j popow et al. nature 000 , 1-4 (2014) doi:10.1038/nature13284

J Popow et al. Nature 000, 1-4 (2014) doi:10.1038/nature13284 tRNA maturation relies on RTCB, archease and DDX1 in vitro and in living cells.

Upload: beau-wells

Post on 30-Dec-2015

26 views

Category:

Documents

1 download

Report

Download

Embed Size (px):

DESCRIPTION

tRNA maturation relies on RTCB, archease and DDX1 in vitro and in living cells. J Popow et al. Nature 000 , 1-4 (2014) doi:10.1038/nature13284. - PowerPoint PPT Presentation

TRANSCRIPT

J Popow et al. Nature 000, 1-4 (2014) doi:10.1038/nature13284

tRNA maturation relies on RTCB, archease and DDX1 in vitroand in living cells.

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Vol 453 1 May 2008 doi:10.1038/nature06733 LETTERS

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

1 November 2007 doi:10.1038/nature06221 LETTERS

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

Published in Nature Materials (2016) doi:10.1038/nmat4569

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

GI Motility online (May 2006) | doi:10.1038/gimo12

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

GI Motility online (May 2006) | doi:10.1038/gimo48

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

GI Motility online (May 2006) | doi:10.1038/gimo46

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009

Mucosal Immunology (2013) 6 , 522-534; doi:10.1038/mi.2012.92

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

doi:10.1038/nature05202 LETTERS

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

17 September 2009 doi:10.1038/nature08355 LETTERS

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

DOI: 10.1038/NPHYS3211 Supplementary Information for

DOI: 10.1038/ncomms1280 molecular dynamics of single

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization

DOI: 10.1038/NMAT4204 Supplementary Information...NATURE MATERIALS | . DOI: 10.1038/NMAT4204. , , – – |

doi:10.1038/nature06481 LETTERS

doi:10.1038/nature12886 Neanderthal from the Altai

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling in astrocytes … · 2014-06-25 · nature neuroscience correction notice Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling