jbc.m113.457903 mmp-9 transcription in mouse brain · 5/28/2013 · experiment, the animals were...
TRANSCRIPT
MMP-9 transcription in mouse brain
1
Matrix Metalloproteinase (MMP)-9 transcription in mouse brain induced by fear learning
Krishnendu Ganguly1@
, Emilia Rejmak1, Marta Mikosz
2, Evgeni Nikolaev
1, Ewelina Knapska
2,
Leszek Kaczmarek1@
Laboratory of Neurobiology1, Laboratory of Neurobiology of Emotions
2
Nencki Institute, Pasteur 3, PL-02-093 Warsaw, Poland
*Running title: MMP-9 transcription in mouse brain
@
To whom correspondence should be addressed: Leszek Kaczmarek, Ph.D. & Krishnendu Ganguly,
Ph.D., Laboratory of Molecular Neurobiology, Nencki Institute, 02-093, Warsaw, Pasteur 3, Poland. Tel.:
(858) 784-2770; Fax: (858) 784-2779; E-mail: [email protected]; [email protected]
Key words: Medial Prefrontal Cortex; Hippocampus; Amygdala; Gene Expression; AP-1; Contextual
fear conditioning
Background: Matrix Metalloproteinase -9, is
involved in fear associated memory formation,
wherein transcriptional regulation is poorly
known.
Results: Overexpression and promoter binding
activity of AP-1 factors regulate MMP-9
transcription, preceding elevated enzymatic
activity in mouse brain.
Conclusion: c-Fos and c-Jun AP-1 components
positively regulate MMP-9 transcription in fear
learning.
Significance: The novel tools and approaches in
vivo allowed to explore MMP-9 transcription in
mouse brain.
SUMMARY
Memory formation requires learning based
molecular and structural changes in neurons,
whereas matrix metalloproteinase (MMP)-9 is
involved in the synaptic plasticity by cleaving
extracellular matrix proteins and thus is
associated with learning processes in the
mammalian brain. As the mechanisms of
MMP-9 transcription in the brain are poorly
understood, this study aimed at elucidating
regulation of MMP-9 gene expression in the
mouse brain after fear learning. We show
herein that contextual fear conditioning
markedly increases MMP-9 transcription, fol-
lowed by enhanced enzymatic levels in the three
major brain structures implicated in fear
learning, i.e., the amygdala, hippocampus and
prefrontal cortex. To reveal the role of AP-1
transcription factor in MMP-9 gene expression,
we have used reporter gene constructs with
specifically mutated AP-1 gene promoter sites.
The constructs were introduced into the medial
prefrontal cortex of neonatal mouse pups by
electroporation, and the regulation of MMP-9
transcription was studied after contextual fear
conditioning in the adult animals. Specifically, -
42/-50 and -478/-486 bp AP-1 binding motifs of
mouse MMP-9 promoter sequence have been
found to play a major role in MMP-9 gene
activation. Furthermore, increases in MMP-9
gene promoter binding by the AP-1
transcription factor proteins c-Fos and c-Jun
have been demonstrated in all three brain
structures under investigation. Hence, our
results suggest that AP-1 acts as a positive regu-
lator of MMP-9 transcription in the brain
following fear learning.
Learned fear allows animals to survive in
their natural environment. Three major structures
of the mammalian brain have been implicated in
fear learning, i.e., the prefrontal cortex (PFC),
amygdala (Amy), and hippocampus (Hipp) (1). It
is also known that experience modifies functional
circuits in the brain (2) and that changes in the
morphology of dendritic spines might be involved
in synaptic plasticity related to learning and
memory (3, 4). Notably, synaptic plasticity
involves remodeling of extracellular matrix in the
brain (5-8).
http://www.jbc.org/cgi/doi/10.1074/jbc.M113.457903The latest version is at JBC Papers in Press. Published on May 28, 2013 as Manuscript M113.457903
Copyright 2013 by The American Society for Biochemistry and Molecular Biology, Inc.
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
2
Matrix metalloproteinase (MMP)-9 is
recently extensively studied extracellular
endopeptidase that cleaves extracellular matrix
(ECM) proteins to modulate synaptic plasticity
and thus it has been associated with learning
process in mammalian brain (8-10). Although
MMP-9 expression and activity have been linked
to such brain pathologies as ischemia, gliomas or
epilepsy (11-13), MMP-9 can also modify basic
brain circuitry during contextual fear learning and
long term memory formation (8, 14, 15). Long
lasting forms of synaptic plasticity and long-term
memory formation require new mRNA and protein
synthesis (10, 15). It has been established that
MMP-9 mRNA expression and accumulation are
regulated mainly at the transcriptional level (16,
17), and several transcription factors have been
shown to regulate MMP-9 transcription, including
AP-1 (18), AP-2 (19), Ets-1 (20, 21), c-Myc (22),
NF-κB (23), and Sp1 (18, 23). In particular, AP-1
has been implicated in controlling MMP-9 gene
transcription (10, 24). However, regulation of
neuronal MMP-9 transcription, in particular in
vivo after fear conditioning is virtually unknown.
In the present study we show that fear
conditioning enhanced MMP-9 enzymatic activity
follows its mRNA accumulation in different
mouse brain structures pivotal for fear circuitry.
Furthermore, we show that increased expression of
MMP-9 mRNA is preceded by enhanced
expression of c-Fos and c-Jun, major components
of AP-1 transcription factor that has been
implicated in MMP-9 gene regulation. Moreover,
AP-1 binding was also increased after the training.
Finally, we mutated the promoter sequence of
mouse MMP-9 gene at four proximal AP-1
putative sites by in vitro mutagenesis and then we
introduced all those reporter constructs, by means
of electroporation, into the brains of newly born
mouse pups aiming at the medial prefrontal cortex.
As a result, we have found that two specific AP-1
binding sites in the MMP-9 gene promoter (-42/-
50 and -478/-486) mediate its activation following
fear conditioning. Hence, our data implicate AP-1
as a positive regulator of MMP-9 gene trans-
cription in neurons after fear learning.
EXPERIMENTAL PROCEDURES Subjects. The experiment was performed
on adult, experimentally naive male C57BL/6
mice (25-30 g), supplied by the Nencki Institute
Animal House. For 1 month before the
experiment, the animals were housed in pairs in
standard home cages (23.0 x18.0 x12.5 cm) with
food and water provided ad libitum. The mice
were habituated to the experimenter’s hand for 5
days preceding the experiment. The experiment
was carried out in accordance with the Polish Act
on Animal Welfare, after obtaining specific
permission from the First Warsaw Ethical
Committee on Animal Research. All efforts were
made to minimize the number of animals and their
suffering.
Behavioral procedure. The mice were
randomly divided into two groups (Non-shocked,
NS; Shocked, S). In the behavioral experiments all
animals were habituated for 3 days (one 20-min
session per day) to the experimental room and
marking process. The training was performed in
MedAssociates fear conditioning chambers housed
in a sound attenuating room. In the S group, mice
were put to the experimental cages where, after
180 s of adaptation period, a single foot shock
(US) was delivered (0.7 mA of 50 Hz pulses for 2
sec). Then, after 60 sec, mice were removed from
the experimental cage (25). In the NS group, mice
were merely exposed to the experimental cages for
an equivalent amount of time (242 sec). Then the
mice were sacrificed at 0, 0.5, 2, 6, 12 and 24 h
following the training/exposure. Twelve animals
were used per each experimental group.
Plasmids. Mice MMP-9 gene promoter
fragment -1625/+595 bp, (with first Exon &
Intron, ExIn WT, 2220 bp) and -1625/+19 bp,
(transcription start site, Tss WT, 1644 bp) from
MMP-9 BAC vector (RP23-449M22) replaced in
place of CMV promoter into a p-eGFP-N1. Here,
two PCR steps were conducted by one common
foreword and two different overlapping PCR
primers (RF-ExIn/Tss-F: 5`-
CCTGATTCTGTGGATAACCGTATTAC
CGCCATGCATGCCTTGGCAGTCATGGATGT
GTGTCC-3`: 65.60/62.7
0C; Exin-R: 5`-CTC
GCCCTTGCTCACCATGGTGGCGATATGCCT
GTGGATGGAGGAAGGGGC-3`: 65.80/62.6
0C;
Tss-R: 5`-CTCGCCCTTGCTCACCATGGTGGC
GAGGTGAGGACCGCAGCTTCTGGCTAA-3`:
65.80/62.6
0C; promoter sequence underlined)
followed by DpnI digestion at last step (26). To
enhance the GFP expression from eGFP initiation
codon, point mutations were carried out in ExIn
WT plasmid at Tss of MMP-9 gene by
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
3
phosphorylated (*) primer pair (ExIn M-F: 5`*-
CGGTCCTCACCATCAGTCCCTGGCAG-3`:
65.80C,R:5`*CAGCTTCTGGCTAACGCGCCTT
TGCAGAG-3`: 65.70C). Point mutation in the
core of four AP-1 binding motif of the MMP-9
gene promoter were generated with the site-
directed mutagenesis Kit (Thermo Scientific)
according to the manufacturer's protocol using the
following phosphorylated primer pairs: (AP-1a-F,
5`*-GGCGGGGTCACTGATAACGTTTTACT
GCCTCT-3`: 65.70C, R: 5`*-GCCTCCCCTC
CAGGCTTATGCTGACTCA-3`: 65.80C; AP-1b-
F: 5`*-CACACACACACGCTGAGAAAGCATA
AGCCTGGAGGG-3`:690C, R: 5`*-TGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TGTTTACA-3`: 690C; AP-1c-F: 5`*-
GCCAGGAGAGGAAGCTGAGAAAAAGACTC
TATCAGG-3`: 66.70C, R: 5`*-CTCTGGGAGC
AGGCTCTTTGAGGCAGGATTTG-3`:67.00C;
AP-1d-F: 5`*-GGCACACAGGAGGCTTAGAAA
GAACAGCTTGCTGAAG-3`:67.80C, R: 5`*-
AGACCTTCATGTGCTTCCCAACGAACAGAC
CTGTGAG-3`: 67.8; mutated nucleotides are
underlined). General and HPLC grade
oligonucleotides were synthesized by Genomed
(Poland) and Metabion (Germany) respectively.
All constructs were verified by DNA sequencing
by Genomed (ABI377, Perkin-Elmer).
In vivo-electroporation in P0 mice pups.
The WT-mmp-9-e-GFP promoter and EF-1β-
galactosidase constructs were purified by Endo
Free Plasmid isolation Kit (Qiagen, Hilden,
Germany) and were in vivo electroporated into P0
MMP-9 wild type (WT) mice pups according to
the protocol of Swartz et al. (27). After 1 month
following plasmid delivery, the mice were
randomly divided into 2 groups (S and NS) and
subjected to behavioral training as described
earlier. After 6 hrs the mice were sacrificed, the
brains were fixed and processed for either
immunochemistry or GFP reporter assay. The
immunofluorescence studies were carried out with
anti-GFP specific primary and secondary
antibodies (Santa Cruz biotechnology).
High resolution florescent in-situ
zymography (ISZ). The procedure was essentially
as described by Gawlak et al. (28). The sections
were dewaxed in absolute ethanol (37 °C, two
times, for 5 min and 10 min, respectively).
Afterwards, the alcohol was removed and slices
were hydrated with phosphate buffered saline
(PBS), pH 7.4, and in situ zymography was
performed as follows: the specimens were first
pre-incubated in water at 37 °C for 40 min, and
then overlaid with a fluorogenic substrate DQ
gelatin (Invitrogen/ Molecular Probes, Eugene,
OR, USA) diluted 1:100 in the buffer supplied by
the manufacturer, for 40 min at 37 °C. Then, they
were washed with PBS and fixed in 4% PFA at
room temperature (RT) for 15 min. Next, the
slides were mounted directly in Vectashield
(Vector, Burlingame, CA, USA) (29). The analysis
of gelatinase (green channel) were captured as
single-plane of confocal images at 6-8 Z-stacks,
using a 63X objective (oil immersion; 1.3 NA)
with a zoom factor of six. The settings of
photomultipliers were adjusted to obtain the
maximal dynamic ranges of pixels in each
channel. We designed an optimized program for
all the images as described in image processing
sections of text using macro program and run the
recorded macro program for all the obtained
images within ImageJ software. Using an unbiased
counting frame in each picture, at each time point
we estimated the mean number of objects per unit
area of the tissue, the ratio of the number of
objects to the number of all gelatinolytic-
immunopositive objects, and the mean
fluorescence intensity of the objects, defined as the
product of the mean area of the localizing objects
times the mean brightness. At least four animals
were analyzed at each time point.
Tissue extraction and partial purification
of gelatinase. Brains were rapidly removed, and
the prefrontal cortex, hippocampus and amygdala
were dissected separately on a cold plate. The sets
of samples (S and NS) were suspended in
phosphate-buffered saline
(10 mM phosphate
buffer pH 7.4, 150 mM NaCl) containing protease
inhibitors (Sigma), minced, and incubated for 10
min at 4°C. After centrifugation at 12,000 x g for
15 min,
the supernatant was collected in new
centrifuge tubes marked as PBS extracts. The
pellet was extracted in the lysis buffer (10 mM
Tris-HCl pH 8.0, 150 mM NaCl, 1% Triton X-100
plus protease inhibitors) and centrifuged at
12,000x g for 15 min to obtain the Triton-X (TX)
extract. Tissue extracts were preserved at -70°C
and used later. PBS and TX extracts from all types
of tissue was used for purification of gelatinase.
Briefly, an extract was mixed with gelatin agarose
bead, incubated at 4oC for 1 h followed by
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
4
centrifugation at 1500x g for 5 min. The pellet was
washed twice with PBS through centrifugation at
1500 x g for 5 min and MMP-2 and -9 were eluted
by incubating the pellet with Laemmli’s sample
loading buffer for 10 min at room temperature (14,
29). Samples were equalized on the basis of the
direct protein concentration measurements using
the BCA method (Theremo Scientific).
Gelatin zymography. For assay of MMP-9
and -2 activities, tissue extracts were
electrophoresed in 8% SDS-polyacrylamide gel
containing 1 mg/ml gelatin (Sigma), under non-
reducing conditions. The gels were washed twice
in 2.5% Triton-X-100 (Sigma) and then incubated
in calcium assay buffer (40 mM Tris-HCl, pH 7.4,
0.2 M NaCl, 10 mM CaCl2) for 18 h at 37°C. The
zones of gelatinolytic activity came as negative
staining (14, 28). A variation of gel-zymography
using acrylamide gel copolymerized with 0.4%
fluorescein isothiocyanate (FITC)-labelled gelatin.
This method allows real-time monitoring of
enzymatic activity under UV light and shows
higher sensitivity than Coommassie staining.
Quantification of zymographic bands was done
using densitometry linked to proper software (Lab
Image).
Fluorescent in situ hybridization (FISH)
for MMP-9 mRNA combined with
immunohistochemical staining. The coding
sequence of MMP-9 mRNA (ATG probe) and
3`UTR (UTR probe) were reverse transcribed and
cloned into a pDrive plasmid (Qiagen PCR
cloning kit). Sense and antisense fluorescein
labelled riboprobes were generated from plasmids
with SP6 or T7 polymerase sites. For in situ
hybridization studies, the animals were lethally
anesthetized with sodium pentobarbital and
perfused transcardially with 4% paraformaldehyde
(PFA) in PBS. Brains were removed, post fixed in
the same fixative, cryoprotected with 30% sucrose
and snap-frozen in isopentane cooled on dry ice.
The staining was performed on 40 μm-thick free-
floating sections. Acetylation buffer (0.1 M
triethanolamine, 0.25% HCl, 0.25% acetic
anhydride) was applied for 15 min in RT. Next,
sections were prehybridized for 3 hours in
prehybridization solution (Sigma-Aldrich)
followed by overnight hybridization at 72 °C in
hybridization solution (Sigma-Aldrich) containing
1:1 mix of ATG and UTR sense or antisense
probes. Afterwards, cells were washed in 0.2x
SSC, with first two washes carried out for an hour
in 70°C, then five consecutive washes for 30 min
in RT. After then, TNB blocking solution (TSA
Plus System, Perkin Elmer) was applied for an
hour (30). Cells were incubated with, mouse anti-
MAP-2 antibody (Sigma) 1:200 overnight in 4°C,
washed with PBST and incubated with secondary
antibody, 1:1000 Alexa 488-conjugated anti-
mouse IgG (Invitrogen) and mounted in
vectashield after nuclear specific TO-PRO staining
(Vector Laboratories). Cells were also incubated
with anti-c-Fos and anti-P-c-Jun specific
antibodies (Santa Cruz) 1:200 overnight in 4oC,
washed with PBST and incubated with secondary
antibody, 1: 1000, alexa 488 conjugated anti-
mouse IgG (Invitrogen) and mounted in
vectashield after nuclear specific TO-PRO staining
(Vector Laboratories). Hybridization signal was
amplified with Cy3 TSA plus System (Perkin
Elmer). The analysis of MMP-9 mRNA
localization (red channel) were captured as single-
plane of confocal images of 6-8 Z-stacks, using a
100X objective (oil immersion; 1.3 NA) with a
zoom factor of three. Images were processed as
described previously in “Methods”.
RNA extraction. Total cellular RNA was
extracted with TRIzol reagent according to the
protocol provided by the manufacturer and
quantified by measuring the absorbance at 260nm.
Complementary DNA was synthesized using 1µg
of total RNA from each sample in a 20µl reaction
buffer using Superscript II Reverse Transcriptase
with an oligo (dT)15 primer (-24).
RT-PCR. Complementary DNA was
amplified against forward and reverse primers of
MMP-9 (Foreward, F: 5`-
CTTCTGGCGTGTGAGTTTCC A-3`; Reverse,
R: 5`-ACTGCACGGTTGAAGC AAAGA-3`),
eGFP (F: 5`-GTCCAGGAG CGCACCATCT-3`;
R: 5`-GCTTGTGCCCCAG GATGTT-3`), c-Fos
(F: 5`- TTCCCCAAAC TTCGACCATG-3`; R:
5`-TGTGTTGACAGGAG AGCCCAT-3`), c-Jun
(F: 5`-CATGCTAACGCA GCAGTTGC-3`; R:
5`-ACCCTTGGCTTCAGT ACTCGG-3`) and
GAPDH (F: 5`- TGCCCCCAT GTTTGTGATG-
3`; R: 5`-GGTCATGAGC CCTTCCACAAT-3`)
respectively. The reactions were subjected to
denaturation (94°C for 30 s), annealing (60°C-
61.5°C for 30 s), and extension (72°C for 60 s) for
35 cycles (24, 29,).
The PCR products were
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
5
fractionated on 2 % agarose gels and visualized by
ethidium bromide staining.
Real time. PCR The real time-PCR was
carried out in a 20 μl volume in optical 96 well
reaction plates containing 2 μl cDNA, 10 pmoles
of each primer and 10 μl SYBR green PCR master
mix with Real-Time PCR System 7300 (Applied
Biosystems, CA, USA). Taq-DNA polymerase
activation was done at 95°C for 10 minutes
followed by 40 cycles at 94°C for 30 seconds,
62°C for 30 seconds and 72°C for 30 seconds. A
quantitative measure of MMP-9, GFP and
GAPDH transcription were obtained through
amplification of all cDNA in each sample at
individual time points by MMP-9, GFP and
GAPDH specific primer pairs as described in
previous method. For performing the regulatory
quantitative measure real time PCR were
conducted in AP-1 specific primers (cFos and
cJun) against GAPDH primers as described as
before. The amount of all mRNA expressions were
quantified relative to the total amount of cDNA
was calculated as ΔCt=CtMMP-9/GFP/ cFOS/
cJUN- CtGAPDH where Ct of all genes and
CtGAPDH were fractional cycle number at which
fluorescence generated by reporter dye exceeds
fixed level above baseline for all cDNA
respectively. The changes of relative mRNA
expressions in respective samples were expressed
as ΔCt NS versus ΔCt S values. Relative
expressions in all genes in respective samples
were calculated as 2-ΔΔCt
(-29).
GFP reporter assay. Enhanced green
fluorescent (eGFP) activity was evaluated using
GFP Assay System with Reporter Lysis Buffer
(Biovision) or β-galactosidase assay. We followed
protocols included to these kits. Results were
recorded using Luminometer Model 2030-000
(Turner Biosystems) and presented in ng/μL GFP
as a standardized light intensity which is a relative
value obtained after normalization of β-
galactosidase bioluminescence to GFP
bioluminescence (31).
Immunocytochemistry. Free floating 40
μm brain sections obtained from mice perfused
transcardially with 4% paraformaldehyde were
dipped overnight for permanent fixation, and then
permeabilized in 1×PBS containing 0.1% Triton
X-100. The cultures were blocked with 10%
normal donkey serum for 1 hour at room
temperature and stained with mouse anti-GFP
(Santa Cruz, 1:500), primary antibodies overnight
at 4°C. GFP staining was detected using donkey
anti-mouse AlexaFluor 488 conjugated antibody
(Invitrogen; 1:1000). For binding of secondary
antibody, cultures were incubated for 2 hours at
room temperature. Finally, cell nuclei were stained
with TO-PRO (Vector Laboratories) and examined
by the confocal microscopy (24, 28).
Western blotting. Equal amounts of the
samples were separated by 10% SDS-PAGE
electro-phoresis in Tris-glycine running buffer (25
mM Tris, 250 mM glycine, pH 8.3, 0.1% SDS)
and transferred to a polyvinylidene difluoride
membrane (Millipore) in transfer buffer (48 mM
Tris, 39 mM glycine, 0.037% SDS, 20%
methanol). Membranes were stained with Ponceau
red solution to check for equal protein transfer.
Then, membranes were rinsed and blocked in 5%
non-fat milk/TBST (25 mM Tris–HCl, pH 8.0;
125 mM NaCl; 0.1% Tween 20) for 2 hours at
room temperature. Then, membranes were
incubated with an appropriate primary antibodies,
i.e., GAPDH (Millipore) and β-dystroglycan from
Santa Cruz Biotechnology, diluted 1:300 at 4 °C
overnight, and horseradish peroxidase (HRP)-
conjugated secondary antibody IgG (Vector) was
added at dilution of 1:5000. Results were
developed using ECL PlusTM reagent (Amersham
Biosciences) on an X-ray film (Kodak) (28).
Electrophoretic mobility shift assay
(EMSA). For EMSA probe we used the following
double-stranded oligonucleotide containing the
foot printed AP-1 motif from mouse MMP-9 gene
promoter (AP-1 binding site is underlined):
GCGGGGTCACTGATTCCGTTTTACTGCCT.
We prepared a double-stranded oligonucleotide
probe by annealing equimolar amounts [10 μM] of
complementary singlestranded oligonucleotides in
a solution containing 0.1 M Tris–HCl (pH 7.5), 0.5
M NaCl, 0.05 M EDTA. Oligonucleotides were
placed at 65 °C for 10 min, slowly cooled down to
room temperature and then kept at 4 °C overnight
(-24). Double-stranded oligonucleotides (100 ng)
were end labeled with (Biotinylated probe)
according to the manufacturers protocol (Thermo
scientific) and purified with NucTrap Probe
Purification Columns (Stratagene). Binding
reactions were performed in a 10 μl volume as
described in manufacturer’s instruction (Thermo
Scientific). Immediately before loading on the gel,
the samples were mixed with an ice cold 5xgel
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
6
loading buffer (2xTris–glycine buffer, 50%
glycerol, 0.2% bromophenol blue). Protein-DNA
complexes were resolved by electrophoresis on
nondenaturing 8% polyacrylamide gel in 1xTris–
glycine buffer and were visualized by
chemiluminescence procedure (Thermo
Scientific).
EMSA supershift. For EMSA supershift
assay we used the following antibodies from Santa
Cruz Biotechnology: c-Jun (sc-7481X), c-Fos (sc-
52X), P-c-Jun (sc-48X) and normal rabbit IgG.
Binding reaction was performed as described
previously (32). Immediately before loading of
samples on the gel we add ice cold 5 × gel loading
buffer (2 × Tris–glycine buffer, 50% glycerol,
0.2% bromophenol blue). Double stranded
oligonucleotides (100 ng) were end labeled with
biotinylated probe according to the manufacturers
protocol (Thermo scientific) and purified with
NucTrap Probe Purification Columns (Stratagene).
Protein–DNA complexes were resolved by
electrophoresis on nondenaturating 8%
polyacrylamide gel in 1 × Tris–glycine buffer and
were visualized by chemiluminescence procedure
(Thermo Scientific).
Image processing. For final inspection, the
images were processed using ImageJ program
(http://rsb.info.nih.gov/ij). Quantification of
gelatinase activity was performed using standard
functions of the ImageJ program. Briefly,
multichannel image-stacks were collected at high
resolution (72 nm/pixel), threshold in each
channel, and segmented into individual three-
dimensional objects. These corresponded to the
foci of gelatinolytic activity (green channel) and
the dots of mRNA localization (red channel) from
cell body plus neuropils. The numbers of
individual objects, as well as the total numbers of
objects, and the mean brightness of objects were
counted automatically in three dimensions. In each
animal, four stacks with whole image over the area
of interest including the nucleus were analyzed in
each brain picture, rendering 1200–1400 positive
area/animal (28).
Statistical analyses. Data are presented as
the mean ± SEM. Significance was calculated
using the Student’s Newman`s Keuls test and one
way ANOVA analysis by Graph Pad Instat-3
software (Germany, 29).
RESULTS:
Enhanced MMP-9 activity and subsequent
β-dystroglycan cleavage in the mouse brain are
associated with fear conditioning. To explore
ECM remodeling by gelatinases in the mouse
brain following fear conditioning, we performed
high-resolution fluorescent in situ zymography
(ISZ). This method allows visualization of
structural details up to the resolution limit of the
light microscopy. We used this technique to reveal
and quantify gelatinolytic activity in the brains of
mice exploring novel environment (NS) versus
mice exposed to a footshock in a novel context
(S). The gelatinolytic activity was studied at
different time points following the
training/exposure in the three major brain
structures implicated in fear learning, i.e., the
medial prefrontal cortex, hippocampus and
amygdala (Fig. 1). The gelatinase activity was
observed in the major subdivisions of the
hippocampus, especially in the pyramidal cell
layers of CA1 (middle panel of Fig. 1A) and CA3
and the granule cell layer of the dentate gyrus, DG
(data not shown). Other structures within the
limbic system, such as the medial prefrontal cortex
(mPFC) (upper panel of Fig. 1A) and the
basolateral nucleus of the amygdala (BLA; lower
panel of Fig. 1A) were also found to express
gelatinase activity. The histogram in Fig 1B
depicts that overall gelatinase activity was
significantly increased in the S group in
comparison with the NS group at 2h-12h time
points. It is evident from Fig. 1B that gelatinase
activity was increased by ~15-20 folds at ~2-6 hrs
time points in all investigated subdivisions of the
mouse brain following fear conditioning and then
gradually decreased to the basal level at 24 hrs.
Next, we investigated the enzymatic
activity levels of two major gelatinases, i.e.,
MMP-2 and MMP-9, with gel zymography that
allows deciphering molecular identity of the
enzymes. The results (Fig. 2A) confirmed that fear
conditioning induced an increased gelatinase
activity in all three brain structures under study
and, furthermore, revealed that MMP-9 was the
major inducible enzyme. The quantification of this
result is provided in Fig. 2B. Herein, except for the
prefrontal cortex, in both the NS and S groups the
basal levels of MMP-2 expression and activity
were not changed significantly (Fig. 2A).
Histogram in Fig. 2B reveals that MMP-9
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
7
activities were increased by ~60, 50 and 40 folds
respectively at 2, 6 and 12 hrs, respectively
following fear conditioning.
Furthermore, we used an indirect method
to measure MMP-9 activity, employing its ability
to cleave its native substrate, β-dystroglycan (33).
The cytosolic extracts from both the NS and S
groups of mice were subjected to Western blotting
with β-dystroglycan and GAPDH specific
antibodies. The level of β-dystroglycan cleavage
was higher after fear conditioning (Fig. 2C), in
parallel with enhanced MMP-9 activity (compare
Fig. 2B and 2D). Herein, the β-dystroglycan
cleavage was increased at ~2-12 hrs that paralleled
expression of MMP-9 activity (Fig. 2D). The
overall cleavage of 30 kD molecular weight
product of β-dystroglycan was enhanced by ~4-12
fold at 2-12 hrs and then gradually diminished at
24 hrs (Fig. 2D).
MMP-9 gene expression after fear
conditioning involves AP-1 transcription factor.
To investigate the cellular localization of MMP-9
mRNA expression, NS and S group of mice were
subjected to in situ hybridization at three specific
time points (0, 2 and 24 hrs) with MMP-9 specific
mRNA probe. We observed that the localization of
MMP-9 mRNA was confined to the major
subdivisions of hippocampus, especially in the
pyramidal cell layers of CA1 (middle panel of Fig.
3A). Other structures associated with higher levels
of MMP-9 mRNA localizations were mPFC
(upper panel of Fig. 3A) and the BLA (lower panel
of Fig. 3A). The histogram in Fig 3B depicts that
overall MMP-9 mRNA accumulation was
significantly increased ~15 fold in the S group in
comparison with the NS group at 2 hrs time point.
Next, we asked whether fear learning
affects MMP-9 mRNA levels in the all the above
mentioned areas of brain tissues. With an aid of
real time-PCR approach, we found that fear
conditioning induced a sharp increase of MMP-9
mRNA levels (~15 fold) at 2 hrs, subsequently
followed by a decline at later time period (Fig.
3C). Since AP-1 transcription factor composed of
c-Fos and c-Jun protein has been implicated in
MMP-9 gene regulation (10) we performed also
real time PCR analyses of c-fos and c-jun mRNAs
in both the NS and S groups (Fig. 3C). We found
that expression of both mRNAs was transiently
upregulated by fear training in all three brain
structures investigated at 0.5-2 hrs, thus preceding
the MMP-9 mRNA upregulation.
Structure of the mouse MMP-9 gene and
associated AP-1 regulatory elements. Screening of
the genomic libraries from both UCSC and
ENSEMBL genome browser yielded multiple
BAC clones, one of which (RP23-449M22; 180
kB) was purchased from BACPAC resources
(Oakland, California), contained the entire 7.7-
kilobase gene, as well as ~110 and ~50 kb of the
5` and 3`end flanking regions, respectively. The
transcription initiation site, as determined by
primer extension, revealed a double start site
located 18 and 19 bp upstream of the translated
sequence (data not shown; Fig. 4). There is a
TATA box-like motif TTAAA at positions -25 to -
30 but no CCAAT box prior to transcription start
site (Tss). There are three GC boxes that may
serve as binding sites for the transcription factor
Sp1 (located at positions -57 to 62, -460 to 465,
and -604 to -609). Four AP-1-like binding sites
were also identified (-45 to -52, -83 to -90, -480 to
-487, and -1060 to -1067). Two of those
correspond to similar sequences in the human or
rat gene, but sites corresponding to the first one (-
45 to -52) and the most upstream one have not
been reported in the human or rat gene. The
conserved sequences of AP-1 sites are as follows
(consensus: TGAG(/C)TCA; mouse:
TGATTCCG; rat: TGAGTCAG and human:
TGAATCAG).Four conserved sequence elements
with similarity to the polyoma virus enhancer A-
binding protein-3 sites were found in the 5`
flanking sequence, as well as in the first intron
(Fig. 5). One consensus sequence (5`-
CCCCAGGC-3`) for AP-2 (-596 to -603), several
microsatellite segments of alternating CA residues,
as well as one NF-κB motif (-534 to -542) were
also present. A putative tumor growth factor-b1-
inhibitory element found in the human gene was
absent in the mouse promoter.
The -43/-50 bp and -486/-479 bp motifs of
mouse MMP-9 gene promoter are responsible for
MMP-9 gene promoter activity after fear learning.
To explore the molecular mechanism of MMP-9
transcription in vivo, LacZ reporter gene under
control of EF1α promoter and mouse WT-mmp-9-
e-GFP reporter eGFP were co-electroporated at
equimolar ratio, i.e., 2 µl (3-4 µg/µl) in P0 mice
pups. This approach allows introducing the
transgene into the cortical regions of the mouse
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
8
brain (the medial prefrontal cortex). The mice
were then reared up to one month of age and
groups of mice were subjected to fear conditioning
or cage exposure as mentioned earlier. For
standardization we also incorporated both peGFP-
N1 and reporter MMP-9 BAC in the prefrontal
cortex of mammalian brain and thereafter
subjected the mice to pentylenetetrazole (PTZ)-
evoked seizure episode (see Rylski et al., 2008,
(24); data not shown). Both groups of mice (NS
and S) were sacrificed 2 hrs following fear
conditioning or exposure to the context, and
processed for immunostaining with e-GFP specific
antibody (green) and TOPRO specific nuclear
stain (blue, Fig. 5B). Notably, we did not observe
GFP expression in the NS mice, indicating that
MMP-9 gene promoter was specifically activated
by fear learning. Furthermore, we analyzed the
MMP-9 mRNA levels by RT-PCR and real time
PCR analyses, and observed parallel expression of
mRNAs of both endogenous MMP-9 and
exogenous MMP-9 promoter-driven GFP in vivo
(Fig. 5B & C). The results shown in Fig. 5B
indicate that 2 hours after the training in the S
group, the eGFP mRNA expression was enhanced
~12 fold and was paralleled by the endogenous
MMP-9 mRNA expression in vivo (increased ~14
fold) as compared with the NS group. GAPDH
specific RT-PCR was run as an endogenous
control in the same experiment. In order to explore
the regulatory mechanisms of the MMP-9 gene by
AP-1 transcription factors after fear learning, we
introduced the mutated versions of different
promoter-reporter constructs into the medial
prefrontal cortex of P0 mice pups and subjected
these mice to fear conditioning (Fig. 5D). The
constructs containing exon1 had a mutation in the
ATG initiator codon for translation (ATG-ATC)
allowing translation of the transcript to start from
the ATG methionine initiator codon in the eGFP
gene. Intron 1 was included in some of the
constructs, since it has been shown to contain
enhancer elements. In the NS group, any mutation
of the AP-1 binding site did not change
significantly the MMP-9 gene promoter activity as
compared to its wild type (wt) equivalent. On the
other hand, 2 hours after the training in the S
group, activity of the MMP-9 gene promoter
mutated at -45/-52 bp site (AP-1a) was decreased
significantly by ~75% and mutated at 480/-487 bp
site (AP-1c) was decreased by ~25%, comparing
to its wt counterpart (Fig. 5E). Thus, it appears
that both -43/-50 bp and -486/-479 bp motifs of
MMP-9 gene promoter exert positive influence
onto the activity of the regulatory DNA fragment
during fear conditioning.
Finally, we analyzed, with an aid of an
electrophoretic mobility shift assay (EMSA), the
capacity of protein extracts to bind to the AP-1
specific consensus sequence of MMP-9 gene
promoter. The 5` biotin labeled DNA probe
composed of a sequence encompassing the mice
MMP-9 gene promoter flanking at -43/-50 bp AP-
1 cis-acting element, was incubated with nuclear
protein lysates from the medial prefrontal cortex,
hippocampus and amygdala obtained at 0, 6 and
12 hrs after the behavioral training (Fig. 6A). To
check for the specificity of the bands we
performed the assay in the presence of 10-fold
excess of the unlabelled probe (data not shown).
Since the two uppermost protein-DNA complexes
disappeared in this competition experiment, we
concluded that these bands represented specific
DNA–protein interactions. As a result, we
observed much stronger binding of protein-DNA
complex in the S group than in the NS group at 6-
12 hrs after the training, indicating the DNA
binding activity by AP-1 complexes during MMP-
9 transcription in vivo.
To test whether AP-1 proteins can bind to
the AP-1 binding region
(GCGGGGTCACTGATTCCGTTTTACTGCCT),
we incubated prefrontal cortex, hippocampal and
amygdalar nuclear protein lysates, obtained at 2
hours following footshock, with antibodies
specific against c-Fos, c-Jun and P-c-Jun proteins,
and then subjected for EMSA supershift assay. We
observed strong supershifts with antibodies
directed against both c-Fos and P-c-Jun proteins,
and slighty weaker supershift with anti-c-Jun
antibody (Fig. 6B). The supershifted bands were
not observed when a control antibody was used
(Fig. 6B).
To visualize c-Fos and phosphorylated c-
Jun proteins in the different compartments of the
mouse brain (PFC, Hipp and Amy) and to confirm
induction of its expression after fear conditioning,
we immunostained the brain sections obtained
from the animals 2 hours after Shock and Non
Shock exposures. We have found that both c-Fos
and c-Jun were strongly upregulated 2 hours after
the shock, whereas no noticeable increase in the
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
9
protein level was observed in the Non Shock
group (Fig. 7A and 8A).
After the shock, c-Fos and c-Jun was
expressed mainly throughout the neuronal cell
body layers of the PFC, Hipp and Amy (Fig. 7A
and 8A). Moreover, MMP-9 mRNA distribution in
the Cg1, CA1 and BLA co-localized with both c-
Fos and P-c-Jun proteins, supporting the
hypothesis about MMP-9 transcriptional
regulation by c-Fos and P-c-Jun proteins (Fig. 7B
and 8B).
DISCUSSION In the present study, we established the
fear conditioning-evoked expression pattern of
MMP-9 mRNA and enzyme activity in three
major mouse brain structures implicated in fear
learning. We have identified AP-1 transcription
factor as an important regulator of MMP-9 gene
transcription and, furthermore, we showed that c-
Fos and phosphorylated c-Jun (AP-1 components)
are involved in regulation of MMP-9 expression.
To achieve those results we have applied a
collection of cellular, molecular and behavioral
approaches, including EMSA, EMSA-supershift,
immuno-FISH, as well as in vivo electroporation
coupled gene reporter assay.
We showed that contextual fear
conditioning results in enhanced expression of AP-
1 transcription factor and its components
especially c-Fos and c-Jun proteins, and that
MMP-9 gene expression is activated in AP-1
dependent manner. In consequence, there is
following increase in MMP-9 activity observed in
the same brain areas. Our data strongly support the
notion about the positive influence of AP-1
composed of c-Fos and c-Jun proteins onto MMP-
9 transcription. Notably, we have employed a
novel approach, using gene reporter constructs
introduced into the prefrontal cortex by neonatal
electroporation. This in vivo electroporation
coupled gene reporter assay was, to the best of our
knowledge, used for the first time for in vivo gene
regulation study in learning. The promoter
sequence of mouse MMP-9 gene derived from a
BAC was selectively mutated at four proximal
AP-1 putative sites and the regulation of MMP-9
transcription was studied in the medial prefrontal
cortex after contextual fear conditioning in the
adult animals. As a result, we have found that two
putative AP-1 binding sites (-42/-50 and -478-486)
of the WT-MMP-9 gene promoter are involved in
MMP-9 transcription during learning process.
It has been established that the prefrontal
cortex, hippocampus and amygdala regulate the
formation, extinction and renewal of fear
memories (1, 33-35). However, the molecular
mechanisms underlying synaptic plasticity in these
structures are poorly understood. In particular,
proteolytic activities capable to reorganize
extracellular matrix in those areas have not
sufficiently been explored. Many extracellular
proteases that modulate the turnover of neuronal
extracellular matrix, by cleaving the substrate
proteins, have recently been implicated in fear-
related plasticity (5-8). In the present study we
observed that overall gelatinase activity was
increased in the medial prefrontal cortex,
hippocampus and amygdala after fear
conditioning, in comparison to the animals
exposed to the experimental context but not
subjected to fear conditioning. Furthermore, we
demonstrate that amongst the gelatinases, the gene
expression and enzymatic activity of MMP-9, but
not MMP-2, have been increased.
It has been demonstrated that the local
synthesis, expression and activation of MMP-9
protein in neurons is rapid and may occur already
within minutes after the neuronal stimulation (14,
24, 29, 33, 36). The present study reveals
protracted MMP-9 activation at later time-points.
To explain this phenomenon, we may suggest that
after initial (occurring within minutes) behavioral
training-driven MMP-9 release and loss in the
extracellular space, there is a need for the second
wave of MMP-9 transcription and associated
translation, in order to replenish this lost pool of
the enzyme (7). Considering the available data it
might be of great interest to further pursue a
question whether observed MMP-9 transcription
contributes to consolidation of fear long-term
memory or whether it is a metaplastic change that
impacts on later learning/memory formation.
We found that upregulated MMP-9
enzymatic activity coincided with enhanced β-DG
cleavage. The localization of β-DG in various cell
compartments in the brain, including dendritic
spines, had already been established (37- 39).
Previously, the co-existence of MMP-9 and β-DG
in vivo, by high resolution double immunogold
labeling was demonstrated (33). The subcellular
co-localization of β-DG and MMP-9 is consistent
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
10
with the idea that MMP-9 could be secreted to the
extracellular space, allowing for a focal, MMP-9-
mediated proteolysis of membrane-bound β-DG.
In our present report, we found both the MMP-9
enzymatic activity and β-DG cleavage in Triton X-
100-soluble fraction from all the associated
compartments of the fear-related brain structures,
which might reflect enzymatic activation of a pool
of membrane-bound MMP-9 and cleavage of
membrane bound β-DG substrate.
Earlier ex vivo and in vivo studies revealed
that, in non-stimulated neurons in culture, as well
as in the hippocampus, noticeable levels of the
truncated form of β-DG could be found. These
may be due to basal activity of either MMP-2 or
MMP-9, as both proteases can cleave β-DG (40,
41). Furthermore, of special note from the
previous study (33) is the finding that β-DG
processing is a fast and transient phenomenon as
within 20 min. after the stimulation, a decrease in
the level of the 30-kDa form has been observed.
Herein, in the NS group we demonstrated a mild
enhancement of β-DG cleavage, which was much
lower than that of the S group. This result suggests
that fear conditioning results in excessive β-DG
cleavage (by ~10-15 folds), while exposure to a
novel context evokes less robust synaptic plasticity
and, thus, moderate β-DG cleavage.
To explore the MMP-9 transcriptional
mechanism following fear conditioning, we
isolated the mRNA from both the S and NS groups
and performed real time PCR. We observed that
fear conditioning resulted in an increased
transcription of MMP-9 gene (but not MMP-2
gene) as soon as 2 hrs after the training. Moreover,
we found that transcription of c-Fos and c-Jun
preceded MMP-9 transcription in vivo supporting
an idea that AP-1 transcription factor may play a
role in MMP-9 gene regulation in activated
neurons (10). To confirm that indeed AP-1
regulates MMP-9 gene transcription after fear
conditioning, we have applied various approaches
in vivo, including EMSA and eGFP-reporter assay
after neonatal brain electroporation driven
incorporation of WT and mutated versions of AP-
1 motifs of mouse MMP-9 gene. The results of
our study strongly support a notion of positive
influence of AP-1 transcription factor, possibly
composed of c-Fos and c-Jun proteins, on the
MMP-9 gene transcription. Both positive and
negative transcriptional regulations of MMP-9
gene by AP-1 complex were shown before in
various cell types under physiological and
pathological conditions (24, 42, 43). However, the
present study provides novel findings about the
positive regulation of MMP-9 in a context of
physiological neuronal plasticity, i.e., during fear
learning.
In the mouse MMP-9 gene regulatory
regions we have identified four functional AP-1
binding motifs that are located at positions at -45
to -52, -83 to -90, -480 to -487, and -1060 to -1067
upstream the transcription start site. In this report,
we individually and in different combinations
mutated all the above mentioned AP-1 motifs by
in vitro mutagenesis and thereafter electroporated
them in the medial prefrontal cortical neurons in
P0 pups in vivo. The in vivo promoter activation
data, as evidenced from the GFP reporter assay,
revealed that after fear conditioning mainly the -45
to -52 motif and moderately at -480 to -487 motif,
but not in the -83 to -90 and -1060 to -1067 AP-1
motifs drove MMP-9 gene activation. This is a
controversial finding, as the other motifs of AP-1,
especially the -88/81 motif, were previously
shown to positively affect MMP-9 gene promoter
activity (both basal and/or inducible) in various
cells (44-46). Although opposite results were also
reported (20, 47, 48). Importantly, it has also been
noted that the AP-1 binding motif is essential for
passive (24, 49-51) and active (52) regulation on
MMP-9 gene transcriptional repression. Our
results are novel because they indicate that AP-1
positively induces MMP-9 gene transcription
following fear conditioning. Furthermore, they
provide the first indication of AP-1 dependent
activation of MMP-9 gene transcription in neurons
in vivo in mammalian brain after behavioral
training. It shall be also noted that mutation of all
four putative AP-1 binding sites in the MMP-9
gene regulatory region did not abolish entirely the
fear conditioning-evoked gene expression,
suggesting that other than AP-1 transcription
factors play a role in this learning.
Previously, Rylski et al. (24) showed the
repressive influence of the AP-1 motif onto MMP-
9 gene expression after seizure induced by PTZ or
kainate in rats. We hypothesize that various
putative AP-1 motifs in MMP-9 promoter might
be essential for a fine tuning (activation or
repression) of MMP-9 gene transcription at
different physiological and pathological
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
11
conditions. Since variable ratios of Fos-Jun
dimeric complexes are needed in those conditions,
they might regulate MMP-9 transcription to affect
synaptic plasticity.
In conclusion, the observations reported
herein show that MMP-9 gene transcription and
associated proteolytic activity following fear
conditioning depends on the tight regulation and
fine tuning by the AP-1 transcription factor.
Enhanced expression of c-Fos and c-Jun dimeric
AP-1 protein complex positively regulates MMP-9
transcription during contextual fear learning. This
is the first indication of AP-1 dependent activation
of MMP-9 gene transcription in neurons during
learning and memory formation in mammalian
brain. The present results contribute to a growing
body of evidence that MMP-9 plays crucial roles
in physiological synaptic plasticity. Furthermore,
our data also decipher the molecular mechanism of
the MMP-9 gene transcription in the brain
structures involved in fear learning in a
physiological context.
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
12
REFERENCES
1. Maren S. (2011) Seeking a spotless mind: Extinction, deconsolidation, and erasure of fear
memory. Neuron 70, 830–845
2. Chklovskii DB. (2004) Synaptic connectivity and neuronal morphology: two sides of the same
coin. Neuron 43, 609-617
3. Holtmaat A, Svoboda K. (2009) Experience-dependent structural synaptic plasticity in the
mammalian brain. Nat Rev Neurosci 10, 647-658
4. Holtmaat A, Wilbrecht L, Knott GW, Welker E, Svoboda K. (2006) Experience-dependent
and cell-type-specific spine growth in the neocortex. Nature 441, 979-983
5. Dityatev A, Schachner M, Sonderegger P. (2010) The dual role of the extracellular matrix in
synaptic plasticity and homeostasis. Nat Rev Neurosci 11, 735-746
6. Pizzorusso T, Medini P, Berardi N, Chierzi S, Fawcett JW, Maffei L. (2002) Reactivation of
ocular dominance plasticity in the adult visual cortex. Science 298, 1248-1251
7. Rivera S, Khrestchatisky M, Kaczmarek L, Rosenberg GA, Jaworski DM. (2010) Metzincin
proteases and their inhibitors: foes or friends in nervous system physiology? J Neurosci 30, 15337–
15357
8. Huntley GW. (2012) Synaptic circuit remodelling by matrix metalloproteinases in health and
disease. Nat Rev Neurosci 13, 743-57
9. Sternlicht MD, Werb Z. (2001) How matrix metalloproteinases regulate cell behavior. Annu
Rev Cell Dev Biol 17, 463-516
10. Kaczmarek L, Lapinska-Dzwonek J, Szymczak S. (2002) Matrix metalloproteinases in the
adult brain physiology: a link between c-Fos, AP-1 and remodeling of neuronal connections? EMBO
J 21, 6643-6648
11. Asahi M, Asahi K, Jung JC, del Zoppo GJ, Fini ME, Lo EH. (2000) Role for matrix
metalloproteinase 9 after focal cerebral ischemia: effects of gene knockout and enzyme inhibition
with BB-94. J Cereb Blood Flow Metab 20, 1681-1689
12. Gu Z, Kaul M, Yan B, Kridel SJ, Cui J, Strongin A, Smith JW, Liddington RC, Lipton SA.
(2002) S-nitrosylation of matrix metalloproteinases: signaling pathway to neuronal cell death.
Science 297, 1186-1190
13. Wilczynski GM, Konopacki FA, Wilczek E, Lasiecka Z, Gorlewicz A, Michaluk P,
Wawrzyniak M, Malinowska M, Okulski P, Kolodziej LR, Konopka W, Duniec K, Mioduszewska
B, Nikolaev E, Walczak A, Owczarek D, Gorecki DC, Zuschratter W, Ottersen OP, Kaczmarek L.
(2008) Important role of matrix metalloproteinase 9 in epileptogenesis. J Cell Biol 180, 1021-1035
14. Nagy V, Bozdagi O, Matynia A, Balcerzyk M, Okulski P, Dzwonek J, Costa RM, Silva AJ,
Kaczmarek L, Huntley GW. (2006) Matrix metalloproteinase-9 is required for hippocampal late-
phase long-term potentiation and memory. J Neurosci 26, 1923-1934
15. Kaczmarek L. (1993) Molecular biology of vertebrate learning: is c-fos a new beginning? J
Neurosci Res 34, 377–381
16. Van den Steen PE, Dubois B, Nelissen I, Rudd PM, Dwek RA, Opdenakker G. (2002)
Biochemistry and molecular biology of gelatinase B or matrix metalloproteinase-9 (MMP-9). Crit
Rev Biochem Mol Biol 37, 375-536
17. Chakraborti S, Mandal M, Das S, Mandal A, Chakraborti T. (2003) Regulation of matrix
metalloproteinases: an overview. Mol Cell Biochem 253, 269-285
18. Sato H, Seiki M. (1993) Regulatory mechanism of 92 kDa type IV collagenase gene
expression which is associated with invasiveness of tumor cells. Oncogene 8, 395–405
19. Sivak JM, West-Mays JA, Yee A, Williams T, Fini ME. (2004) Transcription factors Pax6
and AP-2alpha interact to coordinate corneal epithelial repair by controlling expression of matrix
metalloproteinase gelatinase B. Mol Cell Biol 24, 245–257
20. Himelstein BP, Lee EJ, Sato H, Seiki M, Muschel RJ. (1998) Tumor cell contact mediated
transcriptional activation of the fibroblast matrix metalloproteinase-9 gene: involvement of multiple
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
13
transcription factors including Ets and an alternating purine-pyrimidine repeat. Clin Exp Metastasis
16, 169-177
21. Eberhardt W, Schulze M, Engels C, Klasmeier E, Pfeilschifter J. (2002) Glucocorticoid-
mediated suppression of cytokine-induced matrix metalloproteinase-9 expression in rat mesangial
cells: involvement of nuclear factor-kappaB and Ets transcription factors. Mol Endocrinol 16, 1752–
1766
22. Magid R, Murphy TJ, Galis ZS. (2003) Expression of matrix metalloproteinase-9 in
endothelial cells is differentially regulated by shear stress. Role of c-Myc. J Biol Chem 278, 32994–
3299923
23. Sato H, Kita M, Seiki M. (1993) v-Src activates the expression of 92-kDa type IV collagenase
gene through the AP-1 site and the GT box homologous to retinoblastoma control elements: A
mechanism regulating gene expression independent of that by inflammatory cytokines. J Biol Chem
268, 23460–23468
24. Rylski M, Amborska R, Zybura K, Michaluk P, Bielinska B, Konopacki FA, Wilczynski
GM, Kaczmarek L. (2009) JunB is a repressor of MMP-9 transcription in depolarized rat brain
neurons. Mol Cell Neurosci. 40, 98-110
25. Knapska E, Nikolaev E, Boguszewski P, Walasek G, Blaszczyk J, Kaczmarek L, Werka T.
(2006) Between-subject transfer of emotional information evokes specific pattern of amydala
activation. Proc Natl Acad Sci 103, 3858-3862
26. Van den Ent F and Jan Lowe J. (2006) RF cloning: A restriction-free method for inserting
target genes into plasmids. Biochem Biophys Methods 67, 67–74
27. Swartz M, Eberhart J, Mastick GS, Krull CE. (2001) Sparking new frontiers: using in vivo
electroporation for genetic manipulations. Dev Biol 233, 13-21
28. Gawlak M, Górkiewicz T, Gorlewicz A, Konopacki FA, Kaczmarek L, Wilczynski GM.
(2009) High resolution in situ zymography reveals matrix metalloproteinase activity at glutamatergic
synapses. Neuroscience 158, 167-176
29. Ganguly K, Swarnakar S. (2012) Chronic gastric ulceration causes matrix metalloproteinases-
9 and -3 augmentation: Alleviation by melatonin. Biochimie 94, 2687-2698
30. Dziembowska M, Milek J, Janusz A, Rejmak E, Romanowska E, Gorkiewicz T, Tiron A,
Bramham CR, Kaczmarek L. (2012) Activity dependent local translation of matrix
metalloproteinase-9. J Neurosci 32, 14538-14547
31. Dean KM and Grayhack EJ. (2012) RNA-ID, a highly sensitive and robust method to identify
cis-regulatory sequences using superfolder GFP and a fluorescence-based assay. RNA18, 2335-2344
32. Kaminska B, Kaczmarek L, Chaudhuri A. (1996) Visual stimulation regulates the expression
of transcription factors and modulates the composition of AP-1 in visual cortex. J Neurosci 16,
3968–3978
33. Michaluk P, Kolodziej L, Mioduszewska B, Wilczynski GM, Dzwonek J, Jaworski J, Gorecki
DC, Ottersen OP, Kaczmarek L. (2007) Beta-dystroglycan as a target for MMP-9, in response to
enhanced neuronal activity. J Biol Chem 282,16036-16041
34. Kim JJ, Fanselow MS, DeCola JP, Landeira-Fernandez J. (1992) Selective impairment of
long-term but not short-term conditional fear by the N-methyl-D-aspartate antagonist APV. Behav
Sci 106, 591-596
35. Phillips RG, LeDoux JE. (1992) Differential contribution of amydala and hippocampus to
cued and contextual fear conditioning. Behav Neurosci 106, 274-285
36. Knapska E, Macias M, Mikosz M, Nowak A, Owczarek D, Wawrzyniak M, Pieprzyk M,
Cymerman IA, Werka T, Sheng M, Maren S, Jaworski J, Kaczmarek L. (2012) Functional anatomy
of neural circuits regulating fear and extinction. Proc Natl Acad Sci 109, 17093-17098
37. Wang XB, Bozdagi O, Nikitczuk JS, Zhai ZW, Zhou Q, Huntley GW. (2008) Extracellular
proteolysis by matrix metalloproteinase-9 drives dendritic spine enlargement and long-term
potentiation coordinately. Proc Natl Acad Sci 105, 19520-19525
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
14
38. Zaccaria ML, Di Tommaso F, Brancaccio A, Paggi P, Petrucci TC. (2001) Dystroglycan
distribution in adult mouse brain: a light and electron microscopy study. Neuroscience 104, 311–324
39. Cavaldesi M, Macchia G, Barca S, Defilippi P, Tarone G, Petrucci TC. (1999) Association of
the dystroglycan complex isolated from bovine brain synaptosomes with proteins involved in signal
transduction. J Neurochem 72, 1648-1655
40. Agrawal S, Anderson P, Durbeej M, van Rooijen N, Ivars F, Opdenakker G, Sorokin LM.
(2006) Dystroglycan is selectively cleaved at the parenchymal basement membrane at sites of
leukocyte extravasation in experimental autoimmune encephalomyelitis. J Exp Med 203, 1007-1019
41. Zhong D, Saito F, Saito Y, Nakamura A, Shimizu T, Matsumura K. (2006) Characterization of
the protease activity that cleaves the extracellular domain of beta-dystroglycan. Biochem Biophys
Res Commun 345, 867-871
42. Deschamps AM, Spinale FG. (2006) Pathways of matrix metalloproteinase induction in heart
failure: bioactive molecules and transcriptional regulation. Cardiovasc Res 69, 666-676
43. Yan C, Boyd DD. (2007) Regulation of matrix metalloproteinase gene expression. J Cell
Physiol 211, 19–26
44. Ma Z, Shah RC, Chang MJ, Benveniste EN. (2004) Coordination of cell signaling, chromatin
remodeling, histone modifications, and regulator recruitment in human matrix metalloproteinase 9
gene transcription. Mol Cell Biol 24, 5496–5509
45. Ray A, Bal BS, Ray BK. (2005) Transcriptional induction of matrix metalloproteinase-9 in the
chondrocyte and synoviocyte cells is regulated via a novel mechanism: evidence for functional
cooperation between serum amyloid A-activating factor-1 and AP-1. J Immunol 175, 4039–4048
46. Taheri F, Bazan HE. (2007) Platelet-activating factor overturns the transcriptional repressor
disposition of SP1 in the expression of MMP-9 in human corneal epithelial cells. Invest Ophthalmol
Vis Sci 48, 1931–1941
47. Farina AR, Tacconelli A, Vacca A, Maroder M, Gulino A, Mackay AR. (1999)
Transcriptional up-regulation of matrix metalloproteinase-9 expression during spontaneous epithelial
to neuroblast phenotype conversion by SK-N-SH neuroblastoma cells, involved in enhanced
invasivity, depends upon GT-box and nuclear factor kappaB elements. Cell Growth Differ 10, 353–
367
48. Yang JQ, Zhao W, Duan H, Robbins ME, Buettner GR, Oberley LW, Domann FE. (2001) v-
Ha-RaS oncogene upregulates the 92-kDa type IV collagenase (MMP-9) gene by increasing cellular
superoxide production and activating NF-kappaB. Free Radic Biol Med 31, 520–529
49. Moon SK, Kang SK, Kim CH. (2006) Reactive oxygen species mediates disialoganglioside
GD3-induced inhibition of ERK1/2 and matrix metalloproteinase-9 expression in vascular smooth
muscle cells. FASEB J 20, 1387–1395
50. Moon SK, Kim HM, Kim CH. (2004) PTEN induces G1 cell cycle arrest and inhibits MMP-9
expression via the regulation of NF-kappaB and AP-1 in vascular smooth muscle cells. Arch
Biochem Biophys 421, 267–276
51. Nair RR, Solway J, Boyd DD. (2006) Expression cloning identifies transgelin (SM22) as a
novel repressor of 92-kDa type IV collagenase (MMP-9) expression. J Biol Chem 281, 26424–26436
52. Crowe DL, Brown TN. (1999) Transcriptional inhibition of matrix metalloproteinase 9
(MMP-9) activity by a c-fos/estrogen receptor fusion protein is mediated by the proximal AP-1 site
of the MMP-9 promoter and correlates with reduced tumor cell invasion. Neoplasia 1, 368–372
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
15
FOOTNOTES *This work was supported by the Foundation for Polish Science Programmes Homing (K.G.) and TEAM
(L.K.) Programs. 2To whom correspondence may be addressed: Leszek Kaczmarek, Ph.D., Krishnendu Ganguly, Ph.D.,
Laboratory of Molecular Neurobiology, Nencki Institute, 02-093, Warsaw, Pasteur 3, Poland. Tel.: (858)
784-2770; Fax: (858) 784-2779; E-mail: [email protected]; [email protected] 3The abbreviations used are: Medial Prefrontal Cortex, mPFC; Hippocampus, Hipp; Amygdala, Amy;
Cornu Ammonis, CA: Basolateral amygdala, BLA; Matrix metalloproteinase, MMP; Dystroglycan, DG;
Green fluorescent protein, GFP; Cytomegalovirus, CMV; WT, wild type; restriction free, RF; Non-
shocked, NS; Shocked, S; Transcription start site, Tss; Exon Intron, ExIn; Electrophoretic mobility shift
assay, EMSA.
FIGURE LEGENDS:
FIGURE 1. Contextual fear conditioning induces gelatinase activity in the mouse brain. The coronal
brain sections were processed for high resolution in situ zymography. (A) Overall gelatinase activity
(green) in the mPFC of the prefrontal cortex, the cornu amonis (CA1) field of the hippocampus and the
basolateral amygdala (BLA) of amygdala in the NS and S groups at 0, 0.5, 2, 6, 12 and 24 hrs after the
training. Scale bar: 25 μM. The gelatinase activities are localized all over the neuronal cells including
soma, axon, and dendrites and in extracellular matrix of the tissue. (B) The histogram shows fold changes
of gelatinase intensity from the soma, axon and dendrites of the mPFC, CA1 and BLA at 0, 0.5, 2, 6, 12
and 24 hrs following the training in the S and NS groups. Gelatinase intensity was measured by ImageJ
software from the above photomicrographs and two other representatives from the independent
experiments. Results are reported as the means ± SEM, *p<0.01 compared to the value at 0 hrs of NS
group.
FIGURE 2. Contextual fear conditioning induces MMP-9 activity and associated β-dystroglycan
cleavage in the mouse brain. (A) The figure shows MMP-9 and -2 activities in the prefrontal cortex,
hippocampus and amygdala at different time points following the training in the NS and S groups. (B)
Quantified MMP-9 activity (shown on panel A). (C) The figure shows cleavage products of β-
dystroglycan in the prefrontal cortex, hippocampus and amygdala at different time points following the
training in the NS and S groups. (D) The histogram shows fold changes of 30 kDa cleavage products of
the mPFC, CA1 and BLA at 0, 0.5, 2, 6, 12 and 24 hrs following the training in the NS and S groups.
Activities are measured by Image QUANT designed densitometry values from the above
photomicrograph and two other representatives from the independent experiments. Results are reported as
the means ± SEM, *p<0.01 compared to the value at 0 hrs of NS group.
FIGURE 3. MMP-9 mRNA expression follows AP-1 transcription after fear conditioning . (A) The
figure shows MMP-9 mRNA localization (in red), MAP-2 (in green) and nucleus (in blue) in the medial
prefrontal cortex, hippocampus and amygdala at different time points following the training in the NS and
S groups. Scale bar: 25 μM. (B) Quantified MMP-9 activity (shown on panel A). (C) Graphical
representations of the results of Real Time-PCR analysis of c-Fos, c-Jun and MMP-9 mRNA relative to
GAPDH mRNA in the prefrontal cortex, hippocampus and amygdala where 2-ΔΔCt
values were plotted
against a cycle number in the NS and S groups. Results are reported as the means ± SEM, *p<0.001
compared to the value at 0 hrs of NS group.
FIGURE 4. Structure of the mouse MMP-9 gene and location of AP-1 motifs in promoter sequence. The
schematic diagram shows entire mouse MMP-9 gene (15.5 kb), 5` flanking regions (~15 kb) and 3`
flanking regions (5kb) contained in the mouse MMP-9 BAC clone. The exons of the gene are depicted by
black boxes, numbered from the 5`-end, and the introns and flanking sequences are shown by a solid line.
Scale in kilo bases is shown. The bent arrow indicates the transcription initiation site. The numbering of
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
16
nucleotides starts at the transcription initiation site. The TATA motif, GC boxes, AP-1-like, AP2,
polyoma virus enhancer A-binding protein-3, and NF-kB binding consensus sequences are boxed.
Alternating CA-rich sequences are underlined. Mouse MMP-9 gene promoter fragment -1625/+595 bp,
(with first Exon & Intron, ExIn WT, 2220 bp) and -1625/+19 bp (transcription start site, Tss WT, 1644
bp) from MMP-9 BAC vector (RP23-449M22) were put in place of CMV promoter into a p-eGFP-N1
plasmid by restriction free (RF) cloning. In the core of AP-1 binding motif (blue marked 8bp region) of
the MMP-9 gene promoter AA sites were replaced by site-directed mutagenesis according to the
manufacturer's protocol using the phosphorylated primer pairs.
FIGURE 5. MMP-9 gene activity is associated with -43/-50 bp and -486/-479 bp motifs during fear
learning. (A) The WT and mutated versions of the MMP-9-reporter GFP plasmid and β-gal plasmids
were co-electroporated in the medial prefrontal cortex (PFC) of P0 pups by means of electroporation.
Mice harvesting the WT and control plasmids were kept alive upto 1 month. After 1 month of plasmid
delivery, the mice were randomly divided into two groups (S and NS) and subjected to behavioral training
as described earlier. (B) Fluorescent microscope photomicrographs show the neurons with eGFP reporter
protein expression (green) and TO-PRO (blue) in the S and NS groups in the medial prefrontal cortex in
vivo at 20X and 63X zoom respectively. Scale bar: 50 μM and 10 μM, respectively. (C) The figure shows
the results of the RT-PCR analysis where expression of endogenous MMP-9, GAPDH mRNA and
exogenous eGFP mRNA was investigated in the medial prefrontal cortical neurons following fear
conditioning. For each time point RNA samples were obtained from 2 different experiments and mixed
together. RT-PCR reaction was repeated in duplicate. (D) Quantification of the RT-PCR analysis of RNA
isolated from the medial prefrontal cortex from the NS and S groups. Equal concentrations (0.6μg) of
cDNA were used for RT-PCR analysis of MMP-9 and GFP specific mRNA probe relative to GAPDH
specific mRNA probe. (E) The medial prefrontal cortex of P0 pups were electroporated with different
combinations of WT and mutated versions (with AP-1 motifs) of mouse MMP-9 GFP reporter plasmid
and β-gal plasmid with EF1 promoter and were harvested after one month. (F) The histogram shows
MMP-9 gene promoter activity in the medial prefrontal cortex of the S and NS animals which were
previously co-electroporated with combination of a WT or mutated versions of the reporter plasmids
bearing eGFP gene under control of a wild type MMP-9 mouse gene along with β-gal plasmid under
control of EF-1 promoter. The brains were harvested after 2 hours following the training/exposure and
subjected to GFP assay. Results are reported as the means ± SEM, *p<0.001 versus the NS group.
FIGURE 6. Increased binding of nuclear c-Fos and P-c-Jun proteins at AP-1 cis-element of MMP-9
promoter during fearlearning. The figure showing EMSA assay, where in vitro binding of mouse nuclear
extracts from (A) the prefrontal cortex, hippocampus and amygdala to the consensus AP-1 binding motif
at -43/-50 bp of MMP-9 gene promoter depends on the training conditions being strongly enhanced by
fear conditioning. The binding of proteins extracted from the unstimulated novel cage exposure in NS
group of mice shown in a lane marked as the NS whereas, animals exposed to foot shock is shown in the
lane marked as S at respective time points. In the competition reaction, 15-fold excess of the cold, wild
type probe was used. (B) EMSA supershift assay was done after 2 hours of post shock revealed
significantly stronger binding of hippocampal AP-1 components (c-Fos and P-c-Jun) to the −43/-50 bp
region of mouse MMP-9 gene promoter. Control is run as a “panjun specific Isotype antibody” detecting
all AP-1 components in EMSA supershift reaction. The specific band is designated as “AP-1” which is
specifically formed due to the DNA fragment interaction with AP-1 components and the supershifted
band is marked by the arrow specified as “SS”.
FIGURE 7. The expression of c-Fos protein enhances the transcription of MMP-9 in mouse brain. The
prefrontal cortex (PFC), hippocampus (Hipp) and amygdala (Amy) of mouse brain 2 hours after
contextual fear conditionin (S) and exposure to the experimental cage (NS). Induction of c-Fos expression
is limited mostly to the neuronal cell nuclei and overlaps with a distribution of MMP-9 mRNA. (A)
Immunohistochemical staining of c-Fos with a distribution of MMP-9 mRNA, showed in green and red
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
17
respectively, in the mouse PFC, Hipp and Amy cell nuclei in the NS and S groups. Cell nuclei are stained
with TO-PRO (in blue). Scale bar equals 1 mm. (B) 2 hrs after the training, c-Fos expression overlaps
with MMP-9 mRNA in the Cg1, CA1 and BLA of the mouse brain in the NS and S groups.
Immunohistochemical staining for c-Fos (in green) and in situ hybridization for MMP-9 mRNA (in red)
were performed in the same brain section. Cell nuclei are stained with TO-PRO (in blue). Scale bar equals
10 μm.
FIGURE 8. Expression of P-c-Jun protein enhances the transcription of MMP-9 in the mouse brain. The
prefrontal cortex (PFC), hippocampus (Hipp) and amygdala (Amy) of mouse brain 2 hours after
contextual fear conditioning (S) and exposure to the experimental cage (NS). Induction of P-c-Jun
expression is limited mostly to the neuronal cell nuclei and overlaps with a distribution of MMP-9
mRNA. (A) Immunohistochemical staining of P-c-Jun with a distribution of MMP-9 mRNA, showed in
green and red respectively, is induced in the PFC, Hipp and Amy cell nuclei in the NS and S groups. Cell
nuclei are stained with TO-PRO (in blue). Scale bar equals 1 mm. (B) 2 hrs after the training, P-c-Jun
expression overlaps with MMP-9 mRNA in the Cg1, CA1 and BLA of the mouse brain in the NS and S
groups. Immunohistochemical staining for P-c-Jun (in green) and in situ hybridization for MMP-9 mRNA
(in red) were performed in the same brain section. Cell nuclei are stained with TO-PRO (in blue). Scale
bar equals 10 μm.
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
18
FIGURE 1
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
19
FIGURE 2
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
20
FIGURE 3
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
21
FIGURE 4
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
22
FIGURE 5
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
23
FIGURE 6
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
24
FIGURE 7
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
MMP-9 transcription in mouse brain
25
FIGURE 8
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from
and Leszek KaczmarekKrishnendu Ganguly, Emilia Rejmak, Marta Mikosz, Evgeni Nikolaev, Ewelina Knapska
learningMatrix Metalloproteinase (MMP)-9 transcription in mouse brain induced by fear
published online May 28, 2013J. Biol. Chem.
10.1074/jbc.M113.457903Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on Decem
ber 6, 2020http://w
ww
.jbc.org/D
ownloaded from