MMP-9 transcription in mouse brain

1

Matrix Metalloproteinase (MMP)-9 transcription in mouse brain induced by fear learning

Krishnendu Ganguly1@

, Emilia Rejmak1, Marta Mikosz

2, Evgeni Nikolaev

1, Ewelina Knapska

2,

Leszek Kaczmarek1@

Laboratory of Neurobiology1, Laboratory of Neurobiology of Emotions

2

Nencki Institute, Pasteur 3, PL-02-093 Warsaw, Poland

*Running title: MMP-9 transcription in mouse brain

@

To whom correspondence should be addressed: Leszek Kaczmarek, Ph.D. & Krishnendu Ganguly,

Ph.D., Laboratory of Molecular Neurobiology, Nencki Institute, 02-093, Warsaw, Pasteur 3, Poland. Tel.:

(858) 784-2770; Fax: (858) 784-2779; E-mail: l.kaczmarek@nencki.gov.pl; k.ganguly@nencki.gov.pl

Key words: Medial Prefrontal Cortex; Hippocampus; Amygdala; Gene Expression; AP-1; Contextual

fear conditioning

Background: Matrix Metalloproteinase -9, is

involved in fear associated memory formation,

wherein transcriptional regulation is poorly

known.

Results: Overexpression and promoter binding

activity of AP-1 factors regulate MMP-9

transcription, preceding elevated enzymatic

activity in mouse brain.

Conclusion: c-Fos and c-Jun AP-1 components

positively regulate MMP-9 transcription in fear

learning.

Significance: The novel tools and approaches in

vivo allowed to explore MMP-9 transcription in

mouse brain.

SUMMARY

Memory formation requires learning based

molecular and structural changes in neurons,

whereas matrix metalloproteinase (MMP)-9 is

involved in the synaptic plasticity by cleaving

extracellular matrix proteins and thus is

associated with learning processes in the

mammalian brain. As the mechanisms of

MMP-9 transcription in the brain are poorly

understood, this study aimed at elucidating

regulation of MMP-9 gene expression in the

mouse brain after fear learning. We show

herein that contextual fear conditioning

markedly increases MMP-9 transcription, fol-

lowed by enhanced enzymatic levels in the three

major brain structures implicated in fear

learning, i.e., the amygdala, hippocampus and

prefrontal cortex. To reveal the role of AP-1

transcription factor in MMP-9 gene expression,

we have used reporter gene constructs with

specifically mutated AP-1 gene promoter sites.

The constructs were introduced into the medial

prefrontal cortex of neonatal mouse pups by

electroporation, and the regulation of MMP-9

transcription was studied after contextual fear

conditioning in the adult animals. Specifically, -

42/-50 and -478/-486 bp AP-1 binding motifs of

mouse MMP-9 promoter sequence have been

found to play a major role in MMP-9 gene

activation. Furthermore, increases in MMP-9

gene promoter binding by the AP-1

transcription factor proteins c-Fos and c-Jun

have been demonstrated in all three brain

structures under investigation. Hence, our

results suggest that AP-1 acts as a positive regu-

lator of MMP-9 transcription in the brain

following fear learning.

Learned fear allows animals to survive in

their natural environment. Three major structures

of the mammalian brain have been implicated in

fear learning, i.e., the prefrontal cortex (PFC),

amygdala (Amy), and hippocampus (Hipp) (1). It

is also known that experience modifies functional

circuits in the brain (2) and that changes in the

morphology of dendritic spines might be involved

in synaptic plasticity related to learning and

memory (3, 4). Notably, synaptic plasticity

involves remodeling of extracellular matrix in the

brain (5-8).

http://www.jbc.org/cgi/doi/10.1074/jbc.M113.457903The latest version is at JBC Papers in Press. Published on May 28, 2013 as Manuscript M113.457903

Copyright 2013 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

2

Matrix metalloproteinase (MMP)-9 is

recently extensively studied extracellular

endopeptidase that cleaves extracellular matrix

(ECM) proteins to modulate synaptic plasticity

and thus it has been associated with learning

process in mammalian brain (8-10). Although

MMP-9 expression and activity have been linked

to such brain pathologies as ischemia, gliomas or

epilepsy (11-13), MMP-9 can also modify basic

brain circuitry during contextual fear learning and

long term memory formation (8, 14, 15). Long

lasting forms of synaptic plasticity and long-term

memory formation require new mRNA and protein

synthesis (10, 15). It has been established that

MMP-9 mRNA expression and accumulation are

regulated mainly at the transcriptional level (16,

17), and several transcription factors have been

shown to regulate MMP-9 transcription, including

AP-1 (18), AP-2 (19), Ets-1 (20, 21), c-Myc (22),

NF-κB (23), and Sp1 (18, 23). In particular, AP-1

has been implicated in controlling MMP-9 gene

transcription (10, 24). However, regulation of

neuronal MMP-9 transcription, in particular in

vivo after fear conditioning is virtually unknown.

In the present study we show that fear

conditioning enhanced MMP-9 enzymatic activity

follows its mRNA accumulation in different

mouse brain structures pivotal for fear circuitry.

Furthermore, we show that increased expression of

MMP-9 mRNA is preceded by enhanced

expression of c-Fos and c-Jun, major components

of AP-1 transcription factor that has been

implicated in MMP-9 gene regulation. Moreover,

AP-1 binding was also increased after the training.

Finally, we mutated the promoter sequence of

mouse MMP-9 gene at four proximal AP-1

putative sites by in vitro mutagenesis and then we

introduced all those reporter constructs, by means

of electroporation, into the brains of newly born

mouse pups aiming at the medial prefrontal cortex.

As a result, we have found that two specific AP-1

binding sites in the MMP-9 gene promoter (-42/-

50 and -478/-486) mediate its activation following

fear conditioning. Hence, our data implicate AP-1

as a positive regulator of MMP-9 gene trans-

cription in neurons after fear learning.

EXPERIMENTAL PROCEDURES Subjects. The experiment was performed

on adult, experimentally naive male C57BL/6

mice (25-30 g), supplied by the Nencki Institute

Animal House. For 1 month before the

experiment, the animals were housed in pairs in

standard home cages (23.0 x18.0 x12.5 cm) with

food and water provided ad libitum. The mice

were habituated to the experimenter’s hand for 5

days preceding the experiment. The experiment

was carried out in accordance with the Polish Act

on Animal Welfare, after obtaining specific

permission from the First Warsaw Ethical

Committee on Animal Research. All efforts were

made to minimize the number of animals and their

suffering.

Behavioral procedure. The mice were

randomly divided into two groups (Non-shocked,

NS; Shocked, S). In the behavioral experiments all

animals were habituated for 3 days (one 20-min

session per day) to the experimental room and

marking process. The training was performed in

MedAssociates fear conditioning chambers housed

in a sound attenuating room. In the S group, mice

were put to the experimental cages where, after

180 s of adaptation period, a single foot shock

(US) was delivered (0.7 mA of 50 Hz pulses for 2

sec). Then, after 60 sec, mice were removed from

the experimental cage (25). In the NS group, mice

were merely exposed to the experimental cages for

an equivalent amount of time (242 sec). Then the

mice were sacrificed at 0, 0.5, 2, 6, 12 and 24 h

following the training/exposure. Twelve animals

were used per each experimental group.

Plasmids. Mice MMP-9 gene promoter

fragment -1625/+595 bp, (with first Exon &

Intron, ExIn WT, 2220 bp) and -1625/+19 bp,

(transcription start site, Tss WT, 1644 bp) from

MMP-9 BAC vector (RP23-449M22) replaced in

place of CMV promoter into a p-eGFP-N1. Here,

two PCR steps were conducted by one common

foreword and two different overlapping PCR

primers (RF-ExIn/Tss-F: 5`-

CCTGATTCTGTGGATAACCGTATTAC

CGCCATGCATGCCTTGGCAGTCATGGATGT

GTGTCC-3`: 65.60/62.7

0C; Exin-R: 5`-CTC

GCCCTTGCTCACCATGGTGGCGATATGCCT

GTGGATGGAGGAAGGGGC-3`: 65.80/62.6

0C;

Tss-R: 5`-CTCGCCCTTGCTCACCATGGTGGC

GAGGTGAGGACCGCAGCTTCTGGCTAA-3`:

65.80/62.6

0C; promoter sequence underlined)

followed by DpnI digestion at last step (26). To

enhance the GFP expression from eGFP initiation

codon, point mutations were carried out in ExIn

WT plasmid at Tss of MMP-9 gene by

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

3

phosphorylated (*) primer pair (ExIn M-F: 5`*-

CGGTCCTCACCATCAGTCCCTGGCAG-3`:

65.80C,R:5`*CAGCTTCTGGCTAACGCGCCTT

TGCAGAG-3`: 65.70C). Point mutation in the

core of four AP-1 binding motif of the MMP-9

gene promoter were generated with the site-

directed mutagenesis Kit (Thermo Scientific)

according to the manufacturer's protocol using the

following phosphorylated primer pairs: (AP-1a-F,

5`*-GGCGGGGTCACTGATAACGTTTTACT

GCCTCT-3`: 65.70C, R: 5`*-GCCTCCCCTC

CAGGCTTATGCTGACTCA-3`: 65.80C; AP-1b-

F: 5`*-CACACACACACGCTGAGAAAGCATA

AGCCTGGAGGG-3`:690C, R: 5`*-TGTGTGTG

TGTGTGTGTGTGTGTGTGTGTGTGTGTGTG

TGTTTACA-3`: 690C; AP-1c-F: 5`*-

GCCAGGAGAGGAAGCTGAGAAAAAGACTC

TATCAGG-3`: 66.70C, R: 5`*-CTCTGGGAGC

AGGCTCTTTGAGGCAGGATTTG-3`:67.00C;

AP-1d-F: 5`*-GGCACACAGGAGGCTTAGAAA

GAACAGCTTGCTGAAG-3`:67.80C, R: 5`*-

AGACCTTCATGTGCTTCCCAACGAACAGAC

CTGTGAG-3`: 67.8; mutated nucleotides are

underlined). General and HPLC grade

oligonucleotides were synthesized by Genomed

(Poland) and Metabion (Germany) respectively.

All constructs were verified by DNA sequencing

by Genomed (ABI377, Perkin-Elmer).

In vivo-electroporation in P0 mice pups.

The WT-mmp-9-e-GFP promoter and EF-1β-

galactosidase constructs were purified by Endo

Free Plasmid isolation Kit (Qiagen, Hilden,

Germany) and were in vivo electroporated into P0

MMP-9 wild type (WT) mice pups according to

the protocol of Swartz et al. (27). After 1 month

following plasmid delivery, the mice were

randomly divided into 2 groups (S and NS) and

subjected to behavioral training as described

earlier. After 6 hrs the mice were sacrificed, the

brains were fixed and processed for either

immunochemistry or GFP reporter assay. The

immunofluorescence studies were carried out with

anti-GFP specific primary and secondary

antibodies (Santa Cruz biotechnology).

High resolution florescent in-situ

zymography (ISZ). The procedure was essentially

as described by Gawlak et al. (28). The sections

were dewaxed in absolute ethanol (37 °C, two

times, for 5 min and 10 min, respectively).

Afterwards, the alcohol was removed and slices

were hydrated with phosphate buffered saline

(PBS), pH 7.4, and in situ zymography was

performed as follows: the specimens were first

pre-incubated in water at 37 °C for 40 min, and

then overlaid with a fluorogenic substrate DQ

gelatin (Invitrogen/ Molecular Probes, Eugene,

OR, USA) diluted 1:100 in the buffer supplied by

the manufacturer, for 40 min at 37 °C. Then, they

were washed with PBS and fixed in 4% PFA at

room temperature (RT) for 15 min. Next, the

slides were mounted directly in Vectashield

(Vector, Burlingame, CA, USA) (29). The analysis

of gelatinase (green channel) were captured as

single-plane of confocal images at 6-8 Z-stacks,

using a 63X objective (oil immersion; 1.3 NA)

with a zoom factor of six. The settings of

photomultipliers were adjusted to obtain the

maximal dynamic ranges of pixels in each

channel. We designed an optimized program for

all the images as described in image processing

sections of text using macro program and run the

recorded macro program for all the obtained

images within ImageJ software. Using an unbiased

counting frame in each picture, at each time point

we estimated the mean number of objects per unit

area of the tissue, the ratio of the number of

objects to the number of all gelatinolytic-

immunopositive objects, and the mean

fluorescence intensity of the objects, defined as the

product of the mean area of the localizing objects

times the mean brightness. At least four animals

were analyzed at each time point.

Tissue extraction and partial purification

of gelatinase. Brains were rapidly removed, and

the prefrontal cortex, hippocampus and amygdala

were dissected separately on a cold plate. The sets

of samples (S and NS) were suspended in

phosphate-buffered saline

(10 mM phosphate

buffer pH 7.4, 150 mM NaCl) containing protease

inhibitors (Sigma), minced, and incubated for 10

min at 4°C. After centrifugation at 12,000 x g for

15 min,

the supernatant was collected in new

centrifuge tubes marked as PBS extracts. The

pellet was extracted in the lysis buffer (10 mM

Tris-HCl pH 8.0, 150 mM NaCl, 1% Triton X-100

plus protease inhibitors) and centrifuged at

12,000x g for 15 min to obtain the Triton-X (TX)

extract. Tissue extracts were preserved at -70°C

and used later. PBS and TX extracts from all types

of tissue was used for purification of gelatinase.

Briefly, an extract was mixed with gelatin agarose

bead, incubated at 4oC for 1 h followed by

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

4

centrifugation at 1500x g for 5 min. The pellet was

washed twice with PBS through centrifugation at

1500 x g for 5 min and MMP-2 and -9 were eluted

by incubating the pellet with Laemmli’s sample

loading buffer for 10 min at room temperature (14,

29). Samples were equalized on the basis of the

direct protein concentration measurements using

the BCA method (Theremo Scientific).

Gelatin zymography. For assay of MMP-9

and -2 activities, tissue extracts were

electrophoresed in 8% SDS-polyacrylamide gel

containing 1 mg/ml gelatin (Sigma), under non-

reducing conditions. The gels were washed twice

in 2.5% Triton-X-100 (Sigma) and then incubated

in calcium assay buffer (40 mM Tris-HCl, pH 7.4,

0.2 M NaCl, 10 mM CaCl2) for 18 h at 37°C. The

zones of gelatinolytic activity came as negative

staining (14, 28). A variation of gel-zymography

using acrylamide gel copolymerized with 0.4%

fluorescein isothiocyanate (FITC)-labelled gelatin.

This method allows real-time monitoring of

enzymatic activity under UV light and shows

higher sensitivity than Coommassie staining.

Quantification of zymographic bands was done

using densitometry linked to proper software (Lab

Image).

Fluorescent in situ hybridization (FISH)

for MMP-9 mRNA combined with

immunohistochemical staining. The coding

sequence of MMP-9 mRNA (ATG probe) and

3`UTR (UTR probe) were reverse transcribed and

cloned into a pDrive plasmid (Qiagen PCR

cloning kit). Sense and antisense fluorescein

labelled riboprobes were generated from plasmids

with SP6 or T7 polymerase sites. For in situ

hybridization studies, the animals were lethally

anesthetized with sodium pentobarbital and

perfused transcardially with 4% paraformaldehyde

(PFA) in PBS. Brains were removed, post fixed in

the same fixative, cryoprotected with 30% sucrose

and snap-frozen in isopentane cooled on dry ice.

The staining was performed on 40 μm-thick free-

floating sections. Acetylation buffer (0.1 M

triethanolamine, 0.25% HCl, 0.25% acetic

anhydride) was applied for 15 min in RT. Next,

sections were prehybridized for 3 hours in

prehybridization solution (Sigma-Aldrich)

followed by overnight hybridization at 72 °C in

hybridization solution (Sigma-Aldrich) containing

1:1 mix of ATG and UTR sense or antisense

probes. Afterwards, cells were washed in 0.2x

SSC, with first two washes carried out for an hour

in 70°C, then five consecutive washes for 30 min

in RT. After then, TNB blocking solution (TSA

Plus System, Perkin Elmer) was applied for an

hour (30). Cells were incubated with, mouse anti-

MAP-2 antibody (Sigma) 1:200 overnight in 4°C,

washed with PBST and incubated with secondary

antibody, 1:1000 Alexa 488-conjugated anti-

mouse IgG (Invitrogen) and mounted in

vectashield after nuclear specific TO-PRO staining

(Vector Laboratories). Cells were also incubated

with anti-c-Fos and anti-P-c-Jun specific

antibodies (Santa Cruz) 1:200 overnight in 4oC,

washed with PBST and incubated with secondary

antibody, 1: 1000, alexa 488 conjugated anti-

mouse IgG (Invitrogen) and mounted in

vectashield after nuclear specific TO-PRO staining

(Vector Laboratories). Hybridization signal was

amplified with Cy3 TSA plus System (Perkin

Elmer). The analysis of MMP-9 mRNA

localization (red channel) were captured as single-

plane of confocal images of 6-8 Z-stacks, using a

100X objective (oil immersion; 1.3 NA) with a

zoom factor of three. Images were processed as

described previously in “Methods”.

RNA extraction. Total cellular RNA was

extracted with TRIzol reagent according to the

protocol provided by the manufacturer and

quantified by measuring the absorbance at 260nm.

Complementary DNA was synthesized using 1µg

of total RNA from each sample in a 20µl reaction

buffer using Superscript II Reverse Transcriptase

with an oligo (dT)15 primer (-24).

RT-PCR. Complementary DNA was

amplified against forward and reverse primers of

MMP-9 (Foreward, F: 5`-

CTTCTGGCGTGTGAGTTTCC A-3`; Reverse,

R: 5`-ACTGCACGGTTGAAGC AAAGA-3`),

eGFP (F: 5`-GTCCAGGAG CGCACCATCT-3`;

R: 5`-GCTTGTGCCCCAG GATGTT-3`), c-Fos

(F: 5`- TTCCCCAAAC TTCGACCATG-3`; R:

5`-TGTGTTGACAGGAG AGCCCAT-3`), c-Jun

(F: 5`-CATGCTAACGCA GCAGTTGC-3`; R:

5`-ACCCTTGGCTTCAGT ACTCGG-3`) and

GAPDH (F: 5`- TGCCCCCAT GTTTGTGATG-

3`; R: 5`-GGTCATGAGC CCTTCCACAAT-3`)

respectively. The reactions were subjected to

denaturation (94°C for 30 s), annealing (60°C-

61.5°C for 30 s), and extension (72°C for 60 s) for

35 cycles (24, 29,).

The PCR products were

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

5

fractionated on 2 % agarose gels and visualized by

ethidium bromide staining.

Real time. PCR The real time-PCR was

carried out in a 20 μl volume in optical 96 well

reaction plates containing 2 μl cDNA, 10 pmoles

of each primer and 10 μl SYBR green PCR master

mix with Real-Time PCR System 7300 (Applied

Biosystems, CA, USA). Taq-DNA polymerase

activation was done at 95°C for 10 minutes

followed by 40 cycles at 94°C for 30 seconds,

62°C for 30 seconds and 72°C for 30 seconds. A

quantitative measure of MMP-9, GFP and

GAPDH transcription were obtained through

amplification of all cDNA in each sample at

individual time points by MMP-9, GFP and

GAPDH specific primer pairs as described in

previous method. For performing the regulatory

quantitative measure real time PCR were

conducted in AP-1 specific primers (cFos and

cJun) against GAPDH primers as described as

before. The amount of all mRNA expressions were

quantified relative to the total amount of cDNA

was calculated as ΔCt=CtMMP-9/GFP/ cFOS/

cJUN- CtGAPDH where Ct of all genes and

CtGAPDH were fractional cycle number at which

fluorescence generated by reporter dye exceeds

fixed level above baseline for all cDNA

respectively. The changes of relative mRNA

expressions in respective samples were expressed

as ΔCt NS versus ΔCt S values. Relative

expressions in all genes in respective samples

were calculated as 2-ΔΔCt

(-29).

GFP reporter assay. Enhanced green

fluorescent (eGFP) activity was evaluated using

GFP Assay System with Reporter Lysis Buffer

(Biovision) or β-galactosidase assay. We followed

protocols included to these kits. Results were

recorded using Luminometer Model 2030-000

(Turner Biosystems) and presented in ng/μL GFP

as a standardized light intensity which is a relative

value obtained after normalization of β-

galactosidase bioluminescence to GFP

bioluminescence (31).

Immunocytochemistry. Free floating 40

μm brain sections obtained from mice perfused

transcardially with 4% paraformaldehyde were

dipped overnight for permanent fixation, and then

permeabilized in 1×PBS containing 0.1% Triton

X-100. The cultures were blocked with 10%

normal donkey serum for 1 hour at room

temperature and stained with mouse anti-GFP

(Santa Cruz, 1:500), primary antibodies overnight

at 4°C. GFP staining was detected using donkey

anti-mouse AlexaFluor 488 conjugated antibody

(Invitrogen; 1:1000). For binding of secondary

antibody, cultures were incubated for 2 hours at

room temperature. Finally, cell nuclei were stained

with TO-PRO (Vector Laboratories) and examined

by the confocal microscopy (24, 28).

Western blotting. Equal amounts of the

samples were separated by 10% SDS-PAGE

electro-phoresis in Tris-glycine running buffer (25

mM Tris, 250 mM glycine, pH 8.3, 0.1% SDS)

and transferred to a polyvinylidene difluoride

membrane (Millipore) in transfer buffer (48 mM

Tris, 39 mM glycine, 0.037% SDS, 20%

methanol). Membranes were stained with Ponceau

red solution to check for equal protein transfer.

Then, membranes were rinsed and blocked in 5%

non-fat milk/TBST (25 mM Tris–HCl, pH 8.0;

125 mM NaCl; 0.1% Tween 20) for 2 hours at

room temperature. Then, membranes were

incubated with an appropriate primary antibodies,

i.e., GAPDH (Millipore) and β-dystroglycan from

Santa Cruz Biotechnology, diluted 1:300 at 4 °C

overnight, and horseradish peroxidase (HRP)-

conjugated secondary antibody IgG (Vector) was

added at dilution of 1:5000. Results were

developed using ECL PlusTM reagent (Amersham

Biosciences) on an X-ray film (Kodak) (28).

Electrophoretic mobility shift assay

(EMSA). For EMSA probe we used the following

double-stranded oligonucleotide containing the

foot printed AP-1 motif from mouse MMP-9 gene

promoter (AP-1 binding site is underlined):

GCGGGGTCACTGATTCCGTTTTACTGCCT.

We prepared a double-stranded oligonucleotide

probe by annealing equimolar amounts [10 μM] of

complementary singlestranded oligonucleotides in

a solution containing 0.1 M Tris–HCl (pH 7.5), 0.5

M NaCl, 0.05 M EDTA. Oligonucleotides were

placed at 65 °C for 10 min, slowly cooled down to

room temperature and then kept at 4 °C overnight

(-24). Double-stranded oligonucleotides (100 ng)

were end labeled with (Biotinylated probe)

according to the manufacturers protocol (Thermo

scientific) and purified with NucTrap Probe

Purification Columns (Stratagene). Binding

reactions were performed in a 10 μl volume as

described in manufacturer’s instruction (Thermo

Scientific). Immediately before loading on the gel,

the samples were mixed with an ice cold 5xgel

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

6

loading buffer (2xTris–glycine buffer, 50%

glycerol, 0.2% bromophenol blue). Protein-DNA

complexes were resolved by electrophoresis on

nondenaturing 8% polyacrylamide gel in 1xTris–

glycine buffer and were visualized by

chemiluminescence procedure (Thermo

Scientific).

EMSA supershift. For EMSA supershift

assay we used the following antibodies from Santa

Cruz Biotechnology: c-Jun (sc-7481X), c-Fos (sc-

52X), P-c-Jun (sc-48X) and normal rabbit IgG.

Binding reaction was performed as described

previously (32). Immediately before loading of

samples on the gel we add ice cold 5 × gel loading

buffer (2 × Tris–glycine buffer, 50% glycerol,

0.2% bromophenol blue). Double stranded

oligonucleotides (100 ng) were end labeled with

biotinylated probe according to the manufacturers

protocol (Thermo scientific) and purified with

NucTrap Probe Purification Columns (Stratagene).

Protein–DNA complexes were resolved by

electrophoresis on nondenaturating 8%

polyacrylamide gel in 1 × Tris–glycine buffer and

were visualized by chemiluminescence procedure

(Thermo Scientific).

Image processing. For final inspection, the

images were processed using ImageJ program

(http://rsb.info.nih.gov/ij). Quantification of

gelatinase activity was performed using standard

functions of the ImageJ program. Briefly,

multichannel image-stacks were collected at high

resolution (72 nm/pixel), threshold in each

channel, and segmented into individual three-

dimensional objects. These corresponded to the

foci of gelatinolytic activity (green channel) and

the dots of mRNA localization (red channel) from

cell body plus neuropils. The numbers of

individual objects, as well as the total numbers of

objects, and the mean brightness of objects were

counted automatically in three dimensions. In each

animal, four stacks with whole image over the area

of interest including the nucleus were analyzed in

each brain picture, rendering 1200–1400 positive

area/animal (28).

Statistical analyses. Data are presented as

the mean ± SEM. Significance was calculated

using the Student’s Newman`s Keuls test and one

way ANOVA analysis by Graph Pad Instat-3

software (Germany, 29).

RESULTS:

Enhanced MMP-9 activity and subsequent

β-dystroglycan cleavage in the mouse brain are

associated with fear conditioning. To explore

ECM remodeling by gelatinases in the mouse

brain following fear conditioning, we performed

high-resolution fluorescent in situ zymography

(ISZ). This method allows visualization of

structural details up to the resolution limit of the

light microscopy. We used this technique to reveal

and quantify gelatinolytic activity in the brains of

mice exploring novel environment (NS) versus

mice exposed to a footshock in a novel context

(S). The gelatinolytic activity was studied at

different time points following the

training/exposure in the three major brain

structures implicated in fear learning, i.e., the

medial prefrontal cortex, hippocampus and

amygdala (Fig. 1). The gelatinase activity was

observed in the major subdivisions of the

hippocampus, especially in the pyramidal cell

layers of CA1 (middle panel of Fig. 1A) and CA3

and the granule cell layer of the dentate gyrus, DG

(data not shown). Other structures within the

limbic system, such as the medial prefrontal cortex

(mPFC) (upper panel of Fig. 1A) and the

basolateral nucleus of the amygdala (BLA; lower

panel of Fig. 1A) were also found to express

gelatinase activity. The histogram in Fig 1B

depicts that overall gelatinase activity was

significantly increased in the S group in

comparison with the NS group at 2h-12h time

points. It is evident from Fig. 1B that gelatinase

activity was increased by ~15-20 folds at ~2-6 hrs

time points in all investigated subdivisions of the

mouse brain following fear conditioning and then

gradually decreased to the basal level at 24 hrs.

Next, we investigated the enzymatic

activity levels of two major gelatinases, i.e.,

MMP-2 and MMP-9, with gel zymography that

allows deciphering molecular identity of the

enzymes. The results (Fig. 2A) confirmed that fear

conditioning induced an increased gelatinase

activity in all three brain structures under study

and, furthermore, revealed that MMP-9 was the

major inducible enzyme. The quantification of this

result is provided in Fig. 2B. Herein, except for the

prefrontal cortex, in both the NS and S groups the

basal levels of MMP-2 expression and activity

were not changed significantly (Fig. 2A).

Histogram in Fig. 2B reveals that MMP-9

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

7

activities were increased by ~60, 50 and 40 folds

respectively at 2, 6 and 12 hrs, respectively

following fear conditioning.

Furthermore, we used an indirect method

to measure MMP-9 activity, employing its ability

to cleave its native substrate, β-dystroglycan (33).

The cytosolic extracts from both the NS and S

groups of mice were subjected to Western blotting

with β-dystroglycan and GAPDH specific

antibodies. The level of β-dystroglycan cleavage

was higher after fear conditioning (Fig. 2C), in

parallel with enhanced MMP-9 activity (compare

Fig. 2B and 2D). Herein, the β-dystroglycan

cleavage was increased at ~2-12 hrs that paralleled

expression of MMP-9 activity (Fig. 2D). The

overall cleavage of 30 kD molecular weight

product of β-dystroglycan was enhanced by ~4-12

fold at 2-12 hrs and then gradually diminished at

24 hrs (Fig. 2D).

MMP-9 gene expression after fear

conditioning involves AP-1 transcription factor.

To investigate the cellular localization of MMP-9

mRNA expression, NS and S group of mice were

subjected to in situ hybridization at three specific

time points (0, 2 and 24 hrs) with MMP-9 specific

mRNA probe. We observed that the localization of

MMP-9 mRNA was confined to the major

subdivisions of hippocampus, especially in the

pyramidal cell layers of CA1 (middle panel of Fig.

3A). Other structures associated with higher levels

of MMP-9 mRNA localizations were mPFC

(upper panel of Fig. 3A) and the BLA (lower panel

of Fig. 3A). The histogram in Fig 3B depicts that

overall MMP-9 mRNA accumulation was

significantly increased ~15 fold in the S group in

comparison with the NS group at 2 hrs time point.

Next, we asked whether fear learning

affects MMP-9 mRNA levels in the all the above

mentioned areas of brain tissues. With an aid of

real time-PCR approach, we found that fear

conditioning induced a sharp increase of MMP-9

mRNA levels (~15 fold) at 2 hrs, subsequently

followed by a decline at later time period (Fig.

3C). Since AP-1 transcription factor composed of

c-Fos and c-Jun protein has been implicated in

MMP-9 gene regulation (10) we performed also

real time PCR analyses of c-fos and c-jun mRNAs

in both the NS and S groups (Fig. 3C). We found

that expression of both mRNAs was transiently

upregulated by fear training in all three brain

structures investigated at 0.5-2 hrs, thus preceding

the MMP-9 mRNA upregulation.

Structure of the mouse MMP-9 gene and

associated AP-1 regulatory elements. Screening of

the genomic libraries from both UCSC and

ENSEMBL genome browser yielded multiple

BAC clones, one of which (RP23-449M22; 180

kB) was purchased from BACPAC resources

(Oakland, California), contained the entire 7.7-

kilobase gene, as well as ~110 and ~50 kb of the

5` and 3`end flanking regions, respectively. The

transcription initiation site, as determined by

primer extension, revealed a double start site

located 18 and 19 bp upstream of the translated

sequence (data not shown; Fig. 4). There is a

TATA box-like motif TTAAA at positions -25 to -

30 but no CCAAT box prior to transcription start

site (Tss). There are three GC boxes that may

serve as binding sites for the transcription factor

Sp1 (located at positions -57 to 62, -460 to 465,

and -604 to -609). Four AP-1-like binding sites

were also identified (-45 to -52, -83 to -90, -480 to

-487, and -1060 to -1067). Two of those

correspond to similar sequences in the human or

rat gene, but sites corresponding to the first one (-

45 to -52) and the most upstream one have not

been reported in the human or rat gene. The

conserved sequences of AP-1 sites are as follows

(consensus: TGAG(/C)TCA; mouse:

TGATTCCG; rat: TGAGTCAG and human:

TGAATCAG).Four conserved sequence elements

with similarity to the polyoma virus enhancer A-

binding protein-3 sites were found in the 5`

flanking sequence, as well as in the first intron

(Fig. 5). One consensus sequence (5`-

CCCCAGGC-3`) for AP-2 (-596 to -603), several

microsatellite segments of alternating CA residues,

as well as one NF-κB motif (-534 to -542) were

also present. A putative tumor growth factor-b1-

inhibitory element found in the human gene was

absent in the mouse promoter.

The -43/-50 bp and -486/-479 bp motifs of

mouse MMP-9 gene promoter are responsible for

MMP-9 gene promoter activity after fear learning.

To explore the molecular mechanism of MMP-9

transcription in vivo, LacZ reporter gene under

control of EF1α promoter and mouse WT-mmp-9-

e-GFP reporter eGFP were co-electroporated at

equimolar ratio, i.e., 2 µl (3-4 µg/µl) in P0 mice

pups. This approach allows introducing the

transgene into the cortical regions of the mouse

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

8

brain (the medial prefrontal cortex). The mice

were then reared up to one month of age and

groups of mice were subjected to fear conditioning

or cage exposure as mentioned earlier. For

standardization we also incorporated both peGFP-

N1 and reporter MMP-9 BAC in the prefrontal

cortex of mammalian brain and thereafter

subjected the mice to pentylenetetrazole (PTZ)-

evoked seizure episode (see Rylski et al., 2008,

(24); data not shown). Both groups of mice (NS

and S) were sacrificed 2 hrs following fear

conditioning or exposure to the context, and

processed for immunostaining with e-GFP specific

antibody (green) and TOPRO specific nuclear

stain (blue, Fig. 5B). Notably, we did not observe

GFP expression in the NS mice, indicating that

MMP-9 gene promoter was specifically activated

by fear learning. Furthermore, we analyzed the

MMP-9 mRNA levels by RT-PCR and real time

PCR analyses, and observed parallel expression of

mRNAs of both endogenous MMP-9 and

exogenous MMP-9 promoter-driven GFP in vivo

(Fig. 5B & C). The results shown in Fig. 5B

indicate that 2 hours after the training in the S

group, the eGFP mRNA expression was enhanced

~12 fold and was paralleled by the endogenous

MMP-9 mRNA expression in vivo (increased ~14

fold) as compared with the NS group. GAPDH

specific RT-PCR was run as an endogenous

control in the same experiment. In order to explore

the regulatory mechanisms of the MMP-9 gene by

AP-1 transcription factors after fear learning, we

introduced the mutated versions of different

promoter-reporter constructs into the medial

prefrontal cortex of P0 mice pups and subjected

these mice to fear conditioning (Fig. 5D). The

constructs containing exon1 had a mutation in the

ATG initiator codon for translation (ATG-ATC)

allowing translation of the transcript to start from

the ATG methionine initiator codon in the eGFP

gene. Intron 1 was included in some of the

constructs, since it has been shown to contain

enhancer elements. In the NS group, any mutation

of the AP-1 binding site did not change

significantly the MMP-9 gene promoter activity as

compared to its wild type (wt) equivalent. On the

other hand, 2 hours after the training in the S

group, activity of the MMP-9 gene promoter

mutated at -45/-52 bp site (AP-1a) was decreased

significantly by ~75% and mutated at 480/-487 bp

site (AP-1c) was decreased by ~25%, comparing

to its wt counterpart (Fig. 5E). Thus, it appears

that both -43/-50 bp and -486/-479 bp motifs of

MMP-9 gene promoter exert positive influence

onto the activity of the regulatory DNA fragment

during fear conditioning.

Finally, we analyzed, with an aid of an

electrophoretic mobility shift assay (EMSA), the

capacity of protein extracts to bind to the AP-1

specific consensus sequence of MMP-9 gene

promoter. The 5` biotin labeled DNA probe

composed of a sequence encompassing the mice

MMP-9 gene promoter flanking at -43/-50 bp AP-

1 cis-acting element, was incubated with nuclear

protein lysates from the medial prefrontal cortex,

hippocampus and amygdala obtained at 0, 6 and

12 hrs after the behavioral training (Fig. 6A). To

check for the specificity of the bands we

performed the assay in the presence of 10-fold

excess of the unlabelled probe (data not shown).

Since the two uppermost protein-DNA complexes

disappeared in this competition experiment, we

concluded that these bands represented specific

DNA–protein interactions. As a result, we

observed much stronger binding of protein-DNA

complex in the S group than in the NS group at 6-

12 hrs after the training, indicating the DNA

binding activity by AP-1 complexes during MMP-

9 transcription in vivo.

To test whether AP-1 proteins can bind to

the AP-1 binding region

(GCGGGGTCACTGATTCCGTTTTACTGCCT),

we incubated prefrontal cortex, hippocampal and

amygdalar nuclear protein lysates, obtained at 2

hours following footshock, with antibodies

specific against c-Fos, c-Jun and P-c-Jun proteins,

and then subjected for EMSA supershift assay. We

observed strong supershifts with antibodies

directed against both c-Fos and P-c-Jun proteins,

and slighty weaker supershift with anti-c-Jun

antibody (Fig. 6B). The supershifted bands were

not observed when a control antibody was used

(Fig. 6B).

To visualize c-Fos and phosphorylated c-

Jun proteins in the different compartments of the

mouse brain (PFC, Hipp and Amy) and to confirm

induction of its expression after fear conditioning,

we immunostained the brain sections obtained

from the animals 2 hours after Shock and Non

Shock exposures. We have found that both c-Fos

and c-Jun were strongly upregulated 2 hours after

the shock, whereas no noticeable increase in the

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

9

protein level was observed in the Non Shock

group (Fig. 7A and 8A).

After the shock, c-Fos and c-Jun was

expressed mainly throughout the neuronal cell

body layers of the PFC, Hipp and Amy (Fig. 7A

and 8A). Moreover, MMP-9 mRNA distribution in

the Cg1, CA1 and BLA co-localized with both c-

Fos and P-c-Jun proteins, supporting the

hypothesis about MMP-9 transcriptional

regulation by c-Fos and P-c-Jun proteins (Fig. 7B

and 8B).

DISCUSSION In the present study, we established the

fear conditioning-evoked expression pattern of

MMP-9 mRNA and enzyme activity in three

major mouse brain structures implicated in fear

learning. We have identified AP-1 transcription

factor as an important regulator of MMP-9 gene

transcription and, furthermore, we showed that c-

Fos and phosphorylated c-Jun (AP-1 components)

are involved in regulation of MMP-9 expression.

To achieve those results we have applied a

collection of cellular, molecular and behavioral

approaches, including EMSA, EMSA-supershift,

immuno-FISH, as well as in vivo electroporation

coupled gene reporter assay.

We showed that contextual fear

conditioning results in enhanced expression of AP-

1 transcription factor and its components

especially c-Fos and c-Jun proteins, and that

MMP-9 gene expression is activated in AP-1

dependent manner. In consequence, there is

following increase in MMP-9 activity observed in

the same brain areas. Our data strongly support the

notion about the positive influence of AP-1

composed of c-Fos and c-Jun proteins onto MMP-

9 transcription. Notably, we have employed a

novel approach, using gene reporter constructs

introduced into the prefrontal cortex by neonatal

electroporation. This in vivo electroporation

coupled gene reporter assay was, to the best of our

knowledge, used for the first time for in vivo gene

regulation study in learning. The promoter

sequence of mouse MMP-9 gene derived from a

BAC was selectively mutated at four proximal

AP-1 putative sites and the regulation of MMP-9

transcription was studied in the medial prefrontal

cortex after contextual fear conditioning in the

adult animals. As a result, we have found that two

putative AP-1 binding sites (-42/-50 and -478-486)

of the WT-MMP-9 gene promoter are involved in

MMP-9 transcription during learning process.

It has been established that the prefrontal

cortex, hippocampus and amygdala regulate the

formation, extinction and renewal of fear

memories (1, 33-35). However, the molecular

mechanisms underlying synaptic plasticity in these

structures are poorly understood. In particular,

proteolytic activities capable to reorganize

extracellular matrix in those areas have not

sufficiently been explored. Many extracellular

proteases that modulate the turnover of neuronal

extracellular matrix, by cleaving the substrate

proteins, have recently been implicated in fear-

related plasticity (5-8). In the present study we

observed that overall gelatinase activity was

increased in the medial prefrontal cortex,

hippocampus and amygdala after fear

conditioning, in comparison to the animals

exposed to the experimental context but not

subjected to fear conditioning. Furthermore, we

demonstrate that amongst the gelatinases, the gene

expression and enzymatic activity of MMP-9, but

not MMP-2, have been increased.

It has been demonstrated that the local

synthesis, expression and activation of MMP-9

protein in neurons is rapid and may occur already

within minutes after the neuronal stimulation (14,

24, 29, 33, 36). The present study reveals

protracted MMP-9 activation at later time-points.

To explain this phenomenon, we may suggest that

after initial (occurring within minutes) behavioral

training-driven MMP-9 release and loss in the

extracellular space, there is a need for the second

wave of MMP-9 transcription and associated

translation, in order to replenish this lost pool of

the enzyme (7). Considering the available data it

might be of great interest to further pursue a

question whether observed MMP-9 transcription

contributes to consolidation of fear long-term

memory or whether it is a metaplastic change that

impacts on later learning/memory formation.

We found that upregulated MMP-9

enzymatic activity coincided with enhanced β-DG

cleavage. The localization of β-DG in various cell

compartments in the brain, including dendritic

spines, had already been established (37- 39).

Previously, the co-existence of MMP-9 and β-DG

in vivo, by high resolution double immunogold

labeling was demonstrated (33). The subcellular

co-localization of β-DG and MMP-9 is consistent

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

10

with the idea that MMP-9 could be secreted to the

extracellular space, allowing for a focal, MMP-9-

mediated proteolysis of membrane-bound β-DG.

In our present report, we found both the MMP-9

enzymatic activity and β-DG cleavage in Triton X-

100-soluble fraction from all the associated

compartments of the fear-related brain structures,

which might reflect enzymatic activation of a pool

of membrane-bound MMP-9 and cleavage of

membrane bound β-DG substrate.

Earlier ex vivo and in vivo studies revealed

that, in non-stimulated neurons in culture, as well

as in the hippocampus, noticeable levels of the

truncated form of β-DG could be found. These

may be due to basal activity of either MMP-2 or

MMP-9, as both proteases can cleave β-DG (40,

41). Furthermore, of special note from the

previous study (33) is the finding that β-DG

processing is a fast and transient phenomenon as

within 20 min. after the stimulation, a decrease in

the level of the 30-kDa form has been observed.

Herein, in the NS group we demonstrated a mild

enhancement of β-DG cleavage, which was much

lower than that of the S group. This result suggests

that fear conditioning results in excessive β-DG

cleavage (by ~10-15 folds), while exposure to a

novel context evokes less robust synaptic plasticity

and, thus, moderate β-DG cleavage.

To explore the MMP-9 transcriptional

mechanism following fear conditioning, we

isolated the mRNA from both the S and NS groups

and performed real time PCR. We observed that

fear conditioning resulted in an increased

transcription of MMP-9 gene (but not MMP-2

gene) as soon as 2 hrs after the training. Moreover,

we found that transcription of c-Fos and c-Jun

preceded MMP-9 transcription in vivo supporting

an idea that AP-1 transcription factor may play a

role in MMP-9 gene regulation in activated

neurons (10). To confirm that indeed AP-1

regulates MMP-9 gene transcription after fear

conditioning, we have applied various approaches

in vivo, including EMSA and eGFP-reporter assay

after neonatal brain electroporation driven

incorporation of WT and mutated versions of AP-

1 motifs of mouse MMP-9 gene. The results of

our study strongly support a notion of positive

influence of AP-1 transcription factor, possibly

composed of c-Fos and c-Jun proteins, on the

MMP-9 gene transcription. Both positive and

negative transcriptional regulations of MMP-9

gene by AP-1 complex were shown before in

various cell types under physiological and

pathological conditions (24, 42, 43). However, the

present study provides novel findings about the

positive regulation of MMP-9 in a context of

physiological neuronal plasticity, i.e., during fear

learning.

In the mouse MMP-9 gene regulatory

regions we have identified four functional AP-1

binding motifs that are located at positions at -45

to -52, -83 to -90, -480 to -487, and -1060 to -1067

upstream the transcription start site. In this report,

we individually and in different combinations

mutated all the above mentioned AP-1 motifs by

in vitro mutagenesis and thereafter electroporated

them in the medial prefrontal cortical neurons in

P0 pups in vivo. The in vivo promoter activation

data, as evidenced from the GFP reporter assay,

revealed that after fear conditioning mainly the -45

to -52 motif and moderately at -480 to -487 motif,

but not in the -83 to -90 and -1060 to -1067 AP-1

motifs drove MMP-9 gene activation. This is a

controversial finding, as the other motifs of AP-1,

especially the -88/81 motif, were previously

shown to positively affect MMP-9 gene promoter

activity (both basal and/or inducible) in various

cells (44-46). Although opposite results were also

reported (20, 47, 48). Importantly, it has also been

noted that the AP-1 binding motif is essential for

passive (24, 49-51) and active (52) regulation on

MMP-9 gene transcriptional repression. Our

results are novel because they indicate that AP-1

positively induces MMP-9 gene transcription

following fear conditioning. Furthermore, they

provide the first indication of AP-1 dependent

activation of MMP-9 gene transcription in neurons

in vivo in mammalian brain after behavioral

training. It shall be also noted that mutation of all

four putative AP-1 binding sites in the MMP-9

gene regulatory region did not abolish entirely the

fear conditioning-evoked gene expression,

suggesting that other than AP-1 transcription

factors play a role in this learning.

Previously, Rylski et al. (24) showed the

repressive influence of the AP-1 motif onto MMP-

9 gene expression after seizure induced by PTZ or

kainate in rats. We hypothesize that various

putative AP-1 motifs in MMP-9 promoter might

be essential for a fine tuning (activation or

repression) of MMP-9 gene transcription at

different physiological and pathological

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

11

conditions. Since variable ratios of Fos-Jun

dimeric complexes are needed in those conditions,

they might regulate MMP-9 transcription to affect

synaptic plasticity.

In conclusion, the observations reported

herein show that MMP-9 gene transcription and

associated proteolytic activity following fear

conditioning depends on the tight regulation and

fine tuning by the AP-1 transcription factor.

Enhanced expression of c-Fos and c-Jun dimeric

AP-1 protein complex positively regulates MMP-9

transcription during contextual fear learning. This

is the first indication of AP-1 dependent activation

of MMP-9 gene transcription in neurons during

learning and memory formation in mammalian

brain. The present results contribute to a growing

body of evidence that MMP-9 plays crucial roles

in physiological synaptic plasticity. Furthermore,

our data also decipher the molecular mechanism of

the MMP-9 gene transcription in the brain

structures involved in fear learning in a

physiological context.

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

12

REFERENCES

1. Maren S. (2011) Seeking a spotless mind: Extinction, deconsolidation, and erasure of fear

memory. Neuron 70, 830–845

2. Chklovskii DB. (2004) Synaptic connectivity and neuronal morphology: two sides of the same

coin. Neuron 43, 609-617

3. Holtmaat A, Svoboda K. (2009) Experience-dependent structural synaptic plasticity in the

mammalian brain. Nat Rev Neurosci 10, 647-658

4. Holtmaat A, Wilbrecht L, Knott GW, Welker E, Svoboda K. (2006) Experience-dependent

and cell-type-specific spine growth in the neocortex. Nature 441, 979-983

5. Dityatev A, Schachner M, Sonderegger P. (2010) The dual role of the extracellular matrix in

synaptic plasticity and homeostasis. Nat Rev Neurosci 11, 735-746

6. Pizzorusso T, Medini P, Berardi N, Chierzi S, Fawcett JW, Maffei L. (2002) Reactivation of

ocular dominance plasticity in the adult visual cortex. Science 298, 1248-1251

7. Rivera S, Khrestchatisky M, Kaczmarek L, Rosenberg GA, Jaworski DM. (2010) Metzincin

proteases and their inhibitors: foes or friends in nervous system physiology? J Neurosci 30, 15337–

15357

8. Huntley GW. (2012) Synaptic circuit remodelling by matrix metalloproteinases in health and

disease. Nat Rev Neurosci 13, 743-57

9. Sternlicht MD, Werb Z. (2001) How matrix metalloproteinases regulate cell behavior. Annu

Rev Cell Dev Biol 17, 463-516

10. Kaczmarek L, Lapinska-Dzwonek J, Szymczak S. (2002) Matrix metalloproteinases in the

adult brain physiology: a link between c-Fos, AP-1 and remodeling of neuronal connections? EMBO

J 21, 6643-6648

11. Asahi M, Asahi K, Jung JC, del Zoppo GJ, Fini ME, Lo EH. (2000) Role for matrix

metalloproteinase 9 after focal cerebral ischemia: effects of gene knockout and enzyme inhibition

with BB-94. J Cereb Blood Flow Metab 20, 1681-1689

12. Gu Z, Kaul M, Yan B, Kridel SJ, Cui J, Strongin A, Smith JW, Liddington RC, Lipton SA.

(2002) S-nitrosylation of matrix metalloproteinases: signaling pathway to neuronal cell death.

Science 297, 1186-1190

13. Wilczynski GM, Konopacki FA, Wilczek E, Lasiecka Z, Gorlewicz A, Michaluk P,

Wawrzyniak M, Malinowska M, Okulski P, Kolodziej LR, Konopka W, Duniec K, Mioduszewska

B, Nikolaev E, Walczak A, Owczarek D, Gorecki DC, Zuschratter W, Ottersen OP, Kaczmarek L.

(2008) Important role of matrix metalloproteinase 9 in epileptogenesis. J Cell Biol 180, 1021-1035

14. Nagy V, Bozdagi O, Matynia A, Balcerzyk M, Okulski P, Dzwonek J, Costa RM, Silva AJ,

Kaczmarek L, Huntley GW. (2006) Matrix metalloproteinase-9 is required for hippocampal late-

phase long-term potentiation and memory. J Neurosci 26, 1923-1934

15. Kaczmarek L. (1993) Molecular biology of vertebrate learning: is c-fos a new beginning? J

Neurosci Res 34, 377–381

16. Van den Steen PE, Dubois B, Nelissen I, Rudd PM, Dwek RA, Opdenakker G. (2002)

Biochemistry and molecular biology of gelatinase B or matrix metalloproteinase-9 (MMP-9). Crit

Rev Biochem Mol Biol 37, 375-536

17. Chakraborti S, Mandal M, Das S, Mandal A, Chakraborti T. (2003) Regulation of matrix

metalloproteinases: an overview. Mol Cell Biochem 253, 269-285

18. Sato H, Seiki M. (1993) Regulatory mechanism of 92 kDa type IV collagenase gene

expression which is associated with invasiveness of tumor cells. Oncogene 8, 395–405

19. Sivak JM, West-Mays JA, Yee A, Williams T, Fini ME. (2004) Transcription factors Pax6

and AP-2alpha interact to coordinate corneal epithelial repair by controlling expression of matrix

metalloproteinase gelatinase B. Mol Cell Biol 24, 245–257

20. Himelstein BP, Lee EJ, Sato H, Seiki M, Muschel RJ. (1998) Tumor cell contact mediated

transcriptional activation of the fibroblast matrix metalloproteinase-9 gene: involvement of multiple

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

13

transcription factors including Ets and an alternating purine-pyrimidine repeat. Clin Exp Metastasis

16, 169-177

21. Eberhardt W, Schulze M, Engels C, Klasmeier E, Pfeilschifter J. (2002) Glucocorticoid-

mediated suppression of cytokine-induced matrix metalloproteinase-9 expression in rat mesangial

cells: involvement of nuclear factor-kappaB and Ets transcription factors. Mol Endocrinol 16, 1752–

1766

22. Magid R, Murphy TJ, Galis ZS. (2003) Expression of matrix metalloproteinase-9 in

endothelial cells is differentially regulated by shear stress. Role of c-Myc. J Biol Chem 278, 32994–

3299923

23. Sato H, Kita M, Seiki M. (1993) v-Src activates the expression of 92-kDa type IV collagenase

gene through the AP-1 site and the GT box homologous to retinoblastoma control elements: A

mechanism regulating gene expression independent of that by inflammatory cytokines. J Biol Chem

268, 23460–23468

24. Rylski M, Amborska R, Zybura K, Michaluk P, Bielinska B, Konopacki FA, Wilczynski

GM, Kaczmarek L. (2009) JunB is a repressor of MMP-9 transcription in depolarized rat brain

neurons. Mol Cell Neurosci. 40, 98-110

25. Knapska E, Nikolaev E, Boguszewski P, Walasek G, Blaszczyk J, Kaczmarek L, Werka T.

(2006) Between-subject transfer of emotional information evokes specific pattern of amydala

activation. Proc Natl Acad Sci 103, 3858-3862

26. Van den Ent F and Jan Lowe J. (2006) RF cloning: A restriction-free method for inserting

target genes into plasmids. Biochem Biophys Methods 67, 67–74

27. Swartz M, Eberhart J, Mastick GS, Krull CE. (2001) Sparking new frontiers: using in vivo

electroporation for genetic manipulations. Dev Biol 233, 13-21

28. Gawlak M, Górkiewicz T, Gorlewicz A, Konopacki FA, Kaczmarek L, Wilczynski GM.

(2009) High resolution in situ zymography reveals matrix metalloproteinase activity at glutamatergic

synapses. Neuroscience 158, 167-176

29. Ganguly K, Swarnakar S. (2012) Chronic gastric ulceration causes matrix metalloproteinases-

9 and -3 augmentation: Alleviation by melatonin. Biochimie 94, 2687-2698

30. Dziembowska M, Milek J, Janusz A, Rejmak E, Romanowska E, Gorkiewicz T, Tiron A,

Bramham CR, Kaczmarek L. (2012) Activity dependent local translation of matrix

metalloproteinase-9. J Neurosci 32, 14538-14547

31. Dean KM and Grayhack EJ. (2012) RNA-ID, a highly sensitive and robust method to identify

cis-regulatory sequences using superfolder GFP and a fluorescence-based assay. RNA18, 2335-2344

32. Kaminska B, Kaczmarek L, Chaudhuri A. (1996) Visual stimulation regulates the expression

of transcription factors and modulates the composition of AP-1 in visual cortex. J Neurosci 16,

3968–3978

33. Michaluk P, Kolodziej L, Mioduszewska B, Wilczynski GM, Dzwonek J, Jaworski J, Gorecki

DC, Ottersen OP, Kaczmarek L. (2007) Beta-dystroglycan as a target for MMP-9, in response to

enhanced neuronal activity. J Biol Chem 282,16036-16041

34. Kim JJ, Fanselow MS, DeCola JP, Landeira-Fernandez J. (1992) Selective impairment of

long-term but not short-term conditional fear by the N-methyl-D-aspartate antagonist APV. Behav

Sci 106, 591-596

35. Phillips RG, LeDoux JE. (1992) Differential contribution of amydala and hippocampus to

cued and contextual fear conditioning. Behav Neurosci 106, 274-285

36. Knapska E, Macias M, Mikosz M, Nowak A, Owczarek D, Wawrzyniak M, Pieprzyk M,

Cymerman IA, Werka T, Sheng M, Maren S, Jaworski J, Kaczmarek L. (2012) Functional anatomy

of neural circuits regulating fear and extinction. Proc Natl Acad Sci 109, 17093-17098

37. Wang XB, Bozdagi O, Nikitczuk JS, Zhai ZW, Zhou Q, Huntley GW. (2008) Extracellular

proteolysis by matrix metalloproteinase-9 drives dendritic spine enlargement and long-term

potentiation coordinately. Proc Natl Acad Sci 105, 19520-19525

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

14

38. Zaccaria ML, Di Tommaso F, Brancaccio A, Paggi P, Petrucci TC. (2001) Dystroglycan

distribution in adult mouse brain: a light and electron microscopy study. Neuroscience 104, 311–324

39. Cavaldesi M, Macchia G, Barca S, Defilippi P, Tarone G, Petrucci TC. (1999) Association of

the dystroglycan complex isolated from bovine brain synaptosomes with proteins involved in signal

transduction. J Neurochem 72, 1648-1655

40. Agrawal S, Anderson P, Durbeej M, van Rooijen N, Ivars F, Opdenakker G, Sorokin LM.

(2006) Dystroglycan is selectively cleaved at the parenchymal basement membrane at sites of

leukocyte extravasation in experimental autoimmune encephalomyelitis. J Exp Med 203, 1007-1019

41. Zhong D, Saito F, Saito Y, Nakamura A, Shimizu T, Matsumura K. (2006) Characterization of

the protease activity that cleaves the extracellular domain of beta-dystroglycan. Biochem Biophys

Res Commun 345, 867-871

42. Deschamps AM, Spinale FG. (2006) Pathways of matrix metalloproteinase induction in heart

failure: bioactive molecules and transcriptional regulation. Cardiovasc Res 69, 666-676

43. Yan C, Boyd DD. (2007) Regulation of matrix metalloproteinase gene expression. J Cell

Physiol 211, 19–26

44. Ma Z, Shah RC, Chang MJ, Benveniste EN. (2004) Coordination of cell signaling, chromatin

remodeling, histone modifications, and regulator recruitment in human matrix metalloproteinase 9

gene transcription. Mol Cell Biol 24, 5496–5509

45. Ray A, Bal BS, Ray BK. (2005) Transcriptional induction of matrix metalloproteinase-9 in the

chondrocyte and synoviocyte cells is regulated via a novel mechanism: evidence for functional

cooperation between serum amyloid A-activating factor-1 and AP-1. J Immunol 175, 4039–4048

46. Taheri F, Bazan HE. (2007) Platelet-activating factor overturns the transcriptional repressor

disposition of SP1 in the expression of MMP-9 in human corneal epithelial cells. Invest Ophthalmol

Vis Sci 48, 1931–1941

47. Farina AR, Tacconelli A, Vacca A, Maroder M, Gulino A, Mackay AR. (1999)

Transcriptional up-regulation of matrix metalloproteinase-9 expression during spontaneous epithelial

to neuroblast phenotype conversion by SK-N-SH neuroblastoma cells, involved in enhanced

invasivity, depends upon GT-box and nuclear factor kappaB elements. Cell Growth Differ 10, 353–

367

48. Yang JQ, Zhao W, Duan H, Robbins ME, Buettner GR, Oberley LW, Domann FE. (2001) v-

Ha-RaS oncogene upregulates the 92-kDa type IV collagenase (MMP-9) gene by increasing cellular

superoxide production and activating NF-kappaB. Free Radic Biol Med 31, 520–529

49. Moon SK, Kang SK, Kim CH. (2006) Reactive oxygen species mediates disialoganglioside

GD3-induced inhibition of ERK1/2 and matrix metalloproteinase-9 expression in vascular smooth

muscle cells. FASEB J 20, 1387–1395

50. Moon SK, Kim HM, Kim CH. (2004) PTEN induces G1 cell cycle arrest and inhibits MMP-9

expression via the regulation of NF-kappaB and AP-1 in vascular smooth muscle cells. Arch

Biochem Biophys 421, 267–276

51. Nair RR, Solway J, Boyd DD. (2006) Expression cloning identifies transgelin (SM22) as a

novel repressor of 92-kDa type IV collagenase (MMP-9) expression. J Biol Chem 281, 26424–26436

52. Crowe DL, Brown TN. (1999) Transcriptional inhibition of matrix metalloproteinase 9

(MMP-9) activity by a c-fos/estrogen receptor fusion protein is mediated by the proximal AP-1 site

of the MMP-9 promoter and correlates with reduced tumor cell invasion. Neoplasia 1, 368–372

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

15

FOOTNOTES *This work was supported by the Foundation for Polish Science Programmes Homing (K.G.) and TEAM

(L.K.) Programs. 2To whom correspondence may be addressed: Leszek Kaczmarek, Ph.D., Krishnendu Ganguly, Ph.D.,

Laboratory of Molecular Neurobiology, Nencki Institute, 02-093, Warsaw, Pasteur 3, Poland. Tel.: (858)

784-2770; Fax: (858) 784-2779; E-mail: l.kaczmarek@nencki.gov.pl; k.ganguly@nencki.gov.pl 3The abbreviations used are: Medial Prefrontal Cortex, mPFC; Hippocampus, Hipp; Amygdala, Amy;

Cornu Ammonis, CA: Basolateral amygdala, BLA; Matrix metalloproteinase, MMP; Dystroglycan, DG;

Green fluorescent protein, GFP; Cytomegalovirus, CMV; WT, wild type; restriction free, RF; Non-

shocked, NS; Shocked, S; Transcription start site, Tss; Exon Intron, ExIn; Electrophoretic mobility shift

assay, EMSA.

FIGURE LEGENDS:

FIGURE 1. Contextual fear conditioning induces gelatinase activity in the mouse brain. The coronal

brain sections were processed for high resolution in situ zymography. (A) Overall gelatinase activity

(green) in the mPFC of the prefrontal cortex, the cornu amonis (CA1) field of the hippocampus and the

basolateral amygdala (BLA) of amygdala in the NS and S groups at 0, 0.5, 2, 6, 12 and 24 hrs after the

training. Scale bar: 25 μM. The gelatinase activities are localized all over the neuronal cells including

soma, axon, and dendrites and in extracellular matrix of the tissue. (B) The histogram shows fold changes

of gelatinase intensity from the soma, axon and dendrites of the mPFC, CA1 and BLA at 0, 0.5, 2, 6, 12

and 24 hrs following the training in the S and NS groups. Gelatinase intensity was measured by ImageJ

software from the above photomicrographs and two other representatives from the independent

experiments. Results are reported as the means ± SEM, *p<0.01 compared to the value at 0 hrs of NS

group.

FIGURE 2. Contextual fear conditioning induces MMP-9 activity and associated β-dystroglycan

cleavage in the mouse brain. (A) The figure shows MMP-9 and -2 activities in the prefrontal cortex,

hippocampus and amygdala at different time points following the training in the NS and S groups. (B)

Quantified MMP-9 activity (shown on panel A). (C) The figure shows cleavage products of β-

dystroglycan in the prefrontal cortex, hippocampus and amygdala at different time points following the

training in the NS and S groups. (D) The histogram shows fold changes of 30 kDa cleavage products of

the mPFC, CA1 and BLA at 0, 0.5, 2, 6, 12 and 24 hrs following the training in the NS and S groups.

Activities are measured by Image QUANT designed densitometry values from the above

photomicrograph and two other representatives from the independent experiments. Results are reported as

the means ± SEM, *p<0.01 compared to the value at 0 hrs of NS group.

FIGURE 3. MMP-9 mRNA expression follows AP-1 transcription after fear conditioning . (A) The

figure shows MMP-9 mRNA localization (in red), MAP-2 (in green) and nucleus (in blue) in the medial

prefrontal cortex, hippocampus and amygdala at different time points following the training in the NS and

S groups. Scale bar: 25 μM. (B) Quantified MMP-9 activity (shown on panel A). (C) Graphical

representations of the results of Real Time-PCR analysis of c-Fos, c-Jun and MMP-9 mRNA relative to

GAPDH mRNA in the prefrontal cortex, hippocampus and amygdala where 2-ΔΔCt

values were plotted

against a cycle number in the NS and S groups. Results are reported as the means ± SEM, *p<0.001

compared to the value at 0 hrs of NS group.

FIGURE 4. Structure of the mouse MMP-9 gene and location of AP-1 motifs in promoter sequence. The

schematic diagram shows entire mouse MMP-9 gene (15.5 kb), 5` flanking regions (~15 kb) and 3`

flanking regions (5kb) contained in the mouse MMP-9 BAC clone. The exons of the gene are depicted by

black boxes, numbered from the 5`-end, and the introns and flanking sequences are shown by a solid line.

Scale in kilo bases is shown. The bent arrow indicates the transcription initiation site. The numbering of

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

16

nucleotides starts at the transcription initiation site. The TATA motif, GC boxes, AP-1-like, AP2,

polyoma virus enhancer A-binding protein-3, and NF-kB binding consensus sequences are boxed.

Alternating CA-rich sequences are underlined. Mouse MMP-9 gene promoter fragment -1625/+595 bp,

(with first Exon & Intron, ExIn WT, 2220 bp) and -1625/+19 bp (transcription start site, Tss WT, 1644

bp) from MMP-9 BAC vector (RP23-449M22) were put in place of CMV promoter into a p-eGFP-N1

plasmid by restriction free (RF) cloning. In the core of AP-1 binding motif (blue marked 8bp region) of

the MMP-9 gene promoter AA sites were replaced by site-directed mutagenesis according to the

manufacturer's protocol using the phosphorylated primer pairs.

FIGURE 5. MMP-9 gene activity is associated with -43/-50 bp and -486/-479 bp motifs during fear

learning. (A) The WT and mutated versions of the MMP-9-reporter GFP plasmid and β-gal plasmids

were co-electroporated in the medial prefrontal cortex (PFC) of P0 pups by means of electroporation.

Mice harvesting the WT and control plasmids were kept alive upto 1 month. After 1 month of plasmid

delivery, the mice were randomly divided into two groups (S and NS) and subjected to behavioral training

as described earlier. (B) Fluorescent microscope photomicrographs show the neurons with eGFP reporter

protein expression (green) and TO-PRO (blue) in the S and NS groups in the medial prefrontal cortex in

vivo at 20X and 63X zoom respectively. Scale bar: 50 μM and 10 μM, respectively. (C) The figure shows

the results of the RT-PCR analysis where expression of endogenous MMP-9, GAPDH mRNA and

exogenous eGFP mRNA was investigated in the medial prefrontal cortical neurons following fear

conditioning. For each time point RNA samples were obtained from 2 different experiments and mixed

together. RT-PCR reaction was repeated in duplicate. (D) Quantification of the RT-PCR analysis of RNA

isolated from the medial prefrontal cortex from the NS and S groups. Equal concentrations (0.6μg) of

cDNA were used for RT-PCR analysis of MMP-9 and GFP specific mRNA probe relative to GAPDH

specific mRNA probe. (E) The medial prefrontal cortex of P0 pups were electroporated with different

combinations of WT and mutated versions (with AP-1 motifs) of mouse MMP-9 GFP reporter plasmid

and β-gal plasmid with EF1 promoter and were harvested after one month. (F) The histogram shows

MMP-9 gene promoter activity in the medial prefrontal cortex of the S and NS animals which were

previously co-electroporated with combination of a WT or mutated versions of the reporter plasmids

bearing eGFP gene under control of a wild type MMP-9 mouse gene along with β-gal plasmid under

control of EF-1 promoter. The brains were harvested after 2 hours following the training/exposure and

subjected to GFP assay. Results are reported as the means ± SEM, *p<0.001 versus the NS group.

FIGURE 6. Increased binding of nuclear c-Fos and P-c-Jun proteins at AP-1 cis-element of MMP-9

promoter during fearlearning. The figure showing EMSA assay, where in vitro binding of mouse nuclear

extracts from (A) the prefrontal cortex, hippocampus and amygdala to the consensus AP-1 binding motif

at -43/-50 bp of MMP-9 gene promoter depends on the training conditions being strongly enhanced by

fear conditioning. The binding of proteins extracted from the unstimulated novel cage exposure in NS

group of mice shown in a lane marked as the NS whereas, animals exposed to foot shock is shown in the

lane marked as S at respective time points. In the competition reaction, 15-fold excess of the cold, wild

type probe was used. (B) EMSA supershift assay was done after 2 hours of post shock revealed

significantly stronger binding of hippocampal AP-1 components (c-Fos and P-c-Jun) to the −43/-50 bp

region of mouse MMP-9 gene promoter. Control is run as a “panjun specific Isotype antibody” detecting

all AP-1 components in EMSA supershift reaction. The specific band is designated as “AP-1” which is

specifically formed due to the DNA fragment interaction with AP-1 components and the supershifted

band is marked by the arrow specified as “SS”.

FIGURE 7. The expression of c-Fos protein enhances the transcription of MMP-9 in mouse brain. The

prefrontal cortex (PFC), hippocampus (Hipp) and amygdala (Amy) of mouse brain 2 hours after

contextual fear conditionin (S) and exposure to the experimental cage (NS). Induction of c-Fos expression

is limited mostly to the neuronal cell nuclei and overlaps with a distribution of MMP-9 mRNA. (A)

Immunohistochemical staining of c-Fos with a distribution of MMP-9 mRNA, showed in green and red

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

17

respectively, in the mouse PFC, Hipp and Amy cell nuclei in the NS and S groups. Cell nuclei are stained

with TO-PRO (in blue). Scale bar equals 1 mm. (B) 2 hrs after the training, c-Fos expression overlaps

with MMP-9 mRNA in the Cg1, CA1 and BLA of the mouse brain in the NS and S groups.

Immunohistochemical staining for c-Fos (in green) and in situ hybridization for MMP-9 mRNA (in red)

were performed in the same brain section. Cell nuclei are stained with TO-PRO (in blue). Scale bar equals

10 μm.

FIGURE 8. Expression of P-c-Jun protein enhances the transcription of MMP-9 in the mouse brain. The

prefrontal cortex (PFC), hippocampus (Hipp) and amygdala (Amy) of mouse brain 2 hours after

contextual fear conditioning (S) and exposure to the experimental cage (NS). Induction of P-c-Jun

expression is limited mostly to the neuronal cell nuclei and overlaps with a distribution of MMP-9

mRNA. (A) Immunohistochemical staining of P-c-Jun with a distribution of MMP-9 mRNA, showed in

green and red respectively, is induced in the PFC, Hipp and Amy cell nuclei in the NS and S groups. Cell

nuclei are stained with TO-PRO (in blue). Scale bar equals 1 mm. (B) 2 hrs after the training, P-c-Jun

expression overlaps with MMP-9 mRNA in the Cg1, CA1 and BLA of the mouse brain in the NS and S

groups. Immunohistochemical staining for P-c-Jun (in green) and in situ hybridization for MMP-9 mRNA

(in red) were performed in the same brain section. Cell nuclei are stained with TO-PRO (in blue). Scale

bar equals 10 μm.

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

18

FIGURE 1

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

19

FIGURE 2

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

20

FIGURE 3

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

21

FIGURE 4

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

22

FIGURE 5

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

23

FIGURE 6

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

24

FIGURE 7

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

MMP-9 transcription in mouse brain

25

FIGURE 8

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from

and Leszek KaczmarekKrishnendu Ganguly, Emilia Rejmak, Marta Mikosz, Evgeni Nikolaev, Ewelina Knapska

learningMatrix Metalloproteinase (MMP)-9 transcription in mouse brain induced by fear

published online May 28, 2013J. Biol. Chem. 

  10.1074/jbc.M113.457903Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on Decem

ber 6, 2020http://w

ww

.jbc.org/D

ownloaded from