international tomato genome sequencing project 70 µm 0 µm 123 456789101112 108.0 mb 85.6 mb 83.6...

Download International Tomato Genome Sequencing Project 70 µm 0 µm 123 456789101112 108.0 Mb 85.6 Mb 83.6 Mb 82.1 Mb 80.0 Mb 53.8 Mb 80.3 Mb 64.7 Mb 81.8 Mb 88.5

Post on 29-Jan-2016

243 views

Category:

Documents

0 download

Embed Size (px)

TRANSCRIPT

  • International Tomato Genome Sequencing Project70 m0 m123456789101112108.0 Mb85.6 Mb83.6 Mb82.1 Mb80.0 Mb53.8 Mb80.3 Mb64.7 Mb81.8 Mb88.5 Mb64.7 Mb76.4 Mb242626191220271716101311MbT=220246268274193120213277175164108135113BACsT=2285EuchromatinHeterochromatinTo sequenceChromosomeCountryUSAKoreaChinaUKIndiaNLFranceJapanSpainUSAUSAItaly

  • University of Delhi South CampusAkhilesh K. TyagiJ. P. KhuranaP. KhuranaArun SharmaNational Research Centre for Plant BiotechnologyNagendra K. Singh T. Mohapatra T. R. SharmaK. Gaikwad National Centre for Plant Genome ResearchDebasis ChattopadhyaySabhyata Bhatia Indian Initiative on Tomato Genome SequencingCentromeric RegionHeterochromatic RegionHeterochromatic RegionEuchromatic RegionEuchromatic RegionTelomeric RegionTelomeric RegionUDSC &NCPGRNRCPB(0-60 cM)(69-119 cM)

  • Criteria for BAC selection and confirmationSelection of two candidate seed BACs on chromosome 5 specific marker 100 kb or more in size end sequence availability at SGN4. BAC verification by direct sequencing using two marker/overlapping region-specific primers using vector-specific SP6 and T7 primers2. Purity check of bacterial stock Hind III fingerprint of DNA isolated from six independent colonies3. PCR amplification of genetic markers/overlapping region two marker/overlapping region-specific primer pairs5. Size estimation/confirmation of BAC clone by CHEF analysis of Not I digested BAC DNA6. Validation of BAC on chromosome 5 using Introgression Lines polymorphism in PCR products SNP detection of non-polymorphic bands

  • Confirmation of marker CT101 and its assigned seed BAC position on chromosome 5Marker: CT101 Seed BAC: LE_HBa0191B01Haplotype 1: -ACCCCTCAATATTTCGCTCCAAHaplotype 2: TGTATACTTGCGCCAGTTCAGGGL. esculentumL. pennelliiIL 5-1IL 5-2IL 5-3IL 5-4IL 5-5Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, LE_HBa0191B01Haplotype 2: L. pennellii, IL 5-1(M82)

  • Confirmation of markers and their assigned seed BAC positions on chromosome 5

    cMMarkerAmpli-con sizeHaplotypesSequence0 CT1011100 bpM82, IL5-2, IL5-3, IL5-4, IL5-5-ACCCCTCAATATTTCGCTCCAATGTATACTTGCGCCAGTTCAGGGL. pennellii, IL5-13 T1252375 bpM82, IL5-2, IL5-3, IL5-4, IL5-5GAATL. pennellii, IL5-17 C2At1g602001000 bpM82, IL5-2, IL5-3, IL5-4, IL5-5TAGATATGGTCTACCGA-ACL. pennellii, IL5-110 cLET-8-B23(BAC-specific, non-marker region)360 bpM82, IL5-2, IL5-3, IL5-4, IL5-5GGCT-TTTAA--ATCTGCATTI/DGTTTCAGCT...GACTAAAATCAAGGTTGCGGATGCC...ACCAT-ATCI/DAGTAL. pennellii, IL5-112 T0876110 bpM82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5GA--AAGTTGL. pennellii 15.5cLED-8-G31000 bpM82, IL5-2, IL5-3, IL5-4, IL5-5CTCG...GTTTT-...TGA-TAAGTTTGAAAGI/DAAGTI/DI/DATAATGAAI/DACAAATI/DCTGGGGCACACTGGGA...GGAA......GACTL. pennellii, IL5-1

  • Reallocation of marker T0876 and its associated BAC positions on chromosome 7

    BAC/MarkerAmplicon sizeHaplotypesSequenceLE_HBa0179K09 SP6 ext.750 bpM82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0077G20TACGTG...TTATGACTCGAACAI/DGACAATAGL. pennellii, IL7-2T0876110bpM82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09GA--AAGTTGL. pennellii, IL7-2LE_HBa0179K09 T7 ext.550 bpM82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0077G20ACCGTAL. pennellii, IL7-2SL_MboI0032F07 SP6 ext.700 bpM82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0032f07TCTC...TC...GG...AGTG-TGGAAGATCAI/DCAI/DTAI/DGA-AT-TTTCAL. pennellii, IL7-2

  • Single streak of BAC clones from seed BAC libraryDNA extractionPCR with genetic marker for re-confirmationCHEF-analysis for size estimationShotgun cloning and sequencingSearching for STCs (Sequence Tag Connector) SGN end-sequence databaseDNA fingerprinting(HindIII-digested) for BAC stock purityThe path for genomic sequencing

  • The selected seed BACs and extension BACscMMarkerClones selectedStatus0371015.52173105107108111115119LE_HBa0191B01LE_HBa0051A13LE_HBa0261K11LE_HBa0042B19LE_HBa0179E24LE_HBa0027B05LE_HBa0169M21LE_HBa0166A02LE_HBa0040C21LE_HBa0131D04LE_HBa0006N20LE_HBa0239D11LE_HBa0245E05119LE_HBa0251J13T1632CT101C2-At1g60200cLET-8-B23cLED-8-G3BS4T1360T1777T1541T1584TG69CT130TG597TG185Centromeric RegionHeterochromatic RegionHeterochromatic RegionEuchromatic RegionEuchromatic RegionTelomeric RegionTelomeric RegionLong ArmShort ArmUDSC & NCPGRNRCPBLE_HBa0108A18Phase IIPhase IIIPhase IPhase IIPhase IIIPhase IIIPhase IPhase IPhase IPhase II

    Phase IIPhase IIPhase IIPhase IIPhase I

    16LE_HBa0058L13T1592Library79LE_HBa0334K22cLEX-13-G5Phase I84LE_HBa0227B07T1746LibraryLE_HBa0168B11Phase IISL_MboI0037H06Phase IISL_MboI0005B15Phase IIPhase ISL_MboI0050C14Phase IILE_HBa0106O06SL_MboI0111D17SL_EcoRI0086I08SL_EcoRI0053P22SequencingLE_HBa0189E17Phase IIIT056411LE_HBa0074A13LE_HBa0195M17LE_HBa0051A18SL_MboI0095J08SequencingLibraryPhase ILibraryPhase IIPhase IT12524C2-At1g604400

  • SP6SP6T7T7T7T7T7SP6SP6SP6SP6SP6SP6T7SP6T7T7T7T7HBa0179K09 (108 kb)MboI0032F07 (~140 kb)MboI0052O23MboI0083J01MboI0077G20 (92 kb)SP69002 bp overlap (100%)12955 bp overlap (100%)HBa0188L22HBa0064M20HBa0102G23HBa0123J08HBa0144B20~3.5 kb overlap~1.4 kb overlapPrimer pair 1Primer pair 2Primer pair 1Primer pair 1Primer pair 1Primer pair 2~19 kb overlap~15.5 kb overlapChromosome 7T1401 (COS)CT223 (RFLP)95 cMClones sequenced to Phase III levelClones sequenced to Phase II levelExtension clones verifiedRed bars indicate the PCR positive nature of BAC clones using respective primer pairsDotted line indicates the expected overlapGreen line shows the presence of mapped markers on the BAC clonesBACs mapped on chromosome 7

  • Gene prediction & annotation of some sequenced BAC clones

  • Important genes present on some BAC clones

    S. No.BAC cloneName of the geneOrganism1HBa0191B01Putative cytochrome P450O. sativa2HBa0191B01HAC1 transcription factorA. thaliana3HBa0191B01UDP- glycosyl transferaseA. thaliana4HBa0261K11Putrescine aminopropyltransferaseL. esculentum5HBa0261K11Splicing factor PWI containing protein/ RNA recognition motifL. esculentum6HBa0261K11Polygalactouranase isozyme 1 beta subunit precursorL. esculentum7HBa0042B19Beta fructosidase geneL. pennellii8HBa0042B19Nematode resistance-like protein (Gro1-6)S. tuberosum9HBa0042B19Peptide transporter PTR2-BA. thaliana10SL_MboI0037H06Potyviral capsid protein interacting protein 2a (CPIP2a)N. tabacum11SL_MboI0037H06UV-damaged DNA binding protein 1 (hp1)L. cheesmanii12SL_MboI0037H06VFNT cherry Pto locusL. esculentum13HBa0179E24Tospovirus resistance protein C (Sw5-C)L. esculentum14HBa0179E24Eukaryotic translation initiation factor 5A-3L. esculentum15HBa0179E24ACS6 geneL. esculentum

  • Summary5. Sequencing status of 25 BAC clones * Three BAC clones submitted to SGN/NCBI* One BAC clones in phase III (quality improvement)* Twelve BAC clones in phase II (10 submitted to NCBI)* Nine BAC clones in phase I3. Finally, 31 BAC clones, covering approximately ~3.0 Mb region, have been mapped 2. Nine extension BAC clones from 6 nucleation points have been confirmed1. Twenty two seed BAC clones using 20 markers have been confirmed4. All BAC clones are being mapped on chromosome 5 by using chromosome 5-specific introgression lines 6. Two BAC clones from chromosome 7 have also been completely sequenced and submitted to SGN and NCBI

Recommended

View more >