introductory genetics. what is a gene? a gene is a stretch of dna whose sequence determines the...
TRANSCRIPT
![Page 1: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/1.jpg)
Introductory Genetics
![Page 2: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/2.jpg)
What is a gene?
• A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule (usually a protein)
DNA
Protein
…GAATTCTAATCTCCCTCTCAACCCTACAGTCACCCATTTGGTATATTAAAGATGTGTTGTCTACTGTCTAGTATCC…
Computer program
Specific function
…function sf(){document.f.q.focus()}…
Working copymRNA
![Page 3: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/3.jpg)
Genes are located in the cell nucleus on chromosomes
Karyotype
![Page 4: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/4.jpg)
Down syndrome karyotype (trisomy 21)
![Page 5: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/5.jpg)
DNA(deoxyribonucleic acid)
mR
NA
Protein
![Page 6: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/6.jpg)
![Page 7: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/7.jpg)
Summary
• A gene is a length of DNA that contains instructions for making a specific protein
• Genes are arranged along 23 pairs of chromosomes in the cell nucleus
• Genes work by specifying the amino acid sequence of a protein
![Page 8: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/8.jpg)
Mendel’s laws
![Page 9: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/9.jpg)
Genetic knowledge used for 1000s of years: agriculture
![Page 10: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/10.jpg)
Patterns of disease inheritance known for 1000s of years, e.g. haemophilia
![Page 11: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/11.jpg)
Mendel deduced the underlying principles of genetics from these patterns
1. Segregation
2. Dominance
3. Independent assortment
![Page 12: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/12.jpg)
Mendel’s experiments
![Page 13: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/13.jpg)
Mendel’s data
![Page 14: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/14.jpg)
Mendel’s law of segregation
• A normal (somatic) cell has two variants (alleles) for a Mendelian trait.
• A gamete (sperm, egg, pollen, ovule) contains one allele, randomly chosen from the two somatic alleles.
• E.g. if you have one allele for brown eyes (B) and one for blue eyes (b), somatic cells have Bb and each gamete will carry one of B or b chosen randomly.
B b
B BB Bb
b Bb bbEggs
Sperm
![Page 15: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/15.jpg)
Mendel’s law of dominance
• If your two alleles are different (heterozygous, e.g. Bb), the trait associated with only one of these will be visible (dominant) while the other will be hidden (recessive). E.g. B is dominant, b is recessive.
B b
B BB Bb
b Bb bbEggs
Sperm
![Page 16: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/16.jpg)
Mendel’s law of dominance
• If your two alleles are different (heterozygous, e.g. Bb), the trait associated with only one of these will be visible (dominant) while the other will be hidden (recessive). E.g. B is dominant, b is recessive.
B b
B BB Bb
b Bb bbEggs
Sperm
![Page 17: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/17.jpg)
Terminology…
• Haploid: containing one copy of each chromosome (n=23)
B b
B BB Bb
b Bb bbEggs
Sperm
• Diploid: containing two copies of each chromosome
(2n=46)
![Page 18: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/18.jpg)
Terminology…
• Genotype: the states of the two alleles at one or more locus associated with a trait
• Phenotype: the state of the observable trait
Genotype Phenotype
BB (homozygous) Brown eyes
Bb (heterozygous) Brown eyes
bb (homozygous) Blue eyes
![Page 19: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/19.jpg)
Mendel’s law of independent assortment
• Knowledge of which allele has been inherited at one locus gives no information on the allele has been inherited at the other locus
S/s Y/y
SY Sy sY sy
25% 25% 25% 25%
![Page 20: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/20.jpg)
Mendel’s law of independent assortment
S Y
s y
Gametophytes(gamete-producing cells)
S Y
s yGametes
A b
a BRecombinants
Segregation
![Page 21: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/21.jpg)
Mendel’s law of independent assortment
S Y
s y
Gametophytes(gamete-producing cells)
S Y
s yGametes
S y
s YRecombinants
Recombination
Segregation
![Page 22: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/22.jpg)
• Simplified view of eye colour inheritance: biallelic Mendelian trait
– Brown dominant: BB, Bb
– Blue recessive: bb
Human eye colour
B b
B BB Bb
b Bb bbEggs
Sperm
![Page 23: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/23.jpg)
Human eye colour
?
What is the probability of a child being born with blue eyes?
![Page 24: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/24.jpg)
Human eye colour
?
![Page 25: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/25.jpg)
Human eye colour
?
B?
B?B?B? bb
bb B?
![Page 26: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/26.jpg)
Human eye colour
?
Bb
BbBbB? bb
bb B?
![Page 27: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/27.jpg)
Human eye colour
?
Bb
BbBb
B?
![Page 28: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/28.jpg)
Human eye colour
?
BbP(BB)=1/3
BbBb
P(Bb)=2/3
![Page 29: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/29.jpg)
Human eye colour
?
BbP(BB)=1/3
BbBb
P(Bb)=2/3
P(b)=2/3x1/2=1/3 P(b)=1/2
![Page 30: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/30.jpg)
Human eye colour
?
BbP(BB)=1/3
BbBb
P(Bb)=2/3
P(b)=2/3x1/2=1/3 P(b)=1/2
P(bb)=1/3x1/2=1/6
![Page 31: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/31.jpg)
• Haemophilia A• Males with a mutant gene are
affected• Females with one mutant gene
are unaffected carriers
Non-Mendelian inheritance: Haemophilia
![Page 32: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/32.jpg)
Summary
• Mendel deduced three simple laws of inheritance:– Segregation– Dominance– Random assortment
• The majority of traits don’t follow these rules but Mendel’s laws are nevertheless crucial to understanding almost all genetic inheritance
![Page 33: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/33.jpg)
Frequency
Case 0.200
Control 0.165
Odds ratio: 1.26
![Page 34: Introductory Genetics. What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule](https://reader036.vdocuments.net/reader036/viewer/2022062410/5697bff71a28abf838cbe618/html5/thumbnails/34.jpg)
1. Eye-catching headline of the form “Gene for…”
2. Highly qualified factual paragraph