lable at ScienceDirect

Tuberculosis 91 (2011) 569e578

Contents lists avai

Tuberculosis

journal homepage: http : / / int l .e lsevierhealth.com/journals / tube

MOLECULAR ASPECTS

Isolation of conditional expression mutants in Mycobacterium tuberculosis bytransposon mutagenesis

Francesca Forti*, Veronica Mauri, Gianni Dehò, Daniela GhisottiDipartimento di Scienze Biomolecolari e Biotecnologie, Università degli Studi di Milano, Via Celoria 26, 20133 Milano, Italy

a r t i c l e i n f o

Article history:Received 2 May 2011Received in revised form28 June 2011Accepted 17 July 2011

Keywords:Mycobacterium tuberculosisMutagenesisTransposonEssential genesInducible promoters

* Corresponding author. Tel.: þ39 2 50315022; fax:E-mail addresses: francesca.forti@unimi.it (F. For

unimi.it (V. Mauri), gianni.deho@unimi.it (G. Deh(D. Ghisotti).

1472-9792/$ e see front matter � 2011 Elsevier Ltd.doi:10.1016/j.tube.2011.07.004

s u m m a r y

In Mycobacterium tuberculosis identification of essential genes has been hampered by the scarcity ofsuitable genetic tools for genome wide screenings. We constructed two Himar1 transposon derivatives inwhich the Streptomyces pristinamycin I-inducible ptr promoter was inserted at one transposon end inoutward orientation. These transposons, Tn-pip/pptr (which harbours the promoter and its repressor pipgene) and Tn-pptr (which depends on a host expressing the pip gene), were inserted in the thermo-sensitive mycobacteriophage phAE87. After transduction into M. tuberculosis H37Rv, hygromycin resis-tant clones were selected in the presence of pristinamycin, screened for inducer dependent growth, andthe transposon insertion point mapped by sequencing. Out of 3530 HygR mutants tested, we obtained 14(0.4%) single insertion conditional mutants. In three (leuA, mazE6, rne) pptr was located upstream ofgenes whose function had been assessed by experimental evidence, whereas in seven the transposontargeted genes (ftsK, glf, infB, metC, pyrD, secY, and tuf) whose function had been assigned by similaritywith homologous genes and four ORFs of unknown function (Rv0883c, Rv1478, Rv2050 and Rv2204c).These results validate our mutagenesis system and provide previously unavailable conditional expressionmutants in genes of known, putative and unknown functions for genetic and physiological studies.

� 2011 Elsevier Ltd. All rights reserved.

1. Introduction

The sequencing and annotation of the entire Mycobacteriumtuberculosis H37Rv strain in 19981 and, more recently, of other 19mycobacterial genomes (http://www.ncbi.nlm.nih.gov/genomes/genlist.cgi?taxid¼2&type¼0&name¼Complete%20Bacteria) haveprovided a powerful tool to explore and understand the biology ofthis important pathogen that kills every year about 1.7 millionpeople in the world.2 About 67% of the 4006 protein coding genesidentified in the M. tuberculosis genome has been confidentlyassigned a function, generally by similarity to genes characterizedin other model organisms, whereas for the remaining 33% thefunction attribution is either hypothetical or lacking.3 It is likelythat among the latter class a number of essential genes, some ofwhich encode M. tuberculosis-specific functions, are present. Thesefunctions may thus represent ideal targets for the development ofnew specific drugs that may replace the traditional antibioticswhose efficacy is hampered by the spreading of multidrug

þ39 2 50315044.ti), veronica.mauri@studenti.ò), daniela.ghisotti@unimi.it

All rights reserved.

resistance mechanisms among bacteria.4 Therefore, in recent years,attempts were made to identify and characterize M. tuberculosisessential genes.

Several methods have been developed in the last two decades togenerate either specific gene disruption mutants5e7 or randomtransposon insertion mutant libraries8e10 using derivatives ofHimar1, a transposon that inserts randomly into TA sites.8,9,11 Over70,000 TA dinucleotides present in the M. tuberculosis genomeassure that an insertion will be present approximately every 60bases, that is into nearly any chromosomal region. These approacheshave helped defining the set of “non-essential” genes and, bydefault, the complementary set of putative essential genes.9,12

In the last years, new mutagenesis approaches have beendeveloped in order to target any specific gene and positively definewhether a gene is essential or not. For example, inhibiting geneexpression by antisense RNAs, which has been successfully used inother pathogens such as Staphylococcus aureus,13 has also beenattempted in M. tuberculosis; this approach, however, is not widelyapplied, possibly for the difficulty encountered in designing effec-tive antisense oligonucleotides.14

The most effective strategy to obtain conditional mutants inessential genes consists of inserting a regulatable promoterupstream of the gene to be targeted in substitution of the native

F. Forti et al. / Tuberculosis 91 (2011) 569e578570

promoter. With this strategy the gene will be expressed whentranscription from the regulatable promoter is active (permissiveconditions) and not expressed when transcription is inactive (non-permissive conditions). Thus far, three different regulatedpromoters have been used in mycobacteria for such purpose: theMycobacterium smegmatis acetamidase promoter, which is inducedby acetamide15; the Rhodococcus rhodochrous nitA promoter,induced by 3-caprolactam,16 and several variants of tetracycline-regulated promoters.17e20 Among them, only tetracycline (Tet)and its analogues are known to exhibit a good bioavailability, andthus may be used during mouse infection with M. tuberculosis.

Recently, we developed an inducible system based on the ptrpromoter of Streptomyces pristinaespiralis,21 which is repressed bythe Streptomyces coelicolor Pip protein.22,23 The streptograminpristinamycin I is the inducer of the system. This antibiotic hasa good bioavailability and is used for curing persistent Gram-posi-tive infections in humans.24 This system was tested inM. tuberculosis and in M. smegmatis and found to allow highexpression levels in the presence of pristinamycin and to be stronglyrepressed in the absence of the inducer.21 Compared to the Tetsystems17,19,20 the Pip system showed in reporter assays a higherinduction factor and a more efficient repression in the absence ofthe inducer and was used for the construction of two conditionalmutants in the M. tuberculosis pknB and fadD32 essential genes.21

While these systems are very useful to inactivate the expressionof specifically targeted genes, to our knowledge no conditionalmutagenesis tools have been developed yet for genome wide high-throughput conditional mutagenesis in mycobacteria, whereastransposon-based conditional mutagenesis tools have beensuccessfully employed in bacteria such as Escherichia coli, Salmo-nella enterica and Vibrio cholerae.25e28

In this work we constructed a system for conditional muta-genesis based on a Himar1 transposon derivative harbouring theinducible promoter of the ptr gene (pptr) oriented outward. Upontransposon delivery in the M. tuberculosis chromosome by infec-tion with a thermosensitive mycobacteriophage vector, wescreened for pristinamycin I-dependent clones in which thetransposon turned out to be inserted adjacent either to genes withknown functions or to previously uncharacterized ORFs. This opensup the possibility to identify via high-throughput screening a largenumber of unknown essential functions and to provide a library ofconditional mutants of known and unknown genes for studyingtheir function in vitro as well as in infection.

2. Materials and methods

2.1. Bacterial strains and growth conditions

The following strains were used: M. tuberculosis H37Rv (labo-ratory stock), M. tuberculosis H37Rv-pMY769,21 M. smegmatismc215529 and E. coli DH10B.30 M. tuberculosis strains were grown inMiddlebrook 7H9 broth or 7H10 agar medium supplemented with0.05% Tween 80, 0.2% glycerol and 10% ADN (5% Albumin, 2%Dextrose, 145 mM NaCl). When necessary, streptomycin (20 mg/ml)and hygromycin (50 mg/ml) were added. Pristinamycin I (Sanofi-Aventis, Paris, France) was dissolved in DMSO (50 mg/ml) and usedat 0.5 mg/ml. M. tuberculosis H37Rv-pMY769 carries pMY769,a plasmid unable to replicate in mycobacteria and expressing pip,integrated at the FL5 att site in the chromosome.21 M. tuberculosisauxotrophic mutants were grown in Middlebrook 7H10 supple-mented with leucine (50 mg/ml), methionine (50 mg/ml), or uridine(200 mg/ml), respectively. M. smegmatis mc2155 was grown in LDmedium21 containing 0.2% (vol/vol) glycerol and 0.5% (vol/vol)Tween 80. E. coli DH10B was grown in LD medium and used as hoststrain for cloning and plasmid propagation.

2.2. Construction of Tn-pptr, Tn-pip/pptr and the FD and FMdonor phasmids

The Tn-pptr and Tn-pip/pptr transposons for conditionalexpression mutagenesis were constructed as diagrammed inFigures 1 and 2. The Himar1 transposon8 right inverted repeat,obtained by oligonucleotide annealing (Figure 2C), was cloned inplasmid pAZI9479,21 downstream of pptr, between the þ1 of pptrand the ShineeDalgarno sequence of the ptr gene, obtainingplasmid pMYT817. Then the hyperactive Himar1 transposase31 wasamplified from plasmid pBAD-C9 (kindly provided by D. J. Lampe),and cloned in the NcoI-SphI sites of pMYT817, under the control ofpptr, obtaining plasmid pMYT818. The region comprising Tn-pip/pptr and the hyperactive transposase was sequenced (seeSupplementary Material Figure 1). The left inverted repeat ofHimar1 transposon, obtained by oligonucleotide annealing(Figure 2C), was cloned in the KpnI-XbaI sites of plasmid pjsc284,32

which carries a hyg gene that confers hygromycin resistance (HygR),a l cos region, and a single PacI restriction site, obtaining plasmidpMYT821. The pip gene, controlled by the constitutive pfurA102promoter,33 was PCR-amplified from pAZI9479 and cloned in theHindIII-NcoI sites of pMYT821, obtaining plasmid pMYT826. ThePstI-NdeI fragment of pMYT818, carrying pptr and the transposase,was then cloned in the NsiI-SpeI sites of pMYT821 and pMYT826,obtaining pMYT827 (harbouring Tn-pptr) and pMYT829 (harbour-ing Tn-pip/pptr), respectively. To construct the transducingphasmid vectors, DNA extracted from the thermosensitive phagephAE8734 was annealed through the cohesive ends, ligated,digested with PacI and ligated with PacI-digested plasmidpMYT827 and pMYT829. The two ligation mixtures were thenpackaged in vitro with Gigapack III XL packaging extract (Stra-tagene), and transduced into E. coli DH10B. Phasmid DNA wasextracted from HygR clones and transfected into M. smegmatisstrain mc2155 at the permissive temperature, in order to obtainphage plaques. Phage stocks of FD (from ligation of phAE87 withpMYT827) and FM (from ligation with pMYT829) were thenobtained and used to infect M. tuberculosis.

2.3. Construction of transposon mutant libraries and screening forconditional mutants

The wild type M. tuberculosis strain H37Rv and strain H37Rv-pMY769,21 which expresses pip from the integrated plasmid, weregrown in 10 ml cultures at 37 �C up to OD600 of 0.8e1.0, washedtwice with MP buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 10 mMMgSO4, 2 mM CaCl2), and resuspended in MP buffer in 1/10 theoriginal culture volume. The cells were then incubated at 39 �C for15 min, infected with phage FD or FM at an m.o.i. of about 10, andkept at the same temperature for 3 h. HygR transductants wereselected on 7H10 agar with hygromycin (50 mg/ml) and pristina-mycin I (0.5 mg/ml) and incubated at 37 �C. Single HygR colonieswere streaked in parallel on 7H10-hygromycin agar plates with andwithout pristinamycin I. Clones exhibiting impaired growth in theabsence of pristinamycin I were further tested by efficiency ofplating in permissive and non-permissive conditions.

2.4. Infection of M. smegmatis mc2155

The infection was performed as described above forM. tuberculosis H37Rv, except that post-infection incubation was30 min instead of 4 h. HygR transductants were selected on 7H10agar with hygromycin (50 mg/ml) and pristinamycin I (10 mg/ml)and incubated at 37 �C.

Figure 1. Construction of the transposon-mutagenesis system. The scheme is not drawn to scale. The different steps of the construction are outlined in the figure and described inMaterials and Methods. Construction of FM is outlined; FD was constructed in the same way, but without the insertion of the pfurA-pip fragment.

F. Forti et al. / Tuberculosis 91 (2011) 569e578 571

2.5. Identification of Tn-pptr and Tn-pip/pptr insertion sites in themutants

The chromosomal insertion sites of Tn-pptr and Tn-pip/pptrwere assessed by the Y-linker method.35 Briefly, the genomic DNAwas digested with NlaIII and ligated to the Y linker obtained byannealing the oligos TTTCTGCTCGAATTCAAGCTTCTAACGATG-TACGGGGACACATG and TGTCCCCGTACATCGTTAGAACTACTCGTACCATCCACAT which, upon annealing, form a Y shaped moleculewith one NlaIII-compatible overhang. Aliquots of the diluted liga-tion reaction were used as template in PCR amplifications per-formed with a Y linker specific primer (CTGCTCGAATTCAAGCTTCT)and a transposon specific primer (CGTCACCTTCTACGACCTGA). Insome cases a seminested PCR was performed with the same Ylinker specific primer and a second transposon specific primer(GCGTATGGGAATCTCTTGTACG) internal to the amplified region.The PCR products were gel purified, sequenced and the insertionpoints identified by BLAST analysis against the H37Rv genome.

2.6. Southern analysis

Mutant genomic DNA was digested with ScaI and separated ona 0.8% agarose gel. The DNA was transferred on an AmershamHybond-Nþ membrane (GE Healthcare) by the capillary method,according to the manufacturer’s procedures. The probe, coveringthe left IR of the Transposon and the 50 half of the HygR gene, was

amplified with oligos FG2357 (TAACAGGTTGGCTGATA) and FG1767(GGCTCATCACCAGGTAGGGC), using pMYT829 as template, andlabelled with a-32P-dATP by random priming, using Prime-a-Gene�

Labelling System (Promega). Filter hybridization and washing wereperformed as described.36

2.7. Complementation of Rv1478 and Rv2204c mutants

Coding regions of genes Rv1478 and Rv2204c were amplifiedwith specific oligos and cloned in plasmid pMV261,37 under thecontrol of the M. smegmatis hsp60 promoter, obtaining plasmidspMYT835 (Rv2204c) and pMYT836 (Rv1478), respectively. Eachcomplementing plasmid and, as control, pMV261, were electro-porated into the correspondingmutant strain. A few clones for eachtransformation were streaked onto plates with and without pris-tinamycin I (0.5 mg/ml) to test their dependence on the inducer forgrowth.

3. Results

3.1. Construction of the mutagenesis system

A tool for randomly generating conditional expression lethalmutants in M. tuberculosis was constructed based on Himar1 trans-poson and the pristinamycin I-inducible pptr system, as describedin Materials and methods and illustrated in Figures 1 and 2. Himar1

Figure 2. Schematic representation of Tn-pptr, Tn-pip/pptr and of FM. The elementscomposing the transposons and the phasmid are not drawn to scale. (a) Sequences ofthe left (IRL) and right (IRR) inverted repeats of Himar.18 (b) Tn-pip/pptr carrying theHygR gene, the pip gene, under the control of the pfurA102 promoter, and pptr orientedoutwards. (c) Tn-pptr, as above but lacking the pip gene. (d) The phasmid M, carryingthe pip gene, is represented: cos indicates the phAE87 cos sites, PacI is the restrictionsite used for phage assembly, the elements present in the transposon are the same asin (a), the hyperactive transposase position immediately outside of the transposon isalso indicated.

F. Forti et al. / Tuberculosis 91 (2011) 569e578572

efficiently transposes into TA sites and does not require any hostfactor(s) for transposition.31 The ptr promoter is highly expressed inM. tuberculosis and is strongly repressed by the Pip repressor proteinin the absence of the inducer pristinamycin I.21

Two different minitransposons have been created. The first one,Tn-pptr, is composed of the left and right inverted repeats (IR) ofHimar1 bracketing the hygromycin resistance cassette and pptrtranscribing outwards across the IRR. This compact (2135 bp)minitransposon was created in a recombinant E. coli plasmidcarrying a colE1origin of replication, a l cos site, and the Himar1hyperactive recombinase gene31 located immediately outside ofTn-pptr and expressed under the control of pptr (pMYT827). Tn-pptr can be used for conditional mutagenesis of mycobacteriaexpressing pip, such as H37Rv-pMY769, an M. tuberculosis H37Rvderivative in which the suicide plasmid pMY769, which constitu-tively expresses the pip gene, is integrated into the FL5 att site.21

The second minitransposon, Tn-pip/pptr (3084 bp), harboured bypMYT829 (Figure 1), contains in addition the pip gene expressedfrom the constitutive pfurA102 promoter,33 and can thus beemployed for the mutagenesis of any mycobacterial strain.

Table 1Transposon mutagenesis of M. tuberculosis H37Rv and H37Rv/pMY769.

Infecting phage* Titre of infected cells Survivals (%)y HygR cl

Experiment I:FD NTx e 1.0 � 1FM 4.4 � 107 1.4 1.0 � 1Experiment II:FD 4 � 107 0.7 1.5 � 1FM 3.4 � 107 1.0 3.3 � 1

* Infection was performed as described in Materials and methods, with an m.o.i. of 10y The surviving cells were assayed 3 h after infection.x NT: not tested. The OD600 was 1.0 as in the other infections.

** Only 3 clones were confirmed as single transposon insertions.yy NT: not tested. Clones obtained from the second infection with FD were not analyz

Both pMYT827 and pMYT829 were cloned in the thermosensi-tive mycobacteriophage phAE87,34 which can replicate at 30 �C butnot at 39 �C, as described in Materials and methods, obtaining FD,which harbours Tn-pptr, and FM, which carries Tn-pip/pptr.

Both phage transposon vectors were used for mutagenesis andscreening of conditional expression mutants in M. tuberculosis.M. tuberculosis H37Rv and H37Rv-pMY769 were infected with FMand FD, respectively, at 39 �C for 3 h, then the cells were plated on7H10 agar with hygromycin and pristinamycin I, and incubated for3 weeks at 37 �C, as described in Materials and methods.

The results of the infections are reported in Table 1. Thefrequency of HygR clones obtained with either FMor FDwas about10�3e10�4 and both phasmids gave insertion and conditionalmutants at comparable frequencies. Since in a preliminary experi-ment transposition efficiency and conditional mutant frequencyupon FD and FM infections were comparable, the screening ofconditional mutants in a second experiment was performed onlywith H37Rv transposon mutants obtained by FM infection.

3.2. Analysis of the HygR clones

To identify pristinamycin I-dependent mutants, individual HygR

clones were streaked on 7H10 agar plates both in the presence andin the absence of inducer. The clones that did not grow or grewpoorly in the absence of the antibiotic, were tested semi-quantitatively for efficiency of plating in the non-permissivecondition (Figure 3). Out of 1000 HygR clones obtained from theinfection with FD and 2530 from FM infection, we found 5 (0.5%)and 11(0.43%) pristinamycin I-dependent mutants, respectively.

Genomic DNA of the mutants was then extracted and the copynumber of the transposon was determined by Southern blotting(see Materials and methods). Two mutants harboured two copieseach of the transposon and were not further considered while in allthe other mutants, which carried a single transposon (Figure 4 anddata not shown), the insertion point was identified by Y-linker PCR(see Materials and methods), sequencing and BLAST analysisagainst theM. tuberculosis genome. The sequence of the pptr end ofthe transposon-M. tuberculosis genome junction of the three Tn-pptr conditional mutants in H37Rv/pMY769 and of the 11 Tn-pip/pptr mutants in H37Rv is shown in Sup Figure 2. A summary list ofthe conditional mutants obtained with indication of the gene(s)immediately downstream of pptr is reported in Table 2.

All mutant strains were tested for growth in liquid medium inthe presence and absence of pristinamycin I. As can be seen inFigure 3, the growth of the mutants in which the expression of theftsK, glf, infB, leuA, metC, rne, Rv1478, Rv2050, Rv2204c, secY, and tufgenes was under pptr control, was severely affected and stoppedupon shift to the non-permissive condition. On the other side,growth in liquid medium of the Tn-pptr-Rv0883c mutant was lessaffected by the lack of the inducer; the pyrD mutant recovered

ones/ml Inducer-dependent/HygR clones % Conditional mutants

04 5**/1000 0.5005 4/530 0.75

04 NTyy e

04 7/2000 0.35

. FD and FM infected H37Rv-pMY769 and H37Rv, respectively.

ed.

Figure 3. Comparative growth of the mutants with or without pristinamycin I. For each mutant growth in solid and in liquid medium are reported. Growth in solid medium wasevaluated by measuring the efficiency of plating of the strains: cultures were grown in the presence of 0.5 mg/ml of pristinamycin I to OD600 about 0.5. Serial dilutions of the cultureswere made and 5 ml of each dilutionwere plated on 7H10, ADC, hygromycin (50 mg/ml), with or without pristinamycin I (0.5 mg/ml). Growth curves in liquid mediumwere performedas follows: the cultures were grown in 7H9, ADC, hygromycin (50 mg/ml), pristinamycin I (0.5 mg/ml) to OD600 about 0.5, washed, and 2 dilutions to OD600 about 0.02 were made foreach culture, one with and the other without pristinamycin I (0.5 mg/ml). In several cases (mazE6, pyrD, rne, Rv0883c, Rv2050, Rv2204c, tuf), in which the culture did not stop growingbefore reaching the stationary phase, a 10 fold dilution after two days was performed. In such cases, both OD600 readings performed before and after dilution are reported at the sametimepoint. A representative of several independent growth curves for each mutant is shown. Closed symbols: with pristinamycin I; open symbols: without pristinamycin I.

Figure 4. Analysis of the number of transposon insertions in the conditional mutants.Southern blot analysis was performed as indicated in Materials and Methods on totalDNA extracted from the mutants indicated above the lines, using a probe comple-mentary to the HygR cassette. MW: molecular weight markers are indicated on theright (x 103).

F. Forti et al. / Tuberculosis 91 (2011) 569e578574

a faster growth rate after 6e7 days of slow growth, possibly due tothe selection of constitutive expression mutants; the growth rate ofthe pptr-mazE6 mutant decreased but did not stop completely.

3.3. The Tn-pptr mutagenesis is not efficient in M. smegmatis

We also attempted to mutagenize the model organismM. smegmatis (data not shown), which could speed up the laborious

Table 2M. tuberculosis conditional mutants identified by transposon mutagenesis.

Gene underpptr control

Function Predictedessentiality*

Tin

ftsK Division transmembrane protein (by similarity) E þglf UDP-galactopyranose mutase (by similarity) NE* �

infB Translation initiation factor IF-2 (by similarity) E �

leuA 2-isopropylmalate synthase (experimental evidence) E þmazE6 Antitoxin (experimental evidence) Not reported �

metC o-Acetylhomoserine sulfhydrilase (by similarity) NE* �

pyrDz Dihydroorotate dehydrogenase (by similarity) NE þrne Putative ribonuclease E (experimental evidence) E �

Rv0883cz Conserved hypothetical protein E �

Rv1478 Conserved hypothetical protein NE �

Rv2050 Conserved hypothetical protein E �Rv2204cyy Conserved hypothetical protein NE �

secY Preprotein translocase (by similarity) E �tuf Elongation factor TU (by similarity) E �

* According to Himar1-based transposon mutagenesis in H37Rv strain12: (E) essentialthe same operon.

y The position is given relative to the þ1 translation initiation site of the gene.x Number of amino acids of the gene product.

** The position of the gene relative to contiguous genes transcribed in the same directinterval over 100 bp, putative independence of the genes was hypothesized.yy These mutants were obtained in H37Rv/pMY769.

process of identifying the conditional mutants. However, forreasons we did not explore further, in this host HygR clones couldonly be obtained at a very low efficiency in several experimentsperformed as described in Materials and methods. We also usedhigher pristinamycin I concentrations (up to 40 mg/ml) and addedthe inducer in the liquid culture before phage infection, but noincrease in the number of HygR clones was obtained. No pristina-mycin I-dependent clones could be isolated within the smallnumber of HygR mutants obtained from FM infection.

3.4. Transposon insertion point in the mutants

The transposon insertion point in the different mutants, relativeto the þ1 base of the translation initiation codon of the firstdownstream open reading frame, is reported in Table 2 and in SupFigure 2. As can be seen, for most genes (glf, infB, mazE6, metC, rne,Rv0883c, Rv1478, Rv2050, Rv2204c, secY, tuf) the transposon inser-ted either upstream of or at the translation initiation codonwithoutaltering the open reading frame, thus suggesting that expression ofsuch genes (and of the downstream genes in case of polycistronicoperons) is under the control of pptr and the mutants will be thusdesignated by the name of the first gene downstream of thetransposon prefixed by pptr-. It should be noted that in the case ofinfB, rne, Rv0883c, Rv2050, Rv2204c, secY, and tuf, which are thoughtto be part of monocistronic operons, the conditional lethalphenotype may be attributed directly to the conditional expressionof such genes. As for the other genes thought to be part of poly-cistronic operons, one or more genes downstream of the trans-poson insertion point may be implicated in the conditionalphenotype (see Discussion). In other cases, the transposon insertedwithin a coding region, and the mutant will be designated by pptr-followed by the primed name of the disrupted gene, to denote the

ransposonsertion pointy

Proteinlengthx

Genomic context of the gene**

156 883 Monocistronic operon1 399 First gene of a dicistronic or polycistronic operon:

glf e 3 bp e glfT2e 29 bp e Rv3807c e 7 bp -ubiAe 89 bp e aftB e 395 bp e fbpA.

95 900 Putative monocistronic operon:— Rv2840c e 210 bp e infB e 526 bp e rbfA—

29 644 Monocistronic operon1 82 Putative first gene of a polycistronic operon:

— ctpG e 100 bp e mazE6 e 6 bp overlap e mazF6 ——

69 449 First gene of a putative polycistronic operon:metC e 12 bp e metA e 3 bp overlap e Rv3342

3 357 Monocistronic operon198 953 Putative monocistronic operon:

ndkA e 330 bp e rne45 253 Putative monocistronic operon:

serC e 157 bp e Rv0883c37 241 Last gene of a putative bicistronic operon:

Rv1476 e 226 bp e ripA e 11 bp e Rv1478 e 139 bpe moxR1——

45 111 Monocistronic operon11 118 Last gene of a bicistronic operon:

Rv2205c e 100 bp e Rv2204c90 441 Monocistronic operon58 396 Putative monocistronic operon:

—— fusA1 e 231 bp e tuf e 131 bp e Rv0686 ——

; (NE) non-essential; (NE*) non-essential, but with essential gene(s) downstream in

ion and the number of base pairs (bp) separating the genes are indicated. For gene

F. Forti et al. / Tuberculosis 91 (2011) 569e578 575

50 truncation. In the pptr-’pyrD mutant, the transposon inserted3 bp downstream of the translation initiation codon of pyrD.However, immediately downstream of the insertion point an in-frame GTG codon is present, which may allow translation initia-tion of a peptide missing the first four amino acids. Similarly, inpptr-‘leuA the insertion point was at þ29; a possible GTG startcodon is present 27 bp further downstream, thus creating a 19codons 50-terminally truncated gene. In pptr-‘ftsK the insertionpoint is at þ156 and an ATG codon is formed at the transposoninsertion point. Since these three conditional expression mutantsappear to be part of monocistronic operons and in the presence ofpristinamycin I are able to grow as well as thewild type, we suggestthat these genes are essential and that the encoded N-terminallytruncated proteins are sufficient for cell viability.

3.5. Auxotrophic mutants

The pptr-‘leuA, pptr-metC and pptr-‘pyrD mutants should beauxotrophs. We tested this phenotype by growing the clones in thepresence of leucine, methionine and uridine, respectively. As can beseen in Figure 5, the mutants were able to grow if the correctgrowth factor is added to the growth medium.

3.6. Complementation

Based on the above analysis, five genes previously classified asnon-essential (namely glf, metC, pyrD, Rv1478, Rv2204c12), exhibiteda conditional expression lethal phenotype (Table 2). To test that insuch mutants the conditional phenotype was due to repression ofthe gene under pptr control, we complemented two of them(Rv1478 and Rv2204c) with the wild type allele ectopicallyexpressed from the pMV261 plasmid vector37 under control of thehsp60 promoter, known to ensure a substantial basal level ofexpression at 37 �C.37 Both strains were able to grow in thiscondition (Figure 6), thus confirming that the growth defect wasdue to the absence of the function encoded by Rv1478 or Rv2204cgenes, respectively.

4. Discussion

In this work we demonstrate that isolation of conditionalmutants in essential genes in M. tuberculosis can be achieved witha system that couples a transposon with the pristinamycin I-inducible promoter pptr oriented outwards. When the transposoninserts into the mycobacterial chromosome upstream of an essen-tial gene, expression of the gene will be dependent on the additionof the inducer. Thus, essential gene mutants can be easily screenedby testing the growth ability of transposon-mutagenized clones inthe presence and in the absence of the inducer.

Figure 5. Growth of auxotrophic mutants. Auxotrophic pptr-‘leuA, pptr-metC and pptr-‘pyrDmrespectively. þPI: presence of pristinamycin I; -PI: absence of pristinamycin I; -PI þ GF (Gindicated in Materials and methods.

The mutagenesis system we have developed is based ona Himar1 minitransposon derivative harbouring the induciblepromoter of the ptr gene; this construct may be transduced intomycobacteria by the thermosensitive phage phAE87. In agreementwith previous observations,9 transposition efficiency of Himar1-derived constructs in M. tuberculosis was rather high (yieldingfrom about 3.7 � 10�4 to 2 � 10�3HygR clones/infected cell) andthus a large library of insertion mutants for the screening ofconditional expression mutants could be readily obtained (Table 1).On the contrary, in M. smegmatis the yield of transposon mutantswas rather poor (about 100 HygR cfu/ml of phage infected culture)and transposition efficiency in the order of 10�6e10�7. A tenfoldlower yield of transductants in fast-growing relative to slow-growing mycobacteria had been previously observed witha different Himar1 derivative delivered by phAE87.9 In our system,an additional reason that might have decreased the yield oftransposon insertion mutants could be a low expression of thetransposase, which is under pptr control, since in M. smegmatisa higher concentration of pristinamycin I is necessary for fullinduction of the pip-pptr system.21

Most HygR clones obtained fromM. tuberculosismutagenesis areviable mutants also in the absence of pristinamycin I, eitherbecause the transposon inserted into a non-essential gene orbecause the insertion point did not affect any gene function.Nevertheless, about 0.5% of the transposed clones were conditionalmutants that depend on the presence of the inducer for growth.This rather high frequency of conditional mutants, at least tenfoldhigher than that observed in E. coli using a mini-Tn5 derivative,28

could be due, at least in part, to the higher percentage of essen-tial genes in M. tuberculosis (35%10) as compared to E. coli (about6%38). It is possible that some mutants could not be detectedbecause the expression level of the essential gene in the presence ofpristinamycin I was not adequate for cell viability. Since theinduction level can be modulated by changing the inducerconcentration,21 selection of transposon mutants at different pris-tinamycin I concentrations might allow the identification ofdifferent sets of conditional expression mutants.

By our transposon-mutagenesis system we have isolatedconditional mutants in genes of known, putative, and unknownfunction. It should be noted, however, that for most “known” genesin the M. tuberculosis genome their name and function has beenassigned by analogy with homologous genes of other species andtheir function and essential role have never been directly proved inM. tuberculosis. This is the case for ftsK, infB, secY, and tuf. infB andtuf are predicted to code for the translation initiation factor IF-239

and the translation elongation factor EF-,40 respectively. secY(Rv0732) encodes a predicted preprotein translocase, a componentof a major secretion machinery for translocation of proteins acrossthe plasma membrane.41 ftsK encodes a predicted cell divisiontransmembrane protein homologous to proteins present in

utants were grown on 7H10 agar supplemented with leucine, methionine and uridine,rowth Factor): leucine, methionine or uridine were added to the growth medium, as

Figure 6. Complementation of the pptr-Rv1478 and pptr-Rv2204cmutants. The mutants were transformed with the pMV261 (control vector) and with either pMYT836 or pMYT835,carrying the wild type alleles of Rv1478 and Rv2204c, respectively. Single clones were streaked on Middlebrook 7H10 medium in the presence (þPI) or absence (�PI) ofpristinamycin.

F. Forti et al. / Tuberculosis 91 (2011) 569e578576

Mycobacterium leprae and many other bacteria (for a review see42).A transposon insertionmutant in this genewas previously obtainedand found not to be affected in in vitro growth, but unable to survivein vivo in mouse infection.43 On the contrary, the growth of ourmutant appears to be severely affected in vitro. The reason for thisdifferent behaviour is not clear, since the transposon insertionpoints in the two mutants do not considerably differ (þ143 in thepreviously isolated mutant and þ155 in our mutant). We mayhypothesize that in Lamichhane’s mutant a truncated form of thegene is expressed, probably at low level, from a promoter located inthe transposon,10 whereas in our mutant the truncated geneexpression is completely repressed in the absence of pristinamycinI. In any case, the FtsK protein lacking the N-terminal 52 aminoacids appears to be sufficient for cell viability. The isolation ofconditional expression mutants in these four genes is the firstdirect evidence of their essential role in vitro, and implies that noother paralogous or analogous genes capable to substitute for theirfunctions are present inM. tuberculosis. Thus also inM. tuberculosisthese genes are likely to encode non-redundant essential functions.

In other mutants the transposon insertion has targeted geneswhose biochemical function had been previously clarified. Forexample, RNase E, coded by rne, is a key component of the degra-dative machinery and an essential protein in E. coli and other Pro-teobacteria.44 Mycobacterial RNase E has been purified and shownin vitro to possess endonucleolytic activity.45 Since in B. subtilis andin most Firmicutes both RNase E and the paralogous RNase G arenot present,46 it was not obvious whether in Mycobacteria thisenzymewas essential, as demonstrated by the isolation of the pptr-rnemutant. We have recently confirmed the essential role of rne inbothM. tuberculosis andM. smegmatis by specifically inserting a pip/pptr cassette upstream of this gene and obtaining conditionalexpression mutants in both species (V. Taverniti, F. Forti, D. Ghisottiand H. Putzer, unpublished results).

As for leuA, the gene product has been biochemically andstructurally characterized and proved to be the 2-isopropylmalatesynthase, which catalyzes the first step in leucine bio-synthesis.47e49 We have obtained other mutants in which meta-bolic genes are targeted by transposon insertion: metC, the firstgene of a bicistronic operonwithmetA, is implicated in methioninebiosynthesis, whereas pyrD, a putative dihydroorotate dehydroge-nase may be implicated in pyrimidine biosynthesis.50 No otherM. tuberculosis gene appears to encode the same function.51

Moreover, growth of the pptr-‘leuA, pptr-metC and pptr-‘pyrDmutants was recovered by addition of the required growth factor tothe medium, thus confirming that the mutants are conditionalauxotrophs. The glf gene was classified as non-essential by Sassetti

et al.12 In pptr-glf the transposon is inserted upstream of the firstgene of a polycistronic operon, in which a downstream essentialgene is present (glfT212). This may suggest that the essentialphenotype is due to a polar effect on the downstream geneexpression. However, the glf homologous gene inM. smegmatiswasfound to be essential and could be complemented byM. tuberculosisglf52 Thus, we suggest that also in M. tuberculosis glf is essential.

The mazE6 gene (Rv1991A) encodes an antitoxin as part ofa toxin-antitoxin system with the downstream mazF6 gene in thesame operon. The MazF6 toxin protein is an mRNA interferase,a specific endoribonuclease able to cleave U-rich regions.53

Expression of M. tuberculosis mazF6 alone depresses the growthof E. coli, whereas coexpressionwith the antitoxin MazE6 did not.54

The high number of toxin-antitoxin systems present inM. tuberculosis and in other pathogenic bacteria has suggested thatthese systems may provide a control on translation in response tonutritional stress.55 In other bacteria, such as E. coli, all thesesystems are strictly regulated at the transcriptional level, mostly bythe antitoxin itself. By similarity with autoregulation of the mazE6-mazF6 module in E. coli,56 we can suggest that in our construct themechanism for autoregulation of the mazE6-mazF6 module waslikely lost as a result of the replacement of the module’s nativepromoter with the pristinamycin I-regulated promoter. Theconditional growth phenotype of the pptr-mazE6 mutant could bedue to the consequences of losing the ability to autoregulate thetoxin-antitoxin expression and hence to control MazF toxicity.

Among the genes of unknown function targeted by our trans-poson insertions, Rv1478 and Rv2204c had been previously clas-sified as non-essential.12 The transposon insertion point in the pptr-Rv1478 mutant is within the upstream essential gene Rv1477(ripA57) ((Table 2; Supplementary Figure 2); a fully descriptivename for this mutation is thus Rv1477::Tn-pptr-Rv1478). Theinsertion in Rv1477 causes a truncation of 8 amino acids at the C-end of a 473 amino acids long gene product. This mutant is com-plemented by the wild type Rv1478, thus suggesting that this geneencodes an essential function. In Mycobacterium marinum a muta-tion that prevents the expression of the homologous genes iipA andiipBwas fully complemented byM. tuberculosis Rv1477 and partiallycomplemented by M. tuberculosis Rv1478,58 suggesting that iipA/Rv1477 and iipB/Rv1478 may encode partially redundant functions.Thus we cannot exclude that in our mutant a synthetic phenotypedepending on both truncation of Rv1477 and conditional expres-sion of Rv1478 causes the conditional phenotype.

Rv2204c encodes a protein of 118 amino acids conserved inActinomycetes and in M. leprae that contains an iron-sulphurcluster assembly domain. The homologous gene in E. coli, erpA,

F. Forti et al. / Tuberculosis 91 (2011) 569e578 577

has an essential role in respiratory metabolism.59 While thepreviously isolated mutant has not been characterized, the pptr-Rv2204c conditional phenotype is a strong evidence in favour of itsessential role in M. tuberculosis.

Finally, two genes of unknown function (Rv0883c and Rv2050)previously classified as essential have been targeted by pptr inser-tion. Rv0883c encodes a conserved hypothetical protein of 253amino acids for which no prediction has been made relative to itsstructure and function. Rv2050, which encodes a conserved 111amino acids long protein present in M. leprae, M. smegmatis,S. coelicolor, has been classified within the core genes of myco-bacteria.60 In M. smegmatis the homologous gene (rbpA) is impli-cated in the phenotypic tolerance to rifampicin and the encodedprotein interacts with the b subunit of RNA polymerase.61 Expres-sion of M. tuberculosis Rv2050 in S. coelicolor rpbA null mutantrestores the basal level of resistance to the antibiotic.62

In conclusion, we have set up an efficient mutagenesis systemfor the isolation and characterization of M. tuberculosis conditionalexpression mutants that can be used for in vitro and in vivo studiesto investigate the functions of the mutant genes. It appears relevantto us that the mutant phenotype is manifested in the absence ofpristinamycin I, since in vivo studies of the mutants will not bebiased by the presence of any drug. We have isolated mutants ingenes of known, predicted or unknown function and provideddirect experimental evidence for their essential role.

Acknowledgements

We thank D. J. Lampe for sending the plasmid with hyperactivetransposase and W. R. Jacobs, Jr., for sending the phAE87 phage.

Ethical approval: Not required.

Funding: This work was supported by grants from the EC-VIFramework Contract No. LSHP-CT-2005-018923.

Competing interests: None declared.

Appendix. Supplementary material

Supplementary data related to this article can be found online atdoi:10.1016/j.tube.2011.07.004.

References

1. Cole ST, Brosch R, Parkhill J, Garnier T, Churcher C, Harris D, Gordon SV,Eiglmeier K, Gas S, Barry 3rd CE, Tekaia F, Badcock K, Basham D, Brown D,Chillingworth T, Connor R, Davies R, Devlin K, Feltwell T, Gentles S, Hamlin N,Holroyd S, Hornsby T, Jagels K, Krogh A, McLean J, Moule S, Murphy L, Oliver K,Osborne J, Quail MA, Rajandream MA, Rogers J, Rutter S, Seeger K, Skelton J,Squares R, Squares S, Sulston JE, Taylor K, Whitehead S, Barrell BG. Decipheringthe biology of Mycobacterium tuberculosis from the complete genomesequence. Nature 1998;393:537e44.

2. WHO. Global tuberculosis control: key findings from the december 2009. WklyEpidemiol Rec 2010;85:69e80. WHO report.

3. Camus JC, Pryor MJ, Medigue C, Cole ST. Re-annotation of the genome sequenceof Mycobacterium tuberculosis H37Rv. Microbiology 2002;148:2967e73.

4. CDCP. Emergence of Mycobacterium tuberculosis with extensive resistance tosecond-line drugseworldwide, 2000e2004. MMWR Morb Mortal Wkly Rep;2006:301e5.

5. Pelicic V, Jackson M, Reyrat JM, Jacobs Jr WR, Gicquel B, Guilhot C. Efficientallelic exchange and transposon mutagenesis in Mycobacterium tuberculosis.Proc Natl Acad Sci U S A 1997;94:10955e60.

6. Pavelka Jr MS, Jacobs Jr WR. Comparison of the construction of unmarkeddeletion mutations in Mycobacterium smegmatis, Mycobacterium bovis bacilluscalmette-guerin, and Mycobacterium tuberculosis H37Rv by allelic exchange.J Bacteriol 1999;181:4780e9.

7. Bardarov S, Bardarov Jr S, Pavelka Jr MS, Sambandamurthy V, Larsen M,Tufariello J, Chan J, Hatfull G, Jacobs Jr WR. Specialized transduction: an effi-cient method for generating marked and unmarked targeted gene disruptionsin Mycobacterium tuberculosis, M. bovis BCG and M. smegmatis. Microbiology2002;148:3007e17.

8. Rubin EJ, Akerley BJ, Novik VN, Lampe DJ, Husson RN, Mekalanos JJ. In vivotransposition of mariner-based elements in enteric bacteria and mycobacteria.Proc Natl Acad Sci U S A 1999;96:1645e50.

9. Sassetti CM, Boyd DH, Rubin EJ. Comprehensive identification of conditionallyessential genes in mycobacteria. Proc Natl Acad Sci U S A 2001;98:12712e7.

10. Lamichhane G, Zignol M, Blades NJ, Geiman DE, Dougherty A, Grosset J,Broman KW, Bishai WR. A postgenomic method for predicting essential genesat subsaturation levels of mutagenesis: application to Mycobacterium tuber-culosis. Proc Natl Acad Sci U S A 2003;100:7213e8.

11. Akerley BJ, Rubin EJ, Camilli A, Lampe DJ, Robertson HM, Mekalanos JJ.Systematic identification of essential genes by in vitro mariner mutagenesis.Proc Natl Acad Sci U S A 1998;95:8927e32.

12. Sassetti CM, Boyd DH, Rubin EJ. Genes required for mycobacterial growthdefined by high density mutagenesis. Mol Microbiol 2003;48:77e84.

13. Ji Y, Zhang B, Van SF, Horn Warren P, Woodnutt G, Burnham MK, Rosenberg M.Identification of critical staphylococcal genes using conditional phenotypesgenerated by antisense RNA. Science 2001;293:2266e9.

14. Wei JR, Rubin EJ. The many roads to essential genes. Tuberculosis (Edinb)2008;88(Suppl. 1):S19e24.

15. Parish T, Stoker NG. Development and use of a conditional antisense muta-genesis system in mycobacteria. FEMS Microbiol Lett 1997;154:151e7.

16. Kang CM, Abbott DW, Park ST, Dascher CC, Cantley LC, Husson RN. TheMycobacterium tuberculosis serine/threonine kinases PknA and PknB: substrateidentification and regulation of cell shape. Genes Dev 2005;19:1692e704.

17. Ehrt S, Guo XV, Hickey CM, Ryou M, Monteleone M, Riley LW, Schnappinger D.Controlling gene expression in mycobacteria with anhydrotetracycline and tetrepressor. Nucleic Acids Res 2005;33. e21.

18. Blokpoel MC, Smeulders MJ, Hubbard JA, Keer J, Williams HD. Global analysis ofproteins synthesized by Mycobacterium smegmatis provides direct evidence forphysiological heterogeneity in stationary-phase cultures. J Bacteriol2005;187:6691e700.

19. Carroll P, Muttucumaru DG, Parish T. Use of a tetracycline-inducible system forconditional expression in Mycobacterium tuberculosis and Mycobacteriumsmegmatis. Appl Environ Microbiol 2005;71:3077e84.

20. Boldrin F, Casonato S, Dainese E, Sala C, Dhar N, Palu G, Riccardi G, Cole ST,Manganelli R. Development of a repressible mycobacterial promoter systembased on two transcriptional repressors. Nucleic Acids Res 2010;38. e134.

21. Forti F, Crosta A, Ghisotti D. Pristinamycin-inducible gene regulation inmycobacteria. J Biotechnol 2009;140:270e7.

22. Salah-Bey K, Thompson CJ. Unusual regulatory mechanism for a Streptomycesmultidrug resistance gene, ptr, involving three homologous protein-bindingsites overlapping the promoter region. Mol Microbiol 1995;17:1109e19.

23. Folcher M, Morris RP, Dale G, Salah-Bey-Hocini K, Viollier PH, Thompson CJ.A transcriptional regulator of a pristinamycin resistance gene in Streptomycescoelicolor. J Biol Chem 2001;276:1479e85.

24. Lamb HM, Figgitt DP, Faulds D. Quinupristin/dalfopristin: a review of its use inthe management of serious gram-positive infections. Drugs 1999;58:1061e97.

25. Chow WY, Berg DE. Tn5tac1, a derivative of transposon Tn5 that generatesconditional mutations. Proc Natl Acad Sci U S A 1988;85:6468e72.

26. Judson N, Mekalanos JJ. TnAraOut, a transposon-based approach to identify andcharacterize essential bacterial genes. Nat Biotechnol 2000;18:740e5.

27. Hidalgo AA, Trombert AN, Castro-Alonso JC, Santiviago CA, Tesser BR,Youderian P, Mora GC. Insertions of mini-Tn10 transposon T-POP in Salmonellaenterica sv. typhi. Genetics 2004;167:1069e77.

28. Serina S, Nozza F, Nicastro G, Faggioni F, Mottl H, Deho G, Polissi A. Scanningthe Escherichia coli chromosome by random transposon mutagenesis andmultiple phenotypic screening. Res Microbiol 2004;155:692e701.

29. Snapper SB, Melton RE, Mustafa S, Kieser T, Jacobs Jr WR. Isolation and char-acterization of efficient plasmid transformation mutants of Mycobacteriumsmegmatis. Mol Microbiol 1990;4:1911e9.

30. Grant SG, Jessee J, Bloom FR, Hanahan D. Differential plasmid rescue fromtransgenic mouse DNAs into Escherichia coli methylation-restriction mutants.Proc Natl Acad Sci U S A 1990;87:4645e9.

31. Lampe DJ, Akerley BJ, Rubin EJ, Mekalanos JJ, Robertson HM. Hyperactivetransposase mutants of the Himar1 mariner transposon. Proc Natl Acad Sci U S A1999;96:11428e33.

32. Tufariello JM, Jacobs Jr WR, Chan J. Individual Mycobacterium tuberculosisresuscitation-promoting factor homologues are dispensable for growth in vitroand in vivo. Infect Immun 2004;72:515e26.

33. Sala C, Forti F, Di Florio E, Canneva F, Milano A, Riccardi G, Ghisotti D. Myco-bacterium tuberculosis FurA autoregulates its own expression. J Bacteriol2003;185:5357e62.

34. Bardarov S, Kriakov J, Carriere C, Yu S, Vaamonde C, McAdam RA, Bloom BR,Hatfull GF, Jacobs Jr WR. Conditionally replicating mycobacteriophages:a system for transposon delivery to Mycobacterium tuberculosis. Proc Natl AcadSci U S A 1997;94:10961e6.

35. Kwon YM, Ricke SC. Efficient amplification of multiple transposon-flankingsequences. J Microbiol Methods 2000;41:195e9.

36. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. ColdSpring Harbor Laboratory Press; 1989.

37. Stover CK, de la Cruz VF, Fuerst TR, Burlein JE, Benson LA, Bennett LT, Bansal GP,Young JF, Lee MH, Hatfull GF, et al. New use of BCG for recombinant vaccines.Nature 1991;351:456e60.

38. Kato J, Hashimoto M. Construction of consecutive deletions of the Escherichiacoli chromosome. Mol Syst Biol 2007;3:132.

F. Forti et al. / Tuberculosis 91 (2011) 569e578578

39. Laursen BS, Sorensen HP, Mortensen KK, Sperling-Petersen HU. Initiation ofprotein synthesis in bacteria. Microbiol Mol Biol Rev 2005;69:101e23.

40. Nilsson J, Nissen P. Elongation factors on the ribosome. Curr Opin Struct Biol2005;15:349e54.

41. Malen H, Berven FS, Fladmark KE, Wiker HG. Comprehensive analysis ofexported proteins from Mycobacterium tuberculosis H37Rv. Proteomics2007;7:1702e18.

42. Sherratt DJ, Arciszewska LK, Crozat E, Graham JE, Grainge I. The Escherichia coliDNA translocase FtsK. Biochem Soc Trans 2010;38:395e8.

43. Lamichhane G, Tyagi S, Bishai WR. Designer arrays for defined mutant analysisto detect genes essential for survival of Mycobacterium tuberculosis in mouselungs. Infect Immun 2005;73:2533e40.

44. Carpousis AJ, Luisi BF, McDowall KJ. Endonucleolytic initiation of mRNA decayin Escherichia coli. Prog Mol Biol Transl Sci 2009;85:91e135.

45. Zeller ME, Csanadi A, Miczak A, Rose T, Bizebard T, Kaberdin VR. Quaternarystructure and biochemical properties of mycobacterial RNase E/G. Biochem J2007;403:207e15.

46. Condon C, Putzer H. The phylogenetic distribution of bacterial ribonucleases.Nucleic Acids Res 2002;30:5339e46.

47. Koon N, Squire CJ, Baker EN. Crystal structure of LeuA from Mycobacteriumtuberculosis, a key enzyme in leucine biosynthesis. Proc Natl Acad Sci U S A2004;101:8295e300.

48. de Carvalho LP, Blanchard JS. Kinetic and chemical mechanism of alpha-isopropylmalate synthase from Mycobacterium tuberculosis. Biochemistry2006;45:8988e99.

49. Singh K, Bhakuni V. Cation induced differential effect on structural and func-tional properties of Mycobacterium tuberculosis alpha-isopropylmalate syn-thase. BMC Struct Biol 2007;7:39.

50. Bjornberg O, Rowland P, Larsen S, Jensen KF. Active site of dihydroorotatedehydrogenase A from Lactococcus lactis investigated by chemical modificationand mutagenesis. Biochemistry 1997;36:16197e205.

51. Turnbough Jr CL, Switzer RL. Regulation of pyrimidine biosynthetic geneexpression in bacteria: repression without repressors. Microbiol Mol Biol Rev2008;72:266e300. table of contents.

52. Pan F, Jackson M, Ma Y, McNeil M. Cell wall core galactofuran synthesis isessential for growth of mycobacteria. J Bacteriol 2001;183:3991e8.doi:10.1128/JB.183.13.3991-3998.2001.

53. Zhu H, Zhou HL, Hasman RA, Lou H. Hu proteins regulate polyadenylation byblocking sites containing U-rich sequences. J Biol Chem 2007;282:2203e10.

54. Carroll P, Brown AC, Hartridge AR, Parish T. Expression of Mycobacteriumtuberculosis Rv1991c using an arabinose-inducible promoter demonstrates itsrole as a toxin. FEMS Microbiol Lett 2007;274:73e82.

55. Gerdes K, Christensen SK, Lobner-Olesen A. Prokaryotic toxin-antitoxin stressresponse loci. Nat Rev Microbiol 2005;3:371e82.

56. Marianovsky I, Aizenman E, Engelberg-Kulka H, Glaser G. The regulation of theEscherichia coli mazEF promoter involves an unusual alternating palindrome.J Biol Chem 2001;276:5975e84.

57. Hett EC, Chao MC, Deng LL, Rubin EJ. A mycobacterial enzyme essential for celldivision synergizes with resuscitation-promoting factor. PLoS Pathog2008;4:e1000001.

58. Gao LY, Pak M, Kish R, Kajihara K, Brown EJ. A mycobacterial operon essentialfor virulence in vivo and invasion and intracellular persistence in macrophages.Infect Immun 2006;74:1757e67.

59. Loiseau L, Gerez C, Bekker M, Ollagnier-de Choudens S, Py B, Sanakis Y,Teixeira de Mattos J, Fontecave M, Barras F. ErpA, an iron sulfur (Fe S)protein of the A-type essential for respiratory metabolism in Escherichia coli.Proc Natl Acad Sci U S A 2007;104:13626e31.

60. Marmiesse M, Brodin P, Buchrieser C, Gutierrez C, Simoes N, Vincent V,Glaser P, Cole ST, Brosch R. Macro-array and bioinformatic analyses revealmycobacterial ‘core’ genes, variation in the ESAT-6 gene family and newphylogenetic markers for the Mycobacterium tuberculosis complex. Microbi-ology 2004;150:483e96.

61. Dey A, Verma AK, Chatterji D. Role of an RNA polymerase interacting protein,MsRbpA, from Mycobacterium smegmatis in phenotypic tolerance to rifampicin.Microbiology 2010;156:873e83.

62. Newell KV, Thomas DP, Brekasis D, Paget MS. The RNA polymerase-bindingprotein RbpA confers basal levels of rifampicin resistance on Streptomycescoelicolor. Mol Microbiol 2006;60:687e96.