education Department, Yuzuncu Yil University, Van, Turkey

[email protected]

Aims and Scopes:

Phylogenetic relationships among nine Turkish Orchis species were inferred using Internal Transcribed Spacer region of nuclear

ribosomal DNA (ITS nrDNA). Main objectives of the current study were (i) to shed further light on the systematics and evolutionary

structure of nine Orchis species living in Van-Turkey using sequence diversity of the ITS region (ii) to figure out phylogenetic

relationships among different subgenera, sections and subsections including native and foreign Orchis taxa.


Genomic DNA was extracted by using the cetyltrimethylammonium bromide (CTAB) method [1]. ITS nrDNA region was amplified

by using ITSL and ITS4 primer pair [2]. Phylogenetic tree was constructed based on nucleotide variations via the maximum

likelihood method (MEGA 5.0; [3]). Total nucleotide length, GC content, number of deletion/insertion (indel), variable sites were also

calculated by MEGA software.


213 polymorphic sites with 191 parsimony informative were detected in 657 bp aligned sequence. In the constructed phylogenetic

tree, the first major clade included species from Orchis and Neotinea subgenera and the second one included species of Anacamptis

subgenus. All species in Orchis subgenus except O. collina grouped in the first major clade. Phylogenetic separation of O. collina

from the other species of the same subgenus was also indicated by Haider and his colleagues [4]. They proved distant position of O.

collina and moved this species into the genus Anacamptis. This result was also proved by the current study. Species of Neotinea

subgenus (O. tridentata, and O. ustulata) grouped together and located more closely to the Orchis clade. This position proved that

Neotinea subgenus is phylogenetically closer to the Orchis subgenus according to the Anacamptis. Aceto et al [5] showed close

relationships among O. tridentata, O. ustulata and Neotinea maculata. All these results were considered, moving of O. tridentata, and

O. ustulata species to the genus Neotinea is seen meaningful. O. coriophora, O. palustris, O. pseudolaxiflora, O. collina were

separated from species of Orchis and Neotinea subgenera. Their separation is not unexpected since they were claimed to be species of

Anacamptis genus by Bateman et al [6]. Moving of these species into the Anacamptis genus is also considered in the light of these

results

Keywords: Anacamptis , Neotinea, ITS, Orchis, phylogeny

References:

[1] Doyle, J.J., and Doyle, J.L.. Phytochemical Bulletin, 1987, 19: 11-15.

[2] Hsiao, C., Chatterton, N.J., Asay, K.H. and Jensen, K.B. Genome, 1995, 38: 221-223.

[3] Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and Kumar, S. Molecular Biology and Evolution, 2011, 28: 2731-2739.

[4] Haider, N., Nabulsi, I. and Kamary, Y. Journal of Plant Biology Research, 2012, 1(2): 36-50.

[5] Aceto, S., Caputo, P., Cozzolino, S., Gaudio, L. and Moretti, A. Molecular Phylogenetics and Evolution, 1999, 13: 67–76.

[6] Bateman, R.M., Hollingsworth, P.M., Preston, J., Luo, Y.B., Pridgeon, A.M. and Chase M.W. Botanical Journal of the Linnean Society, 2003,

142: 1-40.

Acknowledgements: This study was financially supported by Yuzuncu Yil University (Scientific Research Projects Foundation, 2015-

FEN-B170), Van, Turkey.





146

IDDGC17-PP-126

RECOMBINANT EXPRESSION OF HUMAN TELOMERASE INHIBITOR 1 (PINX1) IN Pichia

pastoris

Melike Yildiz1, Yagmur Unver

1, Deryanur Kilic

2, 3, Mesut Taskin

1, Abdulhadi Firat

1, Hakan Askin

1

1Ataturk University, Science Faculty, Molecular Biology and Genetic Department, Turkey

2Ataturk University, Science Faculty, Chemistry Department, Turkey

3Aksaray University, Science and Art Faculty, Chemistry Department, Turkey

[email protected]

Aims and Scopes: Human telomerase is a ribonucleoprotein enzyme complex in the core of telomere that provides a telomere

persistence mechanism for a great majority (~90%) of cancers by adding 5'-TTAGGG-3' repeats onto the ends of human

chromosomes [1]. Telomerase expression is reactivated in a great majority (85%) of human cancer cells while it is repressed in many

normal cells [2,3]. PinX1 which is known telomerase inhibitor is encoded by a remarkable tumor suppressor gene [4]. Therefore, this

protein has attracted attention as clinically tumor suppressor in recent years. The aim of this work was cloning and expression of

hPinX1 in P. pastoris.

Materials and Methods: In the present study, human PinX1 gene (hPinX1) from human liver cDNA library was cloned using

pPICZαA vector in chemically competent E. coli One Shot® TOP10 strain and expressed in P. pastoris strain X-33. The recombinant

cells were grown in shaking flask to produce hPinX1. The cells in BMMY medium were incubated by methanol induction at 30 °C

for 48 h at 280-rpm shaker. The cells were harvested and disrupted by acid-washed glass beads. The resulting protein expression in

lysate was confirmed by western blot analysis.

Results and Discussion: Recombinant plasmid DNA sequencing analysis showed 99 % homology with Homo sapiens PIN2 / TER1

interacting telomerase inhibitor 1 (PINX1) transcript variant 1 mRNA. Molecular mass of hPinX1 produced by the recombinant P.

pastoris strain was 47.5 kDa according to Western blot analysis. This is the first study in which hPinX1 was expressed in P. pastoris.

In subsequent studies, optimization of culture conditions and protein purification can be carried out. Because the development of

PINX-based cancer diagnosis and the investigation of different functions may lead to cancer therapy studies. This purified

recombinant protein can be tested on various cancer cells as tumor suppressor.

Figure 1: Western blot analysis of recombinant protein

Keywords: Pichia pastoris X-33, hPinX1, recombinant protein, western blot analysis

References:

[1] Cohen, S. B., Graham, M. E., Lovrecz, G. O., Bache, N., Robinson, P. J., Reddel, R. R. Science 2007, 315, 1850-1853.

[2] Kim, N. W., Piatyszek, M. A., Prowse, K. R., Harley, C.B., West, M. D., Ho, P. L., Coviello, G. M., Wright, W. E., Weinrich, S. L., Shay, J. W.

Science 1994, 266, 2011–2015.

[3] Broccoli, D., Young, J. W., de Lange, T. Proc Natl Acad Sci U S A 1995, 92, 9082-9086.

[4] Johnson, F. B. J Clin Invest 2011, 121, 1242–1244.




147

IDDGC17-PP-127

CLONING AND EXPRESSION OF HUMAN α-AMYLASE GENE

Deryanur Kilic1,2

, Melike Yildiz3, Yagmur Unver

3, Orhan Erdogan

3, Hakan Askın

3, Omer Irfan Kufrevioglu

1

1Ataturk University, Science Faculty, Chemistry Department, Turkey,

2Aksaray University, Science and Art Faculty, Chemistry Department, Turkey,

3Ataturk University, Science Faculty, Molecular Biology and Genetics Department, Turkey,

[email protected] Aims and Scopes: In the human diet, the first stage digestion of starch taken from many basic foods takes place by saliva and

pancreatic α-amylases. α-amylase, endoglycosidase (EC 3.2.1.1), produces maltose and glucose from starches by hydrolyzing α-(1,4)-

glycosidic bonds. Therefore, inhibitors of this enzyme slow glucose release, delay glucose uptake, and reduce postprandial blood

sugar levels [1,2]. The purpose of our study is to clone and express human α-amylase gene using SUMO Expression System.

Materials and Methods: Human α-amylase gene was firstly expressed using Champion pET SUMO Expression System. Ligation of

the gene and pET SUMO vector was carried out for 16 h at 16 °C. Ligation product was transformed to E. coli One Shot® Mach1™-

T1R strain. Recombinant plasmid confirmed by colony PCR was isolated and transferred to E. coli BL21(DE3) strain via heat shock.

Human α-amylase was expressed in E. coli by IPTG induction. The cells were harvested and broken up with freeze-thaw. Activity of

α-amylase in lysate was determined according to Miller‘s method [3].

Results and Discussion: α-amylase gene in recombinant plasmid was confirmed by DNA sequencing. SDS-PAGE analyses showed

that the molecular mass of α-amylase was 75.85 kDa. Activity of α-amylase in lysate was determined as 0.104 EU/ml. As a result, the

expression of the α-amylase enzyme was observed in the experimental group induced by IPTG. However, due to the presence of

inclusion bodies, it was observed that the majority of the expressed protein was in pellets. In this case, it is necessary to carry out the

denaturation process to obtain the protein in the pellet. The next objective of our study is to purify the α-amylase and obtain it in

excess quantities under denature conditions. Then effects of some inhibitory on purified α-amylase will be investigated.

Keywords: α-amylase, recombinant protein, SUMO Expression System

Acknowledgements: This study was financed by Ataturk University Scientific Research Council (Project No: Erzurum BAP-

2015/110).

References:

[1] Sun, H., Wang, D., Song, X., Zhang, Y., Ding, W., Peng, X., Zhang, X., Li, Y., Ma, Y., Wang, R., Yu, P. J Agric Food Chem 2017, 65,

1574−1581.

[2] Kim, K. T., Rioux, L. E., Turgeon, S. L. Phytochemistry 2014, 98, 27−33.

[3] Miller, C.L. Anal Chem 1959, 31, 426-428.





148

IDDGC17-PP-128

ANTICANCEROGENIC EFFECTS OF HYDROXYTYROSOL, A PHENOLIC IN OLIVE MILL WASTE

WATER

Seda Orenay Boyacioglu1, Merve Ercan

2, Olcay Boyacioglu

3

1Adnan Menderes University, Faculty of Medicine, Department of Medical Genetics, AYDIN

2Adnan Menderes University, Faculty of Agriculture, Department of Agricultural Biotechnology, AYDIN

3Adnan Menderes University, Faculty of Engineering, Department of Food Engineering, AYDIN

[email protected], [email protected],[email protected]

Abstract

Aims and Scopes:It is known that olive mill waste water (OMWW) contains more than 30 different phenolic compounds. These

compounds are generally grouped as phenolic acids (Hydroxytyrosol, 3,4-Dihydroxyphenyl acetic acid, p-Dihydroxyphenyl acetic

acid, kaffeic acid, p-coumaric acid, ferulic acid), phenolic alcohols, flavonoids, sekoiridoids and lignans 1. The main component of

OMWW is hydroxytyrosol. The antibacterial, antiviral, and antifungal effects of phenolic compounds found in the OMWW and olive

leaf have been demonstrated by the in vitro studies 2,3.Although the anti-carcinogenic effects of hydroxytyrosol were detected in

breast, and heptocellular carcinomas, the effects on prostate cancer are not well known. 4,5. In this study, hydroxytyrosol, an

OMWW compound with cytotoxic effect, is aimed to be investigated for its cytotoxic effects of prostate cancer cell line.

Material-Methods:.Human prostate cancer cell line PC3 was maintained in RPMI 1640 media supplemented with 10% fetal bovine

serum (FBS) at 37°C under the presence of 5% CO2 in a humidified incubator. PC3 cells were seeded at a density of 3000 cells/well

in a 96 well plate. Cells were treated with filter sterilized hydroxytyrosol dissolved in deionized water for 24, 48, and 72 h. Cell

viability after the hydroxytyrosol treatment was measured via the reduction of 3-(4,5-dimethythiazol2-yl)-2,5-diphenyl tetrazolium

bromide (MTT) colorimetric assay.

Results and Discussion: Results show that hydroxytyrosol has antiproliferative effect on PC3 cell line in a dose and time dependent

manner. Hydroxytyrosol at 50 ug/ml concentration is able to kill the entire PC3 population in 72 h. In this study, we investigated the

cytotoxic effect of Hydroxytyrosol, the major phenolic compound of olive pitch in the human prostate cancer cell line. Although the

anticancerogenic effects of hydroxytyrosol on breast and heptocellular carcinomas are detected, its effects on prostate cancer are not

well known. Although the anticancerogenic effects of hydroxytyrosol on colon, breast, and heptocellular carcinomas are detected, its

effects on prostate cancer are not well known. By treating the PC3 and DU145 human prostate cancer cell lines and non-malignant

prostate epithelial cells as control with hydroxythyrosol, Luo et al. suggested that hydroxythyrosol may have anti-carcinogenic effects

by increasing both apoptosis activity and superoxide production 4. With the results of hydroxytyrosol treatment on cell lines of

peripheral blood mononuclear cells (PBMC), breast (MDA and MCF-7), prostate (LNCaP and PC3), and colon (SW480 and

HCT116) cancer, Rosignoli et al. have come to the conclusion that hydroxytirosol abolished the H2O2-induced oxidative DNA

damage and thus may be an inhibitory chemical agent in the onset and progression stages of cancer 5. Fabiani et al. investigated to

elucidate the role played by H2O2 in chemopreventive activities of hydroxytyrosol on breast (MDA and MCF-7), prostate (LNCaP and

PC3), and colon (SW480 and HCT116) cancer cell lines. It has been determined that the H2O2-inducing ability of hydroxytyrosol is

completely inhibited by pyruvate and that exposure of cells to conditions that do not support the accumulation of H2O2 (addition of

catalase or pyruvate to culture medium) inhibits the antiproliferative effect of hydroxytyrosol 6. In our results, the cytotoxic effects

of Hydroxytyrosol on PC3 cells were also determined consistent with the literature.

Keywords: Olive mill waste water, hydroxytyrosol, prostate cancer, anticancerogenic effects

References

1.Artajo LS, Romero MP, Morelloä JR, Motilva MJ. Enrichment of refined olive oil with phenolic compounds:evaluation of their

antioxidant activity and their effect on the bitter index. J Agric Food Chem 2006; s.6079-6088.

2.Capasso R, Evidente A, Schivo L, Orru G, Marcialis MA, Cristinzio G. Antibacterial polyphenols from olive oil mill wastewaters.

J Appl Bacteriol 1995; s. 393-398.

3. Sousa A, Ferreira R, Calhelha R, Andrade PB, Valentão P, Seabra R. Phenolics and antimicrobial activity of traditional stoned

table olives ―alcaparra‖.Bioorg Med Chem 2006; s. 8533-8538.

4. Luo C, Li Y, Wang H, Cui Y, Feng Z, Li H, Li Y, Wang Y, Wurtz K, Weber P, Long J, Liu J. Hydroxytyrosol promotes

superoxide production and defects in autophagy leading to anti-proliferation and apoptosis on human prostate cancer cells. Curr

Cancer Drug Targets.2013;s.625-39.

5. Rosignoli P, Fuccelli R, Sepporta MV, Fabiani R. In vitro chemo-preventive activities of hydroxytyrosol: the main phenolic

compound present in extra-virgin olive oil. Food Funct. 2016; s.301-307.

6. Fabiani R, Sepporta MV, Rosignoli P, De Bartolomeo A, Crescimanno M, Morozzi G.Anti-proliferative and pro-apoptotic

activities of hydroxytyrosol on different tumour cells: the role of extracellular production of hydrogen peroxide. Eur J Nutr 2012;

s.455-64.










http://www.ncbi.nlm.nih.gov/pubmed/?term=Feng%20Z%5BAuthor%5D&cauthor=true&cauthor_uid=23597197

















































149

IDDGC17-PP-129

DETERMINATION OF ANTIMICROBIAL RESISTANCE PATTERNS OF MULTI- DRUG

RESĠSTANT Escherichia coli ISOLATES

Ali Sevim1, Elif Sevim


2, Neslihan ġahin

2, Fikriye Milletli Sezgin

3




Cooresponding author: [email protected]

Aims and Scopes: Although Escherichia coli isolates are present in normal human fecal flora, some strains of this bacterium can

cause gastroenteritis and food born diseases. In addition, E. coli isolates are the causative agents of the blood-stream infection, lower

respiratory tract infection, wound and abscess infection. Most importantly, E. coli is the most common cause of urinary tract

infections. The most common mechanism of resistance to beta-lactam antibiotics in E. coli is beta-lactamase production. Extended

spectrum beta lactamases (ESBL) produced by E. coli has emerged worldwide as a significant cause of community and healthcare-

associated infections. The goal of the present study was to screen the antibiotic resistance genes in 151 multidrug resistance E. coli

isolates obtained from clinical samples in Kırşehir, Turkey.

Materials and Methods: Multi-drug resistance E. coli isolates were isolated from clinical samples at Ahi Evran University Hospital

of Kırşehir between 2014 and 2015. The genomic DNA of E. coli isolates was obtained using the boiling lysis procedure [1]. The

presence of CTX-M1, CTX-M2, TEM and SHV genes in E. coli isolates were investigated by PCR using primers given in Table 1.

The plasmid isolation of E. coli isolates was performed using Plasmid DNA Isolation Kit (Thermo Scientific). The conjugation

method was used to determine the existence of transferable plasmids carrying resistance gene. The CTX-M1, CTX-M2, TEM and

SHV genes were explored by PCR in plasmids that were isolated from transconjugants.

Table 1. Primers used in this study.

Primers Sequences (5‗-3‗) Amplicon size

(bp) Reference

TEM Fw: AGTATTCAACATTTYCGTGT

Rw: TAATCAGTGAGGCACCTATCTC 847 [2]

SHV Fw: ATGCGTTATATTCGCCTGTG

Rw: TTAGCGTTGCCAGTGCTC 843 [3]

CTX-M1 Fw: GCGTGATACCACTTCACCTC

Rw: TGAAGTAAGTGACCAGAATC 260 [2]

CTX-M2 Fw: TGATACCACCACGCCGCTC

Rw: TATTGCATCAGAAACCGTGGG 341 [2]

Results and Discussion: Among 151 multi-drug resistance E. coli strains, 141 (93.37%) were positive for CTX-M1 group enzymes,

78 (51.65%) were positive for CTX-M2 group enzymes, whereas 2 (1.31%) produced SHV and 113 (74.83%) produced TEM-type

beta-lactamase. The results of the conjugation experiment showed that 38 isolates (24.16%) contained conjugative plasmids and these

conjugative plasmids carried resistance genes. In conclusion, the presence of CTX-M1, CTX-M2, TEM and SHV beta-lactamases

genes is significantly connected with the resistance to penicillins, broad- and extended-spectrum cephalosporins and aztreonam

among ESBL-producing E.coli strains isolated from clinical samples in Kırşehir. It was observed that CTX-M1 enzymes are the most

prevalent ESBLs, followed by TEM, CTX-M2 and SHV.

Keywords: Multi drug resistance, resistance gene (TEM, SHV, CTX-M1, CTX-M2), E. coli, clinical samples

References: [1] Copur Cicek, A.; Ozgumus, O.B.; Saral, A.; Sandallı, C. Annals of Laboratory Medicine 2014, 34, 139-144.

[2] Iraz, M.; Özad-Düzgün, A.; Sandallı, C.; Doymaz, M.Z.; Akkoyunlu, Y.; Saral, A.; Peleg, A.Y.; Özgümüş, O.B.; Beriş, F.Ş.; Karaoğlu, H.; Çopur-Çicek, A.

Annals of Laboratory Medicine 2015, 35, 595-601.

[3] Hanson, N.D.; Moland, E.S.; Hossain, A.; Neville, S.A.; Gosbell, I.B.; Thomson, K.S. Journal of Antimicrobial Chemotherapy 2002, 49, 1011-1014.




150

IDDGC17-PP-130

ANTIFUNGAL ACTIVITY OF Viburnum opulus L. (GILABURU) FRUIT EXTRACTS AGAINST

Candida STRAINS ISOLATED FROM URINE SAMPLES

Fikriye Milletli Sezgin1, Ali Sevim


3, Neslihan ġahin

3, Buket Özdemir

4, Elif Sevim

2




4 Ahi Evran University, Faculty of Science and Arts, Department of Chemistry, KırĢehir


Aims and Scopes: The purpose of the present study was to evaluate the antifungal activity of ethanol, methanol, ethyl acetate,

chloroform and acetone extracts of Viburnum opulus L. (Gilaburu) fruits against 45 Candida strains isolated from urine samples.

Materials and Methods: Forty-five Candida strains were isolated from urine specimens that were sent to The Ahi Evran University

Training and Research Hospital, Microbiology Laboratory. Viburnum opulus L. (Gilaburu) fruits were collected from Kayseri

province and their extracts were prepared using ethyl acetate, ethanol, methanol, acetone, chloroform and aqueous as solvent. The

antifungal activities of the extracts were determined by the agar-well diffusion method [1]. Minimal inhibitory concentrations (MIC)

of extracts that were detected to be effective by the agar well diffusion method were evaluated by broth microdilution method [2].

Results and Discussion: Among 45 Candida strains isolated from urine specimens, 23 were identified as C. albicans and 22 as non-

albicans. In this study, it was determined that ethyl acetate and methanol extracts were effective against 29 Candida strains while

ethanol extracts were effective against 35 Candida strains. It was also found that the aqueous extract inhibited only 5 Candida strains.

The MIC values of ethyl acetate, ethanol and methanol extracts were found to be ranging from 500 μg / ml to 1500 μg / ml.

As a result of the study, it was determined that ethanol, methanol and ethyl acetate extracts of Viburnum opulus L. had quite

good antifungal activity against Candida strains caused urinary tract infection. In conclusion, fermented products of Viburnum opulus

L. may be offered as an alternative to antifungal drugs as a natural preservative for people with suspected or potentially high urinary

tract infections.

Keywords: Viburnum opulus L., Candida albicans, non-albicans, antifungal activity


Number: MMF.A4.17.001.

References:

[1] Magaldi S., Mata-essayaga S., Hartung de Caprilesa C., Perez C., Colella M.T., Olaizola C., Ontiveros Y. International Journal of Infectious

Diseases 2004, 8, 39-45.

[2] Balouiri M., Sadiki M., Ibnsouda S.K. Journal of Pharmaceutical Analysis 2016, 6, 71-79.




151

IDDGC17-PP-131

MICROBIAL COMPOSITION OF RAW MILK AS DETECTED BY CULTURE-DEPENDENT AND

CULTURE-INDEPENDENT METHODS

Sevcihan TaĢ1, Emel Banu Büyükünal

1

1KahramanmaraĢ Sütçü Ġmam University, Faculty of Science and Letters, Department of Biology, Turkey

Aims and Scopes:

Raw milk contains a complex microbial community containing microorganisms from different taxonomical groups. Source of

microorganisms in raw milk can be various including the teat apex, milking equipment, air, water, feed, grass, soil and other

environments [1]. Microorganisms in raw milk can have various roles, such as carrying out fermentations (e.g. Lactococcus,

Lactobacillus, Streptococcus, Propionibacterium and fungal populations), producing spoilage (e.g. Pseudomonas, Clostridium,

Bacillus and other spore-forming or thermoduric microorganisms), supporting health (e.g. lactobacilli and bifidobacteria) or causing

disease (e.g. Listeria, Salmonella, Escherichia coli, Campylobacter and mycotoxin-producing fungi). Precise detection of community

members related to different roles is required.


Most of the knowledge on the identification of the microorganisms that are present in raw milk and dairy products has been acquired

through the culturing-based method. These methods basically depend on the growth of microorganisms in microbiological media and

consecutive morphological, biochemical or physiological characterization [2]. Our knowledge on raw milk microbiome members

enlarged with the application of culture-independent methods, since culture-independent methods relied on analyzing of whole

community without culturing step. This review presents the recent outcomes on microbial composition of different milk types

obtained by culture-dependent, culture-independent or next-generation DNA sequencing (NGS)-based technologies [3].


Next-generation DNA sequencing technologies generate millions of sequence reads in a single run. Therefore, these approaches can

provide a detailed insight into the bacterial composition of milk. In addition, it is likely that these technologies will be used

increasingly in future to investigate the factors that influence the composition of raw milk.

Keywords: raw milk, next-generation DNA sequencing (NGS)

References:

[1] Coorevits, A.; De Jonghe, V.; Vandroemme, J.; Reekmans, R.; Heyrman, J.; Messens, W.; De Vos, P.; Heyndrickx, M. Systematic and Applied

Microbiology 2008, 31, 126-140.

[2] Quigley, L.; O‘Sullivan, O.; Beresford, T. P.; Ross, R. P.; Fitzgerald, G. F.; Cotter P. D. International Journal of Food Microbiology 2011, 150,

81-94.

[3] Quigley, L.; O‘Sullivan, O.; Stanton, C.; Beresford, T. P.; Ross, R. P.; Fitzgerald, G. F.; Cotter, P. D. FEMS Microbiology Reviews 2013, 37,

664-698.




152

IDDGC17-PP-132

AN EFFECTIVE OXIDATIVE DNA DAMAGE INDICATOR; 8-HYDROXY-2'-DEOXYGUANOSINE

Güngör ÇağdaĢ DĠNÇEL1, Orhan YAVUZ

2, Oğuz KUL

3

1Aksaray University, Eskil Vocational School, Laboratory and Veterinary Science, Aksaray, TURKEY contact:

[email protected] 2Aksaray University, Faculty of Veterinary Medicine, Department of Pathology, Aksaray, TURKEY contact: contact:

[email protected] 3Kırıkkale University, Faculty of Veterinary Medicine, Department of Pathology, Kırıkkale, TURKEY

contact: [email protected]

In organism, the free radicals formed and the antioxidant defense system are in equilibrium. However, when free radicals can not be

cleared sufficiently from the organism, oxidative stress exits. Oxidative stress plays an important role in the pathogenesis of many

diseases such as cardiovascular, neurological diseases and diabetes, especially carcinogenesis. Among the DNA base mutations, 8-

hydroxy-2'-deoxyguanosine (8-OHDG) is the most known and is a sensitive indicator of oxidative DNA damage. This product is a

mutation that occurs in DNA by endogenous or exogenous origin of reactive oxygen or nitrogen radicals produced during normal

oxidative metabolism. As a result of the oxidative damage of the altered DNA results in 8-OHDG. The 8-OHdG measurement is

accepted as a direct indicator of oxidative damage in DNA and is the most commonly used method for determining oxidative DNA

damage. Particularly reactive species are those formed by hydroxyl radicals and extreme care should be taken to DNA oxidative

damage. DNA damage caused by oxidative stress and oxydative stress is an issue that maintains its update as it is associated with the

pathogenesis of many diseases. Therefore, it needs to focus on and more work should be done.

Keywords: 8-hydroxy-2'-deoxyguanosine, DNA, carcinogenesis, pathogenesis







153

IDDGC17-PP-133

NOVEL PERFORIN MUTATIONS IN FAMILIAL HEMOPHAGOCYTIC

LYMPHOHISTIOCYTOSIS (FHL)

Ayshan R. YASSIN1,2

, Kaifee ARMAN1, Zekiye ALTAN

1, Yunus ġAHIN

1, Ahmet ARSLAN

1

1Faculty of Medicine, Department of Medical Biology, University of Gaziantep, Gaziantep, Turkey

2Faculty of Medicine, Medical Department, Salahadin University, Erbil, Irak

Contact email: [email protected]

Aims and Scopes: Familial Hemophagocytic Lymphohistiocytosis (FHL) is an autosomal recessive disorder caused by immune

dysregulation with hypercytokinemia (cytokine storm) which leads to a defective natural killer cell (NK) and cytotoxic T lymphocyte

(CTL) development [1]. This is severe and fatal syndrome because of uncontrolled activation and proliferation of T-lymphocytes. It is

known that mutations in perforin (PRF1, FHL 2) genes cause Familial Hemophagocytic Lymphohistiocytosis disease. Molecular

analysis plays an important role in the diagnosis of Familial Hemophagocytic Lymphohistiocytosis (FHL) disease. Perforin is

involved in one of the primary mechanisms of lymphocyte-mediated cytolysis .immune response of cytotoxic T cell or natural killer

(NK) cell against viruses and pathogenic agents are initiated by the secretion of cytolytic granules including perforin and granzyme B

on to the target membrane of the infected cells. The defect in this mechanism caused by perforin mutation leads to the symptom of

familial hemophagocytic lymphohistiocytosis type 2. Detection of perforin mutations is of great importance in this respect.

Materials and Methods: In this study, blood samples were collected from 14 HLH patients in the University of Gaziantep, Sahinbey

Hospital, Department of Hematology. For this thesis study, approval was taken from Medical Ethics Committee of Gaziantep

University. In this study, 5 ml of blood samples were collected in order to get DNA samples from 14 HLH patients. DNA isolation

was done from blood. The amplification of perforin gene was done by PCR technique. For sequence analysis, purification of PCR

products with ExoSAP was done after ampification of exonic regions of perforin gene. Then the products were loaded in sequence

analyzer after sequence PCR.

Results and Discussion: Mutational and nucleotide sequence analysis of the exons revealed novel mutation in one patient. Insertion

of 7 nucleotide sequences (TACTGAC) was detected in the third exon of perforin gene. FHL is very progressive and highly fatal

disease [2,3,4]. However, if FHL diseases is diagnosed early, it can be treated with immunosuppressive chemotherapy and allogeneic

stem cell transplantation [2,3,4]. The mutations occur in the genes that encode PRF1, UNC13D and STXBP2 proteins cause the

familial FLH disease. Molecular analysis of patients with immune deficiency disorders is a powerful approach to understand the role

in the pathogenesis of FHL and in the immune system. In this study, mutational screening of exonic regions of perforin gene was

aimed. Perforin protein that is encoded by perforin gene is a pore forming, constitute a large part of cytolytic lymphocytes granules

and it acts an important role in the signalling pathway of cell death. In 20 % - 40 % of FHL patients, perforin gene mutation has been

identified. In this study, we found a novel insertion of 7 nucleotide sequences (TACTGAC) in the third exon of perforin gene.

Keywords: Familial hemophagocytic lymphohistiocytosis (FHL), Perforin, Mutational screening.

References:

[1] Stepp SE, Dufourcq-Lagelouse R et al. Science 1999, 286(5446):1957-9.

[2] Noriaki Y, Shinobu T et al. Cancer Sci 2015, 1455–1462.

[3] Fischer A, Cerf-Bensussan N et al. J Pediatr. 1986, 108(2):267-70.

[4] Ouachee-Chardin M, Elie C et al. Pediatrics. 2006, 117(4):e743-50.




154

IDDGC17-PP-134

MOLECULAR EPIDEMIOLOGY OF MYCOPLASMA SYNOVIAE INFECTION IN COMMERCIAL

LAYERS

Zeki Aras1, Zafer Sayın

2, Orhan Yavuz

3

1Department of Microbiology, Faculty of Veterinary Medicine, Aksaray University, Campus, 68100, Aksaray, Turkey.

[email protected] 2Department of Microbiology, Faculty of Veterinary Medicine, Selçuk University, Campus, 68100, Konya, Turkey.

3Department of Pathology, Faculty of Veterinary Medicine, Aksaray University, Campus, 68100, Aksaray, Turkey.

Aims and Scopes: Mycoplasma synoviae (M. synoviae) infection is a cause of great economic loss in commercial egg lays hens. The

aims of this study were to investigate the prevalence of M. synoviae and to compare the characteristics of M. synoviae infected and

free flocks of commercial layers.

Materials and Methods: A total of 400 tracheal swabs and 400 blood serum samples were collected from 20 different layer flocks.

Serological investigation was made by RSAT test [1]. RAPD method was used for the molecular typing of M. synoviae strains to

determine the source of infection [2]. M. synoviae was isolated from 89 tracheal swabs collected from 5 out of 20 flocks.

Results and Discussion: The genetic similarity between field strains ranged from 53% to 100% as determined by RAPD. All M.

synoviae strains separated into 2 main-clusters in UPGMA dendogram. These result revealed that the five infected flocks were

contaminated from 2 different sources. The egg production of positive flocks was statistically lower (P < 0.05) than that of the

pathogen free flocks. Infection was more frequent in multi-age farms and on sites with several houses. The mortality of infected

flocks was higher than uninfected flocks, but this difference was not statistically significant. The mean weight of eggs and the average

live weight of hens were similar in free and infected flocks. In conclusion, M. synoviae infection significantly decreased egg

production in layer hens and was more frequent in multiage farms.

Keywords: Mycoplasma synoviae, Layer, Epidemiology, RAPD.

References:

[1] Kleven, S.H., Ferguson-Noel, N. Diseases of Poultry. Blackwell publishing, 2008, pp. 846-851.

[2] Geary, S.J., Forsyth, M.H., Aboul Saoud, S.,Wang, G., Berg, D.E., Berg, C.M. Mol Cell Probes 1994, 8, 311-316.




155

IDDGC17-PP-135

ANTIMICROBIAL ACTIVITY OF Viburnum opulus L. FRUIT EXTRACTS AGAINST MULTIDRUG

RESISTANT URINARY TRACT INFECTION PATHOGENS

Elif Sevim1, Fikriye Milletli Sezgin

2, Neslihan ġahin


3, Buket Özdemir

4, Ali Sevim

1

1 Ahi Evran University, Faculty of Engineering, Department of Genetic and Bioengineering, KırĢehir



4 Ahi Evran University, Faculty of Science and Arts, Department of Chemistry, KırĢehir


Aims and Scopes: The purpose of the present study was to evaluate the antibacterial activity of ethanol, methanol, ethyl acetate,

chloroform and acetone extracts of Viburnum opulus L. (Gilaburu) fruits against multidrug resistant 124 Enterobacteriaceae strains

isolated from urine samples.

Materials and Methods: A total of 124 Enterobacteriaceae strains were tested in this study. The strains were isolated from patients

with Urinary Tract Infections (UTIs) from Ahi Evran University Training and Research Hospital. UTIs in patients were confirmed by

detection of significant bacteremia by urine culture and sensitivity method. The isolated bacterial strains were identified by Vitek-2

Compact Automatization System (BioMerieux® SA, Lyon, France). The Viburnum opulus L. fruits were collected from Kayseri and

their extracts (ethanol, methanol, ethyl acetate, chloroform and acetone) were prepared. The antibacterial activity of V. opulus L.

extracts were determined by agar-well diffusion method [1]. The Minimal Inhibition Concentration (MIC) values of effective extracts

were determined by broth micro dilution method [2].

Results and Discussion: The isolated 124 Enterobacteriaceae strains were identified as Escherichia coli (× 51, Klebsiella pneumonia

(× 44), Enterobacter aerogenes (× 5), Enterobacter cloaceae (× 9), Proteus vulgaris (× 5) and Proteus mirabilis (× 10). According to

the results of agar-well diffusion method, it was observed that acetone and chloroform extracts of V. opulus L. have no effect on 124

strains. The most effective extract was determined as ethanol which is effective on 83 of 124 strains. Moreover, it was determined that

the ethyl acetate and methanol extracts are the most effective against Proteus (11 of 15 Proteus strains) while the ethyl acetate and

ethanol extracts are most effective against Klebsiella and Enterobacter (12 of 14 Enterobacter strains, 29 of 44 Klebsiella strains). It

was also determined that the ethanol and methanol extracts are the most effective against E. coli strains (34 of 51 E. coli strains). The

MIC values of the effective extracts were found to be ranging from 125 to 750 µg/ml for E. coli, Klebsiella and Enterobacter strains

and from 60 to 750 µg/ml for Proteus strains.

Keywords: Antibacterial activity, Viburnum opulus L., urinary tract infection, Enterobacteriaceae


Number: MMF.A4.17.001.

References:

[1] Magaldi S., Mata-essayaga S., Hartung de Caprilesa C., Perez C., Colella M.T., Olaizola C., Ontiveros Y. International Journal of Infectious

Diseases 2004, 8, 39-45.

[2] Balouiri M., Sadiki M., Ibnsouda S.K. Journal of Pharmaceutical Analysis 2016, 6, 71-79.




156

IDDGC17-PP-136

THE INVESTIGATION OF THE EFFECTS OF ATORVASTATIN AND LACTOBACILLUS

ACIDOPHILUS TO THE HMG-COA REDUCTASE GENE IN HIPERCHOLESTEROLEMIC RATS

Gülay ÇĠFTCĠ

1, Alper ÇĠFTCĠ

2, Ümit Özcan

3

1Department of Biochemistry, Faculty of Veterinary Medicine, University of Ondokuz Mayis, 55200 Atakum, Samsun;

2Department of

Microbiology, Faculty of Veterinary Medicine, University of Ondokuz Mayis, 55200 Atakum, Samsun; 3Department of Internal

Medicine, Faculty of Veterinary Medicine, University of Ondokuz Mayis, 55200 Atakum, Samsun, Turkey

Aims and Scopes: Hypercholesterolemia is determined as a common health problem that significantly increases risk of

cardiovascular disease. The aim of this study was to evaluate the effects of cholesterol, atorvastatin and Lactobacillus acidophilus to

3-hydroxy-3-methyl-glutaryl-coenzyme A (HMG-CoA) reductase and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) genes

in rats.

Materials and Methods: The animal material of the study comprised of 50 adult male Sprague-Dawley rats. Rats were divided into

five groups [1,2]. Control group (C) was fed with standard rat food for 8 weeks. Hypercholesterolemic group (HC) was fed with a

ration comprising of the food supplemented with 2% cholesterol for 8 weeks. Hypercholesterolemic and Lactobacillus acidophilus

administrated group (HCL) was fed with a ration comprising of food supplemented with 2% cholesterol for 8 weeks and fed orally

with 2x108

cfu/ml/day Lactobacillus acidophilus probiotic for the last 4 weeks of the trial by gavage.

Hypercholesterolemic+atorvastatin administrated group (HCA) was fed with a ration comprising of food supplemented with 2%

cholesterol for 8 weeks and fed orally with atorvastatin (20 mg /kg) with a cholesterol-rich diet for the last 4 weeks of the trial.

Hypercholesterolemic and atorvastatin+ Lactobacillus acidophilus administrated group (HCAL) was fed with a ration comprising of

food supplemented with 2% cholesterol for 8 weeks and fed orally with atorvastatin–Lactobacillus acidophilus combination for the

last 4 weeks of the trial. After 8 weeks-treatment, the blood samples were taken and animals were sacrificed. The brain were isolated

from animals after sacrification. The serum total cholesterol levels (TC) were analyzed. The reverse transcriptase-polymerase chain

reaction (RT-PCR) was used to measure HMG-CoA mRNA expression levels from brain [3].

Results and Discussion: According to the analysis results, it was detected that TC levels in HC group increased (p<0.05), but in

HCA, HCL and HCAL decreased (p<0.05) in compared to the level of control group. The brain mRNA levels of GAPDH were used

as housekeeping gene for control and determined in all groups. When compared to control group, the brain mRNA expression levels

of HMG-CoA decreased in HCAL, HCL, HCA, and HC groups, respectively. Our results showed a potential beneficial effect of

probiotic and atorvastatin supplementation in hypercholesterolemic rats.

Keywords: Atorvastatin, Lactobacillus acidophilus, Hypercholesterolemia

References: [1] Nguyen, T.D.; Kang, J.H.; Lee, M.S. International Journal of Food Microbiology 2007, 113, 358–361.

[2] Onody, A.; Csonka, C.; Giricz, Z.; Ferdinandy, P. Cardiovascular Research 2003, 58, 663–670.

[3] Heon, P.Y.; Kim, J.G.; Shin, Y.W.; Kim, S.H.; Whang, K.Y. Journal of Microbiology and Biotechnology 2007, 17, 655–662.

Acknowledgements:This study was supported by the Scientific and Technological Research Council of Turkey (TUBITAK) (Project

No: 115O908)




157

IDDGC17-PP-137

THE PHENOTYPIC AND GENOTYPIC INVESTIGATION OF VANCOMYCIN RESISTANCE

AMONG MASTITIS ISOLATES OF STAPHYLOCOCCI

Alper ÇĠFTCĠ*,Mehmet Onur GÖKDAĞ

Department of Microbiology, Faculty of Veterinary Medicine, University of Ondokuz Mayıs, Samsun; TURKEY.

*[email protected]

Aims and Scopes: Mastitis still continues to be a major problem in dairy animals such as cattle, buffalo and ewes due to economic

losses to dairy farms all over the world. Among the mastitis pathogens, staphylococci are considered to be the most important species

because of its multiple antibiotic resistance characteristics. The phenotypic and genotypic determination of vancomycin resistance and

genotyping of mastitis originated staphylococci isolates were aimed in the study.

Materials and Methods: The bacteria used in this study consisted of 100 Staphylococcus spp. isolated from subclinical mastitis milk

samples. The staphylococcal isolates were identified morphologically and biochemically by standard laboratory procedures [6]. The

identification results were confirmed by PCR for being S.aureus or other staphylococci. For this aim, genus specific 16S rRNA gene

(756 bp) and S.aureus specific nuc gene (279 bp) were targetted [2].

The S.aureus isolates were investigated for the polymorphisms of spa and coa genes by PCR [3,5].

The antibiotic resistance profiles of isolates were investigated by Agar Disc Diffusion test with using oxacillin (1µg), vancomycin (30

µg), teicoplanin (30 µg), sulfamethoxazole+trimethoprim (1.25 µg/23.75 µg), tetracycline (30 µg), penicillin (10 IU), cefaperazone

(75 µg), and amoxycillin-clavulanic acid (20/10 µg) discs [1]. The MIC of vancomycin among isolates resistant to vancomycine were

determined by Micro Broth Dilution technique [1]. The vancomycin genotypes (vanA, vanH, vanR, vanS, vanZ, vanY and vanX genes)

of isolates were detected by PCR [7]. The vancomycin resistant isolates were genotyped by RAPD-PCR and phylogenetic

relationships were determined with using Unweighted Pair Group Method with Arithmetic Averages method [4].

Results and Discussion: The staphylococci isolates were identified as S.aureus (n=73) and other staphylococci (n=27) by

conventional methods and PCR.

Twenty-five isolates were found as negative for coa gene and 48 isolates showed nine different coa patterns. All isolates carried spa

gene and four different band patterns were determined for spa gene polymorphisms.

These isolates were evaluated for multiple antibiotic resistance patterns. Multiple antibiotic resistance were detected 9, 5, 5, 7, 6, 4, 11

and 17 isolates to 8, 7, 6, 5, 4, 3, 2 and 1antibiotics, respectively. Thirty-six isolates were susceptible to all antibiotics. Although none

of the Staphylococcus spp. was resistant to vancomycin, nine S.aureus isolates were determined as resistant to vancomycin. The MIC

concentrations of these S.aureus isolates were 64 µg/ml (n=2) and 32 µg/ml (n=7). Two and three of the isolates carried vanA and

vanR genes, respectively. The investigated van genes were not found in four of the isolates.

Nine unique genotypes were defined between the 51 to 75% similarities by RAPD-PCR band patterns.

In conclusion, not only the multiple antibiotic resistances but also the vancomycin resistance was determined in mastitis originated

staphylococci and this status was constituted a risk for public health.

Keywords: PCR, mastitis, Staphylococcus spp., vancomycin

References: [1] Clinical Laboratory Standards Institute. M100-S21. Clinical and Laboratory Standards Institute 2013.

[2] Çiftci, A.; Fındık, A.; Onuk, E.E.; Savasan, S. Brazilian Journal of Microbiology 2009, 40, 254–261.

[3] DaSilva, E.R.; Boechat, J.U.D.; DaSilva, N. Letters in Applied Microbiology 2006, 42, 30–34.

[4] Findik, A.; Ica, T.; Onuk, E.E.; Percin, D.; Kevenk, T.O.; Ciftci, A. Tropical Animal Health and Production 2011, 43, 711–719.

[5] Frenay, H.M.E.; Bunschoten, A.E.; Schouls, L.M. European Journal of Clinical Microbiology& Infectious Diseases 1996, 15, 60–64.

[6] Koneman, E.W.; Allen, S.D.; Janda, W.M.; Schreckenberger, P.C.; Winn, W.C.; Procop, G.; Woods, G. Color Atlas and Textbook of

Diagnostic Microbiology 2005, 700–711.

[7] Miele, A.; Bandera, M.; Goldstein, B.P. Antimicrobial Agents and Chemotherapy 1995, 39, 1772–1778.

Acknowledgements: This work was supported by the Scientific Research Projects Commission of Ondokuz Mayıs University (Project

No: PYO.VET.1904.14.005).





158

IDDGC17-PP-138

SALMONELLA PATHOGENICITY ISLANDS

Belgin SIRIKEN1, Tuba YILDIRIM

2, Ceren YAVUZ

2

Departments of 1Aquatic Animal Diseases ([email protected]; [email protected]), Faculty of Veterinary Medicine, Ondokuz

Mayis University, 55200, Samsun, Turkey;2Department of Biology, Faculty of Science, Amasya University, 05100, Amasya, Turkey

ABSTRACT

Salmonella species are facultative intracellular pathogenic bacteria. They can invade macrophages, dendritic and epithelial cells. The

responsible virulence genes for invasion, survival, and extra intestinal spread are located in Salmonella pathogenicity islands (SPIs)

[1]. SPIs are thought to be acquired by horizontal gene transfer. Some of the SPIs are conserved throughout the Salmonella genus, and

some of them are specific for certain serovars [1,2,3,4]. There are differences between Salmonella serotypes in terms of adaptation to

host cell, virulence factors and the resulting infection according to SPA presence and characteristics. The most important Salmonella

virulence gene clusters are located in 12 pathogenicity islands [1,3,5]. Virulence genes that are involved in the intestinal phase of

infection are located in SPI-1 and SPI2 and the remaining SPIs are required for intracellular survival, fimbrial expression, magnesium

and iron uptake, multiple antibiotic resistance and the development of systemic infections [1,6,7,8]. In addition SPIs, Sigma σs

(RpoS) factors and adaptive acid tolerance response (ATR) are the other two important virulence factors [8]. RpoS and ATR found in

virulent Salmonella strains help the bacteria to survive under inappropriate conditions such as gastric acidity, bile salts, inadequate

oxygen concentration, lack of nutrients, antimicrobial peptides, mucus and natural microbiota and also to live in phagosomes or

phagolysosomes[9,10,11]. This review article summarizes the data related to pathogenicity islands in Salmonella serotypes and some

factors which play role in the regulation of virulence genes.

Keywords: Salmonella; pathogenicity island; sigma factor; adaptive acid tolerance response.

Referenses

[1]Hensel M. Evolution of pathogenicity islands of Salmonella enterica. Int J Med Biol 2004; 291(2-3): 95-102.

[2]Ibarra JA, Steele-Mortimer O. Salmonella--the ultimate insider. Salmonella virulence factors that modulate intracellular survival.

Cell Microbiol 2009; 11(11): 1579-86.

[3]Hall RM. Salmonella genomic islands and antibiotic resistance in Salmonella enterica. Future Microbiol 2010; 5(10): 1525-38.

[4]Sabbagh SC, Forest CG, Lepage C, Leclerc JM, Daigle F. So similar, yet so different: uncovering distinctive features in the

genomes of Salmonella enterica serovars Typhimurium and Typhi. FEMS Microbiol Lett 2010; 305(1): 1-13.

[5]Chiu CH, Tang P, Chu C, et al. The genome sequence of Salmonella enterica serovar Choleraesuis, a highly invasive and resistant

zoonotic pathogen. Nucleic Acids Res 2005; 33(5): 1690-8.

[6]Retamal P, Castillo-Ruiz M, Mora GC. Characterization of MgtC, a virulence factor of Salmonella enterica serovar Typhi. PLoS

One 2009; 4(5): e5551.

[7]Morgan E. Salmonella pathogenicity islands, pp: 67-88. In: Rhen M, Maskell D, Mastroeni P, Threlfall J (eds), Salmonella:

Molecular Biology and Pathogenesis. 2007, Horizon Bioscience. Norfolk, UK.

[8]Dong T, Schellhorn HE. Role of RpoS in virulence of pathogens. Infect Immun 2010; 78(3): 887-97.

[9]Altier C. Genetic and environmental control of salmonella invasion. J Microbiol 2005; 43(Spec No): 85-92.

[10]Tiwari RP, Sachdeva N, Hoondal GS, Grewal JS. Adaptive acid tolerance response in Salmonella enterica serovar Typhimurium

and Salmonella enterica serovar Typhi. J Basic Microbiol 2004; 44(2): 137-46.

[11]Allam US, Krishna MG, Sen M, et al. Acidic pH induced STM1485 gene is essential for intracellular replication of Salmonella.

Virulence 2012; 3(2): 122-35.





159

IDDGC17-PP-139

BIOTECHNOLOGY AND PLANTS USED IN CANCER TREATMENT

Elif AKYILDIZ1, Sevil SAĞLAM

2

1,2

Ahi Evran University, Graduate School of Natural and Applied Sciences, Department of Agricultural Biotechnogy, 40100, KırĢehir,

Turkey

Email of author for contact: [email protected]

Cancer, one of the leading health problems of our era, is perceived as a serious and chronic illness which causes despair and

uncertainty, evokes pain and pain in death, causes guilt and anxiety, creates panic [1]. Some plants and herbal products can be used at

appropriate doses (Astragalus, Rosemary, Cats Clow, Yarrow, D-limonene, Ginseng, Blueberry, Poliganum cuspidatum, Salvestrol Q-

40). Besides these plants, Maitake, Reishi and Shiitake mushrooms are also used for cancer treatment [2]. Biotechnology is using as

an alternative method for production of cancer medicine from those plants. Biotechnology is technology that utilizes biological

systems, living organisms or parts of this to develop or create different products. Today, biotechnology covers many different

disciplines (eg. genetics, biochemistry, molecular biology, etc.). New technologies and products are developed every year within the

areas of eg. medicine (development of new medicines and therapies), agricultural biotechnology (development of genetically modified

plants, biofuels, biological treatment). Plant Biotechnology is an important branch of biotechnology. Under aseptic conditions and in

appropriate nutrient media, it can be mentioned from production of new plant cells, tissues and organs and herbal products

(secondary metabolites) with plant tissue and organ cultures. Pharmaceutical raw materials for cancer treatment are to be produced by

biotechnological methods, gene transformation with Agrobacterium rhizogenes and in vitro callus and suspension cultures. In this

study, what is the cancer, what are the commonly used plants in cancer treatment, and the biotechnological method which is an

alternative production method of these plants has been tried to be put forward. This technology is not known much in Turkey yet,

although there are examples in the world. It is a matter of fact that there is a need for further research and the need for trained

personnel in this area.

Keywords: Cancer, Biotechnogy, Callus Culture, Cell Suspension Culture, Agrobacterium rhizogenes

References:

[1] Kavradım, T. S.; Özer, C. Z. 2014, 6(2), 154-164..

[2] Güveloğlu, E. Kanser İyileşir Hangi evrede olursa olsun umut var!, 2014, volume:1, 92-172.

http://tureng.com/en/turkish-english/as%20a%20matter%20of%20fact




160

IDDGC17-PP-140

DETECTION AND CHARACTERIZATION OF TRANSCRIPTS OF PLASMID pHIG22 BY USING

LACE AND RACE TECHNIQUES

HALIL ĠBRAHIM GÜLER1, SABRĠYE ÇANAKÇI

2, ESMA CEYLAN

2, ALĠ OSMAN BELDÜZ

2

1 Karadeniz Technical University, Faculty of Science, Department of Molecular Biology and Genetic, 61080 Trabzon, Turkey

2 Karadeniz Technical University, Faculty of Science, Department of Biology, 61080 Trabzon, Turkey, [email protected]

Abstract

Aims and Scopes: pHIG22 is a small, novel, cryptic, multicopy and double strand plasmid which has 2222 bp in long and with a total

G + C content of 62,78 from Thermus scotoductus K6. The aim of this study is to detect the transcripts in both strands of pHIG22 and

to characterize these transcripts identified by using LACE and RACE techniques.

Materials and Methods: In order to determine the transcripts encoded by the plasmid pHIG22, cDNA was synthesized by designing

specific primers from different regions at specific intervals in both strands of the plasmid using Thermus scotoductus K6 Total RNA

as template and the obtained cDNAs were amplified by PCR, then the orientation and possible sizes of the transcripts were

determined. The 5'/3' RACE 2nd Generation (Ver. 13, Roche) kit was used to detect the 5 'ends and LACE technique was used to

detect the 3' ends of the identified transcripts of pHIG22. In the RACE technique, the first strand DNAs were generated using specific

primers designed, and then the generated cDNAs were purified, the homopolymeric tail was added, and the target cDNAs were

amplified by PCR. The amplified 5 'ends of the transcripts were cloned into the pGEM-T Easy vector. In the LACE technique, a 5

'phosphorylated primer (P1) was first ligated to the 3' end of the respective transcript with RNA ligase. Subsequently, another primer

(P2) was used as a template (P2 is complementer to P1) and the cDNA was obtained by reverse transcription, which was

complementary to the P1 primer. The generated cDNAs were amplified by PCR using a third primer (P3), and the resulting fragments

were cloned into the pGEM-T Easy vector. All clones were sent to Macrogen (South Korea) for DNA sequence analysis.

Results and Discussion: The use of Thermus scotoductus K6 Total RNA as a template revealed that it generated a total of 2

transcripts, one encoded in the first strand and one encoded in the opposite strand of the pHIG22 plasmid. As a result of studies with

RACE and LACE techniques, it has been determined that Transcript 1 encoded by pHIG22 begins at nucleotide 329 and terminates at

nucleotide 1950; Transcript 2 encoded in the opposite strand was also found to start at nucleotide 2103 and terminate at nucleotide

329. It has been found that the transcripts whose start and end points are determined are complementary to each another. Transcript 1

of 1622 bp in length appears to overlap with a region of Transcript 2 and 1559 bp of 1712 bp in length. It is known from the literature

that interactions between RNAs can be regulated by the pRNAs required for replication. Antisense RNAs that control the number of

plasmid copies are complementary to a 5 'end region of the target transcript (preprimer RNA or Rep mRNA required for replication).

These are referred to as "contrary transcript RNAs" (ctRNA). In some cases, inhibition by ctRNAs is carried out in the matching

region of the target RNAs [1] . The complementation of the 3' end of Transcript 2 to the 5' end of Transcript 1 enhances the belief that

these two transcripts are effective at controlling the number of plasmid copies and at the initiation of replication, as opposed to that of

the transcripts identified from the pHIG22 plasmid. The complementation of the 3 'end of Transcript 2 to the 5' end of Transcript 1

enhances the idea that these two transcripts are effective at controlling the number of plasmid copies and at the initiation of

replication, as the transcripts identified from the pHIG22 plasmid are in different chains and opposite to each other.

Keywords: pHIG22 transcripts, LACE and RACE techniques

Acknowledgements: This study was supported by TUBITAK (Project No: 112T277).

References:

[1] del Solar, G., Giraldo, R., Ruiz-Echevarria, M., J., Espinosa, M. ve Diaz-Orejas, R. Replication and control of circular bacterial plasmids, Microbiol. Mol. Biol.

Rev., 1998, 62, 434–464.




161

IDDGC17-PP-141

SIGNIFICANCE OF MACROPHAGE MIGRATION INHIBITORY FACTOR rs755622 VARIANT IN

PREDICTING BEHÇET'S DISEASE

Serbulent Yigit1, Ayse Feyda Nursal

2 , Akin Tekcan

3, Goknur Kalkan

4, Husniye Rustemoglu

1

1GaziosmanpaĢa University, School of Medicine, Dept. of Medical Biology, Tokat, Turkey

2Hitit University, School of Medicine, Dept. of Medical Genetics, Corum, Turkey

3Ahi Evran University, Faculty of Medicine, Dept. of Medical Biology, KirĢehir, Turkey

4Yildirim Beyazit University, School of Medicine, Dept. of Dermatology, Ankara, Turkey

[email protected]

Abstract

Aims and Scopes: Behçet's disease is a chronic disorder manifested by multisystem involvement [1]. Macrophage

Migration Inhibitory Factor (MIF) is a principal modulator in innate and adaptive immune reactions [2]. We

hypothesized whether MIF rs755622 variant might contribute to genetic susceptibility to BD in a Turkish cohort.

Material and methods: One hundred eleven patients (68 females, 43 males) with BD and one hundred healthy

individuals (59 females, 41 males) were examined in the study. MIF rs755622 variant was genotyped using polymerase

chain reaction-restriction fragment length polymorphism (PCR-RFLP).

Results and Discussion: There was a significantly different in the MIF rs755622 variant genotype distribution between

BD patients and healthy controls. MIF rs755622 CC genotype was more prevalent among patients group compared to

controls (p=0.008/Tablo 1). A significant association was observed when the patients were compared with the controls

according to CC versus GG+GC genotypes (p = 0.003, OR: 1.21, 95% CI: 0.06–0.063). Allele frequencies of MIF

rs755622 variant did not show any statistically significant difference between patients and controls. This results suggest

that MIF rs755622 variant is probably to be associated with susceptibility to the development of BD in a Turkish

cohort.

Keywords: Behçet' disease, macrophage migration inhibitory factor, rs755622, variant.

References

[1] Alpsoy E, Akman A. Behçet's disease: an algorithmic approach to its treatment. Arch Dermatol Res

2009;301(10):693-702

[2] Calandra T, Roger T. Macrophage migration inhibitory factor: a regulator of innate immunity. Nature Reviews

Immunology 2003;3(10):791–800.




162

IDDGC17-PP-142

MOLECULAR PHYLOGENY OF THE CYTOTYPES OF NANNOSPALAX XANTHODON SATUNĠN,

1898 (MAMMALIA:RODENTIA) FROM CENTRAL ANATOLIA BY ISSR MARKER TECHNIQUE

Eda ġEN1, Tuba YAĞCI

1

1 University of Bilecik ġeyh Edebali, Faculty of Science and Arts, Department of Molecular Biology and Genetics, 11230, Gülümbe,

Bilecik, TURKEY. Email:[email protected]

Aims and Scopes: Nannospalax genus belonging to the Spalacidae family has species with a narrow niches area and in terms of their

anatomical and behavioural characteristics, they are best adapted to subterranean life. About 30 cytotypes of the genus Nannospalax

showing exceptional variety karyologically have been recorded in Turkey. According to this, there are 10 different types of cytotypes

of N. xanthodon whose diploid chromosome number ranges from 2n=36 to 60, and NF value ranges from 66 to 92. Genetic variation

between 2n= 54, NF= 74; 2n= 60 NF= 80; 2n= 60, NF= 82 was determined in the species Nannospalax xanthodon for the first time

using ISSR molecular markers technique.

Materials and Methods: 36 mole rat samples belonging to species N. xanthodon (8 populations) distributed in Anatolia were

analiyzed. ISSR regions have been amplified from the genomic DNAs using 7 different ISSR primers. MVSP Version 3.22 package

programmes were used to build phylogenetic trees and phylogenetic network graphics. When the phylogram trees obtained from ISSR

method were exaimed, 36 samples of the genus Nannospalax xanthodon.

Results and Discussion: In this research, ISSR marker techniques was succesful for determining genetic differences between N.

xanthodon cytotypes. Cytotypes were divided into two groups (2n= 54, 2n= 60) However, this grouping was not of the NF value. We

used 7 different ISSR primers and obtained 112 bands of which 101 were polymorphic. Of the total 112 amplification products,

90,17% were found to be polymorphic.

Keywords: ISSR, Genetic markers, Nannospalax xanthodon, Turkey

References:

[1] Sözen, M.; Çolak, F.;Sevindik, M.; Matur, F.Turk J Zool 2013, 37:462–469




163

IDDGC17-PP-143

PRELIMINARY ASSESSMENT OF APPLICABLE DIMETHYLGLYOXIME LIGAND TO

ELIMINATE IRON OVERLOAD FROM IN VITRO

Gülüzar ÖZBOLAT1, Abdullah TULĠ

1

1Cukurova University, Faculty of Medicine Department of Biochemistry, 01330 Adana, Turkey

[email protected]

Aims and Scopes: Oximes have often been used as chelating ligands in the field of coordination chemistry and their metal complexes

have been of great interest for many years. Different oximes and their metal complexes have shown notable bioactivity as chelating

therapeutics , drugs , inhibitors of enzymes and as intermediates in the biosynthesis of nitrogen oxides. [1,2,3]. The aim of this work

is to study the coordination of iron (III) ions with dimethylglyoxime ligand which may give stable chelate complexes that may be used

in pharmaceutical applications. In this study, Dimethylglyoxime was prepared from butanone first by reaction with ethyl nitrite

followed by sodium hydroxylamine monosulfonate. Afterwards, iron(III) complexes were synthesized using dimethylglyoxime ligand

containing oxime group. The complexes have been characterized by elemental analyses, ICP-OES, FT-IR spectra, magnetic

susceptibility and conductivity measurements. Electrochemical behavior of ligand and complexes were examined as supporting

electrolyte and platinum electrode for cyclic voltammetry.The cytotoxicity was evaluated by MTT assay.

Materials and Methods: In this study, dimethylglyoxime reacted with iron with high concentrations at physiological pH and at room

temperature. A brown complex formed at the rate of 1/3. The resulting complex was solved in water even at concentration and

obtained in 95 percent yield. UV-VIS measurements showed that amount of complexation increase depending on time. Complex has

octahedral geometry, which is accordant with magnetic susceptibility results.

Figure 1: Synthesis of dimethylglyoxime - Fe(III) complex

Results and Discussion: ICP-MS showed that concentration of iron (initial concentration is 50 ppm) decreased to 2,5 ppm after

complexation. FT-IR show that O-H peak of complex appearing at 3209 cm-1

almost disappeared, C-H appeared at 1437 cm-1

unchanged and new Fe-N peak appeared at 462 cm-1

after complexation.The cyclic voltammetric behavior of iron (III) complex of

DMG was studied at room temperature. The scan rate was 100 mV s-1, and the quoted E values are versus Ag/AgCl. The CV of

complex, the redox waves with 0.40 V and were attributed to the reduction/reoxidation of the iron redox center in the complex. The

voltammetric behavior of free ligand is characterized by one reduction peak. The peak potential is about -0.30 V (vs. Ag|Ag+) at a

scan rate v= 0.1 Vs-1

. These results indicate that the reductions of free ligand and the complex take place differently. Trypan blue

exclusion for determining cell density and viability, and the MTT colorimetric assay for assessing cell viability and the results showed

the lowest cytotoxic effect. These results indicate that using of DMG for this aim in further studies is appropriate.

Keywords: Oxim, iron (III), ligand, complex, CV,MTT





164

IDDGC17-PP-144

INHIBITION OF HUMAN ERYTHROCYTE GLUTATHIONE S-TRANSFERASE BY SOME

FLAVONOIDS DERIVATES

Mine AKSOY1, Ö. Ġrfan KÜFREVĠOĞLU

1

1Ataturk University, Science Faculty, Turkey

[email protected]

Text

Detoxification plays a vital role in the defense system of living organisms. The glutathione transferase play a important roles in

detoxification processes. Conjugation of the γ-glutamyl-cysteinyl-glycine (GSH,) with electrophilic compounds such as drugs, toxins

and carcinogens is catalyzed by GST (1). GSTs are divided into three main categories: the cytosolic GSTs, the mitochondrial, and the

microsomal GSTs. In humans, cytosolic GSTs are classified as alpha (α), mu (μ), pi (π), sigma (σ), theta (θ), zeta (δ) and omega (ω).

It has been found that cytosolic GSTs are differentially expressed in varied organs of the human body. GSTA and GSTM are mainly

expressed in the liver, and GSTM is also expressed in the kidney, the testis, the adrenal gland (2). Humans have a single functional

GSTP gene termed GSTP1 and more than 95% of the erythrocyte GSTs are GST-P1-1 isoenzyme. Additionally, GSTP1 are found in

oesophagus, lungs, placenta (3).

GSTs are constantly overexpressed in drug-resistant cell lines. Because GST has detoxifying activity, it protects cells from

endogenous toxic products, but overexpression of GST in tumor cells increases resistance to certain anti-cancer drugs by increased

glutathione conjugation (2). Among the GST isoenzymes, GSTP1 is of more interest because it is overexpressed in cancers and is

associated with tumoral drug resistance(4).

Aims and Scopes:

The main objective of our study is to investigate the inhibitory effect of baicalin, baicalein, phloridzin, and phloretin flavonoids on

GST enzyme activity purified from human erythrocytes. Our results show the ability of these phenolic compounds to inhibit human

erythrocytes GSTs in vitro. As mentioned above, in red blood cells mostly GSTP1-1 is present. This may provide more useful

information for the use of polyphenols in the development of chemosensitizers.


Glutathione S-transferase was purified by a simple one step method with glutathione-agarose affinity column from human

erythrocytes. Glutathione S-transferase activity was assayed by following the change in absorbance at 340 nm of 1-chloro-2,4-

dinitrobenzene to dinitrobenzen 5-glutatyon (DNB-SG) over a period of 3 min at 25 ºC using a spectrophotometer (Shimadzu UV-

1208) according to the method described by Habig et al.(5) Quantitative protein assay was performed according to the Bradford‘s

method. SDS polyacrylamide gel electrophoresis was performed after purification of the enzymes. The effects of increasing

concentrations of baicalin, baicalein, phloridzin, and phloretin on human erythrocyte GST were determined spectrophotometrically

using different GSH concentration.


The aim of our study was to investigate the interaction of human erythrocyte GST with baicalin, baicalein, phloridzin, and phloretin

natural plant compounds. These flavonoids were shown to inhibit human erythrocyte GST with IC50 values 28.75, 57.50, 769.10,

36.32 µM, respectively. Ki constants were respectively 14.50±0.707, 24.33±2.08, 762.50±185.97, 96.23±16.79 µM for baicalin,

baicalein, phloridzin, and phloretin flavonoids. According to these results, baicalin is the best inhibitor for human erythrocyte GST.

Keywords:

Natural products, glutathione S-transferase, enzyme inhibition

References:

[1]Hayes JD, Pulford DJ. 1995;30(6):445-600.

[2]Eaton DL, Bammler TK. 1999;49(2):156-64.

[3]Piipari R, Nurminen T, Savela K, Hirvonen A, Mantyla T, 2003;39(3):265-72.

[4]Mannervik B, Castro VM, Danielson UH, Tahir MK, Hansson J, Ringborg U. 1987;8(12):1929-32.

[5]Habig WH, Jakoby WB. 1981;77:398-405.




165

IDDGC17-PP-145

HYDROGEN PEROXIDE INDUCED DAMAGE IN BLOOD CELL GENOMIC DNA

Ali DEMĠRBAĞ1*, Kemal KOÇ

2, Züleyha DOĞANYĠĞĠT

3, Dilek PANDIR

1

1*Bozok University, Faculty of Arts and Science, Department of Biology, Yozgat, Turkey

2Bozok University, Institue of Sciences, Department of Biology, Yozgat, Turkey

3Bozok University, Faculty of Medicine, Department of Histology and Embryology, Yozgat, Turkey


Aims and Scopes:

Hydrogen peroxide (H2O2) can rapidly diffuse the cell membrane, reacting with intracellular metal ions such as iron or copper to

form highly toxic hydroxyl radicals, which cause DNA alteration. Randomly Amplified Polymorphic DNA (RAPD) is a derivative of

PCR where unspecified DNA regions are amplified using a single, short oligonucleotide primer of arbitrary sequence. The object of

current work is to search the impacts of H2O2 on blood cell genomic DNA with different primers.


The genotoxic effects of H2O2 was assessed in normal human lymphocytes using the the RAPD-PCR assay. All volunteers were

healthy, taking no medication, non-smokers, and none of them were farm or agricultural workers. Cells were diluted in 400 μl of

extraction buffer: 50 mM Tris–HCl, pH 7.5, 10 mM EDTA pH 8.0, 100 mM NaCl with 10 % SDS, proteinase K and incubated at

37 °C in a water bath for overnight. Digested proteins were extracted with Tris-buffered phenol, chloroform and isopropanol. The

DNA was precipitated with 99 % ethanol.

The RAPD-PCR protocol consisted of an initial denaturing step of 2 min at 95 °C, followed by 45 cycles at 95 °C for 1 min

(denaturation), 36 °C for 1 min (annealing of primers), and 72 °C for 2 min (extension). Cycling was concluded with a final extension

at 72 °C for 4 min, and then held indefinitely at 4 °C. Optimization of amplification conditions was carried out by ranging the

template DNA from 10 to 100 ng, the primers from 5 to 10 pmol/μl, MgCl2 from 0.5 to 5.0 mM, and temperature of annealing primers

from 32 to 42 °C. A negative control, containing all reaction ingredients except for template DNA, was included for each

amplification.


RAPD-PCR was used for the molecular characterization of live cells as a possible tool to detect DNA alterations in environmental

genotoxic studies [1]. We analyzed the RAPD-PCR products using agarose gel as good, easy, rapid and cheap method [2, 3]. The 4

primers tested in RAPD-PCR to amplify genomic DNA of blood cell at different concentrations of H2O2 in the present study.

Genomic DNA extracted using above method showed clear distinct band without any contaminating smear. The electrophoretic

analysis of RAPD-PCR product showed many bands. In the current study, amplification of genomic DNA extracted from human

blood resulted in a fingerprint pattern with regard to different concentration of H2O2 .

Keywords: RAPD, Blood, toxicology, Hydrogen peroxide, ecotoxicology

References: [1] L. Rocco, I., Valentino, V., Scapigliati, G., Stingo V., Cytotechnology 2014, 66(3): 383–393.

[2] Oliveira, A.L., et al., Genet. Mol. Res. 2010, 9: 1450–1459.

[3] Liu, Z.J., Cordes, J.F., Aquaculture 2004, 238: 1-37

https://www.ncbi.nlm.nih.gov/pubmed/?term=Rocco%20L%5BAuthor%5D&cauthor=true&cauthor_uid=23839298

https://www.ncbi.nlm.nih.gov/pubmed/?term=Valentino%20IV%5BAuthor%5D&cauthor=true&cauthor_uid=23839298

https://www.ncbi.nlm.nih.gov/pubmed/?term=Scapigliati%20G%5BAuthor%5D&cauthor=true&cauthor_uid=23839298

https://www.ncbi.nlm.nih.gov/pubmed/?term=Stingo%20V%5BAuthor%5D&cauthor=true&cauthor_uid=23839298

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3973789/




166

IDDGC17-PP-146

GENOTOXICITY ASSESSMENT OF IMIDACLOPRID USING RAPD-PCR IN HUMAN BLOOD

Ali DEMĠRBAĞ1*, Kemal KOÇ

2, Züleyha DOĞANYĠĞĠT

3, Dilek PANDIR

1

1*Bozok University, Faculty of Arts and Science, Department of Biology, Yozgat, Turkey

2Bozok University, Institue of Sciences, Department of Biology, Yozgat, Turkey

3Bozok University, Faculty of Medicine, Department of Histology and Embryology, Yozgat, Turkey


Aims and Scopes:

Imidacloprid is a neonicotinoid insecticide being used extensively for crop protection and pet flea control programmes. Genotoxic

risks of human exposure to pesticides attracted the attention of the world. This study aimed at evaluating the genotoxicity of

imidacloprid in human peripheral blood lymphocytes using RAPD-PCR tests.


Human peripheral blood samples, collected from healthy volunteers aged 20–30 years old with no smoking history. All samples

except the control group were exposed at different doses of imidaclorpid. Were immediately dispensed into a tube containing 400 µl

DNA extraction buffer (100 mM NaCl, 50 mM Tris, pH 7.5, 10 mM EDTA, 0.5% SDS, and freshly added 3.5 mg/ml proteinase K).

Blood was expelled into lysis buffer quickly to disperse the blood cells. The lysates were incubated at 37 oC overnight. DNA was

extracted twice with phenol and once with chloroform. DNA was precipitated by adding two volumes of ethanol. DNA was collected

by brief centrifugation and washed twice with 70% ethanol, air-dried, and redissolved in double-distilled water.

RAPD reactions were carried out in a 25 µl reaction volume with certain components and cycling parameters. The amplification

products were separated on the 1% agarose gel for 1-2 h at 80 V, and recorded with a digital imager after staining with ethidium

bromide (0.5 mg/ml).


Until now, several PCR-based molecular methods of genotype analysis have been developed for the genetic analysis of blood, RAPD

fingerprinting is quicker and cheaper in spite of lower reproducibility (Liu and Cordes, 2004; Liu et al., 2004). RAPD markers are

much more effective in genetic analysis because the amplification of RAPDs is based on the complete genome. These results suggest

that imidocloprid at high concentrations could affect the DNA much stronger than its lower concentrations. Samples treated with

different doses of imidocloprid exhibited more DNA damage compared to control group. Based on the research performed in this

study there was a significant difference between DNA bands that disappear with increasing doses of imidacloprid.

Keywords: RAPD, Blood, toxicology, imidocloprid, ecotoxicology

References: [1] Liu, Y., Wang, X., Liu, L., Plant Science. 2004, 166: 677-685

[2] Liu, Z.J., Cordes, J.F., Aquaculture 2004, 238: 1-37




167

IDDGC17-PP-147

THE GENETIC ANALYSIS OF SOME SALIX L. TAXA BASED ON SSR MARKERS IN NORTH

AND EAST ANATOLIAN REGIONS OF TURKEY

Sümer Aras¹, Ġlker Büyük1, Kamil Coskunçelebi

2, Aydan Acar

1 , Derya ġimsek¹, Bedri Serdar

3, Talip Çeter

4, Demet

Cansaran Duman5, Burcu Pelin Büyük¹, N. Münevver Pınar¹

1 Ankara University Faculty of Science, Department of Biology Tandoğan-Ankara

2 Karadeniz Technical University, Faculty of Science, Department of Biology-Trabzon

3 Karadeniz Technical University, Faculty of Forestry-Trabzon

4 University of Kastamonu, Faculty of Science and Literature, Department of Biology- Kastamonu

5Ankara University, Biotechnology Institute, Tandoğan-Ankara

[email protected]

Aims and Scopes: Salix L., a wide spread genus that consists of about 500 species, is distributed throughout the temperate and arctic

zones and includes trees, shrubs, ground covers. 33 species of the genus Salix in our country exhibit the natural distribution. The

objectives of this study were to do molecular characterization of the Salix species and establish the genetic relationships among these

species from diverse geographical regions in Turkey. The data from this study would provide a valuable reference for the genetic base

of breeding programs and contribute to the international genetic database.

Materials and Methods: In this study, 16 taxa of Salix which are mainly distributed in North and East Anatolia were examined.

Molecular analysis was performed with the DNA of leaf materials for each species. Simple sequence repeats (SSRs) are highly

polymorphic and abundant sequences dispersed throughout most eukaryotic genomes. As being co-dominant and locus-specific

markers, they are widely used for DNA fingerprinting, linkage map construction and population genetic studies and known as the

most efficient DNA marker system among the systems used currently. In the present study five different SSR loci were used for the

genetic analysis of Salix taxa.

Results and Discussion: As far as the probability of identity (PI) is concerned, while SB24 (18 alleles, PI: 0.019894) locus was the

most informative locus, SB196 (6 alleles, PI: 0.247654) was identified as the least informative locus. The dendogram generated from

UPGMA cluster analysis of 16 Salix species based on the Jaccard coefficient of genetic similarity revealed two main groups. Both

groups were further divided into two major subgroups containing all of the Salix species analyzed. The highest similarity was found to

be 50 % between S.excelsa and S.pseudomi and also between S. babylonica and S. pentandra. This study represented the genetic

characterization of these Salix taxa based on this genomic region and would help advertise more effective solutions for taxonomic

problems of these taxa of Salix.

Keywords: Salix sp., SSR analysis, Scanning Electron Microscopies, Light Microscopy

Acknowledgements: This work was supported by Ankara University Scientific Research Coordination Unit. Project Number:

13B4240010.




168

IDDGC17-PP-148

THE POLLEN MORPHOLOGY AND GENETIC ANALYSIS OF TWO ENDEMIC TURKISH SALIX

L. BASED ON SSR MARKERS

Ġlker Büyük

1, Sümer Aras¹, Kamil CoĢkunçelebi

2, Derya ġimĢek¹, Aydan Acar

1, Bedri Serdar

3, Talip Çeter

4, Demet

Cansaran Duman5, Burcu Pelin Büyük¹, N. Münevver Pınar¹

1 Ankara University Faculty of Science, Department of Biology Tandoğan-Ankara

2 Karadeniz Technical University, Faculty of Science, Department of Biology-Trabzon

3 Karadeniz Technical University, Faculty of Forestry-Trabzon

4 University of Kastamonu, Faculty of Science and Literature, Department of Biology- Kastamonu

5Ankara University, Biotechnology Institute, Tandoğan-Ankara

[email protected]

Aims and Scopes: Salix L. which is a taxonomically problematic genus has four endemic taxa distributed in Turkey. It is very

important to do molecular and morphological characterizations of Salix species and establish the genetic relationships among these

species from diverse geographical regions in Turkey.

Materials and Methods: In this study, pollen morphological features of S. rizeensis and S. trabzonica species were examined by

using Light Microscopy (LM) and Scanning Electron Microscopies (SEM). Pollen slides were prepared according to Wodehouse

technique. In addition, molecular analysis was carried out for these pollens. A total of 6 SSR namely SB24, SB196, SB194, SB80,

SB233 and SB38 were used in this study for the genetic characterization of the Salix species. Polymerase chain reactions (PCR) and

SSR analysis were performed as previously described by Şelli et al. (2007). The allele sizes were determined for each SSR locus using

the Beckman CEQ fragment analysis software. The analyses were repeated at least twice to ensure the reproducibility of the results.

Results and Discussion: It was observed that the pollen grains are radially symmetrical, isopolar, generally tricolpate and

ornamentation is suprareticulate. However, the pollen shape was found oblate-spheroidal in S. rizeensis and spheroidal in

S.trabzonica. The allele sizes were determined quite similar in SB196, SB80 and SB38 loci. According to the pollen DNA data

obtained from SSR loci, the genetic similarity was 33 % between S.rizeensis and S.trabzonica. The study revealed that palynological

and molecular biological approaches contribute to the solution of taxonomic problems of Salix species.

Keywords: Salix sp., SSR analysis, Scanning Electron Microscopies, Light Microscopy

Acknowledgements: This work was supported by Ankara University Scientific Research Coordination Unit. Project Number:

13B4240010.




169

IDDGC17-PP-149

Cloning and expression of putative cyanobacterial genes that encode phosphinothricin N-

acetyltransferase (PAT) enzyme

Ebru YILMAZ

Ondokuz Mayıs University, Faculty of Agriculture, Department of Agricultural Biotechnology, 55139 Kurupelit/Samsun , E-mail:

[email protected]

Aims and Scopes: Phosphinotricin N-acetyltransferase (PAT) is a bacterial enzyme expressed in plants to resist against herbicides

that contain phosphinothricin (PPT). Although the presence of PAT enzyme in cyanobacteria was determined by sequence analysis its

activity has not been determine yet. The aim of this study was cloning of two pat genes, alr4468 of Anabaena sp. PCC7120 and

sll1647 of Synechocystis sp. PCC 6803, and express them in Escherichia coli BL21 cells for partial purification and further enzyme

activity analyses.

Materials and Methods: Anabaena sp. PCC7120 and Synechocystis sp. PCC6803 strains were grown in BG110 and BG11 (Rippka,

1988) media, respectively. The fresh cultures were used in genomic DNA isolation as described by Lind et al., 1985. The primers for

both genes were designed by using CyanoBase (http://genome.microbedb.jp/cyanobase). PCR amplified genes were subcloned to

pGEM-T®Easy vector (Promega) and propagated in E. coli DH5α cells. The alr4468 and sll1647 gene fragments were ligated to

pET-28a(+) (Novagen)and transformed into E. coli DH5α and then into BL21 cells for expression. To confirm the recombinatnts,

PCR and restriction analyses were carried out. The recombinant E. coli BL21 cells carrying alr4468 and sll1647 genes in pET-28a(+)

were grown in Luria Broth at 37 °C and 200 rpm to get an OD600 value around 0.6. 1 mM IPTG was added to the cultures to induce

recombinant protein expression. After 5 h incubation, the cells were harvested and sonicated for protein extraction. The isolated total

protein extracts were analysed by SDS-PAGE to detect overexpressed recombinant Alr4468 and Sll1647 proteins.

Results and Discussion: The SDS-PAGE analysis showed that both enzymes were successfully overexpressed in E. coli BL21 cells

after IPTG induction. Next, the overexpressed proteins will be partially purified using Protino NiTED columns (Macherey Nagel) and

the PAT enzyme activities will be determined. If the PAT enzyme activities are present, they might be used in transfer to plants to add

PPT resistance property.

Keywords: Phosphinothricin N-acetyltransferase, cyanobacteria, protein expression

Acknowledgements: This study was supported by OndokUZ Mayıs University with the project number of PYO.ZRT.1902.16.001.

References

[1] Lind, L. K., Kallas, S. R., Lonneborg, A., Oquist, G., Guastafssan, P., 1985. Cloning of the β-phycocyanin gene from Anacystis

nidulans. FEBS Lett, 188, 27-32.

[2] Rippka, R. 1988. Isolation and purification of cyanobacteria. Editors: PArker, L., Glazer, A. N., Methods of Enzymology, 167,

Cyanobacteria, Academic Press Inc, San Diego, 3-27.

http://genome.microbedb.jp/cyanobase




170

IDDGC17-PP-150

OPTIMIZATION OF CRISPR/Cas9 SYSTEM IN TOBACCO

Dursune Merve KARATAġ1 and Musa KAVAS

1

1Ondokuz Mayıs University, Faculty of Agriculture, Department of Agricultural Biotechnology, 55139 Kurupelit/Samsun


Aims and Scopes: The CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats)/Cas9 system provides bacteria and

archaea with molecular immunity against invading phages and conjugative plasmids [1]. Recently, CRISPR/Cas9 has been widely

used for genome editing in various plants because of its simplicity, high efficiency and design flexibility [2-4] In this study, we

optimized type II CRISPR/Cas9 system to generate and estimate genome editing in the desired target genes in tobacco.

Materials and Methods: Firstly, the CD3-1980 vector was constructed containing Cas9 gene. The generated vector was transferred

to competent E.coli cells and the colonies carrying the gene were determined using PCR. Vector isolated from positive colonies were

transferred to competent A. tumefaciens cells by electroporation. Four weeks old tobacco (Nicotiana tabacum L. cv., Petite havana)

leaves were inoculated with A. tumefaciens. Transient transgenic tobacco plants were obtained by incubation for 8 weeks on MS

media includeding BA (1mg/l), NAA (0.1mg/l), Hygromycin (50mg/l) and Timentin (160mg/l). The regenerated tobacco plant was

transferred to the growth chamber. Molecular and functional characterization experiments will be performed on T1 germinated

plants. Subsequently, the donor vector will be constructed containing sgRNA and target DNA after that four weeks old T1 plants

leaves will be inoculated with A. tumefaciens.

Results and Discussion: Consequently, the effectiveness of the CRISPIR / Cas9 system in tobacco plants will be evaluated and the

use of this technology will be expanded. The presence and function of the gene transcribed in the candidate transgenic plants will be

confirmed by molecular techniques.

Keywords: CRISPR/Cas9, Tobacco, A. tumefaciens

References:

1. Ali, Z., et al., CRISPR/Cas9-mediated viral interference in plants. Genome biology, 2015. 16(1): p. 238.

2. Chen, X., et al., Targeted mutagenesis in cotton (Gossypium hirsutum L.) using the CRISPR/Cas9 system.

Scientific Reports, 2017. 7.

3. Sun, Y., et al., Generation of high-amylose rice through CRISPR/Cas9-mediated targeted mutagenesis of starch

branching enzymes. Frontiers in Plant Science, 2017. 8.

4. Jacobs, T.B., et al., Targeted genome modifications in soybean with CRISPR/Cas9. BMC biotechnology, 2015.

15(1): p. 16.




171

IDDGC17-PP-151

PCR DIAGNOSIS OF AN OUTBREAK OF INFECTIOUS LARYNGOTRACHEITIS (ILT) FROM

FFPE TISSUES IN LAYING HENS IN A COMMERCIAL CHICKEN FARM

Orhan YAVUZ1, Zeki ARAS

2, Güngör ÇağdaĢ DĠNÇEL

3

1Aksaray University, Faculty of Veterinary Medicine, Department of Pathology, Aksaray, TURKEY

2 Aksaray University, Faculty of Veterinary Medicine, Department of Microbiology, Aksaray, TURKEY

3Aksaray University, Eskil Vocational School, Laboratory and Veterinary Science, Aksaray, TURKEY

Aims and Scopes: In this study, the presence of Infectious Laryngotracheitis Virus (ILTV) was investigated in Formalin Fixed

Paraffin Embedded (F FPE) tissues in natural Infectious Laryngotracheitis (ILT) outbreak in a commercial egg laying farm in Konya /

TUKEY.

Materials and Methods: For this purpose, the material of the study comprised 20 hens that were clinically demonstrating ILT and

that were collected from the coop that performs egg laying and serologically ILTV positive in a commercial chicken farm. The FFPE

tissues of respiratory tract organs (Infraorbital sinuses, trachea/larynx, air sacs and lungs) were cut at 20 µm. These tissue sections

were placed into Eppendorf tubes and deparaffinized by xylene for DNA extraction. Then, the PCR performed [1].

Results and Discussion: Samples obtained from respiratory tract organs (Infraorbital sinuses, trachea/larynx, air sacs and lungs) of

laying hens with typical ILT lesions were 55% (11/20), 65% (13/20), 30% (6/20) and 40% (8/20) ILTV positive by PCR, respectively.

Molecular methods such as PCR have recently been used to diagnose of the ILT by many researchers [2, 3]. PCR technique has been

shown to be ancillary for diagnose of ILT when other methods are not adequate. Additionally, PCR technique is more sensitive as per

other methods such as histopathology and virus isolation, and to reduce the false positiveness [4].

Keywords: Hens, ILTV, Pathology, PCR,

References:

[1] Preis, I.S., Fiúza, A.T.L., Silva, C.C.I., Braga, J.F.V., Couto, R.M., Martins, N.R. da S., Ecco, R. Pathological,

immunohistochemical, and molecular findings in commercial laying hens and in backyard chickens naturally infected with the

infectious laryngotracheitis virus, Rev. Bras. Cienc. Avic, 2014, 16, 4, 359-366.

[2] Vögtlin, A., Bruckner, L., Ottiger, H.P. Use of Polymerase chain reaction (PCR) for the detection of vaccine contamination by

infectious laryngotracheitis virus, Vaccine 1999, 17, 2501-2506.

[3] Zhao, Y., Kong, C., Cui, X., Cui, H., Shi, X., Zhang, X., Hu, S., Hao, L., Wang, Y.,. Detection of infectious laryngotracheitis virus

by real-time PCR in naturally and experimentally infected chickens, PLoS One 2013, 28, 8, 6, 1-10.

[4] Crespo, R., Woolcock, P.R., Chin, R.P., Shivaprasad, H.L., Garcia, M. Comparison of diagnostics techniques in an outbreak of

infectious laryngotracheitis from meat chickens, Avian Diseases 2007, 51, 4, 858-862.




172

IDDGC17-PP-152

EVALUATION OF NATIVE-PAGE PROTEIN PROFILE AND OXIDANT/ANTIOXIDANT STATUS

INDEX IN CANINE GENERALIZED DEMODICOSIS

Gülay ÇĠFTCĠ 1,

*, Didem PEKMEZCĠ 2, Gökmen Zafer PEKMEZCI

3, Alper ÇĠFTCĠ

4

1 Department of Biochemistry, Faculty of Veterinary Medicine, University of Ondokuz Mayis, 55200 Atakum, Samsun;

2 Department

of Internal Medicine, Faculty of Veterinary Medicine, University of Ondokuz Mayis, 55200 Atakum, Samsun; 3Department of Aquatic

Animal Diseases, Faculty of Veterinary Medicine, University of Ondokuz Mayis, 55200 Atakum, Samsun; 4Department of

Microbiology, Faculty of Veterinary Medicine, University of Ondokuz Mayis, 55200 Atakum, Samsun, Turkey

*[email protected]

Aims and Scopes: In this study, it was aimed to evaluate the oxidative status and serum native-protein profiles (total protein,

albumin, and globulin) in dogs affected with canine generalized demodicosis.

Materials and Methods: Blood samples were collected from 8 dogs of different breeds and gender at 1–2 years of age that had been

diagnosed with generalized demodicosis. Serum total oxidant status (TOS) and total antioxidant status (TAS) and oxidative stress in-

dex (OSI) were measured as spectrophotometric by modified Erel method [1] by using Reel Assay and compared with control group.

Clinical signs of demodectic mange were calculated as the percentage of dogs positive for each sign. A semi-quantitative assessment

of hair regrowth was made. Serum protein levels were measured by using autoanalyzer. Serum protein profiles were determined by

native-PAGE method as described by Laemmli et al. [2].

Results and Discussion: TAS, TOS and OSI levels of dogs with generalized demodicosis compared with control dogs. Serum

concentration of TOS and OSI levels were found as increased; but TAS levels were evaluated as decreased in dogs with generalized

demodicosis compared with control dogs. TAS, TOS and OSI levels showed no significant difference between the control and

generalised demodicosis group (p > 0.05). There were statistically important negative correlation between TAS and OSI levels

(P<0.001).

Globulin, total protein and albumin levels were determined as increased in the demodicosis positive dogs and these increases were

evaluated as statistically important (P<0.001). Albumin/Globuline (A/G) rate were decreased without a statisticallly significance

(P>0.05). The decrease of albumin fraction and increase of gamma-globulin fraction were evaluated in native protein profiles of

demodicosis positive dogs

In conclusion, the administration of an antioxidant therapy in addition to the routine treatment should be considered in this group of

patients. Further studies need to be conducted to demonstrate the exact mechanism of oxidative stress due to in canine generalised

demodicosis dogs.

Keywords: Native-PAGE, Oxidative stress, canine generalised demodicosis, total antioxidant status

References: [1] Erel, O. Clinical Biochemistry 2005, 38, 1103–1111.

[2] Laemmli, U.K.; Amos, L.A.; Klug, A. Cell 1976, 7, 191–203.





173

IDDGC17-PP-153

DETERMINATION OF MINIMAL INHIBITORY CONCENTRATION OF

ANTIBIOTICS FOR ESCHERICHIA COLI WĠTH GES-5 MUTATIONS

Aysegul SARAL1, Azer OZAD DUZGUN

2

1 Department of Nutrition and Dietetics, Faculty of Health Sciences, Artvin Coruh University, 08000, Artvin, Turkey.

[email protected] 2 Department of Genetics and Bioengineering, Faculty of Engineering and Natural Sciences, GümüĢhane University, 29100

Gumushane, Turkey

Aims and Scopes: A new family of extended-spectrum β-lactamases is the Guiana extended-spectrum β-lactam (GES) which belongs

to the Ambler molecular class A. This enzyme confers resistance to penicillins, narrow- and expanded-spectrum cephalosporins and

ceftazidime, and 27 variants have been reported to date. In previous studies it was determined that mutations at positions 170. and

243. alter carbapenemase and cephalosporinase activity, respectively. Position 169 is located in the omega loop of class A β-

lactamases including members of the GES-type β-lactamases [1]. It was aimed to determine the effects of residues at 169., 170. and

243. positions of GES-5 on minimum inhibition concentration (MIC) in this study.

Materials and Methods: blaGES-5 was cloned into pET100/D-TOPO vector (Invitrogen) according to manufacture‘s protocol.

Recombinant vector, named pET100/D-TOPO-GES-5 was used to generate the M169A, S170A, G243A mutations by site-directed

mutations. One Shot® Chemically Competent E. coli (Invitrogen) was used as the host for transformation of recombinant plasmids.

The authenticity of cloned mutant genes was verified by sequencing. E-test was used to determine MIC. For the E-test, Mueller-

Hinton agar plates were inoculated with swabs saturated with suspensions of colonies of E. coli harboring pET100/D-TOPO-GES-5,

pET100/D-TOPO-GES-5/M169A, pET100/D-TOPO-GES-5/S170A and pET100/D-TOPO-GES-5/G243A equivalent to a 0.5

McFarland standard. E- test strips were placed onto plates according to the manufacturer‘ s instructions (BioMérieux, France). The

results were read after 18 to 24 h of incubation at 37 0C.

Results and Discussion: According to E-test results, amoxicillin, cefixime, piperacillin-tazobactam, ticarcillin/clavulanic acid,

imipenem and ceftazidime MIC values were found same for E. coli containing pET100/D-TOPO-GES-5, pET100/D-TOPO-GES-

5/M169A, pET100/D-TOPO-GES-5/S170A and pET100/D-TOPO-GES-5/G243A. The substitution at position 169 and 243 in GES-5

led to a modest decrease in MIC for cefoperazone/sulbactam. Conversely, substitution at position 170 in GES-5 led to a modest

increase in MIC for cefoperazone/sulbactam. G243A mutation led to modest decrease in MIC for amoxicillin/clavulanic acid and

cefoxitin. M169A and S170A led to a modest increase in MIC for cefaclor. Also, S170A led to decrease in MIC for meropenem

(0,03->0,008). GES-5 and variants will be expressed, purified, kinetically characterized to reveal the effects of mutations on catalytic

efficiency.

Keywords: GES-5, Alanine Mutations, Minimum Inhibition Concentration

References:

[1] Saral, A.; Leonard, D. A.; Ozad Duzgun, A.; Copur Cıcek, A.; June, C. M.; Sandallı, C. Journal of Antibiotics (Tokyo) 2016, 69, 858-862.




174

IDDGC17-PP-154

TOWARDS DETERMINING Didymella rabiei FROM INFECTED CHICKPEA SEEDS WITH RT-PCR

ANALYSES

Hatice Polatbilek1, Oğuz Akveç

1, Feyza Nur Kafadar

1, Durdane Mart

2, Canan Can

1

1. University of Gaziantep, Science and Letter Faculty, Biology Department, Gaziantep

2. Eastern Mediterranean Research Institute, Adana

Corresponding Author: Canan Can, email: [email protected]

Aims and Scopes: Didymella rabiei is one of the most economically important pathogen of chickpea worldwide causing Ascochyta

blight disease [1]. Survey studies conducted in Turkey revealed that the disease is widespread in chickpea growing areas resulting

considerable yield losses [2]. D. rabiei transmits with infected seeds therefore it's important to plant disease free material to reduce

disease incidence and severity. This study aimed to quantify D. rabiei in chickpea seeds. The data obtained may be used in quarantine

measures of this very destructive plant pathogen.

Materials and Methods: D. rabiei infected chickpea seeds were divided into 4 groups. Group 1 had the healthy capsules while

groups 2, 3 and 4 had ≥45, ~20 and ≤10 infection points, respectively. Positive group consisted of D. rabiei Pathotype III isolate

named as 40 KMN 11/14 obtained from Kırşehir-Kaman in 2014. Genomic DNA, mRNA and cDNA isolations from samples were

conducted according to manufacturers (Invitrogen, USA). Primer and probe combinations of 4 different D. rabiei spesific regions

(histone, ribosomal RNA, serine/threonine posphatese and protein kinase) were used in RT-PCR analyses [3]. Reactions were run and

analysed with Sequence Detection System (Applied Biosystems).

Results and Discussion: Each markers resulted time specific amplification from the D. rabiei isolate 40 KMN 11/14. D. rabiei

histone specific marker amplified products from groups 1, 2, 3 and 4. DNA/probe combinations of histone specific markers exhibited

amplification at 1/10 dilutions. Maximum and minimum amplification among rated infected capsules occurred in group 2 and group 3

while no product was obtained in group 3 that had the least infected capsules. Detection of pathogens from infected plants through

RT-PCR is reliable and less time consuming when compared to classical mycological methods [4]. This study revealed that the D.

rabiei specific histone, ribosomal RNA, serine/threonine posphatese and protein kinase regions could be used to determine quantity of

the agent in infected chickpea seeds. These markers should be tested to define infection rate of D. rabiei from infected explants and co

compare virulence groups.

Keywords: Chickpea, Didymella rabiei, RT-PCR, seeds

Acknowledgements: This study was supported by the Scientific and Technological Research Council of Turkey (TUBITAK) with

project no 113O071

References:

[1] Nene Y.L. Tropical Pest Management 1982, 28, 61–70.

[2] Dolar F.S., Gürcan A. Journal of Turkish Phytopathology 1992, 21, 61-65.

[3] Chilvers M.I., Dutoit L.J., Akamatsu H., Peever T.L. Plant Disease 2007, 91(5), 599-608.

[4] Schena L., Nigro F., Ippolito A., Gallitelli D. European Journal of Plant Pathology 2004, 110, 893–908




175

IDDGC17-PP-155

INVESTIGATION OF SPESIFIC IL-1β RS16944 AND IL-1RA VNTR POLYMORPHISMS: THE

SUSCEPTIBILITY CANDITATES FOR DIABETĠC PERIPHERAL NEUROPATHY IN TURKĠSH

POPULATION

Aydın Rustemoglu1, Ayse Feyda Nursal

2, Serbulent Yigit

1, Suheyla Uzun Kaya

3

1 Gaziosmanpasa University, Faculty of Medicine, Department of Medical Biology, Tokat, Turkey

2 Hitit University, Faculty of Medicine, Department of Medical Genetics, Corum, Turkey

3 Gaziosmanpasa University, Faculty of Medicine, Department of nternal Medicine, Tokat, Turkey

Aims and Scopes: Type 2 diabetes mellitus (T2DM) is a metabolic disorder that is characterized by hyperglycemia, insulin resistance,

and relative lack of insulin. Recent research suggests that inflammation plays important role in the development of T2DM [1]. Diabetic

peripheral neuropathy (DPN) is one of the most common complications of T2DM [2]. This study was undertaken to investigate the

possible association between the interleukin-1(IL-1)β, IL-1 receptor antagonist (IL-1Ra) variants and DPN in a Turkish cohort.

Material and methods: A total of 200 subjects were enrolled in this study, as 98 patients with DPN and as 102 healthy controls. The

IL-1β rs16944 and IL-1Ra VNTR variants were analyzed by PCR and PCR-RFLP methods.

Results and Discussion: Statistically significances, for overall genotype distribution in either studied loci, were found. Especially

genotype distribution of rs16944 polymorphism of IL-1β gene were highly different between DPN patients and control group

(p=0.001). The C allele in this locus was found significantly higher in DPN patients (p=0.003, OR=1.88, 95%CI=1.25-2.83). This

allele is most likely effected recessively and predisposes to disease. Given that of the CC genotype was found significantly higher in

DPN patients (p=0.0003), this genotype may have proven to be a high risk for the disease (OR=3.20, 95%CI=1.72-5.96).

A significantly difference between DPN patients and control groups for genotype distributions of IL-1Ra VNTR variant, were found

(p=0.045). But for allele distribution there was not significant difference (p=0.099). For the specific genotypes, although the a1/a1

and a2/a2 genotypes were lower in patients group, and the a1/a2 and a1/a3 genotype were higher in control groups, no statistically

significant differences were found (p>0.05). Our data suggest a potential role of IL-1Ra, and especially IL-1β as a candidate gene for

susceptibility to DPN in Turkish population.

Key words: Type 2 diabetes mellitus, diabetic peripheral neuropathy, interleukin-1β, interleukin-1Ra.

References

[1] Rodrigues KF, Pietrani NT, Sandrim VC, Vieira CM, Fernandes AP, Bosco AA, Gomes KB. Association of a Large Panel of

Cytokine Gene Polymorphisms with Complications and Comorbidities in Type 2 Diabetes Patients. J Diabetes Res 2015; 2015:

605965.

[2] Wang H, Fan D, Zhang Y. Angiogenin gene polymorphism: A risk factor for diabetic peripheral neuropathy in the northern

Chinese Han population. Neural Regen Res 2013; 8(36): 3434-3440.

http://diabetes.webmd.com/guide/diabetes_symptoms_types

https://en.wikipedia.org/wiki/Insulin_resistance

https://en.wikipedia.org/wiki/Insulin




176

IDDGC17-PP-156

THE SYNTHESIS OF CHELATE LIGAND FOR IN VITRO REMOVAL OF IRON FROM OF HUMAN PLASMA WITH

THALASSEMIA

Gülüzar ÖZBOLAT1, Abdullah TULĠ1

1Cukurova University, Faculty of Medicine Department of Biochemistry, 01330 Adana, Turkey [email protected]

Aims and Scopes: Thalassemia, is an inherited autosomal recessive is a hematological disorder. It has been predicted to be most common

monogenic disease. One viable treatment for this disease is frequent and continuous blood transfusions which results in iron overload. After as few

as 10 blood transfusions the signs and symptoms of iron overload can be seen in subject. Unfortunately; the human body does not have an effectively

coping mechanism to eliminate iron overload. Currently applied methods for treatment of iron overload is chelation therapy. Chelation is prescribed

to treat ―metal overload‖ disorders [1,2,3,4]. The synthesis of ligands that form compound with Fe (III) for thalassemia treatment is the first step in

the process, which could potentially be used in clinical practice. In this study, 3-methyl-2,4-pentanedione was obtained by alkylation of

acetylacetone. Subsequently, iron complex of 3-methyl-2,4-pentanedione was synthesized in plasma. The complexes were characterized by

elemental analyses, ICP-OES, FT-IR spectra, magnetic susceptibility and conductivity measurements. Electrochemical behavior of ligand and

complexes were examined as supporting electrolyte and platinum electrode for cyclic voltammetry. The cytotoxicity was evaluated by MTT assay.

Materials and Methods: In this study, 3-methyl-2,4-pentanedione reacted with iron at high concentrations physiological pH and room temperature.

A brown colored complex formed at the rate of 1/3. The resulting complex was solved in water even at concentration and obtained in 94 percent

yield. The complex has octahedral geometry, which is accordance with magnetic susceptibility results.

Figure 1: Synthesis of 3-methyl-2,4-pentanedione - Fe(III) complex

Results and Discussion: UV-VIS measurements showed that the amount of complexation increased depending on time. The complex has octahedral

geometry, which is accordance with magnetic susceptibility results. ICP-MS showed that concentration of iron (initial concentration is 50 ppm)

decreased to 3,5 ppm after complexation. FT-IR showed that the O-H peak of acetylacetone at 3200 cm-1 almost disappeared while C-H peak at 1437

cm-1 remained unchanged. The cyclic voltammetric behavior of the iron (III) complex of ligand was studied at room temperature. The scan rate was

100 mV s-1. The CV of complex, the redox waves with 0.20 V and were attributed to the reduction/reoxidation of the iron redox center in the ligand–

Fe(III) complex. The voltammetric behavior of free ligand is characterized by two reduction peak. The peaks potential are about 0,50 and -0.30 V

(vs. Ag|Ag+) at a scan rate v= 0.1 Vs-1. These results indicate that the reductions of free ligand and the complex take place differently. The effects of

the ligand and complex on cell viability were determined using MTT colorimetric technique. The results showed that the investigated iron(III)

complex had a significantly cytotoxic effect compared to that of the ligand. Although promising 3-methyl-2,4-pentanedione as medicine needs, more

in vitro and in vivo studies.

Keywords: 3-methyl-2,4-pentanedione, chelation, MTT, plasma

References:

[1] Borgna-Pignatti C, Gamberini MR.(2011) Complications of thalassemia major and their treatment. Expert Rev Hematol. 4(3):353-66.

[2] Swaran J.S, Pachauri V. (2010) Chelation in Metal Intoxication. Int. J. Environ. Res. Public Health , 7: 2745-2788

[3] Kohgo Y, Ikuta K, Ohtake T, Torimoto Y, Kato J. (2008) Body iron metabolism and pathophysiology of iron overload. Int J Hematol.

88(1):7-15

[4] Franchini M. Veneri D.(2004) Iron-chelation therapy: an update. Hematol J. 5:287–292





177

IDDGC17-PP-157

CYCLIC VOLTAMMETRIC AND SPECTROPHOTOMETRIC STUDY OF FE(III) WITH 8-HYDROXYQUINOLINE-5-SULFONIC

ACID

Gülüzar ÖZBOLAT1, Yusuf DöğüĢ1, Abdullah TULĠ1


[email protected]

Aims and Scopes: Iron is an essential trace element in living organisms by participating in a wide variety of metabolic processes, including oxygen

transport, nitrogen stabilization, detoxification, electron transport and DNA synthesis. Iron overloads and deficiencies are important factors in the

health of humans and are therefore a key target in drug development. In this study, iron complex of 8-hydroxyquinoline-5-sulfonic acid was

synthesized. Complex was investigated by UV-Vis spectrophotometry. The metal to ligand ratio for Fe(III)- 8-hydroxyquinoline-5-sulfonic acid

system was found to be approximately 1:3.

Figure 1: CV of 8-hydroxyquinoline-5-sulfonic acid and complex

Materials and Methods: The cyclic voltammetric studies of Fe(III)-8-hydroxyquinoline-5-sulfonic acid complex at platin electrode. The cyclic

voltammogram of the complex, at a scan rate of 100 mVs−1. The current-potential curves for ligand, and 8-hydroxyquinoline-5-sulfonic acid -

iron(III) complex using are presented in Fig. 1. A standard three-electrode assembly was employed: platinum as working electrode, Ag/AgCl as

reference electrode, and platinum wire as counter electrode. Fig. 1 shows the cyclic voltammograms (CVs) of collected at ligand and complex. The

CV of the complex is reversible.

Results and Discussion: The voltammetric behavior of free ligand is characterized by one reduction peak at a platinum surface (blue green line).

The peak potential is about -0.40 V (vs. Ag|Ag+) at a scan rate v= 0.1 Vs-1. The peak height corresponds to a one-electron reduction. There appears

no oxidation peak in the reverse scan. It is seen that the free ligand reduces irreversibly with one electron transfer on platinum surface. In contrast to

free ligand, the Iron (III)- 8-hydroxyquinoline-5-sulfonic acid complex undergoes a quasi-reversible process at the platinum surface. The complex is

characterized by reduction peaks at 0,575 V and -0,325 V and oxidation peaks 0,3 V and 0,5 V. These results indicate that the reductions of free

ligand and the complex take place differently.

Key words: CV, 8-hydroxyquinoline-5-sulfonic acid, Fe (III), Ligand

REFERENCES:

[1] Makhotkina, O., Kilmartin, P.A. The use of cyclic voltammetry for wine analysis: Determination of polyphenols and free sulfur dioxide,

Analytica Chimica Acta, 2010; 668: 155-165.

[2] Lieu PT, Heiskala M, Peterson PA, Yang Y. The roles of iron in health and disease. Mol Aspects Med. 22(1-2):1-87,2001

I/10

-2

E / V





178

IDDGC17-PP-158

ELECTROCHEMICAL STUDY OF GLYCINE COMPLEXES WITH Fe(III) IONS AT MODIFIED

CARBON PASTE ELECTROD

Gülüzar ÖZBOLAT

1, Yusuf DöğüĢ

1, Abdullah TULĠ

1


[email protected]

Aims and Scopes: Carbon electrodes are widely used in electroanalysis due to their low background current and wide potential

window suitable for the investigation of an electrochemical oxidation process, chemical inertness, low-cost, and suitability for various

sensing and detection applications. This study is related to electrochemical properties of Fe(III)-glycine complex with carbon paste

electrod that may be used in pharmaceutical applications.

Materials and Methods: The complex was synthesized and characterized with Uv-Visible and FT-IR Then the electrochemical

property of this complex Fe (III)-glycine was investigated by using cyclic voltammetry. All experiments were carried out at room

temperature, in a conventional three-electrode cell. The electrode system contained a working carbon paste electroactive electrode,

homemade, a platinum wire as a counter electrode, and Ag/AgCl as reference electrode.

Figure 1: Cyclic voltammetry of glycine (blue line curve), Fe (III)-glycine (red line curve)

Results and Discussion: Oxidation and reduction peaks were obtained as seen from the obtained curves. The voltammetric behavior

of complex is characterized by one oxidation peak at a carbon paste electroactive electrode (Fig.1). The peak potential is about 0.32 V

(vs. Ag|Ag+ ) at a scan rate v= 0.1 Vs-1 . There appears no reduction peak in the reverse scan. These results indicate that the

reductions of free ligand and the complex take place differently.

Keywords: Glycine, iron (III), ligand, complex, carbon paste electrod

References:

[1] Sun, D.; Zhu, L.; Zhu, G. Glassy Carbon Ceramic Composite Electrodes. Anal. Chim. Acta 2006; 564: 243-247.

[2] Ramirez-Garcia, S.; Alegret, S.; Cespedes, F.; Forster, R. J. Carbon Composite Electrodes: Surface and Electrochemical

Properties. Analyst 2002; 127: 1512-1519.

[3] Makhotkina, O., Kilmartin, P.A. The use of cyclic voltammetry for wine analysis: Determination of polyphenols and free

sulfur dioxide, Analytica Chimica Acta, 2010;668: 155-165.

I/10

-2

E / V





179

IDDGC17-PP-159

MOLECULAR IDENTIFICATION OF NONOMURAEA SP. 12C250 ISOLATED FROM BEDROCK

MATERIAL, SAMSUN

Salih SARICAOĞLU1, Kamil IġIK

1, Ahmet Rıdvan TOPKARA

1, Hilal AY

1, Talha GENÇBAY

1, Orhan DENGĠZ

2

1Department of Biology, Faculty of Art and Science, Ondokuz Mayis University, 55139, Samsun, Turkey.

2Department Plant Nutrition and Soil science, Faculty of Agriculture, Ondokuz Mayis University, 55139, Samsun, Turkey.

Aims and Scopes: This study was aimed to isolate Actinomycete strains from bedrock material of Samsun and also to gain novel

species for the literature. Being an unstudied habitat in terms of Actinomycete diversity, bedrock material has a great potential for

novel Actinomycetes producing bioactive secondary metabolites.

Materials and Methods: In this study, microorganisms were isolated from nine different media applying standart dilution method

[1]. Selected 155 isolates on the basis of morphological characteristics were analysed for 16S rRNA gene sequence data. PCR

amplification of 16S rRNA gene region was conducted by using universal primers 27f and 1525r [2] and sequence data was obtained

by using five different universal sequencing primers. Obtained 16S rRNA gene sequence data of strain 12C250 were aligned in

MEGA6 programme [3]. Phylogenetic trees was inferred by using neighbour-joining method [4].

Results and Discussion: Obtained almost complete 16S rRNA gene sequence analysis, 12C250 isolate was identified to belong to the

genus Nonomuraea. The strain 12C250 shared highest 16S rRNA gene sequence similarity and nucleotide differences with

Nonomuraea candida (11/1389;99.2%), Nonomuraea salmonea(17/1434;98,8%) and Nonomuraea turkmeniaca (17/1414;98,8%)

respectively.

Our findings are considered to have high probability of being novel species according to 16S rDNA analysis of the strain

12C250. Therefore, the isolate should be carried out completion of DNA-DNA homology, polar lipids, isoprenoid quinones analysis

and phenotypic characterization. A polyphasic approach will be adopted to determine exact positions of the strain 12C250.

Keywords: Actinobacteria, Nonomuraea, Samsun, 16S rRNA gene sequencing

Acknowledgements: This research was supported by TUBITAK, Project no: 213O073.

References:

[1] Sivakumar K., 2008. Actinomycetes. In Centre of Advanced Study in Marine Biology Annamalai University.

[2] Lane D.J., 1991. 16S/23S rRNA sequencing. In Nucleic Acid Techniques in Bacterial Systematics, pp. 115-148. Edited by E.Stackebrandt and

M. Goodfellow, JohnWiley and Sons, Chichester.

[3] Tamura K.,Peterson D., Peterson N., Stecher G., Nei M., Kumar S., 2011. MEGA6: Molecular Evolutionary Genetics Analysis Using Maximum

Likelihood, Evolutionary Distance, and Maximum Parsinomy Methods. Mol Bio Evol, 28, 2731-2739.

[4] Saitou N., Nei M., 1987. The neighbour-joining method: a new method forconstructing phylogenetic trees, Molecular and Biological Evolution,

4, 406- 425.




180

IDDGC17-PP-160

DNA barcoding of the Striped Hyaena (Hyaena hyaena) in Hatay and ġanlıurfa-Turkey

Erol Atay1, Ahmet Kasapoğlu1

1Department of Biology, Faculty of Arts and Sciences, Mustafa Kemal University, 31000 Hatay/Turkey.

[email protected]

Aims and Scopes: In this study, DNA barcoding studies of striped hyenas whose numbers are decreasing rapidly and one of the great carnivores in Hatay and Şanlıurfa

provinces, were carried out. We performed molecular characterization of striped hyenas in Turkey for the first time using Cytb mitochondrial DNA isolated from hair, ear and carcass tissues. Sequences of Cytb DNA sequences from10 different striped hyena samples from Turkey were found to be identical to each other. Comparison

of the sequences with the previously reported Cytb sequences, including prehistoric ones, showed that Ctyb gene was highly conserved among the Hyaena hyaena

species. In this study, mitochondrial cytochrome oxidase b (cytb) gene barcoding of Turkish striped hyenas was revealed and relationship with other striped hyenas analyzed.

Material and Methods

DNA Isolation: Carcass (2 samples), hair (7 samples) and ear (1 sample) tissues of striped hyaenas were used for molecular analyses. BiospeedyTM DNA Isolation Kit

(Bioeksen Ltd. Co., Turkey) was used for the DNA extraction. Briefly, 200 mg of the tissue sample was homogenized at 6000 rpm for 2 minutes in a buffer (2% CTAB -hexadecyltrimethylammonium bromide-, 100 mM TrisHCl pH 8, 20 mM EDTA, 1.4 M NaCl) containing 0.1 mm diameter glass beads. The samples were then

incubated at 98°C for 10 minutes. The samples were centrifuged and the supernatant was combined with a binding buffer (final concentration of 3.4 M Guanidinium

thiocyanate, 8 mM Tris-HCl pH 8.0, 25% isopropanol). The extracted DNA was captured using silica columns and then washed twice with a buffer containing 20 mM NaCl, 2 mM Tris-HCl, pH 7.5; 80% v/v Ethanol. The DNA was eluted in 100 mM Tris-HCl pH 8.0 and stored at -20°C.

Primer design PCR primers were designed based on comparison of the available Hyaena hyaena mithocondrial cytochrome b (cytb) gene sequences retrieved from

Genbank. The sequences were aligned using Clustal Omega (www.ebi.ac.uk) and the primers were designed manually. 5'-AACAACCGCCTTTTCATCAG-3' forward and 5'-GGGTTGGCTGGTGTGTAGTT-3' reverse primers were designed to amplify 606 bp region of the ctyb. The specifity of the primers were tested using Primer-

Blast (www.ncbi.nlm.nih.gov).

Real time PCR (Q-PCR): BiospeedyTM EvaGreen Master Mix (Bioeksen Ltd. Co., Turkey) and Biorad CFX Connect (Biorad Inc., U.S.A.) were utilized for all reactions. Reaction mixes contained 25 ng template DNA, 6mg/ml BSA, 5 mg/ml PEG 400, 0.25% Tween 20, 20 mM Tris-HCl pH 8.4, 50 mM KCl, 1.5 mM MgCl2,

0.2 mM dNTP mix, 0.1U Proof Reading Hot-Start DNA Polymerase and 200 nM of each primer. The following thermocycling program was applied: 98°C, 3 min; 35

cycles of 10 s at 95°C, 5 s at 55°C and 20 s at 72°C. A melt curve analysis was performed from 65°C to 95°C to determine if only one amplified product was generated during Q-PCR. Q-PCR runs were analyzed using Biorad CFX Connect Software.

DNA sequencing and phylogenetic analysis: The Q-PCR products larger than 100 bp were purified using BiospeedyTM PCR Product Purification Kit (Bioeksen Ltd.

Co., Turkey). The purified DNA was sequenced using the ABI prism Big Dye Terminator Cycle Sequencing Ready Reaction Kit on an ABI Prism 377 DNA sequencer

(Applied Biosystems, USA). The sequence was analyzed in Chromas (www.technelysium.com) and manually checked for reading errors. Homology search of the

sequence in DNA databases was performed with BLAST (www.ncbi.nlm.nih.gov). The sequence was submitted to the GenBank and; an accession number (KU881801)

was assigned by the GenBank. The sequence and its closest matches in GenBank were aligned using Clustal Omega (www.ebi.ac.uk) followed by manual adjustments. Only unambiguously aligned base positions were used in the analysis. Neighbor-joining method was performed with the MEGA software (www.megasoftware.net) to

construct an unrooted phylogenetic tree. The percentage of replicate trees in which the associated taxa clustered together in the bootstrap test (100 replicates) is shown

next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Poisson correction method and are in the units of the number of amino acid substitutions per site. All positions

containing gaps and missing data were eliminated.

Results: In order to investigate the effect of geographical distribution on genetic diversity of hyena species Cytb DNA sequence of dead hyena was compared to that of other hyena sequences. Results showed that Cytb DNA sequences of the studied 10 different striped hyena samples were identical to each other. The obtained Cytb

DNA sequence was deposited to the database can be accessed from the GenBank (KU881801). Sequence of KU881801 was compared with the previously reported

Cytb sequences (Table 1 and Fig. 2) a phylogenetic tree was constructed. The evolutionary history was inferred using the Neighbour-Joining method. The optimal tree with the sum of branch length = 0.011 is shown. Sequences retrieved from prehistoric samples of Germany (AY048787), Greece (DQ157578), Russia (DQ157576),

Angola (DQ157582) and Syria (DQ157577) are clearly separated from existing of Turkey (KU881801), Germany (AF153055, AY048788), France (JF894376) and

U.S.A. (AY926678). Discussion: Barcoding of wild animals is a useful tool to track animals even using animal parts such as hairs, faces, urines. In the present study, universal primers

successfully amplified Ctyb region of mitochondrial DNA (mtDNA) and similarity among other striped hyenas from different geographical region was analyzed. In a study, wolf range expansion in France and Switzerland has been traced back using mtDNA isolated from faces and hair samples and successfully distinguished

maternal lineages of wolf (Valière et al., 2003). Compared Cytb sequences of striped hyenas were found to be highly conserved within the species from very distant

geographical locations. Prehistoric striped hyenas from Syria and Angola seem to have the same maternal ancestry. On the other hand, sequences of existing hyena samples had identical to those prehistoric European hyena samples. The existing hyenas interestingly had conserved cybt sequences regardless of the geographical

distance even though striped hyenas have more nomadic nature. The Cytb sequence from Turkey is less similar to the sequences from geographically close locations

such as Syria and Greece. Genetic distance between cave and spotted hyenas was found to be lower than that with striped hyenas (Rohland et al., 2005). Contrary to striped hyenas wolves show more genetic diversity as the distance gets larger (Mech, 1987).

Key words: Striped hyena, Hyaena hyaena, cytochrome oxidase b, DNA barcoding

References

Mech, L.D., 1987. Age, season, distance, direction, and socialaspects of wolf dispersal

from a Minnesota pack. In Mammali and Ispersal Patterns Chepko-Sade BD, Halpin ZT (Eds). Chicago: University of Chicago Press, pp. 55–74.

Rohland, N., Pollack, J.L., Nagel, D., Beauval, C., Airvaux, J., Pääbo, S., Hofreiter, M.,

2005. The population history of extant and extinct hyenas. Mol. Biol. Evol. 22: 2435– 2443.

Valière, N., Fumagalli, L., Gielly, L., Miquel, C., Lequette, B., Poulle, M.L., Taberlet, P.,

2003. Long‐distance wolf recolonization of France and Switzerland inferred from non‐ invasive genetic sampling over a period of 10 years. Animal Con 6: 83-92.




181

IDDGC17-PP-161

THE INVESTIGATION OF ACE I/D VARIANT OF FMF-RELATED AMYLOIDOSIS

SUSCEPTIBILITY IN TURKISH PATIENTS Serbulent Yigit

1, Ayse Feyda Nursal

2, Akın Tekcan

3

1 Gaziosmanpasa University, Faculty of Medicine, Department of Medical Biology, Tokat,Turkey

2 Hitit University, Faculty of Medicine, Department of Medical Genetics, Corum, Turkey

3 Ahi Evran University, Faculty of Medicine, Department of Medical Biology, Kirsehir , Turkey

Aims and Scopes: Familial Mediterranean fever (FMF) is an autosomal recessive autoinflammatory disease [1]. The most important

complication of FMF is secondary amyloidosis, which can lead to renal failure. The angiotensin I-converting enzyme (ACE) plays an

important role in the physiology of the blood vessels and inflammatory process [2]. The objective of this study was to evaluate the

possible association between ACE gene insertion/deletion (I/D) variant and FMF-related amyloidosis in Turkish patients from the

Inner Black Sea region.

Materials and Methods: This study was performed on 40 patients with FMF-related amyloidosis and 50 healthy controls. For all

participants, ACE I/D variant was detected by the polymerase chain reaction (PCR) using specific primers.

Results and Discussion: The ACE I/D genotype frequencies of II, ID, and DD were 18%, 40.7%, and 42% in the control group, and

10%, 50%, 40% in the patient group, respectively. There was not any significant difference in the distribution of the ACE genotypes

between patient and controls (p>0.05). The allele frequencies of I and D alleles were 35%, 65% in patients and 38%, 62% in controls.

The ACE alleles did not differ significantly between the two groups (p>0.05; OR:0.87, 95% Cl: 0.47-1.62). ACE I/D variant does not

confer any increased risk for FMF-related amyloidosis in Turkish patients. However, because of the small sample size, these results

require confirmation by a larger study.

Keywords: Secondary amyloidosis, angiotensin I-converting gene, insertion/deletion variant

References

[1] Celikbilek M, Dogan S, Akyol L, , Borekci E, Zararsiz G, Kozan M, et al. Neutrophil-lymphocyte ratio in patients with familial

Mediterranean fever. J Clin Lab Anal. 2015; 29(1):80-3

[2] Nadalin S, Buretić-Tomljanović A, Lavtar P, Starčević Čizmarević N, Hodžić A, Sepčić J, Kapović M, Peterlin B, Ristić S. The lack of

association between angiotensin-converting enzyme gene insertion/deletion polymorphism and nicotine dependence in multiple

sclerosis. Brain Behav. 2016 Nov 14;7(1):e00600.

https://www.ncbi.nlm.nih.gov/pubmed/?term=Celikbilek%20M%5BAuthor%5D&cauthor=true&cauthor_uid=24687426

https://www.ncbi.nlm.nih.gov/pubmed/?term=Dogan%20S%5BAuthor%5D&cauthor=true&cauthor_uid=24687426

https://www.ncbi.nlm.nih.gov/pubmed/?term=Akyol%20L%5BAuthor%5D&cauthor=true&cauthor_uid=24687426

https://www.ncbi.nlm.nih.gov/pubmed/?term=Borekci%20E%5BAuthor%5D&cauthor=true&cauthor_uid=24687426

https://www.ncbi.nlm.nih.gov/pubmed/?term=Zararsiz%20G%5BAuthor%5D&cauthor=true&cauthor_uid=24687426

https://www.ncbi.nlm.nih.gov/pubmed/?term=Kozan%20M%5BAuthor%5D&cauthor=true&cauthor_uid=24687426

https://www.ncbi.nlm.nih.gov/pubmed/?term=Neutrophil-lymphocyte+ratio+in+patients+with++familial+Mediterranean+fever.+J+Clin+Lab+Anal+2015%3B+29(1)%3A80-3.

https://www.ncbi.nlm.nih.gov/pubmed/?term=Nadalin%20S%5BAuthor%5D&cauthor=true&cauthor_uid=28127518

https://www.ncbi.nlm.nih.gov/pubmed/?term=Bureti%C4%87-Tomljanovi%C4%87%20A%5BAuthor%5D&cauthor=true&cauthor_uid=28127518

https://www.ncbi.nlm.nih.gov/pubmed/?term=Lavtar%20P%5BAuthor%5D&cauthor=true&cauthor_uid=28127518

https://www.ncbi.nlm.nih.gov/pubmed/?term=Star%C4%8Devi%C4%87%20%C4%8Cizmarevi%C4%87%20N%5BAuthor%5D&cauthor=true&cauthor_uid=28127518

https://www.ncbi.nlm.nih.gov/pubmed/?term=Hod%C5%BEi%C4%87%20A%5BAuthor%5D&cauthor=true&cauthor_uid=28127518

https://www.ncbi.nlm.nih.gov/pubmed/?term=Sep%C4%8Di%C4%87%20J%5BAuthor%5D&cauthor=true&cauthor_uid=28127518

https://www.ncbi.nlm.nih.gov/pubmed/?term=Kapovi%C4%87%20M%5BAuthor%5D&cauthor=true&cauthor_uid=28127518

https://www.ncbi.nlm.nih.gov/pubmed/?term=Peterlin%20B%5BAuthor%5D&cauthor=true&cauthor_uid=28127518

https://www.ncbi.nlm.nih.gov/pubmed/?term=Risti%C4%87%20S%5BAuthor%5D&cauthor=true&cauthor_uid=28127518





182

IDDGC17-PP-162

EXOSOMES: A NEW GENERATION DRUG DELIVERY VEHICLE IN CANCER

Beyza Ecem Oz

1, Ender Simsek

1, Ozen Ozensoy Guler

1

1 Department

of Medical Biology, Faculty of Medicine, Ankara Yildirim Beyazit University, Bilkent Campus, Ankara, Turkey,

[email protected]

Aims and Scopes: Exosomes are extracellular vesicules generally described as a group of microvesicles with small size of 30-100 nm

[1]. These vesicules contain wide range of biomolecules and carry these molecules between cells [2]. Thus, they play an important

role in many biological activities such as intercellular communication, signal transduction, genetic material transfer and regulation of

immunological response [3]. Especially the communication between the cancer cells in the tumor microenvironment makes these

vesicles remarkable [2]. The purpose of this review is to understand and to evaluate the role of exosomes in cancer.

Materials and Methods: Exosomes can be obtained from cell culture, supernatants and body fluids. Recently, there are several

methods for the isolation and characterization of exosomes, including ultracentrifugation, ultrafiltration, size exclusion (e.g., filters or

chromatography), immunoaffinity separation, polymeric precipitation, microfluidics, commercial kits, exo-spin precipitation,

OptiPrep density gradient purification, aqueous two phase systems (e.g., PEG/ dextran aqueous two phase systems), nanoplasmonic

exosome sensor, magnetic nanosensor [1]. Besides, transmission electron microscopy can be used for shape and size analysis of

exosomes. Identification of exosome is performed with western blot and flow cytometry. As a final step, nucleic acid sequencing,

western blot or ELISA can be used for exosome RNA and protein identification in the follow-up study [2].

Results and Discussion: Exosomes regulate cellular mechanisms associated with cancer hallmarks during carcinogenesis [1]. These

vesicules have roles in angiogenesis, invasion-metastasis and tumor immunity because they have exosomal proteins and miRNAs

contributing to cancer development [2, 4] Furthermore, the studies demonstrated that there are several biomarkers in the exosomes

from the biofluids in cancer patients [4]. Moreover, exosomes have roles in cancer treatment [2]. In addition to all this, because of its

role in the pathogenesis of diseases, they can be used in diagnosis of various cancer types [3].

Keywords: Cancer, Exosome, Extracellular vesicule References:

[1] Sharma, A.; Khatun Z.; Shiras, A. Nanomedicine (Lond.), 2016, 11, 421-437.

[2] Wang, Z.; Chen, J.; Liu, J.; Tian, L. J Transl Med, 2016, 14:297.

[3] Kahraman, T.; Güçlüler G.; Gürsel, Ġ. Turk J Immunol, 2014, 2:34-40.

[4] Guo, L.; Guo N. Critical Reviews in Oncology/Hematology, 95, 2015, 346-358.




183

IDDGC17-PP-163

HOW COULD WE DETECT CIRCULATING TUMOUR CELLS?

Tugba Kevser UYSAL1, Ender SIMSEK

1, Ozen Ozensoy GULER

1

1Department of Medical Biology, Faculty of Medicine, Ankara Yildirim Beyazit University, Bilkent Campus, Ankara, Turkey.

[email protected]

Aims and Scopes: Circulating tumor cells (CTCs) play a crucial role in the metastatic spread of carcinoma and CTCs have been

interested of a subject in the past few decades in terms of prognosis and response to the therapy in several cancer diseases. Due to the

rare nature of CTCs, CTC detection methods must be highly sensitive and specific [1]. Therefore, this process typically requires both

enrichment and detection steps [2]. A variety of methods and their combinations are used in these steps [3]. This review focuses on

recent CTCs detection methods using for identification, enumeration, and characterization of CTCs.

Materials and Methods: CTC detection methods can be grouped into three major categories: positive selection, negative selection,

and selection-free. Both positive and negative selection strategies rely on differing properties and characteristics of white blood cells

and CTCs within the blood. These can be divided into three main categories: physical properties, biological markers, and functional

properties. The other strategy, selection-free, includes flow cytometry, reverse transcription polymerase chain reaction (RT-PCR) and

high-throughput microscopy [4].

Results and Discussion: Recently, CTCs are considered to be the most appropriate tumor markers used in cancer diagnosis [5].

Moreover, studies on the genotype and phenotype of CTCs suggest that the malignant nature of the tumor cell, the early detection of

metastases and the chances of success in treatment may be clarified [6]. Despite the all current methods, there is still a lack of

sensitive methodology. As CTC-related methods are developed, more successful results will be obtained in enumeration and

characterization of CTCs.

Keywords: CTC:Circulating tumor cells, CTCs detection methods, cancer, metastasis.

References:

[6] Sieuwerts, A. M.; Kraan, J.; Bolt-de Vries, J.; van der Spoel, P.; Mostert, B.; Martens, J. W.; Gratama, J. W.; Sleijfer, S.; Foekens, J. A.

Breast Cancer Res Treat., 2009, 118, 455-468.

[7] Hong, B., Zu, Y. Theranostics., 2013, 3, 377-394.

[8] Lowes, L. E.; Allan, A. L. Cancers (Basel)., 2014, 6, 595-624.

[9] van der Toom, E. E.;, Verdone, J. E.; Gorin, M. A.; Pienta, K. J. Oncotarget., 2016, 7, 62754-62766.

[10] Smirnov DA, Zweitzig DR, Foulk BW, Miller MC, Doyle GV, Pienta KJ, Meropol NJ, Weiner LM, Cohen SJ, Moreno JG,

Connelly MC, Terstappen LW, O'Hara SM. Global gene expression profiling of circulating tumor cells, Cancer Res., 2005, 65(12):4993-

4997.

[11] Pantel, K.; Brakenhoff, R. H.; Brandt, B. Nat Rev Cancer., 2008, 8, 329-340.




184

IDDGC17-PP-164

TAGUCHI OPTIMIZATION OF PCR CONDITIONS FOR SELEX DNA LIBRARIES

Muazzez Poyraz1, Elif Yıldız

1, Uğur Köklü

2, Abdullah Tahir Bayraç

1

1 Karamanoğlu Mehmetbey University, Department of Bioengineering, Karaman, Turkey

2 Karamanoğlu Mehmetbey University, Department of Mechanical Engineering, Karaman, Turkey

[email protected]

Text

Random DNA library is a cardinal part of the aptamer selection and the SELEX (Systematic evolution of ligands by exponential

enrichment) methodology. To be able to find the best binding aptamer candidates, a library with high diversity is very important but

also multiplication efficiency and specificity of the selected DNA pools is the other important factor affecting the success of SELEX.

During the repeating cycles of SELEX, researchers have generally low amounts of templates to be used in the PCR, so a large set of

PCR optimization is impossible. Most of the researchers just consent cycle optimization and keep the ball running. Since having

unwanted byproducts is common and very problematic throughout the SELEX optimization of PCR in each cycle has a vital

importance [1]. Taguchi method is one of the optimization methods extensively used for engineering processes [2]. Here, we

demonstrated the feasibility of Taguchi method to optimize PCR conditions of SELEX DNA libraries. In this study, we suggest a new

approach by using orthogonal factorial arrays with Taguchi method. Optimization of a single DNA pool was completed with 16 PCR

reactions instead of 256 reactions using conventional factorial arrays.

Aims and Scopes:

The purpose of this study is to optimize PCR conditions of SELEX libraries to get specific and high yield PCR products using

Taguchi method.


In this study we used a random DNA library having ~1013

different sequences. We used Taguchi methods to find optimal PCR

conditions for a DNA library that has a sequence of 5‘AGAGACCCTGACTGCGAA-(N44)-TGGACACGGTGGCTTCTT-3‘ (80-

mer). In optimization MgCl2, primer, buffer, template factors are used in 4 different levels and PCR products are loaded on 3%

agarose gel electrophoresis and product yields which were affected by the reaction components were determined using gel analysis

software. In order to get the most specific and high yield product Taguchi was aimed to minimize unwanted bands and maximize

wanted PCR product. The results were analyzed by Taguchi method using Minitab software.


In this study, we optimized the concentrations of primers, MgCl2, buffer and template by detecting signal/noise ratios of each reaction

components. The large number of signal/noise ratio was the optimal reaction conditions of PCR for DNA library. Finally, the optimal

reaction conditions were estimated as 0.05 µM primer, 5mM MgCl2, 1.25X Taq buffer, 0.75nM template.

Keywords:

Taguchi method, SELEX, PCR, DNA library, Aptamer.

References:

[1] Ozalp, V. C.; Kavruk, M.; Dilek, O.; Bayrac, A.T. Current Topics in Medicinal Chemistry 2015, 15/12, 1125-1137 [2] Cobb, B. D.; Clarkson, J. M. Nucleic Acids Research 1994, 22, 3801-3805.




185

IDDGC17-PP-165

PURIFICATION OF PON1 ENZYME FROM SHEEP LIVER MICROSOMES AND

INVESTIGATION OF IN VITRO INHIBITION EFFECTS ON ENZYME ACTIVITY OF SOME

UNMARKED RADIONUCLIDE DRUGS

Busra Cebeci1, Sukru Beydemir

2, …

1Hitit University, Alaca Avni Celik Vocational School, Food Processing Department, Turkey

2Anadolu University, Pharmacy Faculty, Turkey

[email protected]

Aims and Scopes: Paraoxonase (PON I, E .C .3.1.8.1) is an enzyme associated with HDL [1, 2]. The enzyme has received this name

because of its ability to hydrolyze the paraoxonin pnitrofenol and diethylphosphate. The enzyme is an esterase responsible for the

hydrolysis of the O-P ester bond in the paraoxone structure. PON1 is synthesized from the liver [2]. Although there is much

information about serum PON1, little information is available on liver microsomal PON1.

Materials and Methods: In this study, sheep liver microsomes were purified using PON1 enzyme DEAE ion exchange and

Sephadex G-150 gel filtration chromatography methods. In vitro inhibition effects of radionuclide-free tin (II)-chloride dihydrate,

MIBI, pyrophosphate, exametazime, diethylenetriamine penta acetic acid, methylene diphosphonic acid drugs on sheep liver

microsomal PON1 enzyme activity were examined.

Results and Discussion: Microsomal PON1 enzyme was purified 392,33 fold with a specific activity of 1687.03 EU / mg using 9%

yield with DEAE-Sephadex A-50 ion exchange and Sephadex G-150 gel filtration chromatography techniques. Then, percent activity

graph [%] of drug for the above-mentioned radionuclide-unmarked drugs were plotted and IC50 values were calculated as in order of

above mentioned drugs 0.0029 mM, 0.0114 mM, 0.0400 mM, 0.0400 mM, 0.0740 mM, 1.2800 mM.

Keywords: PON1, unmarked radionuclide drugs

References:

[1] W.N. Aldridge, Bichem J„ 1953, 53, 117.

[2] A. Canales, FJ. Sanchez-Muniz, Med, Clin. 2003, 121, 537





186

IDDGC17-PP-166

CONSTRUCTION OF A GENE EXPRESSION VECTOR FOR RHODOBACTER

SPHAEROIDES USING A STRONG PROMOTER

Münevver Gülsüm Erdoğan¹*, Hasan Hüseyin Doğan¹

Selçuk Universty, Science Faculty, Biology Department, Selçuklu/Konya,Turkey

Corresponding author: [email protected]

Aims and Scopes: Like other bacteria, gene expression vectors are needed to produce high value added products with PNS bacteria.

In this study, a gene expression vector (PTR) with a strong promoter was designed and constructed for R. sphaeroides. By developing

this system, it will be possible to produce high value added products.

Materials and Methods: First of all, the expression vector elements such as promotor, 6-His tag, stop codons in three reading frame,

transcription terminator and unique restriction endonuclease recognition sites were selected after elaborate analyses and combined in

frame. As a strong promoter, the promoter of the nifHDK operon which encodes Mo-nitrogenase enzyme in R. sphaeroides was

selected. After in silico design of the expression cassette, the whole sequence was synthesized as a synthetic biology approach. As the

vector backbone, a broad host range cloning vector pBBR1MCS2 was used. The vector was cut with SspI and then the construct was

ligated to this site forming the final construct pTR1.

Results and Discussion: All the sequences for promoter, 6-His tag, stop codons in three reading frame, transcription terminator and

unique restriction endonuclease recognition sites were assembled using ―Clone Manager 6‖ software. The final construct pTR1 has

SmaI site just proceeding ribosome binding site. It is also the site where the gene of interest could be cloned and expressed. The size

of the expression vector is 4836 bp which is quite short enough to be able to clone and express long genes. The construct has a

kanamycin resistant gene as a marker and it has the same orientation with the expression cassette. One of the known strong promoters

in PNS bacteria is the nif promoter. In this study, this promoter was used to express biotechnologically valuable proteins in

Rhodobacter sphaeroides. The second advantage of the expression vector is that it is relatively short which enables itself to

accommodate long genes since plasmid based vectors have limited carrying capacity. The third advantage of the construct is that it

can be transferred to the PNS bacteria by conjugation since it has the mob gene. Finally, the vector could further be manipulated so

that it can allow polycistronic gene expression.

Keywords: Rhodobacter sphaeroides, expression vector, gene expression

References: This study was supported by Selçuk University Scientific Research Projects Coordination Unit with the project number

―16201085‖.




187

IDDGC17-PP-167

ASSESSMENT OF DNA EXTRACTION METHODS FOR ALGAE

Nuri ERCAN1, Ġlkay AÇIKGÖZ ERKAYA

2, Tülay ÖZER

3, Fahriye SÜMER ERCAN

4

1Faculty of Agriculture, Ahi Evran University, KırĢehir, Turkey

2Deparment of Environmental Engineering Faculty of Engineering and Architecture, Ahi Evran University, KırĢehir, Turkey

3 Department of Biology, Faculty of Science and Art, Ahi Evran University, KırĢehir, Turkey

4Department of Genetics and Bioengineering, Faculty of Engineering and Architecture, Ahi Evran University, KırĢehir,

Turkey, e mail: [email protected]

Aims and Scopes: The aim of the study is to find the most efficient protocol for obtaining DNA from Spirogyra spp.

Materials and Methods: In our study we compared three DNA extraction methods; a Chelex resin (C100), Qiagen DNA extraction

kit and Cethyl Trimethyl Ammonium Bromide (CTAB) protocols obtained from algae samples. Different DNA extraction protocols

are evaluated for DNA isolation from various organisms. We tried all extraction methods on Spirogyra that is a genus of

filamentous algae of the order Zygnematales. The sampled DNA was quantified by taking the optical density (OD) measurements at

260 and 280 with a spectrophotometer and the purity was evaluated by the ratio of OD260/OD280. The A260/A280 ratio demonstrate the

DNA purity, 1.8-2.0 values suggest ―pure DNA‖ [1]. In DNA isolation with Qiagen protocol we coupled this method with cell

breakage by agitation in the presence of glass beads. Using RAPD-PCR, we demonstrated banding profiles of the DNA extracted

from algae samples with and without glass bead. RAPD-PCR was performed using 2 µl of DNA template in a 15 µl reaction

containing 1.5μl PCR buffer (10X buffer with (NH4)2 SO4, Fermentas), 0.5μl dNTPs (10mM stock solution), 2μl random primer

(10μM, Opc2), 0.25μl Taq Polymerase (5 u/μl, Fermentas), 1.5μl MgCl2 (25mM stock solution, Fermentas), 1.2μl BSA (10mg/ml)

and 6.05μl of sterile distilled water. The PCR products were electrophoresed in a Tris-Asedic Acid-EDTA buffer by 1% agarose gel

for 1.5 h at 80V. The DNA was stained with ethidium bromide and the bands were photographed under UV light.

Results and Discussion: In molecular-based studies, extraction of DNA is the most critical step. We compared three different

isolation protocols. All tested protocols are practical, inexpensive, not time consuming and comparatively low toxic. In present study,

we have obtained DNA with all tested procedures. The differences between isolation methods were statistically significant (P˂0,05)

and the difference was determined using the Tukey test. Although, the hihgest yield of DNA was obtained from C100 method, the

purest DNA was obtained with Qiagen protocol. In DNA isolation with Qiagen protocol we coupled this method with glass beads.

More DNA amount was obtained from crushed samples using glass beads than other. RAPD-PCR is an important and sensitive

method to approve the concentration and purity of the template DNA by producing consistent banding patterns [2]. Using RAPD-

PCR, we demonstrated banding profiles of the DNA extracted from algae samples with and without glass bead.

Keywords: DNA extraction, Algae, Chelex resin, CTAB

References:

[1] Tixier, M. S.; Okassa, M.; LIiguori, M.; Poinso, A.; Salerno, B. and Kreiter, S. Acarologia, 2010, 50(4): 487-494.

[2] Lickfeldt, D. W.; Hofmann, N. E.; Hamblin, A. M. And Voigt, B. Hort Science, 2002, vol. 37, pp. 822–825.

https://en.wikipedia.org/wiki/Genus

https://en.wikipedia.org/wiki/Order_(biology)

https://en.wikipedia.org/wiki/Zygnematales




188

IDDGC17-PP-168

DETERMINATION OF BIOGAS RATIOS BY MIXING OLIVE MILL WASTEWATER WITH

FERTILIZERS OBTAINED FROM THREE DIFFERENT ANIMAL SPECIES IN ÇANAKKALE

Duygu ÇAKMAK

1* Kübra BĠLGĠÇ

2 Baboo ALĠ

1

1COMU Faculty of Agriculture, Department of Agricultural Biotechnology, Terzioglu Campus, Çanakkale

2COMU Graduate School of Natural and Applied Sciences, Department of Bioengineering and Material Engineering, Çanakkale

*Corresponding author’s e-mail:[email protected]

Abstract

Biogas; such a usable gas that is obtained after the breakdown of the biochemical fermentation and microbiological activity of plant

and animal wastes under anaerobic conditions. In this study; Tahirova sheep, Saanen goat and Atabey chicken manures were

compared with each other after mixing olive mill wastewater into them aim to determine the biogas ratios and the microorganism

density using spectrophotometer. 200 ml samples were prepared with olive mill wastewater in the form of 40% solid matters for each

of three different species. The samples were incubated for a period of 21 days in 135 rpm at 35.5 °C. Samples were taken at intervals

of one week and measured for microbial density at a wavelength of 550 nm. The pH value was adjusted 7 throughout the experiments.

Quantities of biogas were determined as sheep>goat>chicken after 21 days of this study. According to the results, dry matter contents

were recorded as 55.2% for sheep, 51.2% for goat, and 64% for chicken. It was noted that the manure containing the highest dry

matter content was the chicken manure. When compared in terms of microbial growth; the samples containing sheep and goat

manures completed the lag phase in the first 10 days, and significant change was not observed in microbial density while entering into

inert (stationary) phase in the second part of experiment. However, the latent phase in the first stage of sample, which contained

chicken manure, took much time as compared to other samples, and determined that it was still found in the lag phase at the second

stage of experiment. Saanen goat manure had the highest microbial density while the manures of Tahirova sheep was observed with

the highest biogas ratios. In spite of this, there is no biogas investment in Çanakkale province and its vicinity till now. In conclusion, it

was aimed to execute the potential of obtaining the renewable energy source of biogas from animal fertilizers, and the bacteria with

isolated DNA can be genetically analyzed by using universal primers specific to DNA and the microbial counting can also be done by

PCR.

Keywords: Biogas, bacteria, spectrophotometer, olive mill wastewater, DNA





189

IDDGC17-PP-169

TARGETING CANCER CELLS WITH NANOTECHNOLOGY

Emine Terzi1, Ender Simsek

1,Ozen Ozensoy Guler

1

1Ankara Yildirim Beyazit University, Medical Faculty, Medical Biology Department, Bilkent Campus, Ankara, TURKEY,

[email protected]

Aims and Scopes: Nanotechnology refers to designing, characterization and application of materials on the scale of 1-100 nm [1].

Within this technology, we can create a crucial effect on disease diagnosis, monitoring, regenerative medicine, drug delivery, drug

discovery and biomedical science [2]. The application of nanotechnology for cancer therapy has drawn attention in recent years.

Cancer nanotechnology provides new approaches for early diagnosis, prevention and personalized medicine and aims targeting the

cancer cells without destroying normal cells [3].

Materials and Methods: Cancer nanotechnology based on two main subjects: Laboratory based diagnostics and in vivo

diagnostics/therapeutics. Nano-sized structures for laboratory based diagnostics includes nanocantilevers, magnetic nanobeads, gold

nanoparticles and quantum dots. These structures can be coated with monoclonal antibodies and targeted to cancer cells. In recent

years, studies have focused on developing smart nanostructures which are capable of detecting and destroying malignant cells in vivo

[4]. Liposomal doxorubicin and albumin bound paclitaxel (Abraxane) are two therapeutic nanocarriers were approved by the US FDA

for clinical practices [3].

Results and Discussion: Nanotechnology in the field of cancer is a promising research area. Nano-sized structures provide

opportunities for carrying therapeutic agents with less toxicity and targeting cancer cells. Common using of nanotechnological

approaches will provide more effective treatment for cancer therapy [3].

Keywords: Cancer, nanotechnology, targeted therapy

References:

[1] Grobmyer, S. R.; Iwakuma, N.; Sharma, P.; Moudgil, B. M. Humana Press. 2010, 1-9.

[2] Naves, L. B.; Dhand, C.; Venugopal, J. R.; Rajamani, L.; Ramakrishna, S.; Almeida, L. Progress in Biomaterials, 2017, 1-14.

[3] Misra, R.; Acharya, S.; Sahoo, S. K. Drug Discovery Today, 2010, 15.19: 842-850.

[4] http://www.tinhoahoc.com/Nanotechnology/Nano-cancers.pdf.




190

IDDGC17-PP-170

CONSTRUCTION OF A NEW EXPRESSION VECTOR FOR RHODOBACTER SPHAEROIDES AND

EXPRESSING IT WITH FLUORESCENT PROTEINS

Vahide CoĢkun1*

, Hasan Hüseyin Doğan1

1Vahide CoĢkun, Selcuk University, Science Faculty, Biology Department, Selçuklu/Konya, Turkey

*Corresponding author: [email protected]

Aims and Scopes: Purple non sulfur (PNS) bacteria have versatile metabolic activities. They can produce a large number of high

value added products like 5-amionolevulinic acid (5-ALA), biohydrogen, vitamin B12, Coenzyme Q10, poly-β-butyric acid and

carotenoids. The usage of PNS bacteria in elucidation of many biological processes as model bacteria and their capability to produce

many important high value-added products make PNS bacteria extremely important. Besides these, contrary to E. coli and most of the

gram negative bacteria, Rhodobacter sphaeroides’ being non-immunogenic increased its usage in many biotechnological processes.

Like other bacteria, specifically designed expression vectors are needed to produce high value added products with PNS bacteria.

Newly designed vectors are developed by adding new and logical features to the existing ones. In this context, a local, inducible,

superior and competitive expression vector unique for a PNS bacterium Rhodobacter sphaeroides was developed. In this way, it will

be possible to produce high value added products. In the expression vector, the inducible promotor of fruBKA operom was used.

Thus, inducible gene expressions was enabled. As a proof of concept study, red fluorescent protein gene was cloned into designed

vector and expressed in R. sphaeroides.

Materials and Methods: Generation of local and competitive molecular tools towards the development of Rhodobacter sphaeroides

as a robust and sustainable cell factory and over production of 5-aminolevulinic acid was targeted. In this context, a unique expression

vector was designed by combining carefully selected vector parts to the broad host range vector frame. As a proof of concept study,

red fluorescent protein gene was cloned into designed vector and expressed. First of all, the expression vector elements such as

promotor, 6-His tag, stop codons in three reading frame, transcription terminator and unique restriction endonuclease recognition sites

were selected after elaborate analyses and combined in frame. The promoter of the fruBKA operon in R. sphaeroides was selected.

After in silico design of the expression cassette, the whole sequence was synthesized as a synthetic biology approach. As the vector

backbone, a broad host range cloning vector pBBR1MCS2 was used.

Results and Discussion: All the sequences for promoter, 6-His tag, stop codons in three reading frame, transcription terminator and

unique restriction endonuclease recognition sites were assembled using ―Clone Manager 6‖ software. Like other bacteria, specifically

designed expression vectors are needed to produce high value added products with PNS bacteria. In this context, a fructose inducible

expression vector for Rhodobacter sphaeroides was constructed to generate high value added products. Firstly, carefully selected

vector parts were combined in silico and then synthesized to form a synthetic construct. The construct includes promoter of fruBKA

operon, 6-Histidine tag, stop codons in three reading frame and a strong transcription terminator (BBa_J95029). Then, the construct

was ligated to the broad host range vector frame pBBR1MCS2 forming the final construct. There is an NruI (TCG/CGA) recognition

site just proceeding ribosome binding site and where the gene of interest could be cloned and expressed. As a proof of concept, the red

florescent protein gene was cloned and its expression was tested in R. sphaeroides. As a conclusion, a molecular tool towards the

development of Rhodobacter sphaeroides as a robust and sustainable cell factory was constructed in the context of synthetic biology.

Keywords: 5-ALA, expression vector, fruBKA, gene expression, Rhodobacter sphaeroides

Acknowledgements: This study was supported by Selçuk University Scientific Research Projects Coordination Unit with the project

number ―152011082‖.





191

IDDGC17-PP-171

DOXORUBICIN-LOADED DEXTRAN COATED MAGNETIC NANOPARTICLES AFFECT ON

CYTOKINES GENE EXPRESSION IN BREAST CANCER CELL LINE

Serap Yalcin1, Pelin Mutlu

2, Ufuk Gunduz

3

1Faculty of Arts and Sciences, Department of Molecular Biology and Genetics, Ahi Evran University, Kırsehir, Turkey

2 Central Laboratory, Molecular Biology and Biotechnology R&D Center, Middle East Technical University, Ankara,

Turkey

3Faculty of Art and Sciences, Department of Biology, Middle East Technical University, Ankara, Turkey

Aims and Scopes: IL-6 and IL-8 are a well-known proinflammatory cytokines. IL-8 contributes to cancer progression through its

potential functions as a mitogenic, motogenic and angiogenic factor. Interleukin (IL)-6 has important roles in the proliferation and

metastasis[1,2]. In the present study, Dextran coated magnetic nanoparticles (Dox-Dex-MNPs) were prepared to obtain an effective

targeted delivery system for Doxorubicin on breast cancer cell line.

Materials and Methods: Dox-Dex-MNPs were synthesized and characterized by TEM, SEM, FTIR, VSM and TGA analyses. Drug

loading efficiencies and release characteristics were investigated. On the other hand, drug-sensitive and drug-resistant MCF-7 cell

lines were grown in RPMI 1640 medium supplemented with 10% FBS at 37oC and 5% CO2. Total RNA content was isolated by TRI

Reagent according to the manufacturer‘s instructions. cDNA was synthesized from 1 ug of total RNA and random hexamer primers.

The expression levels of IL-6 and IL-8 genes were shown using qRT-PCR.

Results and Discussion: According to SEM, TEM, VSM and TGA results, the synthesized Dox-Dex-MNPs possess desired shape

and size range (10-15 nm) as they can be internalized into the cell and also have superparamagnetic properties. FTIR analysis

confirmed that Doxorubicin was successfully loaded on dextran coated MNPs. According to the gene expression results, IL-6 and IL-

8 significantly (6-fold and 9-fold, respectively) overexpressed in MCF-7/Dox cells with respect to the sensitive MCF-7 cell line. On

the other hand, due to the application of free Doxorubicin to the MCF-7/Dox cells, both IL-6 and IL-8 genes 3 fold more

overexpressed leading to 22- and 29-fold overexpression with respect to the sensitive MCF-7 cell line. Additionally, application of

Dox-Dex-MNPs to MCF-7/Dox cell line decreased again the expression levels of these cytokines significantly.

Key Words: IL-6, IL-8, Magnetic nanoparticles, Doxorubicin, breast cancer References:

[1] Chen, D. R.; Lu, D. Y.; Lin, H. Y.; Yeh, W. L. 2014, 10. [2] Jiang, X. P.; Yang, D. C.; Elliott, R. L.; Head, J. F. 2011, 31(9), 2899-2906.




192

IDDGC17-PP-172

SCREENING OF GENE MUTATIONS IN THE D-LOOP REGION OF MITOCHONDRIAL DNA IN

HUMAN GLIOBLASTOMA MULTIFORME TUMOR

Serap Yalçın1, Gamze Turna

2

1Department of Molecular Biology and Genetics, Faculty of Art and Sciences, Ahi Evran University, Kırsehir, Turkey

2Department of Biochemistry, Faculty of Medicine, Ahi Evran University, Kırsehir, Turkey

Aims and Scopes: The objective of this study was to determine the gene mutations in D-loop region of mitochondrial DNA (mtDNA)

in T98G (human glioblastoma multiforme tumor) [1, 2] and to investigate the role of the gene mutation in D-loop region in the human

glioblastoma multiforme tumor.

Material and Methods: Genomic DNA was isolated from the T98G cell line and analyzed for evidence of mutation in the D-Loop

region. In order to identify mutations, the 590 bp long fragment of D-loop region was amplified by PCR using specific primers. DNA

direct sequencing was performed on each template using the forward primer.

Results and Discussion: The mutational analysis of the mitochondrial DNA revealed the presence of A16031d, A16037d, C16067T,

A16183C, T16189C, A16194C, T16195TT, C16197T, C16201A, G16204C, C16205A, G16208T, C16211A, C16214A, C16228T,

C16232A, C16239A, C16242T, T16243G, C16245G, G16255A, A16258C, A16265C, A16269C, C16270A, T16271A, T16276A,

C16282A, A16293C, C16301A, G16303A, T16304A, C16306A, T16308A, A16309T, T16311A, C16313A, T16315A, A16318AA,

A16322T, T16330A, C16332A, T16334A, G16336A, C16337A, C16339A, C16344A, C16358T, T16359C, T16362C, T16368G,

T16372G, G16373A, G16384A, T16386A, A16402C, T16409C, T16413G, T16422A, G16428C, C16431A, G16434A, G16436A,

T16437G, C16439G, C16442T, G16450C, T16462A, C16465A, G16474GG, G16477C, C16488A variations in D-Loop region. This

study demonstrated mutations in the mtDNA D-loop region in T98G cells; however, the association between occurrences of human

glioblastoma multiforme tumor and mtDNA mutations requires further investigation.

Keywords: Human glioblastoma multiforme tumor(T98G), D-Loop region, mtDNA

References:

[1] Yusoff, A.A.M. 2015, 11, 535-544.

[2] Vidone, M.;Clima, R.; Santorsola, M.; Calabrese, C.; Girolimetti, G.; Kurelac, I.; Amato, L.B.; Iommarini, L.; Trevisan, E.; Leone, M.; Soffietti, R.; Morra, I.;

Faccani, G.; Attimonelli, M.; Porcelli, A.M.; Gasparre, G. 2015, 3,46-54.




193

IDDGC17-PP-173

D-LOOP, CO-1 AND ND4 MTDNA MUTATIONS IN LNCAP CELL LINE

Gamze Turna1, Serap Yalcin

2

1Department of Biochemistry, Faculty of Medicine, Ahi Evran University, Kırsehir, Turkey

2Department of Molecular Biology and Genetics, Faculty of Art and Sciences, Ahi Evran University, Kırsehir, Turkey

Aims and Scopes: Mitochondria plays a key role for apoptosis, and mitochondrial DNA (mtDNA) may regulate tumorigenesis [1].

Mitochondrial DNA variations have been reported in prostate cancer [2,3]. Increased electron transport chain (ETC) activity, oxygen

consumption and ROS production may raise a risk of developing prostate cancer. We analysed the presence of sequence variations of

D-loop region, CO-1 and ND-4 genes in the mitochondrial DNA (mtDNA) of LnCap cell line.

Material and Methods: Genomic DNA was isolated from LnCap cell line and analyzed for D-Loop, ND4 and CO-1 genes by

polymerase chain reaction(PCR). In order to screen for 590 bp, 670 bp and 735bp fragments of D-Loop, ND4 and CO-1 genes

containing the regions were amplified using specific primers by PCR, respectively. DNA direct sequencing was performed on each

template using the forward primer.

Results and Discussion: The mutational analysis of the mitochondrial DNA revealed the presence of A16031d, A16037d, G16129A,

C16148T, T16519C variations in D-Loop region, A6272d, A6281d deletions in CO-1 gene, and T11152C transition in ND-4 gene.

Results showed that the mtDNA mutations per cell follows a higher frequences distribution in cancer cells as compared in normal

cells. This is the first study to demonstrate the importance of D-Loop, ND-4 and CO-1 mtDNA mutations in prostate cancer.

Keywords: Prostate cancer, ND4, CO-1, D-Loop region, mtDNA

References:

[1] Lu, J.; Sharma, L.K.;Bai, Y.2009, 19(7),802-815. [2] Canto, P.; Benítez Granados, J.; Martínez Ramírez, M.A.; Reyes, E.; Feria-Bernal, G.; García-García, E.; Tejeda, M.E.; Zavala, E.; Tapia, A.; Rojano-Mejía, D.;

Méndez, J.P.2016,19(3),187-191. [3] Sun, Q.; Arnold, R.S.; Sun, C.Q.; Petros, J.A.2015,75(16),1916-25.




194

IDDGC17-PP-174

DETECTĠON OF Β-THALASSEMĠA IVSI-6 MUTATĠON USĠNG PĠEZOELECTRĠC BĠOSENSOR

ĠMMOBĠLĠZED WĠTH A SĠNGLE OLĠGONUCLEOTĠDE

Umut KÖKBAġ, Kezban KartlaĢmıĢ, Abdullah Tuli, Levent Kayrın

Cukurova University Faculty of Medicine Department of Biochemistry, Adana, Turkey

[email protected]

Aims and Scopes: β-Thalassaemia is the most monogenic autosomal recessive disorder characterized by defective production of the

β-chain of hemoglobin.[1]

It cause syndromes, they are a group of hereditary anemias of varying clinical severity.[2]

Definition of the

β-globin genotype in carriers supports genetic counselling, and in patients with homozigocity of this disease is useful to predict

prognosis and management options.[3]

DNA-based diagnosis of β-thalassemias routinely relies on polymerase chain reaction(PCR)

and gel electrophoresis.[1]

The aim of this study, developing a new procedure for the detection of β–thalassemia IVSI-6 mutation using a 3-primer system for

PCR coupling with a DNA-based piezoelectric biosensor.

Materials and Methods: For this study, PCR products amplified from genomic DNA, which was obtained by amplification-

refractory mutation system (ARMS). These products were detected directly by using a quartz crystal microbalance. We immobilized

with a single oligonucleotide probe with Poly Hema-Mac nanopolymer. Than we compare the results with jel electroprosis.

Results and Discussion: The frequency changes after hybridization of the PCR products amplified from a representative sample of

normal β-globin, β–thalassemia IVSI-6 mutation heterozygote, and homozygote were 211±14, 267±8, and 314±6 Hz, respectively.

The biosensor was evaluated through an examination of 3 blind specimens. It could accurately discriminate between normal and β–

thalassemia IVSI-6 mutant samples, which suggests that this biosensor system is a promising alternative technique to detect β–

thalassemia IVSI-6 mutation because of its specificity and less hazardous exposure as compared with conventional methods. This

technique is faster and cheaper than other techniques.

Keywords: Genosensor, Beta thalassemia, Genetic diagnostic, Biosensor, DNA.

References:

[1] Y. Liu, Y. Yang, X. Kang, B. Lin, Q. Yu, B. Song, G. Gao, Y. Chen, X. Sun, X. Li, L. Bu, Y. Fan. Nucleic acids 2017, 6, 57-

67.

[2] M. Baldini, A. Marcon, F. M. Ulivieri, S. Seghezzi, R. Cassin, C. Messina, M. D. Cappellini, G. Graziadei, Annals of

hematology 2017, 18, 73-85.

[3] E. Cassinerio, I. M. Baldini, R. S. Alameddine, A. Marcon, R. Borroni, W. Ossola, A. Taher, M. D. Cappellini, Annals of

hematology 2017, 23, 16-24.





195

IDDGC17-PP-175

PREPARATION OF RNA SEQ ANALYSIS FROM MOUSE THYMUS FED SHORT-TERM

CALORIE RESTRICTION

Zehra Ömeroğlu Ulu1, Salih Ulu

1, Soner Dogan

2, BilgeGüvenç Tuna

3, Nehir Özdemir Özgentürk

1,

1Yildiz Technical University, Faculty of Art and Science, Molecular Biology and Genetics, Istanbul

2Yeditepe University, School of Medicine, Department of Medical Biology, Istanbul, Turkey

3Yeditepe University, School of Medicine, Department of Medical Biophysic, Istanbul, Turkey

Corresponding author:[email protected]

Aims and Scopes: RNA sequencing (RNA-seq), gene expression is measured, is one of the applications of next generation

sequencing (NGS) technologies (1,2). For RNA seq, 10 weeks of age female MMTV-TGF-α mice were fed ad libitum (AL),

chronic caloric restricted (CCR) and intermittent caloric restricted (ICR). The CCR mice group was fed with 85% of the

daily food consumption of AL mice. The ICR mice group was fed AL for 3 weeks then following week 60% caloric

restriction compared to AL were applied for one week. Mice were sucrified at the age of 17 or 18 weeks old and were

taken thymus at Yeditepe University.

Materials and Methods: RNA were isolated from thymus tissue of ad libitum, chronically calorie restriction and

intermittent calorie restriction fed MMTV-TGF- α mice from 10 week old to 18 week old using Trizol (Invitrogen) and

RNeasy Mini Kit (Qiagen). The concentration of RNA was measured with Bio-spec-nano UV-VIS Specthrophometer.

RNA integrity number was detected with the Agilent 2100 Bioanalyzer system. The mRNA sequencing libraries for

RNA-seq were constructed with the TruSeq RNA Sample Prep Kit. Secondly, Pair-end (2 x 100 bp) sequencing were

performed using an Illumina HiSeqTM

4000 Sequencing System (Illumina) at Beijing Genomics Institute (BGI).

Results and Discussion: Results from present study indicate that RNA-seq is a powerful tool to analyze transcriptomes,

to study gene expression profile and to compare distinct stages of conditions RNA-Seq resulted in an average of ~139.5

million raw reads 100 bp reads per sample with average of ~95 million mapped reads For removing adapter sequences

and low-quality reads from raw reads were used Flexbar software. The quality of clean reads was checked using FastQC

program (3). Three different RNA-seq data was prepared for further RNA-seq analysis.

Keywords: RNA-seq, FastQC, MMTV-TGF-α mice

References: [1] Mortazavi A., Williams B.A., Mccue K., Schaeffer L., Wold B., Nature Methods 2008 5, 621–628

[2]Wang ZY, Fang BP, Chen JY, Zhang X, Luo ZX, Huang LF, Chen XL, Li YJ, BMC Genomics 2010,11, 726

[3]Andrews S., FastQC: 2010 http://www.bioinformatics.babraham.ac.uk/projects/fastqc

http://www.bioinformatics.babraham.ac.uk/projects/fastqc




196

IDDGC17-PP-176

EXOPOLYSACCHARIDE PRODUCTION OF LACTIC ACID BACTERIA ISOLATED FROM

SOURDOUGH

Nilgün ÖZDEMĠR1, Badamgarav ENKHTUR

1 Ahmet Hilmi ÇON

1

1Ondokuz Mayıs University, Faculty of Engineering, Department of Food Engineering, Samsun/Turkey

[email protected]

Consumer demand for food that does not contain any chemical preservatives, has a long shelf life, and is more nutritious and delicious

is increasing day by day. This situation reveals the importance of fermented foods, such as sourdough. The use of sourdough in bread

production improves the aroma and textures of bread.

In the emergence of these positive effects, certain functional LAB strains in sourdough ecosystem and their metabolites play an

important role. It is known that some LAB in fermented foods produce metabolites as exopolysaccharides (EPS). The EPS, natural

polymers of high molecular weight, contribute to the specific rheology and texture of fermented products. When they added to food

products, polysaccharides function as thickeners, stabilizers, emulsifiers, gelling agents, and water binding agents. EPS structure in

bread production also positively affects the technological properties of the dough and bread such as dough water absorption, dough

rheology and process ability, bread texture and retarding bread staling.

In this study, it is aimed to isolate and identify EPS producers LAB‘s from Vakfıkebir bread, the most important sourdough bread

type of our country. EPS production ability of LAB isolates isolated from sourdough collected from the Black Sea region were

investigated. According to the results, it was determined that 27 LAB had EPS production ability and 3 promising isolates from these

were identified by 16s rDNA sequence analysis. These isolates were determined as Leuconostoc citreum 23109, Lactobacillus

pentosus 2705 and Leuconostoc pseudomesenteroides Y2502. It was reported in many literature that L. citreum and L.

pseudomesenteroides species are present in EPS producer strains, however, the ability to produce EPS of L. pentosus species were

rarely detected. The results are interesting in this regard.

These results highlight the fact that these identified isolates can be used in different food ecosystems as a preliminary data and it is

necessary to carry out studies in this regard.

Keyword: Exopolysaccharide, LAB, sourdough

This research was financially supported by Ondokuz Mayıs University, Commission of Scientific Research Projects (Samsun, Turkey)

(grant no: PYO. MUH.1905.16.004).





197

IDDGC17-PP-177

ANTIFUNGAL ACTIVITY OF LACTIC ACID BACTERIA ISOLATED FROM TARHANA DOUGH

AGAINST SOME MOLDS Nilgün ÖZDEMĠR

1, Ahmet Hilmi ÇON

1

1Ondokuz Mayıs University, Faculty of Engineering, Department of Food Engineering, Samsun/Turkey

[email protected]

The increased interest in bio-preservation of food systems has recently led to the development of new natural antimicrobial

compounds having different origins. Main natural antimicrobial compounds (antibacterial, antifungal etc.) is microorganism

metabolite produced from microorganism like lactic acid bacteria (LAB). Of these LAB metabolites, those found in the fermented

foods increases shelf life of them. Especially, it is known that fermented cereal products are more resistant to growth of molds and

yeast that are undesirable but can be found for any reason.

The aim of this study is to identify these that exhibit antifungal activity from the LAB isolated from tarhana doughs. The antifungal

activities of LAB strains isolated from tarhana drough against Aspergillus flavus MAM 200682 and Aspergillus niger ATCC 16888

strains were screened using the overlay method and the antifungal activity of 24 LAB strains was determined. Of these; 7

Lactobacillus plantarum (PFC74, PFC76, PFC78 PFC84, PFC85, PFC89 and PFC98), 1 Lactobacillus alimentarius (PFC91) and 1

Lactobacillus brevis (PFC100) against A. flavus MAM 200682 and 1 Lactobacillus plantarum PFC89 and 1 Lactobacillus brevis

PFC100 against A. niger ATCC 16888 showed more zones. Minimum inhibitory concentration (MIC) values of the culture filtrates of

these LAB isolate were determined according to microtiter-plate-based method. The results indicate that the Lactobacillus plantarum

PFC76 and Lactobacillus plantarum PFC76 culture filtrates have lower MIC values and therefore higher antifungal activity.

These isolates with high antifungal activity are thought to be used as a natural preservative in different food productions for reliable

food quality and long shelf life.

Keyword: LAB, seconder metabolite, antifungal activity, natural food preservative

This research was financially supported by Ondokuz Mayıs University, Commission of Scientific Research Projects (Samsun, Turkey)

(grant no: PYO. MUH.1905.15.001).





198

IDDGC17-PP-178

ANALYZE OF SOME PROTECTED miRNA in Corylus avallena L.

BüĢra YĠRMĠBEġ

1, H.Nur AYDIN

1, Zehra ÖMEROĞLU ULU

1, Salih ULU

1, Nehir ÖZDEMĠR ÖZGENTÜRK

1

1Department of Molecular Biology & Genetics, Faculty of Arts and Sciences, University of Yıldız Technical, Esenler, Istanbul, Turkey

Corresponding Author [email protected]

Aims and Scopes: Hazelnut has become a valuable nutrient througout the history. As well as, it is used to in food endustry, it is also

used as oil plant and has economical value. It is quite important plant and has high economicall value for Turkey that 70% of world

need is supplied from Turkey. A lot of hazelnut species grow in Turkey, but the most widespread species are Corylus avellana L.

Tombul which has high economically value becasue of their special flavor and oil content [1,2]. Although their economic and cultural

characteristics, Corylus avellana L. Tombul has very little data in the gene banks. In plants and animals recent scientific advances

have revealed the synthesis pathways and the regulatory mechanisms of miRNAs. microRNAs (miRNAs) are a class of small,

endogenous RNAs of 21–25 nucleotides (nts) in length[3]. They play an important regulatory role in animals and plants by targeting

specific mRNAs for degradation or translation repression . The aim of this study is to analyze some protected miRNAs in diffenet

tissues of Corylus avellena L. by using RT-PCR and Real Time PCR

Materials and Methods: In this study, total RNA isolation is made from young leaves, folwers (male and female), bud of Corylus

avallena L. (EXİQON miRCURY™ RNA Isolation Kit). RNA is measured on NanoDrop. After that cDNAs were synthesized from

miRNA (miRCURY LNA™ Universal RT microRNA PCR) cDNAs is amplified in PCR and is displayed in agarose gel

electropheresis. Results is verified by using Real Time PCR ( miRNA 1st-Strand cDNA Synthesis Kit).

Results and Discussion: : miR-159, miR-160, miR-171, miR-396, miR-2919 and miR-8123 which are protected in plants were

amplifed in different tissues in Corylus avallena L. by PCR and Quantitative PCR. Also expression levels of protected miRNAs are

compared in different tissue. As we expect, miR-159, miR-160, miR-171, miR-396, miR-2919 and miR-8123 which are protected in

plants are also found in different tissues in Corylus avallena L. The sequence of protected miRNAs (miR-159, miR-160, miR-171,

miR-396, miR-2919 and miR-8123) must be determined to compare with other plant species.

Keywords: miRNA, Corylus avallena L.

References: [1] Köksal, A. I., A.Ü. Ziraat Fakültesi Bahçe Bitkileri Bölümü, 2002 Ankara. ISBN 975-92886-0-5.

[2] Karadeniz, T., Bostan, S.Z., Tuncer, C. ve Tarakçıoğlu, C., Ziraat Odası Başkanlığı Bilimsel Yayınlar Serisi, 2009 No: 1.

[3]Treiber, T., Treiber, N., Meister, G., Tromb Haemotolog 2012, 107:605-10.





199

IDDGC17-PP-179

THE BIOSENSOR DESIGN TOWARDS DETERMĠNATĠON CLOZAPINE N-OXĠDE IN

SCHIZOPHRENIC PATIENTS

Kezban Kartlaşmış, Umut Kökbaş, Levent Kayrın

Cukurova University Medical Faculty, Medical Biochemistry, Adana

[email protected]

Aim and Scope: Schizophrenia, a complicated and depotentiation neuropsychiatric diseases, places an huge burden on affected

individuals, families, and society. In the whole world prevalence of schizophrenia, is likely around 1% and nearly 5% of people with

the disorder incline commit suicide. Clozapine is accepted as the gold standard drug in the treatment of schizophrenia. It is frequently

used in patients with resistance to treatment with other atypical antipsychotic medications. Improper use can result in serious

consequences such as gastrointestinal hypomotility, myocarditis, agranulocytosis and metabolic side effects. Sudden withdrawal of

clozapine treatment; It is reported that it may cause electrocardiogram change, QTc prolongation, neutropenia, tachycardia, atrial

palpitations, fever, diabetic ketoacidosis, syncope and hepatic enzyme deficiency. Identification, minimization and removal of these

side effects are necessary for treatment. At least 9 metabolites, have been identified or theorized. The majority of the parent

compound appears to be metabolized to clozapine N-oxide. In our study, it is aimed to develop an electrochemical method that can

measure the clozapine concentration levels in the shortest time, with the least amount of sample and at reasonable cost. In this context,

the clinician will be able to perform appropriate dose reconstitution according to the concentration of the metabolites that the patient

using clozapine consume more than necessary or if the amount of the drug is less than necessary in accordance with the

pharmacogenetic structure and drug monitoring can be done easily.

Materials and Methods: In this study for the determination of clozapine N-oxide, dimethylaniline monooxygenase enzyme fixed on

the gold electrode by using BSA/gelatin and crosslinking by glutaraldehyde. Cyclic voltammograms have been carried out between -

0.35 V and 0.75 V potentials vs. Ag/AgCI.

Results and Discussion: Clozapine N-oxide concentration was detected by using differential pulse method between -0.25 and 0.3 V

potentials by observing the differentiations in the current values. During the optimization studies the amount of gelatin, bovine serum

albumin and glutaraldehyde were determined. As a result, this determination suggests that fast / slow metabolizers of schizophrenia

patients and the doctor will contribute to the adjustment of appropriate drug doses.

Key words: Biosensor, Clozapine N-Oxide, Dimethylaniline monooxygenase, Schizophrenia.

References [1] Taylor DM, CNS Drugs. 2017, 31(3):177-180.

[2] Krivoy A, Gil-Ad I, Tarasenko I, Weizman A, Taler M, Behav Brain Res. 2017, 14;323:141-145.

[3] Land R, Siskind D, McArdle P, Kisely S, Winckel K, Hollingworth SA, Acta Psychiatr Scand. 2017, 135(4):296-309.

[4] Andrade C, J Clin Psychiatry. 2016, 77(12): e1656-e1660

[5] Bastiampillai T, Allison S, Gupta A, Aust N Z J Psychiatry. 2017, 51(3):295-296.

http://tureng.com/tr/turkce-ingilizce/depotentiation




200

IDDGC17-PP-180

A NEW BIOSENSOR DESIGN IN 5-HIAA DETERMINATION FOR THE DIAGNOSIS OF

CARCINOID TUMORS

Kezban KartlaĢmıĢ, Umut KökbaĢ, BaĢak GünaĢtı, Levent Kayrın,

Cukurova University Medical Faculty, Medical Biochemistry, Adana

[email protected]

Aims and Scopes: Carcinoid syndrome is a clinical picture of carcinoid tumors characterized by the production of serotonin from

neuroendocrine system cells. The source is mostly the gastrointestinal tract or lungs [1]. Clinical manifestations occur when liver

metastasis occurs or the liver fails to metabolize serotonin for a reason such as cirrhosis. In lung-derived carcinoid tumors, serotonin

produced directly leads to clinical manifestations in the early period because of direct systemic circulation [2]. 5-Hydroxyindoleacetic

acid (5-HIAA) is the most important metabolite of serotonin that is excreted in the urine [3]. Under normal conditions, it has been

reported that in the presence of functional metastatic carcinoid tumors, this ratio increases up to 80% when the tryptophan in the diet

is converted to only about 1-3% serotonin [4]. Accurate and reliable determination of 5-HIAA has been widely investigated by using

HPLC, tandem mass spectrometry, microdialysis and differential pulse voltammetry methods, which are generally time consuming

and not very suitable for routine or on-line anlysis [5]. The purpose of this study is to create a prefix for a test that can be used to

diagnose carcinoid syndromes.

Materials and Methods: 'Peroxisome proliferator activated receptor gamma (PPAR-gamma)', a molecule that can be actively bound

to the 5-HIAA metabolite, is selected using the such as bovine serum albumin, gelatin and glutaraldehyde immobilization agents on

the gold electrode to be used in the biosensor. The receptor that interacts with the 5-HIAA present in the medium is the result of the

current that will form in the biosensor system.

Results and Discussion: In biosensor, cyclic voltammograms have been carried out between 0.3 V and 0.9 V potentials vs. Ag/AgCI.

5-HIAA concentration was detected by using lineer sweep method between -0.45 and 0.7 V potentials by observing the

differentiations in the current values. During the optimization studies the amount of gelatin, bovine serum albumin and glutaraldehyde

were determined.

Keywords: Biosensor, carcinoid syndrome, 5-HIAA, PPAR.

References:

[1] Van Woert, M.H., Rosenbaum, D., Howieson, J., Bowers, M.B. N. Engl. J. Med. 1977, 13;296(2):70-5

[2] Linnoila, M., Karoum, F., Potter, W.Z. Arch. Gen. Psychiatry 1982, 39(5):513-6

[3] Kaye, W.H., Ebert, M.H., Raleigh, M., Lake, R. Arch. Gen. Psychiatry 1984, 41(4):350-5

[4] Kruesi, M.J., Rapoport, J.L., Hamburger, S., Hibbs, E., Potter, W.Z., Lenane, M., Brown, G.L. Arch. Gen. Psychiatry 1990, 47(5):419-26.

[5] Lincoln, J., Crowe, R., Kamm, M.A., Burnstock, G., Lennard-Jones, J.E. Gastroenterology 1990, 98(5 Pt 1):1219-25.




201

IDDGC17-PP-181

A WEB BASED TOOL FOR ENRICHMENT ANALYSIS OF TRANSPOSABLE ELEMENTS IN

PLANTS

Gökhan Karakülah1, Aslı Suner

2

1Ġzmir International Biomedicine and Genome Institute, Dokuz Eylül University, Ġnciraltı, 35340, Ġzmir, Turkey. E-mail:

[email protected] 2Ege University, School of Medicine, Department of Biostatistics and Medical Informatics, Bornova, 35100, Ġzmir, Turkey.

Aims and Scopes: Transposable elements (TEs), also called ―jumping genes‖, are unique mobile DNA sequences that comprise

major part of many plant genomes [1-2]. Previous findings indicate their regulatory roles on nearby gene expression in plants by

functioning as novel cis-regulatory sites [3-5]. Herein, we introduced a web interface, which helps to identify TEs with potentially

regulatory functions on a group of genes sharing a common biological feature.

Materials and Methods: We extracted genomic locations of plant TEs and genes from Ensembl Plants database (release 34) [6-7].

Thereby, we identified all TEs located within the upstream regions of transcription start sites of plant genes. Afterwards, we

developed a web interface through a group of open source software, including Apache (https://www.apache.org/), MySQL

(https://www.mysql.com/) and PHP (http://php.net/) that allows to enrichment analysis of TEs located within the upstream regions of

given a list of genes. Our web interface calculates enrichment score and its statistical significance for each TE using the multinomial

goodness of fit test.

Results and Discussion: The web tool introduced here takes, for example, a group of differentially expressed genes under a particular

biological condition as input and returns the list of TEs associated with those genes, along with their calculated enrichment scores and

statistical significances. The tool is particularly beneficial when identifying whether members of a group of genes tend to be

significantly linked with certain TEs. We believe that this web interface is likely to significantly enhance our understanding of the role

of TEs in diverse biological processes.

Keywords: Transposable elements, Gene regulation, Plant genomes, Database, Bioinformatics

References:

[1] Biemont, C. Vieira C. Nature 2006, 443, 521-524.

[2] Kelly, L. J. Leitch I. J. Chromosome Res 2011, 19, 939-953.

[3] Elbarbary, R. A.; Lucas B. A. Maquat L. E. Science 2016, 351, aac7247.

[4] Makarevitch, I.; Waters A. J.; West P. T.; Stitzer M.; Hirsch C. N.; Ross-Ibarra J. Springer N. M. PLoS Genet 2015, 11, e1004915.

[5] Feschotte, C. Nat Rev Genet 2008, 9, 397-405.

[6] Kersey, P. J.; Allen J. E.; Armean I.; Boddu S.; Bolt B. J.; Carvalho-Silva D.; Christensen M.; Davis P.; Falin L. J.; Grabmueller C.; Humphrey

J.; Kerhornou A.; Khobova J.; Aranganathan N. K.; Langridge N.; Lowy E.; McDowall M. D.; Maheswari U.; Nuhn M.; Ong C. K.; Overduin B.;

Paulini M.; Pedro H.; Perry E.; Spudich G.; Tapanari E.; Walts B.; Williams G.; Tello-Ruiz M.; Stein J.; Wei S.; Ware D.; Bolser D. M.; Howe K.

L.; Kulesha E.; Lawson D.; Maslen G. Staines D. M. Nucleic Acids Res 2016, 44, D574-580.

[7] Hubbard, T.; Barker D.; Birney E.; Cameron G.; Chen Y.; Clark L.; Cox T.; Cuff J.; Curwen V.; Down T.; Durbin R.; Eyras E.; Gilbert J.;

Hammond M.; Huminiecki L.; Kasprzyk A.; Lehvaslaiho H.; Lijnzaad P.; Melsopp C.; Mongin E.; Pettett R.; Pocock M.; Potter S.; Rust A.; Schmidt

E.; Searle S.; Slater G.; Smith J.; Spooner W.; Stabenau A.; Stalker J.; Stupka E.; Ureta-Vidal A.; Vastrik I. Clamp M. Nucleic Acids Res 2002, 30,

38-41.




202

IDDGC17-PP-184

CHARACTERIZATION OF DNA APTAMER ADSORPTION ON GRAPHENE OXIDE

Ceren Bayrac1*

, Gulnur Camizci1

1Karamanoglu Mehmetbey University, Department of Bioengineering, Turkey,

* corresponding author: [email protected]

Aims and Scopes:

Graphene oxide (GO) which is a water soluble, single monomolecular layer of graphite with certain groups such as epoxide, carbonyl,

carboxyl and hydroxyl groups has unique properties to provide unique advantages for different application areas. It has large surface

area, electrical conductivity, good dispensability in water, and fluorescence quencher property. Also, it can interact with DNA

hydrophobically by π-π stacking [1, 2]. Effective adsorption of DNA on GO has provided potential use of GO in DNA-based

biosensors for different applications. As DNA molecule, aptamers have been widely used with adsorption on GO. They are single

stranded DNA (ssDNA) molecules that specifically bind to their target with high affinity [3]. Due to these unique properties of

aptamers and GO mentioned above, their use in combination has become a new research area. Therefore, the characterization of

adsorption process of ssDNA on GO has become important for further sensor studies. In this study, the adsorption of ssDNA which is

an aptamer selected against a lymphoma cancer cell on GO was characterized and the optimum conditions for adsorption process were

determined. Based on these results, further studies will be conducted for the development of aptamer-based fluorescent sensor assay

with GO.


DNA aptamer (tdo5) specific for the human Burkitt‘s lymphoma cell line, Ramos, was used in this study. It was 45-mer long ssDNA

with 64.4% of GC content. The sequence of fluorescein modified tdo5 was 5‘-CAC

CGGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCCCGGTG-FAM-3′. The stock solution was prepared in dH2O and stored

at -20°C till experiment. GO dispersed in dH2O and washed twice before experiment. Standard curve (fluorescence versus

concentration) was constructed with FAM labeled ssDNA at different concentration (335, 167.5, 33.5, 16.75, 3.35, 1.675, 0.335,

0.1675 nM). ssDNA adsorbed on GO were confirmed by using FT-IR spectrophotometry (Vertex 70, Bruker). Optimization of mass

ratio of aptamer to GO was performed at 25°C. Different mass ratio of aptamer to GO (1:100, 1:200, 1:400, 1:500) were incubated for

40 min shaking at 400 rpm. After incubation, ssDNA not adsorbed on GO was recovered by centrifugation at 13.000 rpm for 15 min

and its fluorescence was measured by fluorometer (Qubit 2.0, Invitrogen) at green channel (excitation at 470 nm, emission at 520

nm). The contact time for adsorption process was optimized with the incubation of 1:400 mass ratio of ssDNA to GO for 10, 20, 30,

40, 50, and 60 min. The effect of temperature on adsorption of ssDNA on GO was studied at 4, 25, 37, and 50°C. Several different

salt concentrations (5, 10, 50, 100, and 500 mM) were tested for the effect on adsorption capacity.


In order to characterize the adsorption of ssDNA on GO, tdo5 aptamer sequence with 3‘ FAM modification was used and the amount

of ssDNA unbound to GO was measured via fluorometer. The optimum mass ratio of GO to ssDNA was determined as 1:400

(ssDNA:GO) for the maximum adsorption capacity of GO. With optimum mass ratio of GO to ssDNA, incubation time was studied

and optimum time was determined as 40 min to have efficient adsorption process. The effect of temperature on adsorption capacity

was investigated and it was found that with at high temperatures the strength of interaction between GO and ssDNA became weak so

that the adsorption capacity decreased at these conditions. Therefore, the optimum temperature for effective adsorption was selected

as 25°C. The effect of salt concentration on adsorption capacity was obvious that with the increase in salt concentration, the

adsorption capacity also increased. This showed that at lower salt concentration, interaction between GO and ssDNA was weak. These

data will be used in future studies which is the development of sensor with the use of tdo5 aptamer and GO to detect cancer cell.

Keywords:

Graphene oxide, aptamer, adsorption

References:

[1]Wu, M.; Kempaiah, R.; Huang, P.J.; Maheshwari, V.; Liu. J. Langmuir 2011, 27, 2731–2738 [2]He, Y.; Jiao, B.; Tang, H. RSC Adv. 2014, 4 , 18294–18300

[3]Bayraç, C.; Öktem, H.A. J Mol Recognit 2017, 30, e2583

mailto:%20*%20corresponding%20author:%[email protected]




203

IDDGC17-PP-185

STRESS INDUCED LTR-RETROTRANSPOSON ACTIVATION IN S. POMBE

Merve Seda Ibisoglu1, Cansu Yalcingil

1, Sibel Yilmaz

1

1 Istanbul Yeni Yuzyil University, Faculty of Science and Arts, Molecular Biology and Genetics Department. Yilanli Ayazma Street,

Dr. Azmi Ofluoglu Campus, Zeytinburnu/Istanbul- TURKEY

[email protected]

Aims and Scopes: In this study, we investigated LTR-Retrotransposon movements in Schizosaccharomyces pombe (972h-) grown

under magnesium and heat stress culture conditions. LTR-Retrotransposons are a subclass of transposons that, like retroviruses, can

increase their copy number in the genome via an RNA intermediate. Thus they constitute a high percentage of eukaryotic genomes

especially in cereal plants (~80%). In spite of their abundance, most of them have been silenced with various mechanisms. However,

previous studies showed that retrotransposons could gain back their transcriptional and insertional activities under stress conditions [1,

2]. In the genome of lower eukaryotes like yeast, percentages of retrotransposons decrease. In S. cerevisiae, retrotransposons (Ty:

Transposon Yeast) constitute 3% of the genome, while in S. pombe (Tf: Transposon Fusion) 0.8%. To understand whether Tfs

reactivate under various stress conditions, we used the IRAP marker technique that was originally developed for plants [3]. In this

technique, PCR primers are designed according to LTR sequences in reverse orientation and amplify genomic regions between two

LTR-retrotransposons. In the case of a LTR-retrotransposon insertion events, amplification results in polymorphic PCR bands.

Materials and Methods: S. pombe (972h-) strain was grown on yeast extract agar (YEA) to obtain single colonies. All experiments

were conducted with 3 randomly selected colonies. These three colonies were grown on YE liquid medium until they reached 0.5 OD

at 595 nm wavelength. Subsequently, each culture was divided into 3 falcon tubes of 10 ml. The tubes were centrifuged at 5000 rpm

for 5 min. Cell debris was washed with sterile distilled water and incubated under different culture conditions. Cells from the 1st tubes

of each culture were inoculated to Edinburgh Minimal Medium (EMM) supplemented with MgCl2 (5mM) and incubated at 30oC

overnight (control sample). Cells from the 2nd

tubes were inoculated to EMM without MgCl2 and incubated at 30oC overnight (MgCl2

stress sample). The last tubes‘ cells were inoculated to EMM, supplemented with MgCl2, and incubated 35oC overnight (heat stress

sample). After the incubation period, yeast cells were harvested by centrifugation and genomic DNAs were extracted from each

culture. Full sequence of Tf was obtained from NCBI (Accession CU329670) and its LTR sequences were determined using the

LTRharvester program. Primers of LTR sequences were designed manually because of their reverse orientation. PCR products were

separated at 2% agarose gel at 100 V for 5 h in 1X TBE buffer and the polymorphism ratio was calculated with Jaccard‘s coefficient

[4].

Results and Discussion: PCR resulted in 5 bands for each sample and all of these bands were monomorphic among samples

belonging to the same group. This result showed that there was no natural retrotransposon insertional activity between individual

colonies. However, 2 polymorphic bands were observed in control and test samples and the polymorphism ratio was 33%. One of

these bands was about 1700 bp length and unique to control samples. The other was approximately 4000 bp and observed in both Mg

and heat stress samples. Because of the monomorphic nature of colonies in the control group, we concluded that these 2 polymorphic

bands might be result of the Tf insertional activity that was induced by Mg and heat stresses. In addition, both stress conditions

resulted in the same band patterns. This result shows that both stress conditions have similar effects on Tf activity. In a previous

study, the insertional activity of Tf was demonstrated under oxygen stress in S. pombe [1]. In this study, we demonstrated Tf‘s

insertional activity under Mg and heat stresses as well. It is thought that retrotransposons have a role in the control of some genes that

are up or down regulated under various stress conditions [5]. Our results show that Tfs might be responsible for regulation of the

genes which have a role in overcoming Mg and heat stresses.

Keywords: S. pombe, retrotransposon, IRAP, Mg stress, heat stress.

Acknowledgements: The authors would like to thank Prof. Dr. Aysegul SARIKAYA and Res. Assist. Gulsen UZ to supply yeast

strains. This study was funded by The Scientific and Technological Research Council of Turkey (TUBITAK). Project number:

2202A-1/1919B011601040

References: [1] Sehgal, A. et al. PLoS Genet 2007, 3(8), 1389-1396.

[2] Yilmaz, S.; Gozukirmizi, N. Biotechnol Biotec Eq 2013, 27(6), 4227-4230

[3] Kalendar, R. et al. Theor Appl Genet 1999, 98, 704-711.

[4] Jaccard, P. Bull Soc Vaud Sci Nat 1908, 44, 223-270.

[5] Elbarbary, R. A. et al. Science 2016, 351 (6274), aac 7247.

https://www.tubitak.gov.tr/en




204

IDDGC17-PP-187

DETECTION OF COMMON BETA THALASSEMIA MUTATIONS IN ÇUKUROVA REGION BY

HRM ANALYSIS Mustafa Muhlis Alparslan

1, Ebru Dündar Yenilmez

1, BaĢak GünaĢtı

1, Abdullah Tuli

1

Çukurova University, Medical Faculty, Department of Medicinal Biochemistry, Adana, TÜRKĠYE


Aims and Scopes: Hemoglobinopathies, deriving from mutations in alpha and beta gene clusters are the most common hereditary

diseases in human. Approximately %7 percentage of the world population is known as being carrier of globin gene mutation. The

widespread usage of High Resolution Melting analysis (HRM) in the molecular diagnosis of Beta Thalassemias in recent years has

been a quick scan tool that carries out the sequence alterations with Polymerase Chain Reaction (PCR) without requiring post-PCR

treatment. This study aimed to detect the most common Beta Thalassemia mutations in Çukurova Region using HRM method and to

compare the results with conventional PCR techniques.

Materials and Methods: HRM analysis was used to determine the common Beta Thalassemia mutations. Beta Thalassemia

mutations were practised in 100 samples which includes both chorionic villus and whole blood. The results confirmed with

Amplification-Refractory Mutation System (ARMS), Restriction Fragment Length Polymorphism (RFLP), Sanger Sequencing

methods.

Results and Conclusion: Five Beta Thalassemia mutations (IVS-I-110, IVS-I-6, IVS I-1, Cd 39, IVS-II-745) which are the most

prevalent in our region are succesfully determined in 100 samples. Comparing with conventional PCR methods, Melting Curve

Analysis has shown that it is an efficient, rapid and also useful in verifying of other methods to characterize Beta Thalassemia

mutations.

Keywords: Beta thalassemia, High resolution melting analysis, ARMS, RFLP, Sanger Sequencing

References: [1] Shih, H.C.; Er, T.K.; Chang, T.J.; Chang, Y.S.; Liu, T.C.; and Chang, J.G. Clin Biochem2009, 42, 1667-76.

[2] Turner, A.; Sasse , J.; and Varadi, A. BMC Med Genet2016, 17, 75.






205

IDDGC17-PP-188

OVER EXPRESSION of YELLOW FLUORESCENT PROTEIN mTopaz in E.coli

in BIOREACTOR for USE in BIOLOGICAL APPLICATIONS

Hülya Kuduğ1, Duygu Düzgün

2, Rizvan Ġmamoğlu

3, Ġsa Gökçe

4

1,2,3,4



[email protected]

Aims and Scopes:

Yellow fluorescent proteins, as a spectral class, are among the brightest and most versatile genetically encoded probes yet developed.

mTopaz is a yellow fluorescent protein (YFP) that a genetic mutant of green fluorescent protein (GFP) originally derived from

the jellyfish Aequorea victoria. Its excitation and emission peaks are 514 nm and 527 nm. Like the parent GFP, YFP is a useful tool

in cell and molecular biology thanks to its properties useful for fluorescence microscopy [1]. In this work we aimed to supply a new

commercial source for new fluorescent proteins by using bacterial expression system to use in numerous applications as bioimaging,

biolabelling, biosensoring and energy material to develop solar cells.


The E.coli strain BL21 (AI) was transformed with a pBAD plasmid containing the gene encoding mTopaz. E.coli cells were grown in

3L Luria-Bertani (LB)-Amp medium in bioreactor. Temperature at 37°C and pH at 7.0 were controlled. The dissolved oxygen

concentration (DO) was maintained at 30% saturation by increasing agitation speed (500–2,000 rpm) and O2 and air if required.

Production of recombinant mTopaz was induced at OD600 =2 with 0.04% (w/v)arabinose. 6xHis-tag on the N-terminus of the protein

used for purification of recombinant mTopaz. Recombinant protein analyzed by SDS-PAGE and UV spectroscopy.


The monomeric yellow fluorescent proteins are currently the most useful probes in the yellow class, but neither is commercially

available [2]. Here we produced recombinant mTopaz protein in high-yield in bioreactor at optimal conditions. Increasing in

volumetric productivity has resulted mainly from improvements in arabinose concentration and induction time. Productivity of

bacterial cells cultivated in bioreactors has reached the 18 gram per liter in highest performance at 5 hours induction with %0.04

arabinose. Optimal conditions for the expression of the gene mTopaz determined by 12% SDS-PAGE and characterized by UV

spectroscopy.

Keywords: Yellow fluorescent protein, mTopaz, Recombinant protein.

References:

[1] Nagai, T.; Ibata, K.; Park, E. S.; Kubota, M.; Mikoshiba, K.; Miyawaki, A. A variant of yellow fluorescent protein with fast and

efficient maturation for cell-biological applications Nature Biotechnology 2002 , 20 (1): 87–90.

[2] Shaner N.C.; Patterson G.H.; Davidson M.W.Advances in fluorescent protein technology. Journal of Cell Science 2007, 120 (24):

42247-60.

Acknowledgements: This study was supported by the Scientific and Technological Research Council of Turkey (TÜBİTAK), Grant

No: 114Z956

https://en.wikipedia.org/wiki/Green_fluorescent_protein

https://en.wikipedia.org/wiki/Jellyfish

https://en.wikipedia.org/wiki/Aequorea_victoria

https://en.wikipedia.org/wiki/Cell_(biology)

https://en.wikipedia.org/wiki/Molecular_biology

https://en.wikipedia.org/wiki/Fluorescence_microscopy




206

IDDGC17-PP-189

PURIFICATION OF GLUTATHIONE REDUCTASE ENZYME FROM SOYBEAN (Glycine max L.)

AND INVESTIGATION OF INHIBITION KINETICS OF SOME HEAVY METALS

Gürkan BĠLĠR1, Deniz EKĠNCĠ

1

1Ondokuz Mayıs University, Faculty of Agriculture, Department of Agricultural Biotechnology, 55100, Samsun, Turkey

([email protected])

Aims and Scopes: Glutathione reductase (Glutathione: NADP+ oxireductase, E.C. 1.8.1.7: GR), is an important antioxidant enzyme

that catalyze conversion of oxidized glutathione (GSSG) into reduced glutathione (GSH) and keep the [GSH]/[GSSG] rate at a certain

level [1]. Inhibition of glutathione reductase activity by several heavy metals in organism, results in negative physiological and

biochemical effects giving rise to several pathologic circumstances. In this study it was aimed to purify glutathione reductase enzyme,

having significant functions in all organisms, from soybean seeds to investigate its certain kinetic properties and effects of some

heavy metals on enzyme activity.

Materials and Methods: To purify GR enzyme from soybean seeds, firstly the homogenate was prepared and then ammonium

sulphate precipitation was performed between the range of 0-60%, based on literature. Following dialysis, it was applied to 2',5'-ADP

Sepharose 4B affinity column [2-4]. During purification process temperature was kept under control and all procedures were

performed at +4oC, in order to minimize the loss of activity. Molecular weight of soybean seed GR was determined by using SDS

polyacrylamide gel electrophoresis technique [5].

Results and Discussion: Purified soybean glutathione reductase enzyme was screened as a single band of about 75 kDa molecular

weight in polyacrylamide gel electrophoresis. Optimum ionic strength, pH and substrate concentrations were examined for soybean

seed glutathione reductase enzyme. These values were found to be 300 mM Tris for optimum ionic strength, 8.5 for pH and 0.18 mM

for substrate concentration. Inhibitory effects of some of the common heavy metals in nature, namely silver, manganese, cadmium,

copper, zinc, nickel, chromium, magnesium and barium on the purified soybean seed glutathione reductase enzyme were investigated.

Each of the heavy metals showed inhibitory effect on enzyme activity. I50 values of these heavy metals were determined as 0.00025

mM, 3.305 mM, 0.0016 mM, 0.318 mM, 0.015 mM, 0.21 mM, 2.394 mM, 3.881 mM and 1.576 mM, respectively.

Keywords: Glutathione reductase, Characterization, Purification, Soybean, Heavy metals

References:

1. Çakmak, R., et al., Design, synthesis and biological evaluation of novel nitroaromatic compounds as potent glutathione reductase

inhibitors. Bioorganic & medicinal chemistry letters, 2011. 21(18): p. 5398-5402.

2. Smith, I.K.; T.L. Vierheller, and C.A. Thorne, Assay of glutathione reductase in crude tissue homogenates using 5, 5′-dithiobis (2-

nitrobenzoic acid). Analytical biochemistry, 1988. 175(2): p. 408-413.

3. Carlberg, I.; B. Mannervik, Purification and characterization of glutathione reductase from calf liver. An improved procedure for affinity

chromatography on 2',5'-ADP-Sepharose 4B. Anal Biochem, 1981. 116(2): p. 531-6.

4. Erat, M., Purification of human erythrocyte glucose 6-phosphate dehydrogenase and glutathione reductase enzymes using 2',5'-ADP

Sepharose 4B affinity column material in single chromatographic step. Protein Expr Purif, 2004. 34(2): p. 257-60.

5. Laemmli, U.K., Cleavage of structural proteins during the assembly of the head of bacteriophage T4. nature, 1970. 227: p. 680-685.




207

IDDGC17-PP-190

PRODUCTION of RECOMBINANT RED FLUORESCENT PROTEIN (mApple) for FURTHER

RESEARCHS in BIOIMAGING

Duygu Düzgün1, Hülya Kuduğ

2, Yasemin Bozkurt

3, Ġsa Gökçe

4

1,2,3,4



[email protected]

Aims and Scopes:

mApple with red fluorescent protein, is suited for use in multiple conventional and super-resolution imaging modalities, specifically,

widefield and confocal microscopy, structured illumination microscopy (SIM), and single-molecule localization microscopy [I]. In the

red to far-red region, mApple is currently the best choice in terms of brightness, photostability and performance in fusion proteins [II].

mApple peaks excitation/emission at 568 nm and 569 nm. This work aimed to expression of mApple in bioreactor in high yield

using E.coli expression system and purification of it.


Transformed E.coli cells with pBAD-mApple recombinant plasmid were cultured in 3 liters LB triple medium supplemented with 100

ug/ml ampicillin at 37 oC in bioreactor. When the optical density at 600 nm was 0.5, L- arabinose was added to a final concentration

of %0.04 in order to express mApple. After 5 hours, the cells were harvested by centrifugation. Cell pellets were suspended in lysis

buffer and disrupted by sonication. Soluble protein was collected using ultra-centrifugation. 6xHis-tag on the N-terminus protein used

for purification of recombinant mApple. The expression levels of mApple was assessed using 10% (w/v) SDS-PAGE and UV

spectroscopy.


One of the most efficient expression systems for producing recombinant proteins in E.coli is a pBAD- system. It is observed that at

optimized arabinose concentration (0.04 %) for 5 hours induction resulted high levels of fluorescent protein expression. The method

relies on induced expression in the BL21-AI strain of E.coli and yields large amounts (18 mg/L) of fluorescent protein from a 3 liters

culture. This method provides a quick, high-yield production and can be used to produce any fluorescent protein that is needed in

biomedical research especially bioimaging.

Keywords: Red fluorescent protein, mApple, Expression in E.coli.

References:

[1] McEvoy, L.A., Hoi, H., Bates, M., Platonova, E., Cranfill, P.J., Baird, M.A., Davidson, M.W., Ewers, H., Liphardt, J., Campbell, R.E. mMaple:

A Photoconvertible Fluorescent Protein for Use in Multiple Imaging Modalities.Plos One. 2012, volume 7, 1.

[2] Shcherbo, D., Murphy, C. S., Ermakova, G. V., Solovieva, E. A., Chepurnykh, T. V., Shcheglov, A. S., Verkhusha, V. V., Pletnev, V. Z.,

Hazelwood, K. L., Roche, P. M., et al. Far-red fluorescent tags for protein imaging in living tissues. Biochem. J. 2009, 418, 567-574.


No: 114Z956




208

IDDGC17-PP-191

PROKARYOTIC OVEREXPRESSION OF A GREEN FLUORESCENT PROTEIN (mEmerald) in

BIOREACTOR and ITS PURIFICATION

Duygu Düzgün1, Hülya Kuduğ

2,Rizvan Ġmamoğlu

3, Ġsa Gökçe

4

1,2,3,4



[email protected]

Aims and Scopes:

The discovery of green fluorescent protein in the early 1960s ultimately indicated a new era in cell biology by enabling investigators

to apply molecular cloning methods, fusing the fluorophore moiety to a wide variety of protein and enzyme targets, in order to

monitor cellular processes in living systems [I].When coupled to recent technical advances in widefield fluorescence and confocal

microscopy, the green fluorescent protein and its color-shifted genetic derivatives have demonstrated invaluable service in many

thousands of live-cell imaging experiments. One of the best of these in terms of photostability and brightness may be

the mEmerald variant, but lack of a commercial source has limited its usege. In this work we aimed to supply a new commercial

source for new fluorescent proteins by using bacterial expression system to product in high yield.


In this work mEmerald gene that cloned into bacterial expression vector pBAD transformed into BL21-AI E.coli strain by heat shock.

mEmerald expression was optimized by fine adjustments such as induction time and inducer concentration. E.coli cells were grown in

3L Luria-Bertani (LB)-Amp medium in bioreactor. Temperature at 37°C and pH at 7.0 were controlled. The dissolved oxygen

concentration (DO) was maintained at 30% saturation by increasing agitation and O2-enrichment if required. Production of

recombinant mEmerald was induced at OD600 =2 with 0.04% (w/v) arabinose. 6xHis-tag on the N-terminus of the protein used for its

purification. mEmerald was characterized by SDS-PAGE and UV spectroscopy.


Our results demonstrated that mEmerald was succesfully expressed in bioreactor in E.coli pBAD expression system under the control

of araBAD promotor. Optimization of the expression procedure showed that, induction by %0,04 arabinose at OD600=2 and 5 hours

incubation at 37°C resulted in the highest expression levels of soluble mEmerald. Expression under optimal conditions as determined

by 12% SDS-PAGE and characterized by UV spectroscopy. The expression of mEmerald resulted in production of a soluble and pure

in a yield of 20 mg/L bioreactor cultivation.

Keywords: Green fluorescent protein, mEmerald, Recombinant protein

References:

[1] Soundrarajan, N., Cho, S.Y., Ahn, B., Choi, H., Thong, L.M., Choi, H., Cha, S.Y., Kim, J.H., Park, C.K., Seo, K., Park, C. Green

fluorescent protein as a scaffold for high efficiency production of functional bacteriotoxic proteins in Escherichia coli. 2016, volume

6, 1.


No: 114Z956




209

IDDGC17-PP-192

ENHANCED IN VITRO BIOMASS PRODUCTION IN LAVANDULA STOECHAS

SUBSP STOECHAS L.

Nihan AKINCI1, Cüneyt AKI

1

1 Department of Biology, Faculty of Arts and Science, Çanakkale Onsekiz Mart University, Çanakkale, Turkey [email protected]

Aims and Scopes: Lavandula stoechas subsp stoechas L. is an important plant that is used in food, cosmetics, perfumery and

pharmaceutical industries [1]. Therefore, in vitro culture of this plant is very important. Various internal and external factors affect

callus induction and growth; several chemical factors, nutrients and exogenous plant growth regulators (PGRs) are the most important

factors affecting plant growth in in vitro culture [2]. In plant tissue and cell culture, callus growth and biomass production are also

controlled by the types and concentrations of PGRs, and the interactions between PGRs [2,3].

This research aims to evaluate the effects of different concentrations and combinations of plant growth regulators on callus growth

and biomass production in L. stoechas subsp. stoechas which are cultured in vitro, for the purpose of maximizing growth.

Materials and Methods: L. stoechas subsp stoechas plants were collected from Lapseki, Çanakkale on May 2015. After surface

sterilization, leaf explants were placed on ten different MS medium which supplemented with two auxin (NAA or IAA) (0,5; 1 mg/L)

in combination with different concentrations of cytokinin (BAP) (0,5; 1; 2; 4; 5 mg/L) and 3% (w/v) sucrose for callus induction. The

pH of medium was adjusted to 5.75 before autoclaving. The medium was gelled with 0.7% (w/v) agar. Petri plates were placed in

controlled growth chamber at 25±2°C under 16 h light and 8 h dark cycle with a light intensity of 72 µmol m-2s-1 provided by cool-

white fluorescent lamps. Each treatment had five plates with 10 explants per plate. Plant explants were routinely sub-cultured (every

20 days for 5 months) to fresh medium with the respective PGRs and concentrations. In order to determine the biomass changes, fresh

weight was weighed by precision scale in laminar flow cabinet during each subculture.

Results and Discussion: After the second subculture, three MS media, which were containing the combination of 1 mg/L NAA+5

mg/L BAP, 1 mg/L IAA+1 mg/L BAP and 1 mg/L IAA+5 mg/L BAP were eliminated for very small amount of callus. Maximum

callus biomass increase have occured in MS medium containing the combination of 1 mg/L NAA+2 mg/L BAP, whereas minimum

callus biomass increase have occured in MS medium containing the combination of 1 mg/L IAA+4 mg/L BAP.

Increases in the amount of callus biomass were determined to be dependent on the PGRs concentrations and combinations. It is

thought that the differences between NAA+BAP mixture and IAA+BAP mixture are due to IAA‘s and NAA‘s molecular differences

and their different degrees of binding of biological membrane lipids.

Calli were observed compact and dark green in MS media which containing the mixture of NAA+BAP, so they can be used for the

shoot regeneration, micropropagation researches. Moreover, calli are friable and light green in the MS media which containing the

mixture of IAA+ BAP, hence, these calli are more suitable for the cell suspension culture, secondary metabolites production

researches.

Plant cell suspension cultures are very important secondary metabolite sources for natural drug‘s raw material. Different PGRs can be

used to increase the secondary metabolite capacity in in vitro plant cell cultures for the future researches.

Keywords: Lavender, plant growth regulator, callus, in vitro.

Acknowledgements: This work has not been funded by any organization.

References: [1] Angioni, A.; Barra, A.; Coroneo, V.; Dessi, S.; Cabras, P. J. Agric. Food Chem. 2006, 54, 4364-4370.

[2] Fatima, Z., Mujib, A., Fatima, S., Arshi, A. And Umar, S. Turk J Bot 2009, 33, 393-405. [3] Asemota, O., Eke, C.R. and Odewale, J.O. African J Biotechnol 2007, 6, 2353-2357.




210

IDDGC17-PP-193

DETERMINATION OF GENETIC DIFFERENCES IN Eurygaster austriaca (HEMIPTERA:

SCUTELLERIDAE) POPULATIONS

Serdar Bilginturan1, Erhan Koçak

1

1Süleyman Demirel University, Agriculture Faculty, Agricultural Biotechnology Department, 32260, Isparta, TURKIYE, Email:

[email protected]

Abstract

In Turkey's agricultural production, wheat is an important food material and an important input source for humans. Sunn pest,

Eurygaster spp. (Heteroptera: Scutelleridae) is the most important pest of wheat in the Middle East, the Near East, the Balkans and

Russia. There are three species of Sunn pest (Eurygaster integriceps, E. maura, E. austriaca) with economical importance in Turkish

cereal fields [1]. The aim of the study is to determine the genetic differences within the species of Eurygaster austriaca which cause

damage in cereal fields in our country. For this purpose, Marmara (Çanakkale, Edirne, Balikesir, Sakarya, Kocaeli), Aegean (Muğla,

Aydın, Uşak, Denizli, İzmir), Mediterranean (Antalya, Isparta), Eastern Anatolia (Tunceli, Bingöl) and Central Anatolia (Kırıkkale,

Konya) in total 16 populations were collected from five regions. From the E. austriaca DNAs obtained by CTAB method [2], AFLP

PCR method [3] was used as a molecular marker. LI-COR 4200 Global Edition IR2 DNA Gene Sequencer, which can read from two

different channels (700-800 nm) was used for the analysis with Saga Lite Electrophoresis Software. In the study, green colored

(700nm) EcoRI 5'-GACTGCGTACCAATTC NNN-3' ACC, AGC, ATT, CAA, CGC, CGG, GAA, GTT, GGG; with the red colored

EcoRI primers AAA, AAG, ATC, CCG, CTT, CCC, GAT, GGC (800 nm) in the combination of MseI primers 5'-

GATGAGTCCTGAGTAA NNN-3' TGG, GTT, CCC, AGG, TCG, ACC, CAA, CGG, ACG, GCG, AGC performed in a single E.

austriaca population and results of EcoRI-CGC/MseI-TGG(42), EcoRI-CCC/ MseI-GTT(40), EcoRI-ACC/MseI-CCC(35) have been

identified as the most polymorphic combinations. Also, the polymorphism rates of other populations collected from across the country

are going to be determined. It is expected that an average of 200-250 polymorphic bands will be obtained in Turkish populations of E.

austriaca in the obtained data. This suggests that the species has a high variation rate and therefore is subject to a low selection

pressure or that the population may have been affected by genetically different individuals. It is possible to come across this situation

in our country which is at the intersection of migration routes.

Eurygaster austriaca, Molecular, Population, AFLP, Türkiye

References:

[1] Koçak, E., S. Bilginturan, E. Kaya, C. Gözüaçık, N. Babaroğlu, M. İslamoğlu, G.Çetin, A. Tülek, Türkiye Hububat Alanlarındaki Süne (Eurygaster

spp.) Türlerinin Dağılımı. Türkiye V. Bitki Koruma Kongresi, 2014, 115.

[2] Nancy, C.-C., Mauricio, Q., Horacio, C.-C. and Guadalupe, Z.-P., A Simple and Rapid Method for DNA Isolation from Xylophagous Insects.

International Journal of Molecular Sciences, 2010, 11, 5056-5064.

[3] Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Hornes M, Frijters A, Pot J, Peleman J, Kuiper M, Zabeau M, AFLP: a new technique for

DNA fingerprinting. Nucleic Acids Research. 1995, 23(21), 4407-4414.




211

IDDGC17-PP-194

ATP-BINDING CASSETTE TRANSPORTERS

Tuba Yıldırım

1, Seda Mesci

2, Burak Yazgan

3, Belgin Sırıken

4

1,

Department of Biology, Faculty of Arts and Sciences, Amasya University, 05100, Amasya, Turkey,

(E-mail: [email protected])

2Department of Biology, Institute of Science, Amasya University, 05100, Amasya, Turkey

3Central Research Laboratory, Amasya University, 05100, Amasya, Turkey

4Departments of Aquatic Animal Diseases, Faculty of Veterinary Medicine, Ondokuz Mayıs University,

55200, Samsun, Turkey

Abstract (Review):

The development of resistance against treatment or drug in cancer cells is a major problem. Chemotherapy resistance results in failure

in treatment of more than 90% of patients with metastatic cancer. Drug transport proteins cause apoptosis suppression, increased

proliferation, changes in drug-target interaction, drug inactivation and resistance to cytotoxic agents. In the treatment of cancer,

resistance can be prevented by removing these factors [1, 2, 3].

P-glycoprotein (P-gp/MDR), multidrug resistance-associated proteins (MRPs) and breast cancer resistance protein (BCRP) encoded

by ABCB1 gene, members of the ATP-binding cassette (ABC) transporter protein family, play a role in the intestinal excretion of

drugs. In addition, it also facilitates bile and urinary excretion of drugs in the liver and kidneys [4, 5, 6].

In cancer cells in which P-gp protein is not expressed, it was determined that ABC proteins were synthesised in high amounts, and

also more than 49 different ABC transporters were identified [3]. The ABCC subfamily with 13 members of the ATP-binding cassette

(ABC) transporter (MRP1/ABCC1, MRP2/ABCC2, MRP3/ABCC3, MRP4/ABCC4, MRP5/ABCC5, MRP6/ABCC6,

MRP7/ABCC10, MRP8/ABCC11 and MRP9/ABCC12) play an important role in the development of multiple drug resistance [7].

Currently, molecules blocking P-gp function have been synthesising to overcome P-gp mediated multidrug resistance in cancer

treatment and provide accumulation of anti-cancer drugs in tumour cells [1, 2, 8].

Keywords: ABC Transporters, P-glycoprotein (P-gp/MDR), Cancer.

References:

[1] Stavrovskaya, A.A.; Stromskaya, T.P. Biochemistry (Mosc), 2008, 73:592-604.

[2] Pala Kara, Z.; Öztürk, N.; Öztürk, D.; Okyar, A. Marmara Üniversitesi Sağlık Bilimleri Enstitüsü Dergisi, 2013, 3(1):1-13.

[3] Cort, A.; Özben, T.; Saso, L.; De Luca, C.; Korkina, L. Hindawi Publishing Corporation Oxidative Medicine and Cellular Longevity, 2016,

pp17.

[4] Cole, S.P.C.; Deeley, R.G. Bioessays, 1998, 20 (11):931-940.

[5] Boumendjel, A.; Florin, A.; Boutonnat, J. ABC Transporters and Multidrug Resistance. John Wiley & Sons Inc; Hoboken, NJ: 2009.

pp261–288.

[6] Karvar, S. Turkish Journal of Biology, 2014, 38: 800-805.

[7] Zhou, S.F.; Wang, L.L.; Di, Y.M.; Xue, C.C.; Duan, W.; Li, C.G.; Li, Y. Current Medicinal Chemistry, 2008, 15(20).

[8] Kumar, Y.S.; Adukondalu, D.; Sathish, D.; Vishnu, Y.V.; Ramesh, G.; Latha, A.B.; Reddy, P.C.; Sarangapani, M.; Rao, Y.M.

Metabolism and Personalized Therapy, 2010. 25:1-4.

http://www.ingentaconnect.com/content/ben/cmc;jsessionid=27r9css7eolpj.alexandra


http://www.degruyter.com/view/j/dmdi.2010.25.issue-1-4/issue-files/dmdi.2010.25.issue-1-4.xml




212

IDDGC17-PP-195

PARTIAL PURIFICATION OF CARBONIC ANHYDRASE ENZYME FROM BROWN MEAGRE (Sciaena

umbra) GILL AND INVESTIGATION OF INHIBITION KINETICS OF SOME HEAVY METALS

AyĢe Karabuğa1,Gürkan Bilir

1, Ömer TaĢ

1, Ahmet Can Olcay

1, Deniz Ekinci

1


([email protected])

Aims and Scopes: Carbonic anhydrase (CA, EC 4.2.1.1) is an important zinc metalloenzyme catalyzing rapid and reverse hydration

and dehydration reactions of carbondioxide (CO2) and bicarbonate (HCO3-), respectively [1]. It is known to regulate pH and CO2

levels in all living organisms [2]. Discovery of novel CA inhibitors are crucial for their potential applications for drugs acting as

diuretics, antiepileptics, antiglaucoma, antiobesity and antitumour agents [3]. In this study carbonic anhydrase enzyme was partially

purified from gill tissue of brown meagre (Sciaena umbra) to perform enzyme characterization and investigate the effects of certain

heavy metals on enzyme activity.

Materials and Methods: Tissue homogenate of brown meagre gill was prepared using liquid nitrogen to be utilized in purification

steps. CA enzyme was partially purified from the tissue extract by means of ammonium sulphate precipitation and dialysis. Following

the purification step, optimum values of ionic strength, substrate concentration and pH for the enzyme were determined by

spectrophotometric analyses. Inhibitory effects of certain heavy metals (Fe, Ag, Pb, Cr, Ba) on CA activity were also investigated.

Results and Discussion: The highest activity for brown meagre CA enzyme was observed at 60-70% interval of ammonium sulphate

precipitation. In the characterization studies, we determined the optimum ionic strength as 200 mM Tris buffer, optimum substrate

concentration as 3.09 mM and optimum pH as 9, for brown meagre gill carbonic anhydrase enzyme. Each of the heavy metals tested

showed inhibitory effects on the enzyme activity. I50 values of the heavy metals were calculated to be 0.844 mM for Fe, 1.815 mM for

Ag, 1.104 mM for Pb, 1.455 mM for Cr and 3.752 mM for Ba.

Keywords: Carbonic anhydrase, Characterization, Purification, Brown meagre, Heavy metals.

References:

[1] Supuran, C. T.; Scozzafava, A.; & Casini, A. Carbonic anhydrase inhibitors. Medicinal research reviews 2003, 23(2), 146-189.

[2] Soydan, E.; Güler, A.; Bıyık, S.; Şentürk, M.; Supuran, C. T.; & Ekinci, D. Carbonic anhydrase from Apis mellifera: purification and inhibition

by pesticides. Journal of Enzyme Inhibition and Medicinal Chemistry 2017, 32(1), 47-50.

[3] Supuran, C. T. Structure and function of carbonic anhydrases. Biochemical Journal 2016, 473(14), 2023-2032.




213

IDDGC17-PP-196

Identification of Transposable Elements Induced with Cold Stress in

Brachypodium distachyon

Tugba Gurkok1 , Mine Turktas

2, Bilge Hilal Cadırcı

3, Mehmet Kursat Guzel

4


2 Cankiri Karatekin University, Faculty of Science, Biology Department, Cankiri, Turkey

3 Gaziosmanpasa University, Faculty of Engineering and Natural Sciences Department of Bioengineering, Tokat, Turkey

4 Gaziosmanpasa University, Faculty of Science, Biology Department, Tokat, Turkey

Aims and Scopes: Abiotic stress such as cold leads several physiological and molecular alterations in plants. As a member of

Poaceae Brachypodium distachyon has a small genome and was introduced as a model plant for genomic and transcriptomic studies.

Transposable elements (TEs) are the major components of plant genomes that have important roles in host genome organization and

regulation. Here, we in silico identified the transposons in B. distachyon treated with cold.

Materials and Methods: Previously, RNA-seq analysis was conducted through in cold treated and control B. distachyon. The

sequences obtained from transcriptome assays were downloaded from NCBI and reads were aligned to the B. distachyon whole

genome. Using RepeatMasker program homology based in silico identification of TEs was performed. Classification of transposons

was carried out with using PGSB data base and TEs were clustered. The read numbers of transposons were detected and the read

numbers were compared between cold treatment RNA-seq library and control library.

Results and Discussion: It has been several studies about the how transposons effect host genome organization. However, so much

evidence has obtained that TEs are also transcriptionally active. Here, we found that both in control and treated plants revealed TE

expression. Besides, it was determined that after cold treatment the number of TE read numbers were higher in comparison with

control. This might be evidence that cold treatment induce TE transcription in B. distachyon. In addition RNA transposons such as

Gypsy showed higher ratios revealing a correlation between abiotic stress and retrotransposon relation.

Keywords: Brachypodium, cold stress, transcriptome, transposons




214

IDDGC17-PP-197

RECENT DEVELOPMENTS ON GENOMICS OF LACTIC ACID BACTERIA

Sevcihan TaĢ1, Emel Banu Büyükünal

1

1KahramanmaraĢ Sütçü Ġmam University, Faculty of Science and Letters, Department of Biology, Turkey

Aims and Scopes:

Lactic acid bacteria (LAB) are widely used in the food industry as starter cultures or as probiotics [1]. In addition, they are valuable

for production of bulk and fine chemicals such as including lactic acid, polyols, vitamins and food ingredients, because of their

stabilities against environmental stresses and diverse metabolic characteristics [2]. Until now, more than 75 complete LAB genomes

have been sequenced and many traits related to industrial applications of LAB have been clarified based on the genomic analysis [3].


The introduction of genomics and functional genomics as well as high-throughput technologies in the last decade has provided an

extensive understanding of genetics, physiology and application of LAB. This review aims to illustrate recent developments on

industrial LAB that are obtained through genomics [4].


The genetic events including genome reduction, horizontal gene transfer (HGT) and gene duplication have been considered to

contribute to the present genome shape and structure of LAB. The availability of sequenced genomes allows the understanding of the

evolution and divergence of LAB as well as understanding the industry-relevant physiological features of LAB. Omics approaches

characterized by genomics, transcriptomics, proteomics and metabolomics analyses will help discovery of novel genes, proteins,

metabolic pathway and regulatory circuits, which may increase the understanding of the industrial application related physiological

features. This knowledge will offer opportunities to engineer LAB with improved functionalities and industrial applications.

Keywords: genomics, horizontal gene transfer (HGT), lactic acid bacteria (LAB)

References:

[1] Douillard, F. P.; de Vos, W. M. Microbial Cell Factories 2014, 13, S1-S8.

[2] Gaspar, P.; Carvalho, A. L.; Vinga, S.; Santos, H.; Neves, A.R. Biotechnology Advances 2013, 31, 764-788.

[3] Schroeter, J.; Klaenhammer, T. FEMS Microbiology Letters 2009, 292, 1-6.

[4] Chongde, W.; Jun, H.; Rongqing, Z. Critical Reviews in Microbiology 2017, 1-11.




215

IDDGC17-PP-198

CHARACTERIZATION OF GLUTATHIONE REDUCTASE ENZYME FROM THE GILL TISSUE

OF TURBOT (Psetta maxima) AND EXAMINATION OF INHIBITION KINETICS OF SOME

PESTICIDES

Ömer TAġ1, Deniz EKĠNCĠ

1


([email protected])

Aims and Scopes: Glutathione reductase (Glutathione: NADP+ oxidoreductase, E.C.1.8.1.7; GR), catalyzes the reduction of

glutathione disulfide (GSSG) to reduced form (GSH) in the presence of NADPH. In order to maintain a high ratio of [GSH]/[GSSG],

the enzyme has a crucial role [1]. Inhibition of glutathione reductase activity results in adverse physiologic and biochemical effects in

the organism. This could lead to the alterations in the metabolisms of living organisms, and cause detrimental effects for both life

kingdom and environment[2]. In this study, it was aimed to investigate the purification of glutathione reductase enzyme, having

important functions in all organisms, from the gill tissue of the turbot fish, determine some kinetic properties and understanding the

effect of some pesticides on enzyme activity.

Materials and Methods: The homogenate of turbot gill was initially prepared for the purification of the total GR enzyme from the

extract. Based on the literature information, ammonium sulphate precipitation and dialysis were performed at 60-80% interval [3-4].

Enzyme activity was measured spectrophotometrically at 340 nm. All of the purification steps were carried out at + 4 °C in order to

prevent loss of activity as much as possible.

Results and Discussion: Optimum ionic strength, pH and substrate concentrations were examined for turbot gill tissue glutathione

reductase enzyme. These values were found to be 300 mM phosphate for optimum ionic strength, 6.5 for pH and 0.2 mM for substrate

concentration. Inhibitory effects of some common pesticides, namely atrazine, carbaryl, carbofuran, oxamyl, propoxur, simazine and

tebuconazole on the purificated turbot gill glutathione reductase enzyme were investigated. Each of the pesticides showed inhibitory

effect on enzyme activity. I50 values of these pesticides were determinated as 18.728 µM, 14.395 µM, 19.716 µM, 17.854 µM, 16.709

µM, 14.281 µM and, 9.516 µM, respectively.

Keywords: Glutathione reductase, Characterization, Purification, Turbot, Gill, Pesticide

References:

[1] Schirmer, R.H.; Krauth-Siegel, R.L. Schulz, G.E, In Coenzymes and Cofactors In: Dolphin, D., Poulson, R., Avramovic, O., Eds, John

Wiley and Sons, New York 1989, Vol.3, p. 553-559.

[2] Ekinci, D.; Beydemir, Ş., Risk assessment of pesticides and fungicides for acid–base regulation and salt

transport in rainbow trout tissues. Pesticide Biochemistry and Physiology 2010, 97(1), p. 66-70

[3] Smith, I.K.; T.L. Vierheller, and C.A. Thorne, Assay of glutathione reductase in crude tissue homogenates using

5,

5′-dithiobis (2-nitrobenzoic acid). Analytical biochemistry 1988, 175(2), p. 408-413.

[4] Carlberg, I.; Mannervik, B., Purification and characterization of glutathione reductase from calf liver. An

improved procedure for affinity chromatography on 2',5'-ADP-Sepharose 4B. Anal Biochem, 1981, 116(2), p.

531-6.




216

IDDGC17-PP-199

Determination of microRNAs Involved in Oil Biosynthesis and Fruit Maturation in Olive Using Real Time PCR

Mine Turktas1, Tugba Gurkok

2, Ummugulsum Tanman Ziplar

1

1 Cankiri Karatekin University, Faculty of Science, Biology Department, Cankiri, Turkey [email protected]


Aims and Scopes: Being a member of Oleaceae family and characteristic tree of Mediterranean region, olive is an economically and

ecologically important domesticated plant. Beside to its agricultural importance, it is widely used in health and cosmetics industries,

as well. 97% of the world's olive production comes from Mediterranean basin. Having 90 million trees, Turkey is the fourth largest

country producing olive. MicroRNAs (miRNA) are small non-coding RNAs having important roles in various metabolic pathways

like growth of plants and stress responses. Although miRNAs have been identified in olive, any studies have been conducted on olive

oil biosynthesis and fruit development. In this study, in silico miRNA identification have been done on two olive (Olea europaea)

varieties in different stages of development. Expression level of 10 miRNAs and their target genes were analyzed on four olive

samples using real-time PCR, and their effects on development and oil biosynthesis were evaluated.

Materials and Methods: The work-flow of the study includes; i) identification of miRNAs in transcriptome libraries using

bioinformatic tools, ii) identification of target genes, iii) designing appropriate primers for amplification of the miRNAs and target

genes to be analyzed with qRT-PCR, iv) RNA isolation from fruits of two olive varieties each collected at two different

developmental stages, v) Determination of expression levels of miRNA and target genes by quantitative RT-PCR.

Results and Discussion: A total of known 1816 miRNAs have been identified among four transcriptome libraries. Differential

expression of miRNAs have been observed between the libraries. As a result of the target analysis, 534 pre-miRNA sequences showed

homology with 6084 EST sequence. Some miRNA sequences target a large number of genes, while some target only a single gene.

Each miRNA analyzed on average was found to have 11 target genes. The results indicate that while miRNAs involved in different

pathways show differences between the two olive varieties, they play a more significant role in the ripening process in olive.

Keywords: Bioinformatics, development, olive, oil biosynthesis, micro RNA

Acknowledgements: The project was supported by Cankiri Karatekin University Scientific Research Committee (Project Number:

FF090316B04).




217

IDDGC17-PP-201

SURVEY OF CHIMERIC mRNAs IN HIV INFECTED PATIENT RNA-SEQ DATA

Oğuzhan Kalyon1 , Alper Yılmaz

2

1 Yildiz Technical University, Faculty of Arts and Sciences, Department of Molecular Biology and Genetics, Istanbul, Turkey.

[email protected] 2 Yildiz Technical University, Department of Bioengineering, Istanbul, Turkey

Aims and Scopes: It has been demonstrated that the HIV virus is integrated into the host DNA. The integrated provirus may be

transcriptionally silent or active, and its regulation depends on viral or host factors [1]. Due to viral sequence integration into host

genome, there are fusion gene cases at DNA level. However, there are other ways of producing fusion sequences at RNA level and

trans-splicing is most typical example of RNA fusion.

Trans-splicing is a special form of alternative splicing, like alternative cis-splicing, which can facilitate diversification of genotypes and

phenotypes. This phenomenon is not only observed in host cells where trans-splicing takes places between genes of same species, but

also observed between viral mRNA and host mRNA [2]. Earlier studies showed that HIV Nef mRNA is able to trans-splice to both non-

HIV viral (SV40) and host mRNAs [3]. Revealing all possible trans-splicing events by traditional methods is merely impossible but

with advent of next generation sequencing technology and vast databases of raw sequencing data, rare events of trans-splicing cases can

be unveiled.

Materials and Methods: We are interested in viral RNA and host RNA trans-splicing cases and beyond. Next generation sequencing

high throughput detection because we can determine all of fusion that has not been investigated in specific region. We performed a

survey of viral-host fusion mRNA cases in HIV infected patients. Hundreds of millions of RNA-Seq reads were aligned to reference

sequence composed of human genome and viral genome sequences.

Results and Discussion: We identified split alignments of short reads to both human genome and viral genome found in infected

patients. The results of this study has potential to contribute to understanding of viral mechanisms yet to be discovered.

Keywords: HIV, next generation sequencing, fusion transcript

References:

[1] Lusic, M., & Siliciano, R. F. Nature Reviews Microbiology 2016 , 15(2), 69-82.

[2] Patzel, V. SOJ Microbiol Infect Dis 2013, 1(1), 2.

[3] Caudevilla, C., Da Silva-Azevedo, L., Berg, B., Guhl, E., Graessmann, M., & Graessmann, A. FEBS letters 2001, 507(3), 269-279.




218

IDDGC17-PP-202

DIFFERENTIAL GENE EXPRESSION ANALYSIS RELATED TO WNT SIGNALING PATHWAY IN

DOXORUBICIN RESISTANT HELA CELL LINE

Pelin MUTLU1, Serap YALÇIN

2, Negar TAGHAVĠ POURĠANAZAR

3, Meral YÜCEL

3, Ufuk GÜNDÜZ

3

1Middle East Technical University, Central Laboratory, Molecular Biology and Biotechnology R&D, Ankara, TURKEY

2Ahi Evran University, Department of Molecular Biology and Genetic, KırĢehir, TURKEY

3Middle East Technical University, Department of Biology, Ankara, TURKEY

Contact author (Pelin MUTLU): [email protected], [email protected]

Text

Aims and Scopes: Starring role of activation of the Wnt signal transduction in the pathogenesis of some types of solid tumors and

also its relation with chemotherapy resistance is a very interesting issue that has been emphasized in recent years [1,2]. Although, it is

known that increase in the activity of β-catenin is important in cancer formation and drug resistance, the underlying mechanisms are

still unclear. The Wnt signaling pathway, being highly conserved evolutionarily in an organism, is involved in both embryonic and

adult stages [3]. β-catenin which is located in cytoplasm, is moved to the nucleus by the activation of Wnt signaling. Thus, it activates

transcription of many genes that are regulating cell proliferation. Many of these genes are known as oncogenes and are important

targets in cancer treatment. Changes in the expression levels of the genes that take part in this signaling pathway, may lead to the

emergence of various types of cancer [4,5].

Materials and Methods: In this study, changes in the expression levels of 93 genes related to Wnt signaling pathways that are

thought to be important in drug resistance were determined by using qPCR method in doxorubicin-sensitive and -resistant HeLa

(cervical cancer) cell lines. Genes that were up or downregulated more than twofolds were considered as significant.

Results and Discussion: Among these genes 6 of them overexpressed and 30 of them downregulated while the rest remained

unchanged in doxorubicin resistant HeLa cell line with respect to its drug sensitive subline. This report provides a preliminary in vitro

study to the relationship between drug resistance and Wnt signaling pathway in cervical cancer. Since in vitro developed drug-

resistant HeLa sublines do not have similar microenvironment of tumor cells as in vivo, correlation of drug resistance requires further

analysis. With the data obtained from this study, new diagnostic, prognostic and therapeutic candidate molecules in Wnt signaling

pathways can be put forward which are related to Doxorubicin resistance in cervical cancer.

Keywords: Cervical cancer, HeLa cell line, Doxorubicin resistance, Wnt signaling

References:

[1] Nusse, R.; Varmus, H.E. Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of

the host genome. Cell 1982, 31, 99–109.

[2] Zhang, H., Zhang, X., Wu, X., Li, W., Su, P., Cheng, H., Xiang, L., Gao, P., Zhou, G. Interference of Frizzled 1 (FZD1) reverses

multidrug resistance in breast cancer cells through the Wnt/b-catenin pathway. Cancer Letters 2012, 323, 106-113.

[3] Nusse, R., Varmus, H.E. Wnt genes. Cell 1992, 69, 1073-1087.

[4] Ġlyas, M. Wnt signalling and the mechanistic basis of tumour development. Journal of Pathology 2005, 205, 130–144.

[5] Lustig, B., Behrens, J.J. The Wnt signaling pathway and its role in tumor development. Journal of Cancer Research and Clinical

Oncology 2003, 129, 199-221.

This work was supported by the THE SCIENTIFIC AND TECHNOLOGICAL RESEARCH COUNCIL OF TURKEY(Project

Number: TÜBĠTAK-SBAG (214S634)).


https://www.tubitak.gov.tr/en




219

IDDGC17-PP-203

GENOME-WIDE IDENTIFICATION OF CAMTA GENE FAMILY MEMBERS IN PHASEOLUS

VULGARIS AND THEIR EXPRESSION DURING SALT STRESS

Ġlker BÜYÜK1, Emre ĠLHAN

2, Dilara YILDIRIM

1, Behçet ĠNAL

3, Sümer ARAS

1

1Department of Biology, Faculty of Science, Ankara University, Ankara, Turkey

2Department of Molecular Biology and Genetics, Faculty of Science, Erzurum Technical University, Erzurum, Turkey

3Department of Agricultural Biotechnology, Faculty of Agriculture, Siirt University, Siirt, Turkey

[email protected]

Aims and Scopes: Transcription factors (TFs) play an important role in growth and development of plants as well as all organisms in

the nature. Up to date, approximately 30 TF families were identified and they were classified according to the conserved motifs that

code for the DNA-binding domains. Calmodulin-binding transcription activator (CAMTA) gene family is a novel protein family and

was first identified in tobacco, then CAMTAs were reported existing in various eukaryotes, including Arabidopsis thaliana, rice and

many other plants such as grapevine. However, no such information is available in common bean till now. Hence, the present study is

aimed to identify and characterize CAMTA genes at a genome-wide scale in common bean.

Materials and Methods: For this purpose various in-silico approaches have been used and the results have been confirmed through

bench-work studies. Expression levels of putative Pvul-CAMTA genes have also been analyzed using publicly available RNA-seq data

and further, the expression levels of eight putative Pvul-CAMTA genes have been investigated using qRT-PCR in common bean

cultivars; cv. ‗Yakutiye‘ and cv. ‗Zulbiye‘.

Results and Discussion: As a results, a total of 8 candidate Pvul-CAMTA genes were identified and they were distributed on

chromosomes 1, 2, 3, 6 and 9. A total of seven Pvul-CAMTA genes were targeted by miRNAs of 9 plant species and the most targeted

gene was Pvul-CAMTA-4. The expression profile of Pvul-CAMTA genes based on publicly available RNA-seq data and qRT-PCR

analysis revealed that the expression profiles of Pvul-CAMTA genes were mostly changed under salt stress treatment in both leaf and

root tissues. Expression profile analysis of CAMTA genes based on RNAseq and qRT-PCR technologies revealed that Pvul-CAMTA

genes might play an important role in salt stress response for common bean cultivars. The current genome-wide and gene expression

analyses of Pvul-CAMTA genes in common bean may provide an important genetic resource for further studies such as gene knockout

and protein-protein interaction studies since it is the first study to identify and analyze CAMTA members in common bean.

Additionally, potentials of these genes as functional markers may be useful for breeding new stress tolerant common bean cultivars.

Keywords: CAMTA, Phaseolus vulgaris L., qRT-PCR, bioinformatics, RNA-seq





220

IDDGC17-PP-204

EXPRESSION ANALYSIS OF Pvul-CAMTA GENES IN RESPONSE TO COLD STRESS

CONDITIONS IN PHASEOLUS VULGARIS

Ġlker BÜYÜK, Ata Umut ÖZSOY, Dilara YILDIRIM, Sümer ARAS

Department of Biology, Faculty of Science, Ankara University, Ankara, Turkey

[email protected]

Aims and Scopes: Low temperature or cold stress is one of the types of abiotic stress which has a huge impact on farmers and

impacts bean growers all over the world in every single country. It has been shown to enhance the transcript, protein and activity of

many stress related genes/proteins up to date. The identification and characterization of cold stress-related genes is quite important to

enhance our knowledge of response mechanisms against cold stress conditions in common bean. Hence, the present study is aimed to

analyze the expression profiles of Pvul-CAMTA (Calmodulin-binding transcription activator genes in common bean) genes which

have been previously identified by our research group in two common bean cultivars under cold stress conditions.

Materials and Methods: For this purpose, two common bean cultivars; cv. ‗Yakutiye‘ and cv. ‗Zulbiye‘ have been grown under

controlled conditions in climate chambers and were exposed to +4 °C for 3, 12 and 24 hours. Immediately following sampling, leaves

were homogenised with liquid nitrogen and RNAs were extracted using the TRIzol protocol. cDNAs were synthesized and used as a

qRT-PCR template. SYBR Green Real Time PCR (qRT-PCR) analysis of 6 Pvul-CAMTA genes were performed using the Light

Cycler Nano (Roche Diagnostics, US) and Actin (ACT) gene was used as control for the normalization of qRT-PCR data.

Results and Discussion: The data obtained from qRT-PCR analysis showed that the alterations in the expression levels of Pvul-

CAMTA genes were found significantly associated with the changes in exposure time of cold stress in both common bean cultivars

(Yakutiye and Zulbiye). The study concluded that expression levels of almost all of the Pvul-CAMTA genes were decreased

depending on the increase in exposure time of cold stress. In the light of these findings, the role of Pvul-CAMTA genes in stress

response of common bean against cold stress conditions was shown and their possible role in early stress perception and defense were

evaluated in the current study.

Keywords: Cold stress, CAMTA, common bean, qRT-PCR, abiotic stress





221

IDDGC17-PP-205

UNKNOWN DNA SEQUENCE ANALYSIS USING BIOINFORMATIC TOOLS

Meriem Taleb 1,2

, , Ghania Tail 1, Halide Nihal Açikgöz

2

1Laboratory of Biotechnologies Environment and Health, Faculty of Nature and Life Sciences, University of Blida1, Blida, Algeria.

2Laboratory of Forensic Biology and Entomology, Forensic Sciences Institute, Ankara University, Ankara, Turkey.

Aims and Scopes: Bioinformatics is at the crossroads of different scientific disciplines, in particular biology, mathematics, and

computer sciences [1]. In this work, a DNA sequence fragment from an available public sequence pool was analyzed in order to

annotate the putative function of the protein product, as well as the most likely taxonomic classification of the host organism.

Materials and Methods: The in silico analyses begin with open reading frame (ORF) prediction, followed by identification of

conserved protein functional domains, as well as similarity searching in sequence databases. Where homologs are identified, analysis

concludes with multiple sequence alignments and phylogenetic tree reconstruction [1].

Results and Discussion:Open reading frames (ORFs) were searched in two directions using SMS [2]. The longest sequence (which

codes for 316 aa) was chosen. After the translation of the ORF, the 3D modeling was carried out. Our sequence contains 261 groups,

2011 atoms and 2039 bonds. The protein domains were then searched using PFAM database [3]. The significant protein domain found

was DUF697 which has an E-value 0.00031 and belongs to the family of bacterial proteins of unknown or hypothetical functions that

are usually associated with a GTPase. The BLASTp [4] results were not optimal. There were no homologues that align well with our

sequence, similarity in all cases and about 50%. The two highest scores are close, one was 203 with E-value of 3e-61, the other was

201 with E-value of 3e-60 while the smallest was 36.2 with E-value of 9.8. The taxonomic report did not give convincing results. the

scores were close and weak so we chose only a study group made up of proteobacteria, CFB group bacteria and firmicutes.

Using CLUSTALw (EBI) [5], we performed an alignment with only 6 sequences that have the highest scores. The resulting

phylogeny [6] shows that our sequence is specifically related to the Proteobacteria family. It is therefore legitimate to conclude that it

is close to the g-proteobacteria group (represented by Thiorhodovibrio sp.) which contains a protein associated with a GTPase

(GTPase associated protein).

Keywords: Metagenome annotation, bioinformatics, BLAST, DNA analysis.

References:

[1] Hingamp, P.; Brochier, C.; Talla, E.; Gautheret, D.; Thieffry, D.; Herrmann, C. Metagenome Annotation Using a Distributed Grid of

Undergraduate Students. PLoS Biol 2008, 6(11), e296.

[2] http://www.bioinformatics.org/sms2/orf_find.html

[3] http://pfam.xfam.org/

[4] https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins

[5] http://www.ebi.ac.uk/Tools/msa/clustalw2/

[6] http://www.phylogeny.fr/

http://www.bioinformatics.org/sms2/orf_find.html

http://pfam.xfam.org/

https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins

http://www.ebi.ac.uk/Tools/msa/clustalw2/

http://www.phylogeny.fr/




222

IDDGC17-PP-206

GENE EXPRESSION PROFILE OF LNCRNA MEG3 IN VARIOUS CANCER AND NORMAL CELL

LINES

Yunus SAHIN1, Zekiye ALTAN

1, Kaifee ARMAN

1, Meltem K. OZER

1, Esra BOZGEYIK

1, Ayshan R. YASSIN

1,2, Ecir Ali

CAKMAK1

1Faculty of Medicine, Department of Medical Biology, University of Gaziantep, Gaziantep, Turkey

2Faculty of Medicine, Medical Department, Salahaddin University, Erbil, Iraq

Contact email: [email protected]

Aims and Scopes: A substantial fraction of cancer's genetic aetiology is exacted by noncoding regulatory sequences, particularly by

long noncoding RNAs (lncRNAs). Recent studies show that several cancer risk loci are transcribed into lncRNA which plays key

roles in tumorigenesis [1]. The dysregulation and alteration of several lncRNAs has been reported in various cancer types. Based on

the expression lncRNAs, expression profiling of human tumors as identified marks associated with diagnosis, staging, progression,

prognosis, and response to treatment [2]. Maternally expressed gene 3 (MEG3) is a lncRNA which is located at chromosome 14q32.3

in humans [3]. MEG3 is suggested to function as a tumor suppressor lncRNA [4]. In this study, determination of expression profile of

MEG3 gene in various cancer and normal cell lines was aimed in order to lead more information about its function in cancer.

Materials and Methods: For the expression analysis of MEG3 gene, 14 different cell lines purchased from the ATCC were used.

After RNA isolation from the obtained cells, these RNAs were converted to cDNA by RT-PCR. PCR was performed to determine the

expression level of the MEG3 gene. Expression profile analysis of MEG3 gene in various cancer and normal cell lines was done by

using ImageJ Program.

Results and Discussion: According to gene expression profile, while MEG3 gene expression was not observed in 12 cancer cell lines

(HGC-27, DU-145, A549, A-172, PC-3, HCT-116, U-2 OS, CAL-29, HeLa, MDA-MB-231, MCF7 and SKBR-3), its expression was

observed in normal breast cell line hTERT-HME1 and normal osteoblast cell line hFOB 1.19. This result showed that MEG3 gene

function as a tumor suppressor gene in cancer cells. In order to figure out exact role of lncRNA MEG3 in cancer cells, expression

profile of MEG3 gene has to be done in more cancer and normal cell lines and human normal and cancer tissues and further functional

analysis is needed.

Keywords: Cancer, lncRNA, MEG3, Non-coding-RNA.

References:

[1] Cheetham, S. W., et al. British journal of cancer, 2013, 108.12: 2419-2425..

[2] Calore, Lovat, et al. International journal of molecular sciences, 2013, 14.8: 17085-17110.

[3] Miyoshi, Naoki, et al. Genes to Cells, 2000, 5.3: 211-220.

[4] Zhou, Zhang, et al. Journal of molecular endocrinology, 2012, 48.3: R45-R53.




223

IDDGC17-PP-207

THE EFFECT OF NCOA5 GENE RS2903908 POLYMORPHISM ON THE MALE INFERTILITY

Aydın Rüstemoğlu1,*

, Nevin KarakuĢ

1, Hüsniye Rüstemoğlu

1,*, Fikret Erdemir

2

1- Gaziosmanpasa University Medical Faculty Department of Medical Biology, TOKAT,

2- Gaziosmanpasa University Medical Faculty Department of Urology, TOKAT

*- Gaziosmanpasa University Medical Faculty Department of Medical Biology, TOKAT, [email protected]

Abstract

Infertility is defined as the inability to achieve pregnancy in spite of unprotected sexual intercourse for 15-20%, clinically for at least

1 year. Among the causes of infertility are genetic, congenital, urogenital etc. problems. Approximately 50% of infertile cases are of

male origin, of which about 40% are idiopathic and their causes are unknown.

Nuclear receptor coactivator 5 (NCOA 5) is the coactivator of broad alpha and beta estrogen receptors and orphan nuclear receptor

NR1D2. NOCA5 has been shown to have a direct or indirect coactivator or corepresor effect for many genes. It has been reported that

haploinsufficiency in the NCOA5 gene leads to infertility in male mice. In this study, the effect of NCOA5 broad rs2903908

polymorphism on male infertile was assessed.

We were investigated 121 azoospermic infertile men and 99 healthy control samples which have at least two children. The NCOA5

broad rs2903908 polymorphism were investigated by Real_Time PCR method, The results were analyzed with SPPS 16.0 software.

The results obtained from our study shows that the TT genotype was high in patients (14.88% vs 6.06%). This difference was

statistically significant (p = 0.049), and the TT genotype could be a risk factor for male infertility (OR = 2.71, 95% CI = 1.04-7.08).

Our study is the first study in this context, and our results suggest that changes in the NCOA5 gene may be a risk factor for male

infertility. However, for the validity of these data, the results of studies using more examples are needed.

Keywords: Azoospermia, Infertility, NCOA5, rs2903908, polymorphism.





224

IDDGC17-PP-208

CHARACTERIZATION AND ISOLATION OF BACTERIA THAT BIODEGRADE

HYDROCARBONS DERIVED FROM PETROLEUM IN AREAS CONTAMINATED WITH

INDUSTRIAL WASTE

Hatıce OGUTCU 1, M. Yunus Emre KARAMAN

1, Hulya AVSAR

1, Ferhat KANTAR

1, Mehmet KARADAYI

2, Medine

GULLUCE2

1Department of Biology, Faculty of Arts and Science, Ahi Evran University, KırĢehir, TURKEY

2Department of Biology, Faculty of Science, Erzurum, Turkey

[email protected]

Aims and Scopes: The contamination of soils and groundwater with petroleum compounds is among the most prevalent problems in

environments worldwide [1]. The reason for petroleum biodegradation is the ability of microorganisms to utilize hydrocarbons to

satisfy their cell growth and energy needs [2]. Microorganisms that biodegrade the components of petroleum hydrocarbons are

isolated from varius enviroments, particularly from petroleum-contaminated sites. Hydrocarbon-degrading bacteria are widely

distributed in marine, freshwater, soil habitats and their use in bioremediation of hydrocarbon-contaminated soils, which exploits their

ability to degrade and/or detoxify organic contaminants, has been established as an efficient, economical, versatile and

environmentally sound treatment [1].

Materials and Methods: About 10 g soil samples were aseptically collected from different areas contaminated with industrial waste

containing petroleum derivative hydrocarbons from around tire factory in Kırşehir. Bacteria were isolated from soil samples using an

enrichment medium containing petrol and were isolated 2 bacteria. Morphological, physiological, biochemical and kemotaxonomical

characterisation of bacterial strains were carried out.

Results and Discussion: As a result, in this study, Achromobacter xylosoxidans (GenBank Number: KY010276) and Massilia

alkalitolerans (GenBank Number: KY010277) strains were identified by 16S rRNA sequence analysis. Achromobacter xylosoxidans

is a Gram-negative rod, oxidase and catalase-positive and motile bacterium. Massilia alkalitolerans is a Gram-negative rod, oxidase

and catalase-positive and motile bacterium.

Keywords:Bioremediation, Industrial Waste, Achromobacter xylosoxidans, Massilia alkalitolerans, Biodegradation

Acknowledgment: This work was supported in part by a grant from Ahi Evran Univ. Scientific Research Projects Commission for

Scientific Research No: PYO- Fen.4003/2.14.009.

References:

[1] Mirdamadian, S, H.; Emtiazi, G.; Golabi, M.H.; Ghanavati, H. Journal of Petroleum & Environmental Biotechnology, 2010, 1:102, 7458-7463.

[2] Hemalatha, S.; Veeramanikandan, P. Journal of Environmental Protection, 2011, 2, 243-254.





225

IDDGC17-PP-210

FORENSIC DNA TYPING

Büşra CUMHUR

Ankara University, Institute of Forensic Sciences, Forensic Biology 06590 Dikimevi, Ankara, Turkey

[email protected]

Aims and Scopes: Biological materials encountered in crime scene investigations have become important evidence for the presence

of perpetrators and criminals. The use of biological material in identification has gained different forms with the development of

genetic analysis techniques and has solved judicial cases such as sexual abuse and paternity detection. Biological material such as

bone, tooth, hair, blood, gaita etc. can be used in the isolation of DNA and even ancient DNA studies can be done. This presentation

will cover the identification of crime or criminal activity in judicial cases.

Materials and Methods: The use of biologic material in identification is done with STR (short tendam repeat) loci, that matches the

Mendelian pattern and polymorphic because of the variation in repeat number. STRs are located in the non-coding regions (introns) of

DNA in consecutive repeating sequences. Each polymorphism seen in each STR region is highly common, typically shared by 5-20%

of the population each. Given that the combination of these polymorphism when looked at multiple loci is unique to a single person,

and this makes it a distinctive tool for identification. Forensic studies use different STR-based DNA profiling systems for people in

different countries. In animals there are two types of identification which are individual and species identity. The latter is DNA

barcode technology. DNA barcode technology is a method used to identify species by using species-specific differences in the DNA

region at a length of 400-800 base pairs. The cytochrome C oxidase 1 (CO1) region located at the 5 'end of the mitochondrial genome

is used to generate barcodes in the identification of animal species.

Results and Discussion: The most common 13 STR loci used for identification of human beings are acceptable and sufficient by

CODIS (Combined DNA Index System). CODIS is a data bank established by the FBI in 1990. While in the UK, the SGM+ system is

used which is compatible with the National DNA Database of that country. In animals, for example; cat (Felis catus), mitochondrial

DNA sequence was introduced in 1996 by Lopez et al. and is used as a reference sequence. Generally speaking, animal studies use the

STR markers recommended by ISAG and FAO. As the number of populations and racial diversity are increasing in the construction

of STRs, the number of new alleles reported are increased as well and the sufficiency of commercial kits used today is decreasing.

Acknowledgements: I would like to thank Assoc. Dr. Bengi Çınar KUL, Dr. Asem HILWAH for their help.

Keywords: Forensic Idenifiction, STR Marker, DNA

References:

[1] Usefullness Of Microsatellite DNA Markers For Parentage Testing For Some Goat Populations İn Turkey, Zafer BULUT et al., Journal of Cell

and Molecular Biology, 2014,12(1&2): 39-45.

[2] The Short Tandem Repeat Loci In Forensic Dna Analysis, Lale DÖNBAK, T Klin J Med Sci, 2002, 22:233-238.

[3] Identification of Animal and Plant-Based Products: DNA BARCODES, Dilek KAYA AKYÜZLÜ et. al.,forensic biplogy congress proceedigs

book 2014,30

[4] Mtdna And Str Analyses Of Domestıc Cats In Forensıc Cases, Itır Erkan et al., forensic biplogy congress proceedigs book 2014, 54.

[5] Ancient DNA Studies and Turkey, Iraz AKIŞ, Journal of Cell and Molecular Biology, 2014,12(1&2):1-9,





226

IDDGC17-PP-211

ISOLATION AND MOLECULAR CHARACTERISATION OF AROMATĠC HYDROCARBON

DEGRADING BACTERIA FROM PETROLEUM-CONTAMINATED SOILS LOCATED IN

MERSĠN, TURKEY

Hatıce OGUTCU

1, Ferhat KANTAR

1,2, M. Yunus Emre KARAMAN

1, Ömer F. ALGUR

3

1Department of Biology, Faculty of Arts and Science, Ahi Evran University, KırĢehir, TURKEY

2 Suphı Oner Ogretmenevı ve ASO, Yenısehır, Mersın, TURKEY

3Department of Biology, Faculty of Science, Ataturk University, Erzurum, TURKEY

[email protected]

Aims and Scopes: Transportation, production, refinery, storage of crude petroleum may caused to contamination of soils with

polycyclic aromatic hydrocarbons (PAHs). Aromatic hydrocarbons are the major enviromental issue that has been increased through

industrial development. Aromatic hydrocarbons are common enviromental pollutants with toxic, genotoxic, mutagenic and

carcinogenic properties. Bacteria play a major role in cleaning of this pollution. Therefore, biodegradation using bacteria is usually

preferred.

Materials and Methods: In this study, about 10g of soil samples were aseptically collected from different petroleum- contaminated

areas near petroleum distribution area in Mersin (Kazanlı-Karaduvar) ,Turkey. Bacteria were isolated from soil samples using an

enrichment medium containing petrol and were isolated one bacteria. The isolate was described by morphological , physiological,

biochemical tests and molecular methods (16S rRNA gene sequence analysis).

Results and Discussion: As a result of assesment which datums of phenotypic, genotypic characterization and according to 16S

rRNA gene sequencing analysis, the strain designated as FH6-1 was found to be closely related to Stenotrophomonas maltophilia

species by phylogeny.

Finally, in this work, different bacterial species degrading polyaromatic hydrocarbon from the contaminated areas with petroleum and

petroleum derivatives were acquired. Bacterial strain were found to use crude petroleum as carbon sources in order to grow. It is

thought that usage of species with a fore mentioned features in bioremediation studies will contribute to the improvement of the

balance of ecosystem.

Keywords:Polycyclic Aromatic Hydrocarbons (PAHs), Petroleum-Degrading Bacteria, Bioremediation, Biodegradation,

Stenotrophomonas maltophilia

Acknowledgment: This work was supported in part by a grant from Ahi Evran Univ. Scientific Research Projects Commission for

Scientific Research No: PYO- Fen.4003/2.14.009.





227

IDDGC17-PP-212

ISOLATION AND MOLECULAR CHARACTERISATION OF THE BACTERIAL FLORA IN THE

DIGESTIVE TRACT OF EUSOMUS OVULUM GERMAR, 1824 (COLEOPTERA:

CURCULIONIDAE)

Yasemin ERBEY1, Hatice OGUTCU

1, Mahmut ERBEY

1, Mehmet KARADAYI

2, Medine GULLUCE

2

1Department of Biology, Faculty of Arts and Science, KırĢehir, Turkey

2Department of Biology, Faculty of Science, Erzurum, Turkey

Correspondence: [email protected]

Aims and Scopes:

Curculionidae is considered to be one of the most richest families in Coleoptera. The most of species in the family that except some

species are phytophagous. Larva and adults feed on plant organs such as: roots, stems, leaves and fruits. This group has a detrimental

effect on crops and forest trees and can cause huge economic losses (Ross, 1953; Mihajlova, 1978). Thus, this family has an economic

importance.

In this study, the bacteria flora in digestive system of 1 species Eusomus ovulum Germar, 1824 of Curculionidae (Coleoptera) were

investigated.


Our study the bacteria flora in digestive system of Eusomus ovulum (Curculionidae) were investigated. The samples were collected

from different localities in Kırşehir between May and August in 2014. The catch samples put in sterile tube and lively bring to

laboratuary. Samples dissected and removed to digestive system and spreaded to petri dishes of nutrient agar at the steril conditions.

Developed single colonies selected and purified and achieved 1 isolate. The isolate was described by morphological (coccus and

bacil), physiological, biochemical tests and molecular methods (16S rRNA PCR and 16S rRNA sequence analysis). Pure cultures

were stocked in sterile glycerol solution (20%) at–20◦C for further characterization.


Firstly, bacterial isolates were characterized based on their morphological properties. Colony morphology of the isolates was

evaluated on nutrient agar by direct observations or using a stereomicroscope. Gram staining of the isolates was performed according

to the method of Claus (1992).

Physiological properties of the bacterial isolates were also determined temperature and NaCl tolerance tests were performed (Bertani,

1951). Finally, the bacterial isolates were characterized based on 16S rRNA gene sequencing to confirm conventional identification

methods. The obtained sequences were used to perform Blast searches in NCBI GenBank database.

As a result of assessment which datums of phenotypic, genotypic characterization and diagnosis of Klebsiella sp. (GenBank Number:

KR010976) isolate was made. As a results, the bacterial species that achieved from the species of Curculionidae family (Coleoptera).

Keywords: Coleoptera, Curculionidae, Eusomus ovulum , Flora, Gut bacteria, Klebsiella sp.

References:

Bertani, G. J. Bacteriol, 1951, 62, 293-300.

Claus, D. World J Microbiol Biotechnol. 1992, 8(4): 451-462.

Mihajlova, B., Fragmen. Balk., 1978, 10 (14): 1-234.

Ross, A. H. The Catholic University of America Washington, 1963, 123-141.




228

IDDGC17-PP-213

CHIMERISM ANALYSIS FOLLOWING HEMATOPOETIC STEM CELL

TRANSPLANTATION USING STR-PCR IN LEUKEMIA PATIENTS

Ebru Dündar Yenilmez

1, BaĢak GünaĢtı

1, Mustafa M. Alparslan

1, Abdullah Tuli

1

1Çukurova University, Faculty of Medicine, Department of Medical Biochemistry, Adana, Turkey

[email protected]

Objectives: Hematopoietic stem cell transplantation is becoming an increasingly important

approach to treatment of different malignant and non-malignant disorders [1]. Donor chimerism

analysis has become a routine method for the following of engraftment after allogeneic

hematopoietic stem cell transplantation (HSCT) [2]. In recent years many studies focused on the

application of this analysis method for the detection of relapsing disease after allogeneic HSCT

[1]. This study aimed to assess the chimerism status using polymerase chain reaction of short

tandem repeat (STR) in leukemia patients.

Materials and Methods: Our study includes 26 patients with acute leukemias (11 ALL, 15 AML).

The 16 STR alleles of donor and recipients analyzed before HSCT to determine the informative

alelles. Chimeric status was determined by Polymerase Chain Reaction (PCR) of Simple Tandem

Repeat (STR) sequences after HSCT (30th

day and 60th

day period).

Results and Conclusion: Twenty-six patients who underwent HSCT included in this study. The

chimeric status performed using STR-PCR of 26 patients after 30 and 60th

day after HSCT.

Twenty-four of the 26 patients chimeric allele status were 100%, 2 of 26 were 75%. Quantitative

monitoring of recipient- and donor-derived cells by molecular methods has become an

indispensable diagnostic tool in the surveillance of patients undergoing allogeneic HSCT [3]. Our

analysis of patient/donor cell chimerism during the posttransplant period reveals donor and

recipient information for preemptive therapeutic interventions for clinicans.

Keywords: Chimerism, donor-recipient, STR-PCR, leukemia.

References:

[1] Lion T, Watzinger F, Preuner S Leukemia 2012; 26: 1821-1828.

[2] Waterhouse M, Bertz H, Finke J Ann Hematol 2014; 93: 293–298.

[3] Thiede C, Bornhäuser M, Ehninger G Acta Haematol 2004; 112: 16-23.




229

IDDGC17-PP-214

DETERMINATION OF ENDOSIMBIONT BACTERIA WOLBACHIA INFECTION IN THE SUNN

PEST (Eurygaster integriceps, Hemiptera: Scutelleridae) POPULATIONS ACROSS TURKEY

İlyas KARAMAN

1, Erhan KOÇAK

1

1Süleyman Demirel University, Agriculture Faculty,

Agricultural Biotechnology Department, Isparta, TURKIYE


Eurygaster integriceps (Hemiptera: Scutelleridae) is the most important pest of wheat in Turkey. Wolbachia, an endosymbiont

bacterium, is identified in 66% of terrestrial arthropods and causes reproductive changes as partenogenesis, male lethality, feminism

and cytoplasmic incompatibility on the hosts. In the study, males of E. integriceps distributed in the country in South Eastern

Anatolia (Diyarbakır, Siirt, Şırnak) Eastern Anatolia (Ağrı, Tunceli, Bingöl, Elazığ), Mediterranean Sea (Mersin, Kahramanmaraş),

Marmara (Bursa, Edirne, Kırklareli, Sakarya) and Aegean (Çanakkale) Regions, were collected to determine endosymbiont bacteria

Wolbachia by molecular methods and the prevalence rate in populations was determined. A total of 150 specimens collected from 15

provinces enrolled in the study. The PCR reactions following DNA extraction in the study were screened with newly designed wsp

primers and screened on an agarose gel to determine the presence of Wolbachia and sequencing performed from the resulting PCR

reactions to confirm the presence of Wolbachia. According to the gel images, Wolbachia was detected in 142 (94.66%) of 150

scanned samples. The detection rate was 98% in the five provinces of the Marmara Region, 85% in the two provinces of

Mediterranean Region, 85% in the four provinces of South Eastern Anatolia Region and 95% in the four provinces of Eastern

Anatolia Region. The provinces where 100% Wolbachia presence was detected were as Ağrı, Bursa, Çanakkale, Edirne, Elazığ,

Kırklareli, Siirt, Şırnak and Tunceli. This is the first study to determine the presence and the spread rate of Wolbachia on E.

integriceps species.

Keywords: Wolbachia, Endosymbiotic Bacteria, Molecular description, Eurygaster integriceps, Türkiye





230

IDDGC17-PP-215

MOLECULAR ANALYSES OF TWO ENDEMIC LIMNEBIUS (COLEOPTERA) SPECIES FOR THE

TURKISH FAUNA BY CYTOCHROM OXIDASE I DNA SEQUENCE

Ahmet Kasapoğlu1, Erol Atay

2

1Mustafa Kemal University Science Faculty Biology Department akasapogluku.edu.tr HATAY/ TURKEY

2 Mustafa Kemal University Science Faculty Biology Department HATAY/ TURKEY

The genus Limnebius (Coleoptera; Hydraenidae) forms a well defined, distinctive group of small water beetles with a rather similar

external morphology, Most of the Limnebius species can only be reliably distiguished on the basis of aedeagi (Hernando et. al. 2008).

The genus has a world wide distribution exept Antarctica and South America and with more than 150 described species (Rudoy et. Al.

2016).

Limnebius adults have uniform morphology with oval and drop-like body shape (Jaech, 1993). Turkish Limnebius fauna has 21

species and 4 of them (L. attalensis, L. claviger, L. ferroi ve L. spinosus) are endemic. (Ertorun et. al. 2011).

Aims and Scopes: We determined Cytochrome c oxidase subunit I (CO1) of Limnebius ferroi Jach, 1993 and Limnebius claviger

Jach, 1993 species which are endemic for the Turkish fauna, by using real time PCR. Besides compared and discussed with related

species morphologically.

Materials and Methods: We used Real time PCR (Q-PCR) for determination of sequence Cytochrome c oxidase subunit I (CO1).

Results and Discussion: We observed that Limnebius claviger very similar to Limnebius montanus by molecular analyses. Although

both species similar, Limnebius claviger bigger (2.7 mm) than Limnebius montanus (1.7 mm). On the other hand Limnebius ferroi

and L. irmelae, in nitidus species group, are similar both molecular and morphological features.

Keywords: DNA sequence, Limnebius, Hydraenidae, Turkey.

References:

1.Hernando, C, at al. 2008. Limnebius zaerensis, a new species from the Pays Zaër-Zaïane, central Morocco, Koleopterologische

Rundschau, 78, 195-198.

2. Jach, M. A. 1993, Taxonomic revision of the Palearctic species of the genus Limnebius LEACH, 1815 (Coleoptera: Hydraenidae).

Koleopterologische Rundschau, 63; 99-187.

3. Rudoy, A. at al. 2016. Evolution of the male genitalia in the genus LimnebiusLeach, 1815 (Coleoptera, Hydraenidae) Zoological

Journal of Linnean Society. DOI: 10.1111/zoj.12402

4.Ertorun N. at.al. 2011. Checklist of the Hydraenidae (Coleoptera) of Turkey, with notes on distribution. Zootaxa 3055: 22–42




231

IDDGC17-PP-216

In silico BINDING MODEL OF TEC1 TRANSCRIPTION FACTOR ON NTH1 PROMOTOR IN

Saccharomyces cerevisiae

Selen ÇAKAS1, Tülay TURGUT GENÇ

2

1 Çanakkale Onsekiz Mart University, Graduate School of Natural andApplied Sciences, Departmant of Biology

2 Çanakkale Onsekiz Mart University, Faculty of Science and Literature, Departmant of Biology

[email protected]

Abstract

Aims and Scopes: Trehalose, acummulated under stress conditions in Saccharomyces cerevisiae yeast strains, is hydrolised by

neutral trehalase (Nth 1p), when enviromental conditions return to normal circumstances [1]. Nth1p is encoded by NTH1 gene which

is 2256bp in length and is not include intron [1,2]. Tec1p, which is a transcription factor, is encoded by TEC1 gene (Transcription

Enhancement Control 1) and it has increased chronological lifespan owing to the MAPK (Mitogen-Activated Protein Kinase) and

TORC1 (Target of Rapamycin) pathways [3,4]. Tec1p has controlled transcripts by binding to genes, contained TAE/ATTS elements

((A(G/C/T)C(G)AT(A)TC(G)C(G)C(T)C(T/A/G)) in promotor region. Transcriptional regulation of NTH1 gene is carried out by

TOR signal system and NTH1 gene include TEA/ATTS elements, in order to bind Tec1p on NTH1 promotor region. In our study,

therefore, in silico binding model of TEC1 Transcription Factor on NTH1 Promotor was done.

Materials and Methods: In this research, NTH1 promotor region (1000 bp in lenght) downloaded from SGD ( Saccharomyces

cerevisiae Genome Database) was used. Tec1p TAE/ATTS DNA binding site was detected on the NTH1 promotor by using JASPAR

CORE database. Predicted-3D modelling of whole aminoacid sequences (486 aminoacids) of Tec1 protein and aminoacid sequences

which include TEA/ATTS DNA binding site (75 aminoacids) was carried out using I-TASSER software. Tec 1p binding elements in

NTH1 promotor were turned into pdb format sending to 3D-DART webserver tool. Pdb files, obtained from I-TASSER software and

3D-DART webserver, were sent to NPDock-Genesilico.pl websites and predicted binding model results were attained. The obtained

models were visualized by using VMD (Visual Moleculaer Dynamics) program.

Results and Discussion: It was determined that there is high possibility of binding of Tec1 transcription factor to NTH1 promotor,

owing to in silico DNA-TF binding modelling which is carried out by using databases and computer tools. In vivo studies which

supported 3D model related to NTH1 transcriptional regulation on the Δtec1 mutants have been proceeding.

Keywords: Saccharomyces cerevisiae, NTH1, TEC1, 3D-modelling

References:

[1] Nwaka S., Kopp M., Holzer H.,. Journal of Biological Chemistry, 1995, 270: 10193-10198.

[2] Kopp M., Müler H., Holzer H., Journal of Biological Chemistry, 1993, 268: 4766-4776.

[3] Madhani H. D., Fink G. R., Science, 1997, 275 (5304), 1314-1317.

[4] Brückner S., Kern S., Birke R., Saugar I., Ulrich H. D., Mösch H. U., Genetics, 2011, 189(2), 479-494.




232

IDDGC17-PP-217

DNA BIOSENSORS: GENOSENSORS

Yeliz GENÇ BEKĠROĞLU

Ondokuz Mayıs University, Bafra Vocational School, Department of Plant and Animal Production, Samsun

[email protected]

Biosensors are defined as ―devices that transform biological response to a chemical compound into optic, thermal or

electrical signals‖ by International Union of Pure and Applied Chemistry (IUPAC). Recent developments in biosensor technologies

have revived the applicability of biosensors in many areas such as medicine, pharmacy, food safety, environmental pollution and

defense industry. In addition, the emergence of DNA structure and the development of hybridization, amplification and recombinant

DNA technologies have also pioneered the development of DNA sensors. Basically, DNA sensors are based on the principle of

hybridization of a chain of DNA piece that represents a specific disease, a genetic character or the pathogenesis of a bacterium or a

virus with one chain DNA oligomer (DNA probe) fixed on transducer surface. In this study, genosensor studies which have been

conducted to shed light on the effects of DNA targeted drugs or substances on DNA, to find out the interaction mechanisms of these

substances or to specify point mutations and also for many other purposes have been examined and compared.

Keywords: DNA biosensors, genosensors,

References: (1) A. Rasooly, Biosensor technologies. Methods 2005; 37(1):1-3.

(2) 9. Campàs M, Katakis I. DNA biochip arraying, detection and amplification strategies. Trend Anal Chem. 2004; 23:49-62.

(3) Palecek, E., "Past, present and future of nucleic acids electrochemistry.", Talanta, (2002), 56, (5), 809

(4) Wang, J., Kawde, A.N., Erdem, A., Salazar, M.(2001). Magnetic beadbased label-free electrochemical detection of DNA

hybridization,Analyst,126: 2020-2024.




233

IDDGC17-PP-218

ANTIMICROBIAL RESISTANCE PATTERNS OF VANCOMYCIN RESISTANT ENTEROCOCCI

AND MOLECULAR EPIDEMIOLOGICAL ANALYSIS BY PFGE AS A GOLD STANDART

Nergis AĢgın1, Elçin Kal Çakmaklıoğulları

1, BarıĢ Otlu

2, Nafia Canan Gürsoy

2

1 Karabuk University, Medical Faculty, Microbiology Department, Karabuk, Turkey, [email protected]

2 Inonu University, Medical Faculty, Microbiology Department, Malatya, Turkey

Aim and Scopes:

Enterococci are facultative gram-positive cocci that live as commensal of the gastrointestinal tract of humans. Vancomycin-resistant

enterococcus(VRE) has increasingly become a major nosocomial pathogen worldwide after 1980‘s.[1] In this study, it was aimed to

determine the antibiotic resistance profile of 47 VRE strains isolated from inpatients at our hospital and to investigate clonal

relationship between strains by pulsed-field gel electrophoresis (PFGE) as a gold standard


Forty-seven VRE strains that are isolated from inpatients at our hospital between May 2013 and January 2015 were included in this

study. Identification and antibiotic susceptibility of strains were determined by BD-Phoenix PMIC Combo panels. Vancomycin

resistance was confirmed by E-test. (Biomeriux). Vancomycin resistance genes were detected polymerase chain reaction (PCR) [2].

The presence of clonal relationship between the strains was investigated by PFGE. This method that optimized by Durmaz et al[3]

was modified according to CDC (Centers for Disease Control) recommendation [4] . Pearson correlation coefficient and Unweighted

Pairwise Grouping Mathematical Averaging (UPGMA) method were used for similarity calculations for band analysis and clustering

analysis. Strains with more than 95% similarity to each other were accepted in the same clone.


VRE strains were isolated from rectal swab (n=35), blood (n=7) and urine (n=5). All strains were identified as E. faecium. All of

them were highly resistant to ampicillin, high-level gentamicin, vancomycin and teicoplanin. An E. faecium strain was detected

moderately sensitive to linezolid. Daptomycin and quinupristine resistance were not detected. All the strains had VanA-type

resistance gene. Forty-seven VRE strains were divided into 23 genotypes by PFGE. Thirty-one of the strains are located in any

cluster. Clonally related strains were consisted in seven clusters (tolerance 1.5, cut off 95%). The clustering rate is 66%. The largest

cluster is Genotype I and contains eight strains. The smallest cluster is Genotype IV and contains two strains. There is no single clone

outbreak in our hospital. However, the clustering rate is high. It is indicated cross contamination. Because of this, infection control

measures should be applied effectively.

Keywords: Enterococci, PFGE, Vancomycine resistance.

References:

[1] Tristan O’Driscoll, Christopher Crank,Vancomycin-resistant enterococcal infections: epidemiology, clinical manifestations, and

optimal managementInfection and Drug Resistance 2015:8 217–230

[2] Yean CY, Yin LS, Lalitha P, Ravichandran M. A nanoplex PCR assay for the rapid detection of vancomycin and bifunctional

aminoglycoside resistance genes in Enterococcus species. BMC Microbiol 2007; 7: 112.

[3] Durmaz R, Otlu B, Koksal F, Hosoglu S, Ozturk R, Ersoy Y, Aktas E, Gursoy NC, Caliskan; The optimization of a rapid pulsed-field gel

electrophoresis protocol for the typing of Acinetobacter baumannii, Escherichia coli and Klebsiella spp. A. Jpn J Infect Dis. .2009.

62(5):372-7

[4], Unified Pulsed-Field Gel Electrophoresis (PFGE) Protocol for Gram Positive Bacteria (Revised: 08/2012)

http://www.cdc.gov/HAI/settings/lab/lab_settings.html (10.06.2016)

http://www.cdc.gov/HAI/settings/lab/lab_settings.html




234

IDDGC17-PP-219

Distribution of VDR gene variants in head and neck cancer

Özlem Küçükhüseyin1, M.Tolgahan Hakan

1,2, Roya Mesediyeva

1 , Ayşegül Verim

3, İlhan Yaylım

1

1 Department of Molecular Medicine, The Institute of Experimental Medicine, Istanbul University, Istanbul, Turkey

2 Department of Biology, Hitit University, Art and Science Faculty Çorum, Turkey.

3

Department of Otorhinolaryngology/Head and Neck Surgery, Haydarpaşa Numune Education and Research Hospital, Istanbul,

Turkey.

Abstract.

Background. Cancers of the upper aerodigestive tract, head and neck cancers (HNC), classified according to their

localization as lip and oral cavity, pharynx, larynx, and salivary gland, nasal cavity and sinuses. HNC is the sixth most

common type of cancer, making up 5.3% of all cases and account for an estimated 348,300 new cancer cases and 179,600

cancer deaths worldwide per year. In recent studies, it was shown that vitamin D treatment mediates anti-proliferative and

pro-differentiation effects in various tissues, including most of cancer cell lines. Vitamin D shows its effects by binding

its spesific receptor VDR, and the polymorphisms on VDR gene could contribute to the pathogenesis of various diseases

including cancer. In the present preliminary study, the determination of the effects of vitamin D serum levels, and the

VDR TaqI, VDR FokI and cyclin D1 G870A polymorphisms on the development of head and neck cancer was aimed.

Material and Method. 50 HNC patients and 50 healthy volunteers as controls were included in the present study. The

VDR TaqI, VDR FokI and cyclin D1 G870A genotypes were determined by using polymerase chain reaction- restriction

fragment length polymorphism (PCR-RFLP) method, and vitamin D serum levels were determined by using

commercially available enzyme linked immunosorbent assay (ELISA) kits according to manufacturer‘s instructions.

Results. The serum level of vitamin D in HNC patients was lower than healty controls but difference was not statistically

significant (p>0.05). The genotype distributions in patients were 46.4% TT, 48.2% Tt, 5.4% tt for VDR TaqI; 25.6% FF,

43.9% Ff, 30.5% ff for VDR FokI; and 23.1% GG, 25.6% GA, 51.3% AA for cyclin D1 G870A, and in control subjects

those were 66.7% TT, 33.3% Tt, 0% tt; 46.2% FF, 38.5% Ff, 15.4% ff; 32.0% GG, 40.0% GA, 28.0% AA, respectively.

Conclusion. The present study was a preliminary study to establish the link between VDR TaqI, VDR FokI and cyclin

D1 G870A polymorphisms or vitamin D serum levels and pathogenesis of HNC among Turkish population.

The present prelimineary study was supported by a grant from the Scientific Research Projects Coordination Unit of

Istanbul University (Project No: 50701).




235

IDDGC17-PP-220

DETERMINATION OF THE GENOTOXIC ACTIVITY OF Sideritis libanotica Labill. subsp. linearis

EXTRACT

Ahmet Kayraldız

1, Esra Köker

1, Lale Dönbak

1, Hüsniye Sevtap Kutlu

1

1.KahramanmaraĢ¸ Sütçü Ġmam University, Science and Letters Faculty, Department of Biology KahramanmaraĢ/Turkey,

[email protected]

Aims and Scopes: Sideritis, also known as mountain tea, is a genus of flowering plants. Species and subspecies of the Sideritis are

widespread in Mediterranean regions, Balkans, Iberian Peninsula and Macaronesia and have an important place in the medical and

aromatic plants, commonly as an herbal tea. Mountain tea is known to have antioxidant, antimicrobial, anti-inflammatory,

antispasmodic, sedative, carminative and analgesic effects. Due to lack of knowledge about its genotoxicity, in this study, genotoxic

effects of Sideritis libanotica Labill. subsp. linearis (Bentham) Borm. were investigated by in vitro chromosomal aberrations (CA),

sister chromatid exchange (SCE) and micronucleus (MN) tests using human peripheral lymphocytes. Proliferation index (PI), mitotic

index (MI) and nuclear division index (NDI) values were also assessed to determine the cytotoxic effect of the plant extract.

Materials and Methods: Leaves and branches of S. libanotica linearis subsp. collected from the around of Ilıca-Kahramanmaraş

(Turkey) were separated and left to air dry. By taking 20 g from dried branches and leaves, ethanol extract was prepared and used in

the experiments. For cell cultures, 5 ml of intravenous blood sample was taken from healthy and non-smoking two women and two

men between 22-25 ages and cells treated with 0,16, 0,32, 0,65, and 1,30 µg/ml of plant extract for 24 and 48 h. In microscobic

examinations, frequencies of SCE/Cell, CA/Cell, cells containing abnormality (AC), MN and binucleated cell containing

micronucleus (BNMN) and also PI, MI, and NBI values were determined for each sample. The data obtained from microscobic

examinations were compared with control groups by using t-test in SPSS (17.0) packet programme.

Results and Discussion: When the obtained data compared to the control group, SCE level was found to be significantly increased in

the 48 h treated cells with the extract and decrease in MI value was also significant in the treated cells except for the lowest dose (0,16

µg/ml). CA and MN values with the percentage of abnormal cells and the frequency of micronucleated binucleated cells did not show

significant differences in comparison to control group. Beside, treatment with the plant extract did not affect the PI and NBI values. In

conclusion, genotoxicity and cytotoxicity analyzis demonstrated that S. libanotica Labill. subsp. linearis has slightly genotoxic and

cytotoxic effect in human peripheral lymphocytes.

Keywords: Sideritis libanotica Labill. subsp. linearis, Plant extract, Genotoxic effect, Cytotoxicity

https://en.wikipedia.org/wiki/Flowering_plant

https://en.wikipedia.org/wiki/Balkans

https://en.wikipedia.org/wiki/Iberian_Peninsula

https://en.wikipedia.org/wiki/Macaronesia




236

IDDGC17-PP-221

INVESTIGATION OF ANTIMICROBIAL, ANTIOXIDANT AND GENOTOXIC

ACTIVITY OF Elymus repens ROOT EXTRACT

Lale Dönbak1, Tuğba Purkaya

1, Ergül Belge KurutaĢ

2, Ahmet Kayraldız

1, Ekrem Kireçci

3, ġakire KaradaĢ

1

1.KahramanmaraĢ Sütçü Ġmam University, Faculty of Science and Letters, Department of Biology KahramanmaraĢ/Turkey,

[email protected]

2.KahramanmaraĢ Sütçü Ġmam University, Faculty of Medicine, Department of Medical Biochemistry KahramanmaraĢ/Turkey

3.KahramanmaraĢ Sütçü Ġmam University, Faculty of Medicine, Department of Medical Microbiology KahramanmaraĢ/Turkey

Aims and Scopes: Elymus repens is a very common perennial species of grass native to most of Europe, Asia, and northwest Africa,

that belongs to Liliopsida class of Poaceae family. It grows in almost every region in our country. It is one of the most valuable grass

used for feeding of cattle because of its high protein and starch content. The plant is also has a considerable value as a herbal

medicine. The roots of E. repens is used in the treatment of a wide range of urinary track, bladder, kidney, liver, and stomach

disorders, cold, jaundice and skin diseases such as acne and eczema because of anti-inflammatory, aperient, demulcent, diuretic,

emollient, lithontripic and tonic properties. In this study, antimicrobial, antioxidant and genotoxic activity of Elymus repens roots

were investigated due to lack of knowledge about this properties of the plant roots.

Materials and Methods: Elymus repens were collected from the around of Narlı- Kahramanmaraş (Turkey). Roots were separated

from the leaves and then left to air dry. Ethanol extract of roots were prepared by using 20 g of air dried root pieces and used in the

experiments. Antimicrobial (Antibacterial; Staphylococcus aureus, Staphylococcus epidermidis, Escherichia coli, Pseudomonas

aeruginosa bacterias/Antifungal; Candida albicans) activity of the extract was analyzed by using Disk diffusion method. Folin-

Ciocalteu, DPHH (1,1-diphenyl-2-picrylhydrazyl radical), and Oyaizu methods used for the measurements of antioxidant activity.

Genotoxic effects of root extract were analyzed by in vitro chromosomal abnormality (CA), sister chromatid exchanges (SCE) and

micronucleus (MN) tests using human peripheral lymphocytes. To determine the cytotoxic effect, Proliferation index (PI), mitotic

index (MI) and Nuclear division index (NDI) values of treated cells were also assessed.

Results and Discussion: According to antimicrobial (antibacterial/antifungal) activity tests, root extract was found to have

antibacterial effect only on the Staphylococcus epidermidis among other bacterias and have not antifungal effect on Candida albicans.

The highest of the antioxidant activity was determined as butylated hydroxyanisole (BHA)>Elymus repens>butylated hydroxytoluene

(BHT). Also, extract have scavenging properties against to DPHH, ABTS+ (2,2'-azinobis-(3-ethylbenzthiazoline-6-sulfonate) and OH.

radicals. Treatment with root extract did not affect SCE, CA, MN frequencies and also PI and NBI values in human lymphocytes.

Whereas, there was a significant decrease in MI value of the cells treated with highest dose (1,30 µg/ml). Root extract of E. repens did

not show genotoxic and cytotoxic effects in human lymphocytes. As a result, roots of E. repens can be used as a natural antioxidant

source.

Keywords: Elymus repens, Antimicrobial activity, Antioxidant effect, Genotoxicity


https://en.wikipedia.org/wiki/Perennial

https://en.wikipedia.org/wiki/Poaceae

https://en.wikipedia.org/wiki/Europe

https://en.wikipedia.org/wiki/Asia

https://en.wikipedia.org/wiki/Africa




237

IDDGC17-PP-222

Analysis of 16S rRNA sequences of different bacterial species by different statistical methods

ġerife Eylül DUMAN1

1Necmettin Erbakan Üniversity, Seydisehir vocational college, Dental services department, Konya

Aims and Scopes: Over the last 20 years, developments in molecular phylogenetics have greatly contributed to our understanding of

genetic relationships among species. Sequences from the nuclear and organelles genomes of thousands of species are readily available

in public databases, enabling researchers without access to molecular biology tools to investigate genetic relationships by sequence

comparisons using the appropriate nucleotide substitution models and tree building algorithms. Genomes are composed of different

types of nucleotide sequences, such as coding regions, non-coding regions, exons, introns and repetitive elements. Mutations of these

distinct sequence types follows different patterns, thus their analysis requires different statistical models [1,2]. İn this study bacterial

16s rRNA sequences were analyzed with different distance methods and different tree reconstruction algoritms to clarify the best

genetic relationship estimation strategy.

Materials and Methods: 16s rRNA sequences of 17 bacterial species downloaded from NCBI database in order to their sequence

quality scores. MEGA 7.0 and Geneious programs were used to analyze nucleotide sequence divergence among the sample set by

taking account different calculation algorithms. The results were interpreted with the consideration of the existing scientific literature.

Nucleotide sequences were aligned using Muscle and ClustalW alignment methods. Overall mean distance and pairwise distances are

calculated for the aligned data set. The distances obtained from the analyze lead to find best model for constructing phylogenetic r

trees by using different statistical methods (UPGMA, Minimum Evolution / Neighbor-Joining / Maximum Likelihood / Bayesian).

Results and Discussion: The total number of 615 nucleotides aligned in the data set, gaps were completely deleted, and only this

aligned sequences used for downstream analyses. The Jukes-Cantor model was selected for substitution model as overall mean

distance was calculated 0.311 in the data set. Branch lengths and topology problems were observed in the genetic relationship

dendrogram while UPGMA method used for reconstruction and in the Minimum Evolution method the correct topology was only

displayed when the out group was manually indicated.

Neighbor-Joining / Maximum Likelihood / Bayesian methods yielded consistent topologies with the scientific literature but different

branch lengths were calculated as a result. Maximum Likelihood / Bayesian methods were time consuming as the number of samples

and the sequence length might be consider for choice. Neighbor-Joining was selected as a most suitable method for the analyses for

this kind of work.

Keywords: 16S rRNA, nucleotide sequences, MEGA 7.0

References: [1] Nei, M., and Kumar, S. Molecular Evolution and Phylogenetics. Oxford University Press Inc., New York, 2000.

[2] Grishin, N. V. Estimation of the number of amino acid substitutions per site when the substitution rate varies among sites. J. Mol.

Evol., 1995 41: 675–679.




238

IDDGC17-PP-223

DEVELOPING OF SOLID PHASE EXCTRATION PROCEDURE FOR DETERMINATION OF

TRACE SILVER BY USING BACTERIAL BIOMASS

Cigdem ER

1, Harun CĠFTCĠ

2, Ergin KARĠPTAS

3, Esin KĠRAY

4

1Mucur Vocational Training School, Ahi Evran University, KırĢehir, Turkey

2Department of Biochemistry, Faculty of Medicine, Ahi Evran University, KırĢehir, Turkey

3Ahi Evran University, Faculty of Medicine, Department of Microbiology,Kirsehir, Turkey

4Ahi Evran University, Faculty of Science and Arts, Department of Biology,Kirsehir, Turkey

[email protected]

Silver is considered to be toxic to humans and the recommendations of the World Health Organization (WHO) permit a

maximum concentration of 0.1 mg L-1

of silver in drinking water disinfection, the maximum. Thus, the determination of

low concentrations of silver is of increasing interest. Solid-phase extraction (SPE) is the most common technique for the

removal and separation of metal ions from environmental samples.

In the present study, a SPE procedure was developed for the determination of silver in various water samples on

Rhodococcus ruber bacterial biomass (RrBB) by High-Resolution Continuum Source Flame Atomic Absorption

Spectrometry (HR-CS FAAS).

R. ruber is important in many biotransformations and some transformations results in useful commercial processes.

Another important application of Rhodococcus comes from bioconversion, using biological systems to convert cheap

starting material into more valuable compounds, such as its ability to metabolize harmful environmental pollutants,

including toluene, naphthalene, and herbicides. Therefore, these organisms have environmental, commercial and

economical aspects major importance.

The optimum experimental and analytical parameters such as pH of the sample solution, sample volume, flow rate of

sample solution and eluent, volume and concentration of the eluent, effect of common matrix ions and were investigated

and optimized. A sample volume of 1000 mL resulted in a preconcentration factor (PF) of 200. Under the optimized

conditions, the detection limit and relative standard deviation (RSD) for silver were found to be 1.24 µg L-1

and 3.9% (n =

7), respectively. The proposed method was applied for the determination of trace amounts of silver in various water

samples and the method was verified using standard reference materials.

The proposed method has distinct advantages such as simplicity, low cost, and rapid and precise procedure for rapid

adsorption of silver from large volumes of the sample solutions.

Keywords: Biomass, Silver, FAAS, Rhodococcus ruber, SPE





239

IDDGC17-PP-224

PURIFICATION OF PON1 ENZYME FROM SHEEP LIVER MICROSOMES AND

INVESTIGATION OF IN VITRO INHIBITION EFFECTS ON ENZYME ACTIVITY OF SOME

MARKED RADIONUCLIDE DRUGS

Busra Cebeci1, Sukru Beydemir

2, …

1Hitit University, Alaca Avni Celik Vocational School, Food Processing Department, Turkey

2Anadolu University, Pharmacy Faculty, Turkey

[email protected]

Aims and Scopes: Paraoxonase (PON I, E .C .3.1.8.1) is an enzyme associated with HDL [1, 2]. The enzyme has received this name

because of its ability to hydrolyze the paraoxonin pnitrofenol and diethylphosphate. The enzyme is an esterase responsible for the

hydrolysis of the O-P ester bond in the paraoxone structure. PON1 is synthesized from the liver [2]. Although there is much

information about serum PON1, little information is available on liver microsomal PON1.

Materials and Methods: In this study, sheep liver microsomes were purified using PON1 enzyme DEAE ion exchange and

Sephadex G-150 gel filtration chromatography methods and in vitro inhibition effects of radionuclide-labeled Tc-MIBI, Tc-

SnCl2.2H2O and Tc-Pyrophosphate drugs on sheep liver microsomal PON1 enzyme activity were examined.

Results and Discussion: Microsomal PON1 enzyme was purified 392,33 fold with a specific activity of 1687.03 EU / mg with 9%

yield using DEAE-Sephadex A-50 ion exchange and Sephadex G-150 gel filtration chromatography techniques. Then, percent activity

graph [%] of drug for the above-mentioned marked radionuclide drugs were plotted and IC50 values were calculated as in order of

above mentioned drugs 0,0100 mM, 0,0111 mM, 0,6500 mM.

Keywords: PON1, marked radionuclide drugs

References:

[1] W.N. Aldridge, Bichem J„ 1953, 53, 117.

[2] A. Canales, FJ. Sanchez-Muniz, Med, Clin. 2003, 121, 537





240

IDDGC17-PP-225

THE FLORA OF LACTIC ACID BACTERIA IN TRABZON (VAKFIKEBĠR) BREAD SOURDOUGH Merve YURTTAġ

1, Nevzat ġAHĠN

2, Ahmet Hilmi ÇON

3

1University of Amasya, Nutrition and Dietetics, Amasya, Turkey

2University of Ondokuz Mayıs, Department of Food Engineering, Samsun, Turkey

3University of Ondokuz Mayıs, Department of Biology, Samsun, Turkey

[email protected]

Abstract

Sourdough fermentation is one of the oldest food biotechnology methods that affect sensory, nutritional, shelf life characteristics, and

structure of yeasted bakery products and has attracted attention in recent years. Sourdough containing lactic acid bacteria and yeast is

a dough with low pH which derives its characteristics from metabolic activities of this micro-flora. Lactic acid bacteria make positive

contributions to bread by affecting its taste and aroma, increasing appreciation of consumers, and extending its shelf life. In the

present study, the flora of lactic acid bacteria in sourdough samples obtained from 25 different establishments producing Trabzon

(Vakfıkebir) bread during winter season was identified. 42 different groups were formed in grouping of 500 isolates, isolated from

sourdoughs, via (GTG)5. 62 isolates chosen as representative of these groups were identified by 16S rDNA sequence analysis. 22 of

these 62 isolates were identified as Weissella cibaria, 17 as Lactobacillus sanfranciscensis, 6 as Leuconostoc pseudomesenteroides, 3

as Leuconostoc citreum, 3 as Lactobacillus curvatus, and 1 as Weissella minor, Weissella viridescens, Weissella confusa, Weissella

uvarum, Lactobacillus paralimentarius, Lactobacillus graminis, Lactobacillus plantarum subsp. plantarum, Lactobacillus pentosus,

Lactobacillus fermentum, Lactococcus lactis subsp. lactis and Leuconostoc mesenteroides subsp. mesenteroides. In the international

studies, even though species from genera Leuconostoc, Weisella, Pediococcus, Lactococcus, Enterococcus, and Streptococcus have

been isolated from sourdoughs produced by traditional method, Lactobacillus strains have been reported to be the most frequently

observed bacteria. Lactobacillus sanfranciscensis, Lb. brevis, Lb. plantarum are the most frequently isolated bacteria among

lactobacilli. Different studies are needed to identify new species in our conventional product which has not been examined in terms of

bacterial systematics in Turkey and to reveal our gene wealth.

Keywords: LAB, seconder metabolite, antifungal activity, natural food preservative

Acknowledgements

The research was funded by a grant (project 114O450) from Scientific and Technological Research Council of Turkey.




241

IDDGC17-PP-226

MOLECULAR IDENTIFICATION OF INSECTS IN FORENSIC ENTOMOLOGY

Meriem Taleb 1,2

, Halide Nihal Açikgöz 2 , Ghania Tail

1

1Laboratory of Biotechnologies Environment and Health, Faculty of Nature and Life Sciences, University of Blida1, Blida, Algeria.

2Laboratory of Forensic Biology and Entomology, Forensic Sciences Institute, Ankara University, Ankara, Turkey.

Abstract:

Medico-legal entomology, one area in the broad field of entomology, is routinely used in forensic applications [1]. A carrion-fly

maggot is by far the most common insect evident collected during a death investigation. Identification of the species of some larval

instars can be difficult using morphological features [3]. Molecular biology has a role to play in providing an alternative means of

insect identification using DNA [2]. Larval development is dependent on temperature and every species has a slightly different growth

rate. It is thus crucial to identify the larval species feeding from a corpse correctly to calculate the minimum post-mortem interval.

Thus, established molecular methods were transferred to the forensic field to ensure correct species identification. Other applications

include the identification of insect gut contents and the characterization of the population genetic structure of a forensically important

insect species [3]. We summarize the techniques used in molecular identification of insects that are currently used in, or have been

proposed for, forensic entomology.

Mitochondrial DNA (mtDNA) is useful for insect species identification as it is, for the most part, resistant to degradation and its use

can enable forensic scientists to provide identification of fly species within a day. Using some preservatives can result in

fragmentation of the DNA molecule. Any insect specimens chosen for DNA extraction should be taken from live cultures and killed

by freezing. Once killed, the specimens need to be cleaned before the DNA is extracted, to remove contamination by foreign DNA.

Washing initially in bleach or acetone has been found to be satisfactory and does not affect the level of DNA preservation. A second

precaution against contamination is to analyse the DNA from the head or thorax of the individual adult fly or the mid-section of a

larva [2]. Details of primer sequences can be accessed from GenBank. This information can then be used to request prepared primers

from pharmaceutical companies. DNA sequencing is basically done in three steps: polymerase chain reaction (PCR), followed by a

sequencing reaction, then gel electrophoresis.

The sequences of the protein-coding regions of the mtDNA, e.g. those coding for cytochrome oxidase subunits 1 and 2 (COI and

COII), are compared with known species ‗signatures‘ in the Genbank. Software such as Blast Search is used to search GenBank.

Although DNA identification of species can be a very useful tool in forensic entomology, it does not replace conventional

identification of species through morphological characterists.

Keywords: Forensic entomology, insect, larva, DNA, PMI, molecular systematics.

References:

[1] Cainé, L. M.; Corte Real; F., Saloña-Bordas; M. I., Martínez de Pancorbo, M.; Lima, G., Magalhães; T., Pinheiro, F. DNA typing of

Diptera collected from human corpses in Portugal. Forensic Science. International 2009, 184, 21-23.

[2] Gennard, D. Forensic Entomology An Introduction. Second Edition, Wiley-Blackwell, London, 2012, 249 p

[3] Wells, J.D.; Stevens, J.R. Application of DNA-Based Methods in Forensic Entomology. Annual Review of Entomology 2008, 5, 103-120.




242

IDDGC17-PP-227

ANTIMICROBIAL ACTIVITIES AGAINST A PATHOGENIC STRAINS OF NEW 3-

HYDROXYPYRIDINE SUBSTITUTED CROWN ETHER LIGAND AND COMPLEXES

Serhat Kocoglu

1,2, Hatice Ogutcu

3, Zeliha Hayvalı

1, Ferhat Kantar

3,4

1Department of Chemistry, Ankara University, Faculty of Science, 06100, Ankara, Turkey

2Bozok University, Science and Technology Application and Research Center, Yozgat, Turkey 3Department of Biology, Faculty of Arts and Science, Ahi Evran University, KırĢehir, Turkey

4 Suphi Öner Öğretmenevi ve ASO, YeniĢehir, Mersin, Turkey

[email protected]

Aims and Scopes: Crown ethers, which contain a hydrophobic ethylenic residues that surround a hydrophilic cavity of ether oxygen

atoms, are able to bind selectively a range of alkali and alkaline earth metal cations. They have been a topic of great interest in

chemical and biological research for more than four decades [1,2]. Crown ethers exhibit ionophoric properties in membranes,

behaving very similarly to the biologically important ionophores such as gramicidin, valinomycin, nonactin which makes particularly

interesting and useful in chemical and biological study and their pharmaceutical potential remains large. Besides its general use in

chemistry, it has also been used in biological examinations such as antimicrobial activities, DNA interactions, enzyme activities [3].

Materials and Methods: In this study, antibacterial and antifungal activities of new 3-hydroxypyridine substituted crown ether ligand

and Na+, K

+ and Ag

+ complexes were investigated. The synthesized compounds were examined for their antimicrobial activity by the

well-diffusion method [4]. The four samples were kept dry at room temperature and dissolved (0.1 µg/µL) in DMSO. DMSO was

used as both solvent and control. The antibacterial activities of new compounds have been determined against pathogenic strains

Listeria monocytogenes 4b ATCC19115, Staphylococcus aureus ATCC 25923, Escherichia coli ATCC 1280, Salmonella typhi H

NCTC-901.8394, Bacillus cereus RSKK-863, Micrococcus luteus ATCC 9341, Shigella dysenteria type 2 NCTC 2966,

Staphylococcus epidermidis ATCC 12228, Pseudomonas.aeroginosa sp., Brucella abortus RSKK03026. In addition to these, two

antifungal susceptibility tests were used by Candida albicans ATCC 90028 and Saccharomyces cerevisiae sp.

Results and Discussion: New 3-hydroxypyridine substituted crown ether ligand and Na+, K

+ and Ag

+ complexes were screened for

antimicrobial activity in DMF solvent as a control substance. All the synthesized compounds and antibiotic exhibited varying degree

of inhibitory eff ects on the growth of different tested strains.

Compounds were the most potent growth inhibitors against Br. abortus with a zone value of 21-27 mm. Br. abortus is a gram-

negative bacterium that causes premature abortion of cattle fetus, in addition it is a human pathogen which is a very serious,

debilitating and sometimes chronic disease that may affect a variety of organs.

The results of antifungal screening indicated that the compounds showed more activity for C.albicans.

In summary, compounds have been prepared for preliminary screening as antimicrobial agents. They exhibited a very good

antimicrobial activity against a wide range of microorganisms.

Keywords:Antimicrobial activity, Crown ether ligand, pathogenic strains.

References:

[1] Hayvalı, Z., Guler, H., Öğütcü H., Sarı, N. Medicinal Chemistry Res. 2014, 3652-3661.

[2] Kralj M., Tusek-Bozic L., Frkanec L. Chem. Med. Chem. 2008, 3, 1478-1492.

[3] Shubert, V.A., JamesIII, W.H., Zwier, T.S. J. Phys. Chem. A 2009, 113, 8055-8066.

[4] Sarı, N., Şahin, S. Ç., Öğütcü, H., Dede, Y., Yalçın, S., Altundas ,A., Doğanay, K. Spectrochimica Acta Part A: Molecular and Biomolecular

Spectroscopy 2013, 106, 60-67.





243

IDDGC17-PP-228

ANALYSIS OF G6PD MEDITERRANEAN MUTATION BY SEQUENCING ANALYSIS

BaĢak GünaĢtı1, Ebru Dündar Yenilmez

1, Mustafa Muhlis Alparslan

1, Umut KökbaĢ

1,

Kezban KartlaĢmıĢ1, Abdullah Tuli

1

1Department of Medical Biochemistry, Cukurova University, Adana, Turkey

Aims and Scopes: Glucose-6-phosphate dehydrogenase (G6PD; E.C.1.1.1.49) is the key enzyme catalyzing the first step of pentose

phosphate metabolic oxidative pathway. G6PD deficiency is the most common human enzymopathy, which is inherited as an X-

linked recessive disorder. [1]. The deficiency of G6PD deficiency may result in hemolytic anemia due to drug toxicities, infections

during the neonatal period, consumption of beans and stress conditions. More than 300 different biochemical variants of the enzyme

have been described. In many parts of the world the Mediterranean type of G6PD deficiency is prevalent [2]. Mediterranean type of

G6PD is the most common mutation of G6PD enzyme gene. This mutation occurs at 536. nt (C→T), resulting in a serine to

phenylalanine replacement [3]. In this study we were genotyped G6PD Mediterranean mutation by sequencing analysis.

Materials and Methods: G6PD enzyme activity were enrolled in 10 cases (3 male and 7 female). Enzyme activity was determined

with the Beutler method. DNA from 10 cases with G6PD deficiency was extracted from whole blood to investigate the mutation at nt.

536 (C→T) that is characteristic of G6PD Mediterranean. G6PD Mediterranean mutation was initially genotyped MboII restriction

enzyme. This mutation was genotyped by Sanger sequencing analysis for confirm.

Results and Discussion: In this study G6PD Mediterranean mutation were identified in 4 cases 2 of hemizygote and 2 of

heterozygote. Our study shows that Sanger sequencing analysis is a method that has the highest accuracy ratio and takes the least time

in comparison with restriction enzyme cleavage methods. Thus, this method may be frequently used for molecular diagnosis as a gold

standart.

Keywords: Glucose-6-phosphate Dehydrogenase, G6PD Mediterranean, Sequencing Analysis

References:

[1] Frigerio R, Sole G, Lovicu M, Passiu G. Haematologica. 1994 Jul-Aug;79(4):319-21.

[2] Gómez-Manzo S, Marcial-Quino J, Vanoye-Carlo A, Serrano-Posada H, Ortega-Cuellar D, González-Valdez A, Castillo-Rodríguez RA, Hernández-Ochoa B, Sierra-Palacios E, Rodríguez-Bustamante E, Arreguin-Espinosa R. Int J Mol Sci. 2016 Dec 9;17(12). pii: E2069

[3] Molou E, Schulpis KH, Thodi G, Georgiou V, Dotsikas Y, Papadopoulos K, Biti S, Loukas YL. Scand J Clin Lab Invest. 2014 Apr;74(3):259-63.




244

IDDGC17-PP-229

INTERLEUKIN 17F (7488 A/G) IS NOT RESPONSIBLE FOR THE PATHOGENESIS OF BOTH

NICOTINE DEPENDENCE AND SCHIZOPHRENIA IN TURKISH PATIENTS

Mehmet Atilla Uysal1, Mustafa Pehlivan

2, Nazan Aydın

3, Selin Kurnaz

4, Pınar Aydın

3, Ulgen Sever4, Sacide Pehlivan

4

1Department of Chest Diseases, Yedikule Hospital for Chest Diseases and Thoracic Surgery Training and Research Hospital,

Istanbul, Turkey 2 Department of Haematology, Gaziantep Univesity, Faculty of Medicine, Gaziantep, Turkey

3 Department of Psychiatry, Bakirkoy Research and Training Hospital for Psychiatry, Neurology and Neurosurgery, Istanbul, Turkey

4Department of Medical Biology, Istanbul University, Ġstanbul Faculty of Medicine, Istanbul, Turkey

Aims and Scopes: IL-17F is a cytokine that has an important role in the regulation of lung immunity and inflammation and has been

reported to be involved in the prevention of nicotine[1].The present study was examined to investigate the associations between the

7488 A/G missense variant of IL17 and the risk of heavy smokers (HS) or heavy smoker Schizophrenia (HSSch) patients. [2]

Materials and Methods: We included 154 (72F / 82M) patients with HS, 77 (33F / 44M) patients of HSSch and 100 (52F / 48M)

healthy controls (HC). DNA isolated from peripheral blood cells. The genotypes of the study variant were determined using the PCR-

RFLP method. The results were statistically analyzed by calculating the odds ratios (OR) and 95% confidence intervals (CI) using the

χ2 test.

Results and Discussion: The distributions of genotypes and allele frequencies were compared among all groups. The GG, GA, and

AA genotypes were observed in (0%), 1 (10.4%), and 13 (89.6%) patients with HS (respectively), (1.3%), (6.5%), and 7 (92.2%)

patients with HSSch (respectively), and in (0%), 1(13%), and 8(87%) HC. The G and A alleles were observed in 1(5.2%) and 292

(94.8%) patients with HS (respectively), (4.5%), and 14 (95.5%) patients with HSSch (respectively), and in 1 (6.5%) and 18 (93.5%)

HC (respectively). The proportions of G/A, A/A, G/G genotypes among nicotine dependent and schizophrenia patients compared to

healthy controls were not statistically significant (p>0.05, p>0.05, p>0.05, respectively). Moreover, the proportions G and A alleles

among nicotine dependent and schizophrenia patients compared to healthy controls were not statistically significant (p>0.05,

respectively). Our results suggest that missense variant of the IL17F gene may have a non-significant association with the

etiopathogenesis of both HSSch and HS.

Keywords: IL17F gene, nicotine dependence, 7488 A/G variant, PCR-RFLP.

References:

[1] Dimitrov, D.H; Lee, S. 2013, 151, 29-35.

[2] Cua, D.J; Tato, C.M.. 2010, 10(7), 479–89.

Acknowledgements: This study was partially supported by Istanbul University BAP thesis project (No: TYL-2016-20431) support

programe.




245

IDDGC17-PP-230

A NEW MOLECULAR ASPECTS FOR IDENTIFICATION OF

FORENSIC INSECTS: DNA BARCODING

Aysel Kekillioğlu1,Ülkü Nur Nazlıer

2

1,2NevĢehir HBV Uni. Sci & Lit Fac. Biology Dept. NevĢehir- Turkey

ABSTRACT

Introduction:Forensic entomology appears to provide answers to several questions that can be raised in a forensic case. Firstly,

forensic entomology intend to establish the time of death, known as postmortem interval (PMI), or more precisely, how long a carrion

has been exposed in the environment. Indeed, using medical techniques, such as the measurement of body temperature or analyzing

livor and rigor mortis, time since death can only be accurately measured for the first 2 or 3 days after death. [1]. Accurate

identification of an insect specimen is usually a crucial first step in a forensic entomological analysis. Closely related carrion species

can substantially differ in growth rate, diapause response or ecological preferences. [2]

Aims and Scopes: Today, the concept of DNA barcoding arises as a molecular approach to identify species. This concept is based on

a DNA sequence that acts as a barcode specific for each species[3]. In Turkish forensic entomology is still a very undeveloped area

and this study appears to cover this gap. For purposes of this study, we will focus our attention in medicolegal and wildlife forensic

entomology, because the involvement of insects in decomposition of cadavers.

Materials and Methods: Species identification by DNA barcoding is a sequencing-based technology. Once obtained the sequence

information of the target specimen it is possible comparing this information to a sequence library from known species[4].

Results and Discussion: The key point for any taxonomic system is its ability to deliver accurate species identification and,

according to[3] DNA barcoding accurately identified species in more than 95% of cases. Generally, the mitochondrial genome

(mtDNA) of animals is a better target for analysis than the nuclear genome because of its high copy number, lack of introns, its

limited exposure to recombination and its haploid mode of inheritance and therefore, have an increased chance of generating species-

specific markers [5].

Keywords: Forensic insects, PMI, DNA barcoding Taxonomy, mtDNA, Entomology, Ecology

References:

[1] Hall M., Amendt J. 2007. Forensic entomology – scientific foundations and applications. Forensic Sci. Int. 169S: S27-S28.

[2] Wells JD, Sperling FAH. DNA-based identification of forensically important Chrysomyinae (Diptera: Calliphoridae). Forensic Sci Int

2001;120:110–115.

[3] Hebert PDN, Cywinska A, Ball SL, deWaard JR. Biological identifications through DNA barcodes. Proc R Soc Lond B 2003;270:313‐321.

[4] Hajibabaei M.,. Singer G.A.C., Clare E.L., Hebert P.D.N. 2007. Design and applicability of DNA arrays and DNA barcodes in biodiversity

monitoring. BMC Biol. 5: 1‐24.

[5] Harvey M., Dadour R.I., Gaudieri S., Mansell M.W., Villet M.H. 2003. MtDNA‐based identification of blowflies in forensic entomology: more

accurate postmortem interval estimation and beyond. Forensic Sci. Int. 136(Supplement 1): 389.




246

IDDGC17-PP-231

INSECT RESISTANCE TRANSGENES OF CROPS

Aysel Kekillioğlu,

NevĢehir HBV Uni. Sci & Lit Fac. Biology Dept. NevĢehir- Turkey

Aims and Scopes: Today, insect-resistance transgenes, whether of plant, bacterial or other origin, can be introduced into plants to

increase the level of insect resistance, a technology that has dramatically extended the scope of resistance genes available to plant

breeders. [1,2] Approximately 40 different genes conferring insect resistance have been incorporated into crops, and the first

insectresistant crops have been commercialized in several countries. [3] The use of transgenic plants may lead to a reduction in the

use of broad spectrum insecticides, thereby extending the useful life of these compounds and reducing the ecological damage they

cause. However, there is concern that the constitutive expression of toxins will encourage the selection of resistance to such products

in pest populations. [4] This study aims to provide the main analyze of the insect-resistance genes that have been transferred into

crop plants worldwide.

Materials and Methods: The insect-resistance genes transferred into plants to date mainly target the insect digestive system. Most

have been derived from a single species of bacterium or a range of higher plants, although some insectresistance genes from animals

and other microorganisms have also recently been introduced into crop plants.

Results and Discussion: Recent problems with the approval of transgenic maize in the European Community were based on

risks connected with the antibiotic-resistance marker gene, rather than the insect-resistance gene itself.[5] The current trend is

therefore either not to use antibioticresistance marker genes or to deliver the marker gene in a different locus so that it can later

be bred away.

Keywords: Insects, Crops, Resistance, Transgenes, Pest, Insecticides

References:

[1] Hilder, V. A. et al. (1987) Nature 300, 160–163

[2] Vaeck, M. et al. (1987) Nature 328, 33–37

[3] Gatehouse, A. M. R., Boulter, D. and Hilder, V. A. (1992) in Plant Genetic Manipulation for Crop Protection (Gatehouse, A. M. R.,

Hilder, V. A. and Boulter, D., eds), pp. 155–181, CAB International

[4] Roush, R. (1997) in Advances in Insect Control: The Role of Transgenic Plants (Carozzi, N. and Koziel, M., eds), pp. 271–294, Taylor & Francis

Hall M., Amendt J. 2007

[5] MacKenzie, D. (1997) New Sci. 153 (2063), 8




247

IDDGC17-PP-232

EPIGENETICS EFFECTS OF PHYSICAL EXERCISE ON OSTEOPOROSIS

Sengul Tural1, Ercan Tural

2, Betul Z. Celik

1, Mehmet Elbistan,

1 Nurten Kara

1

Ondokuz Mayıs University Faculty of Medicine Departemnt of Medical Biology, Samsun, Turkey1

Ondokuz Mayıs University Havza Vocational School Departemnt of Physical Theraphy, Samsun, Turkey2

Aims and Scopes: Osteoporosis is a multifactorial disease characterized by a decrease bone mineral density (BMD) and micro-

architectural deterioration of bone structure. Although there are several environmental influences on BMD, a genetic contribution to

the pathogenesis of osteoroposis has recently been recognized. Twin and family studies have demonstrated an importanat genetic

component of osteoporosis regarding many parameters of bone properties with a heredity of 50-80%. The existence of many

candidate genes which have effect on bone mass was reported. Association studies based on candidate gene polymorphisms and

subsequent meta-analyses, and the more recent genome-wide association studies (GWAS), have clearly identified a handful of genes

associated with BMD and other osteoporosis related phenotypes. Indeed, epigenetic factors, representing a link between individual

genetic aspects and environmental influences, are also strongly suspected to be involved in bone biology and osteoporosis.

Materials and Methods: This is a review study.

Results and Discussion: Epidemiological studies have demonstrated a positive relationship between early growth and later bone

mass, both at peak and in later life, and also with reduced risk of hip fracture. Mother–offspring cohorts have allowed the elucidation

of some of the specific factors in early life, such as maternal body build, lifestyle and 25(OH)-vitamin D status, which might be

important. Bone metabolism has been demonstrated to be under the control of epigenetic mechanisms. Runt -related transcription

factor 2 (RUNX2), the master transcription factor of osteoblast differentiation, has been shown to be regulated by histone

deacetylases and microRNAs (miRNAs). Some miRNAs were also proven to have key roles in the regulation of Wnt s ignalling

in osteoblastogenesis, and to be important for the positive or negative regulation of both osteoblast and osteoclast differen tiation.

Exogenous and environmental stimuli, influencing the functionality of epigenetic mechanisms involved in the regu lation of bone

metabolism, may contribute to the development of osteoporosis and other bone disorders, in synergy with genetic determinants.

The progressive understanding of roles of epigenetic mechanisms and physical activity in normal bone metabolism and in

multifactorial bone disorders will be very helpful for a better comprehension of disease pathogenesis and translation of this

information into clinical practice.

Keywords: Epigenetics, Physical Activity, Osteoporosis

https://en.wikipedia.org/wiki/Epigenetics




248

IDDGC17-PP-233

Interacting Network Macromolecules between Cytosol and Mitochondria in Cancer Cells


2, Esen TUTAR

3




Aims and Scopes: Cancer cell metabolism is higher than healthy cell and this metabolic stress causes nascent chains to

fold faster and more functional proteins must be expressed. Overexpressed client proteins folding in shorter time frame

requires helpers to fold functional proteins to their native structure. Heat shock proteins (Hsps) rescue cancer cell

synthesis lag by folding client proteins and prevents overexpressed protein dependent aggregation. Hsps are located at

different compartments of the cell. Redundant form of Hsps existence is not full elucidated yet but this research shows

interaction of cytosolic and mitochondrial Hsp network as evidenced by microarray studies. Considering redundant forms

of Hsps in both compartment and isoforms it is important to determine coordinating and cooperating macromolecules.

Results and Discussion: Cytosolic Hsp70 proteins (both inducible HSPA4L and constitutive HSPA13) and

mitochondrial (HSPA9) interaction network prevent cancer cell apoptosis. Interestingly mitochondrial Hsp60 (HSPD1)

and cytosolic HSP90 (HSP90AB1) also involved in this network. The network is regulated by two miRNAs (has-miR-

194 and hsa-miR-215) and five pseudogenes. Interestingly Hsp90 and Hsp60 pseudogenes control Hsp network for anti-

apoptotic pathway. It should be noted that only cancer cells express the pseudogenes. The results are determined by

microarray experiments

Keywords: HSPs, cancer, mitochondria




249

IDDGC17-PP-234

DEVELOPMENT OF A NOVEL REAL TIME PCR METHOD FOR IDENTIFICATION OF

ESCHERICHIA COLI O157:H7

Esen TUTAR1*

, Kübra Sueda AKINCI2, Ġsmail AKYOL

2

1 KahramanmaraĢ Sütçü Ġmam University, Faculty of Science and Arts, KahramanmaraĢ, Turkey


KahramanmaraĢ, Turkey

* [email protected]

Aims and Scopes: Escherichia coli O157:H7 is pathogen that is known to be one of main causes on foodborne diseases.

This bacterium is commonly responsible for hemorrhagic colitis and hemolytic-uremic syndrome in humans [1-2].

Foodborne diseases caused by E. coli O157:H7 result from consumption of contaminated animal products such as raw

meats and dairy products [3]. In order to prevent the E. coli O157:H7 infections and their adverse effects, it is necessary

to identify the casual agents and to quantify their contamination accurately. It is aimed to provide an effective and fast

method for the prevention and control of E. coli O157:H7 infections in terms of human health and food safety.

Materials and Methods: In this study, we developed a newly Real Time PCR assay for identification of E. coli

O157:H7. One milliliter of the reference bacterial cultures grown in TSB and incubated at 37°C overnight was used to

DNA extraction. Another 1 mL of the same bacterial cultures was used to the total viable count of microorganisms.

Optimization of Real Time PCR reactions were performed to determine the optimal conditions by testing various

combinations of primer and probe concentrations and different annealing temperatures. A standard curve was generated

with Ct values obtained versus Log DNA concentration and Log microorganism counts.

Results and Discussion: The specific primers and Taqman probe targeting stx2 gene were determined to develop a Real

Time PCR that can identify E. coli O157:H7. Primer concentrations and annealing temperature were optimized and

following standard curve was generated from a dilution series of a standard DNA isolated E. coli O157:H7 reference

strain. In developed newly Real Time PCR protocol for E. coli O157:H7, Ct values were ranged from 17 to 25 while total

viable count of microorganisms are varied from 3.5x105 to 9.0x 10

7 cfu/mL for stx2 gene. The dynamic ranges of novel

protocol were 3.15-806.75 ng/μL based on DNA concentrations. The correlation coefficient (r2 values) was 0.999 for E.

coli O157:H7. The results of regression analysis indicated that standard curve has a good linearity for target pathogen.

The novel Real Time PCR protocol developed in this study has a potential to be a fast and reliable method to identify E.

coli O157:H7. This protocol may be alternative method to use in routine diagnostic laboratories for accurate and sensitive

diagnosis of E. coli O157:H7.

Keywords: Real Time PCR, Escherichia coli O157:H7, foodborne pathogen



References:

[1] Gyawali, R.; Ibrahim, S. A. 2012, 24 (1): 01-11.

[2] Riordan, J. T.; Viswanath, S. B.; Manning, S. D.; Whittam, T. S. 2011, 46 (6): 2070-2073.

[3] Elizaquível, P.; Sánchez, G.; Aznar, R. 2012, 25 (2012):704-708




250

IDDGC17-PP-235

IDENTIFICATION OF Staphylococcus aureus USING NOVEL MOLECULAR METHODS

Kübra Sueda AKINCI1,

Esen TUTAR2, Hakan BOZDOĞAN

3, Ġsmail AKYOL

1


KahramanmaraĢ, Turkey 2 KahramanmaraĢ Sütçü Ġmam University, Faculty of Science and Arts, KahramanmaraĢ, Turkey

3 Ahi Evran University, Technical Sciences Vocational School, Department of Plant and Animal Production, KırĢehir,

Turkey

*[email protected]

Aims and Scopes: Staphylococcus aureus is a common foodborne pathogen. S. aureus has the ability to produce highly

heat-stable enterotoxins that cause staphylococcal food poisoning in humans. The prevalence of S. aureus in foods present

a potential hazard to consumer health. The aim of this study was to develop the molecular methods by using conventional

PCR and Real Time PCR for identification of S. aureus.

Materials and Methods: One milliliter of the reference bacterial cultures grown in TSB and incubated at 37°C overnight

was used to DNA extraction. Another 1 mL of the same bacterial cultures was used to the total viable count of

microorganisms. Isolated S. aureus DNAs were used as template to amplify a region of about 791 bp of the 16S rRNA

gene by conventional PCR and following the amplified products were sequenced. In order to develop a novel Real Time

PCR assay, optimization of Real Time PCR reactions were performed to determine the optimal conditions by testing

various combinations of primer and probe concentrations and different annealing temperatures. A standard curve was

generated with Ct values obtained versus Log DNA concentration and Log microorganism counts.

Results and Discussion: In the conventional analyses, 16S rRNA gene was amplified to identify S. aureus and the

amplified products was sequenced for the validation of microbial identification. The specific primers and Taqman probe

targeting nuc gene were determined to develop a novel Real Time PCR assay that can identify S. aureus. According to the

Real Time PCR results, DNA concentrations, total viable count of microorganisms and Ct values were ranged from 1.5-

191.5 ng/μL, 5.6x105-7.2x10

7 cfu/mL and 17- 26, respectively. The results of regression analysis indicated that standard

curves have a good linearity for S. aureus with the square regression coefficients (r2 values, 0.997). In this study, we

developed the two molecular methods as conventional PCR assay and Real Time PCR assay to detect and quantify S.

aureus. These molecular methods could be successfully used to identify S. aureus and could be a valuable diagnostic tool,

especially in the food microbiology.

Keywords: Conventional PCR, Real Time PCR, Staphylococcus aureus, foodborne pathogen






251

IDDGC17-PP-236

Pseudogenes and miRNAs in Different Cancer Types

Yusuf TUTAR1, Esen TUTAR

2



Our understanding of cancer pathways has been changed by the determination of non-coding parts of the human

genome in recent years. miRNAs and pseudogenes are key players of the non-coding parts of the genome, and

alteration of their expression levels are clues for significant biomarkers in pathogenesis of diseases. Especially,

miRNAs and pseudogenes have both oncogenic and tumor-suppressive roles in each step of cancer

tumurogenesis. In the current study, the association between oncogenes and miRNAs-pseudogenes were

reviewed and determined in different human cancers. Pseudogenes existence occurs only in cancer cells.

Keywords: Pseudogenes, cancer, miRNAs

INTERNATIONAL

DNA DAY AND GENOME

CONGRESS 2017

(IDDGC’17)

ABSTRACT BOOK

APRIL 24-28, 2017

AHİ EVRAN UNIVERSITY

KIRŞEHİR / TURKEY

PUBLICATION DATE: 05 May, 2017

international dna day and genome congress...

Documents