jcm accepts, published online ahead of print on 28 december … · 1/37 1 title 2 molecular and...

1/37

Title 1

Molecular and microbiological characterization of Clostridium difficile isolates from single, 2

relapse, and re-infection cases. 3

4

Running Title 5

Characterization of C. difficile isolates. 6

7

Authors 8

Kentaro Oka 1, 2), Takako Osaki 1), Tomoko Hanawa 1), Satoshi Kurata 1), Mitsuhiro 9

Okazaki 3), Taki Manzoku 2), Motomichi Takahashi 2), Mamoru Tanaka 2), Haruhiko 10

Taguchi 4), Takashi Watanabe 5), Takashi Inamatsu 6) and Shigeru Kamiya* 1). 11

12

* Corresponding author. Mailing address: Department of Infectious Diseases, Kyorin 13

University School of Medicine, 6-20-2, Shinkawa, Mitaka, Tokyo, 181-8611, Japan. Phone: 14

+81-422-47-5511. Fax: +81-422-44-7325. E-mail: [email protected]. 15

16

Address of the institution at which the work was performed 17

Department of Infectious Diseases, Kyorin University School of Medicine, 6-20-2, 18

Shinkawa, Mitaka, Tokyo, 181-8611, Japan. 19

20

Author affiliations 21

1) Department of Infectious Diseases, Kyorin University School of Medicine, Tokyo, Japan 22

Copyright © 2011, American Society for Microbiology. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.05588-11 JCM Accepts, published online ahead of print on 28 December 2011

Copyright © 2012, American Society for Microbiology. All Rights Reserved.J. Clin. Microbiol. doi:10.1128/JCM.05588-11 JCM Accepts, published online ahead of print on 11 January 2012

on February 16, 2020 by guest

http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

2/37

2) Miyarisan Pharmaceutical Co., Ltd., Tokyo, Japan 23

3) Department of Clinical Laboratories, Kyorin University Hospital, Tokyo, Japan 24

4) Department of Immunology, Kyorin University Faculty of Health Sciences, Tokyo, 25

Japan 26

5) Department of Laboratory Medicine, Kyorin University School of Medicine, Tokyo, 27

Japan 28

6) Department of Infectious Diseases, Tokyo Metropolitan Geriatric Hospital, Tokyo, Japan.29


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

3/37

Abstract 30

In this study, we investigated the correlation between the microbiological characteristics 31

of Clostridium difficile clinical isolates and the recurrence of C. difficile-associated disease 32

(CDAD). Twenty C. difficile isolates recovered from 20 single infection cases and 53 33

isolates from 20 recurrent cases were analyzed by pulsed-field gel electrophoresis (PFGE) 34

and PCR ribotyping, and cytotoxicity, antimicrobial susceptibility and 35

sporulation/germination rates of the isolates were examined. Recurrent cases were divided 36

into relapse or re-infection cases by the results of C. difficile DNA typing. Among the 20 37

recurrent cases, 16 cases (80%) were identified to be relapse cases caused by the initial 38

strain and the remaining 4 cases (20%) to be re-infection cases caused by different strains. 39

All 73 isolates were susceptible to both vancomycin and metronidazole, but resistance 40

against clindamycin, ceftriaxone, erythromycin and ciprofloxacin was found in 87.7%, 41

93.2%, 87.7% and 100% of the isolates, respectively. No correlations were observed 42

between DNA typing group, cytotoxicity and sporulation rate of isolates, and infection 43

status, i.e., single, relapse or re-infection. However, the isolates recovered from relapse 44

cases showed a significantly higher germination rate when incubated in medium lacking the 45

germination stimulant, sodium taurocholate. These results indicate that the germination 46

ability of C. difficile may be a potential risk factor for the recurrence of CDAD.47


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

4/37

Introduction 48

Clostridium difficile is a Gram-positive, obligately anaerobic, spore-forming bacillus, 49

which is the causative pathogen of pseudomembranous colitis (PMC) and is also associated 50

with a large proportion of inpatient cases of antibiotic-associated diarrhea (AAD) (5, 22, 51

35). The main virulence factors of C. difficile are the two large clostridial glucosylating 52

toxins, toxin A (TcdA) and toxin B (TcdB), which have enterotoxic and cytotoxic activity, 53

respectively. These genes are located within a pathogenicity locus (PaLoc) along with other 54

toxin production-related genes. Most pathogenic strains isolated in cases of C. 55

difficile-associated disease (CDAD) produce both toxins (A+/B+ strains). Regarding other 56

toxin variant strains, A−/B+ isolates have been reported worldwide but naturally occurring 57

A+/B− isolates have not previously been reported. Some isolates produce an additional 58

binary toxin (CDT), but its role in CDAD is not well understood (10, 26, 27, 35). Recently, 59

outbreaks due to an emerging hyper-virulent strain of C. difficile BI/NAP1/027, which 60

produces a binary toxin, have been reported in North America and Europe (28, 35). 61

Oral antibiotics, such as vancomycin or metronidazole are commonly used and effective 62

in the treatment of CDAD. However, recurrent cases of CDAD (rCDAD) are common and 63

result inhave become a difficult clinical problem, in terms of prolonged duration of 64

hospitalization and increasing treatment costs (36, 40). Recurrence rates are generally 10 to 65

35%, but patients with known recurrent CDAD may exhibit higher rates than this (4, 9, 29). 66

Concerning the rRisk factors of for recurrent CDAD, several epidemiological analysis 67

reports have suggested host risk factors such as are: continuous use of antibiotics, older age, 68

hypoalbuminemia, diabetes mellitus, antacids and stool colonization with 69


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

5/37

vancomycin-resistant enterococci (VRE) (8, 12, 24, 37). Abnormal flora and/or host 70

immune response are also possible reasons for recurrence (40). 71

Recurrences are caused by the persistence of the same strain of C. difficile as first 72

episode and/or the re-infection of the new strain from environment. It has been reported 73

that the relapse rates due to the same strain were 25 to 87.5% (2, 4, 9, 32, 41, 45). However, 74

it is important to note that these may include an external reinfection by the original strain. 75

Various studies have reported molecular and microbiological characterization of isolates 76

from CDAD and/or rCDAD patients. In most of these studies, the DNA and toxin type were 77

investigated, and in some, antimicrobial susceptibility and/or cytotoxicity of C. difficile 78

clinical isolates were also tested as phenotypic characteristics (9, 23, 30, 32, 33, 42). 79

However, reports for other phenotypic characteristics such as sporulation rate are very 80

limited. 81

Sporulation and germination are one of the most important factors in the pathogenicity of 82

C. difficile and the recurrence of CDAD. It is presumed that the toxin production of C. 83

difficile is related to sporulation and germination (3, 16), and that sporulation allows for 84

persistence of C. difficile in the intestinal tract and the environment (4, 32, 35). Spores are 85

resistant to antibiotics and it is reasonable to assume that sporulation contributes to the 86

spread and survival of C. difficile. A rapid germination rate may allow for rapid growth of C. 87

difficile when antibiotic levels are greatly reduced or absent.Due to its conference of 88

antibiotic resistance, it is sensible to presume that sporulation contributes to the spread of C. 89

difficile, while germination rate is important for its rapid growth prior to restoration of 90

normal gut microbiota in recurrent cases. 91


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

6/37

In this study, we performed DNA typing of clinical isolates of C. difficile and examined 92

cytotoxicity, antibiotic susceptibility and sporulation/germination rates to investigate the 93

correlation between microbiological characteristics and the recurrence of CDAD.94


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

7/37

Materials and methods 95

C. difficile strains 96

Seventy-three clinical isolates of C. difficile were used in this study to compare 97

genotypic and/or phenotypic characteristics between strains isolated from single infection 98

cases and those from recurrent cases. A single detection of C. difficile from one patient 99

during the observation period (more than 1.5 years) was regarded as a single infection case, 100

and multiple detections with an interval of two or more weeks from one patient was 101

regarded as a recurrent case. Twenty strains from 20 single infection cases and 53 strains 102

from 20 recurrent cases were isolated from inpatients in the following two facilities: Tokyo 103

Metropolitan Geriatric Hospital, Tokyo, Japan (TMG strain, 2002-2005, 3 strains from 3 104

single infection cases and 7 strains from 3 recurrent cases) and Kyorin University Hospital, 105

Tokyo, Japan (KY strain, 2004-2005, 17 strains from 17 single infection cases and 46 106

strains from 17 recurrent cases). 107

108

Identification 109

C. difficile isolates were identified by PCR assay using primer sets B 110

(CCGTCAATTCMTTTRAGTTT, M = A or C, R = A or G) and PG-48 111

(CTCTTGAAACTGGGAGACTTGA) derived from the C. difficile 16S rRNA gene 112

according to the procedure previously described with slight modifications (13, 20). Briefly, 113

a single colony of C. difficile grown on GAM (Gifu Anaerobic Medium) agar (Nissui 114

Medical Co., Tokyo, Japan) was suspended in 100μl of TE (10mM Tris-HCl, 1mM EDTA 115

[pH8.0]). The composition of GAM agar is as follows: peptone, 1%; soya-bean peptone, 116


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

8/37

0.3%; proteose peptone, 1%; digested blood powder, 1.35%; yeast extract, 0.5%; meat 117

extract, 0.22%; liver extract powder, 0.12%; glucose, 0.3%; potassium dihydrogen 118

phosphate, 0.25%; sodium chloride, 0.3%; soluble starch, 0.5%; L-cysteine 119

monohydrochloride, 0.03%;sodium thioglycolate, 0.03%; and agar 1.5%; the pH was 7.1, 120

and the agar was sterilized at 115°C for 15 min. The suspension was boiled for 10 min and 121

centrifuged at 10,000 x g for 5 min. The resultant supernatant was used as template DNA. 122

123

PCR ribotyping 124

PCR ribotyping was performed by the method previously described with slight 125

modification, and primers CTGGGGTGAAGTCGTAACAAGG (positions 1445 to 1466 of 126

the 16S rRNA gene) and GCGCCCTTTGTAGCTTGACC (positions 20 to 1 of the 23S 127

rRNA gene) (18, 39). Briefly, the volume of PCR reaction mixture was downscaled to 50 128

μL and the amplified PCR products were concentrated to a final volume of approximately 129

10 μL followed by heating at 75˚C for 90 to 120 min before electrophoresis in 3% 130

Metaphor agarose (Lonza Rockland Inc., Basel, Switzerland) at a constant voltage of 120V 131

for 4h. Isolates with patterns differing by one or more bands were assigned to different PCR 132

ribotypes and the difference in faint bands was ignored. 133

134

Pulsed-field gel electrophoresis (PFGE) 135

PFGE analysis was performed by the method previously described with slight 136

modifications (6, 18, 19). One milliliter of C. difficile overnight culture was inoculated into 137

4mL of TYG medium and incubated at 37˚C for 5h in an anaerobic chamber (10% CO2, 138


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

9/37

10% H2 and N2 to balance), and an arbitrary volume of the culture was centrifuged at 5,000 139

x g for 5 min to obtain an appropriate size of pellet. The pellet was washed with 1mL of 140

TES buffer (50 mM Tris [pH 8.0], 5 mM EDTA, 50 mM NaCl) twice, embedded in an 141

agarose plug and incubated at 37˚C for 1h with lysozyme-lysostaphin followed by 142

incubation with proteinase K at 50˚C for 18h using a GenePath Group 1 Reagent Kit 143

(Bio-Rad Laboratories, Inc., CA, USA) according to the manufacturer’s instructions. DNA 144

in the plug was digested with SmaI for 18h at 25˚C. 145

Electrophoresis was performed with the CHEF Mapper system (Bio-Rad Laboratories, 146

Inc., CA, USA) and GenePath Gel Kit (Bio-Rad Laboratories, Inc., CA, USA) with 147

program 16 (6 V/cm, 120˚ angle, 5.3 to 49.9 sec switch time, non-linear ramp, 14˚C, 19.7 h 148

run time). In case that a smear band was obtained, the sample was subjected again to 149

electrophoresis by adding with tThiourea was added to a 1.0% agarose gel and running 150

buffer at a final concentration of 200 μM in case DNA degradation was observed to prevent 151

DNA degradation during electrophoresis (25). 152

DNA fragments were stained with ethidium bromide and photographed using the GelDoc 153

system (Bio-Rad Laboratories, Inc., CA, USA). Major PFGE types were defined by more 154

than three fragment differences and these major types were subtyped by three or fewer than 155

three fragment differences (43). Dendrogram analysis was carried out using Fingerprinting 156

II Software (Bio-Rad Laboratories, Inc., CA, USA). 157

Using the results of PFGE analysis, recurrent cases were divided into relapse cases and 158

re-infection cases. If the strain isolated at the time of recurrence was an identical PFGE 159

type to the initial strain, it was deigned to be a relapse case, but if different, it was regarded 160


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

10/37

as re-infection. 161

162

Toxin detection 163

The toxin type of C. difficile strains was analyzed by PCR as previously described (18, 164

20, 21). The template DNA was prepared by the boiling method described above. Two 165

primer sets, NK3 (GGAAGAAAAGAACTTCTGGCTCACTCAGGT) and NK2 166

(CCCAATAGAAGATTCAATATTAAGCTT), and NK11 167

(TGATGCTAATAATGAATCTAAAATGGTAAC) and NK9 168

(CCACCAGCTGCAGCCATA) were used for the detection of the toxin A gene, and primer 169

set NK104 (GTGTAGCAATGAAAGTCCAAGTTTACGC) and NK105 170

(CACTTAGCTCTTTGATTGCTGCACCT) was used for the toxin B gene. 171

172

Cytotoxicity assay 173

Cytotoxicity was determined by the method described by Kamiya et al. (15). Briefly, 174

African green monkey kidney (Vero) cells were grown in Eagle’s Minimum Essential 175

Medium (Sigma-Aldrich, Inc., MO, USA) supplemented with 8% fetal calf serum 176

(Sigma-Aldrich, Inc., MO, USA) in 96 well microplates, and the cell culture medium was 177

removed and replaced with 100 μL of fresh maintenance medium (Eagle’s MEM containing 178

0.5% calf serum) before assay. The culture supernatant of C. difficile in BHI broth 179

(incubated at 37˚C for 24h) was subjected to 2-fold serial dilution with maintenance 180

medium. The cell-culture medium was then removed and replaced with 100 μL of each 181

diluted sample. The cytotoxicity of the sample was determined as the highest dilution 182


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

11/37

resulting in a 100% cell rounding after incubation for 24h. 183

184

Antimicrobial susceptibility testing 185

Minimum inhibitory concentrations (MICs) of vancomycin, metronidazole, clindamycin, 186

ceftriaxone, erythromycin and ciprofloxacin were measured by Etest (AB Biodisk, Solna, 187

Sweden). A cotton swab dipped into a 1.0 McFarland standard-matched suspension of the 188

test isolate was used to inoculate a pre-reduced GAM agar plate. Etest strips and MIC value 189

measurements were performed according to the manufacturer’s instructions. Antibiotic 190

resistance was defined as follows, in accordance with the interpretative criteria described in 191

the manufacturer’s package insert and previous reports (1, 48): vancomycin ≥ 32 mg/L, 192

metronidazole ≥ 32 mg/L, clindamycin ≥ 8 mg/L, ceftriaxone ≥ 64 mg/L, erythromycin ≥ 8 193

mg/L and ciprofloxacin ≥ 4 mg/L. 194

195

Spore formation rate 196

Spore formation rate of C. difficile was determined by microscopic observation. A few 197

colonies of C. difficile grown on a GAM agar plate at 37˚C for 5 days were suspended in an 198

appropriate volume of sterile saline and the numbers of spores and vegetative cells were 199

counted under phase contrast microscopy using a bacteria-counting chamber. Spore 200

formation rate was calculated by the following formula: Spore formation rate (%) = 201

(Number of spores per mL / Number of total cells (spores and vegetative cells) per mL) x 202

100. 203

204


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

12/37

Germination rate 205

Germination rate of C. difficile was evaluated by the methods described previously (17, 206

31). To count the number of spores, a suspension of C. difficile cells was heated at 70˚C for 207

10 min to kill all the vegetative cells. The heat-treated suspension was then subjected to 208

10-fold serial dilution with sterile saline and inoculated onto GAM agar or Brain heart 209

infusion (BHI) agar (BD, NJ, USA) with or without supplementation of sodium 210

taurocholate (Wako Pure Chemical Industries, Ltd., Osaka, Japan). After incubation of the 211

plates at 37˚C for 48h in an anaerobic chamber, the colonies were counted and the 212

germination rate was calculated by the following formula: Germination rate (%) = (Colony 213

forming units (CFU) per mL / Microscopic counts of spores per mL) x 100. 214

215

Statistics 216

For the statistical comparison of spore formation rate and germination rate, 217

Tukey-Kramer’s test and Steel-Dwass’s test were used for parametric and non-parametric 218

data, respectively. Normality of a distribution and homogeneity of variances were evaluated 219

by chi-square goodness of fit test and Bartlett’s test.220


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

13/37

Results 221

Genotyping 222

We carried out PCR ribotyping and PFGE analysis to determine the infection status of 223

recurrent cases and to investigate the correlation between genotype, phenotype and 224

infection status. 225

All 73 strains were typable and resolved into 11 ribotypes (Fig. 1 and Table 1) and 12 226

major PFGE types (Fig. 2 and Table 1). Major ribotypes of C. difficile isolates were R2 (31 227

strains, 42.5%), R1 (14 strains, 19.2%) and R4 (13 strains, 17.8%). DNA degradation 228

during PFGE assay observed in some isolates completely resolved by addition of thiourea 229

at a final concentration of 200μM. Forty-nine strains were assigned to PFGE major type P1 230

(67.1%) and 11 strains were assigned to type P3 (15.1%), and these 2 types accounted for 231

more than 80% of the total (Table 1). Type P1 strains were recovered from 28 out of 40 232

patients (70.0%), and type P3 strains were recovered from 8 out of 40 (20.0%). 233

Among the 20 recurrent cases, 16 patients were regarded to be relapse cases caused by 234

the same strain (80.0%) and the remaining 4 patients to be re-infection cases caused by 235

different strains (20.0%) (Table 2). In the relapse cases, the major PFGE type and DNA 236

ribotype was P1 (12 strains, 75.0%, Table 2) and R2 (8 strains, 50.0%, data not shown). 237

There was no significant association between DNA typing group (PFGE type or PCR 238

ribotype) and incidence of recurrence. 239

240

Toxin type and Cytotoxicity 241

Among 73 strains used in the study, 67 strains were toxin A+, B+ (91.8%), 2 were toxin 242


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

14/37

A−, B+ (2.7%) and 4 were toxin A−, B− (5.4%) (Table 3). Toxin A+, B+ strains were 243

mainly categorized to types P1/R2, P3/R4 and P1/R1. In contrast, toxin A−, B+ and A−, B− 244

strains were categorized to type P8/R8 or P10/R8, and P5/R5 or P11/R10, respectively. 245

There was no correlation between toxin type and infection status (Table 3). Cytotoxicity 246

assay showed 13 strains (17.8%) were highly toxigenic (> 28 toxin titer) and 5 strains 247

(6.8%) had a low toxicity of 22 titer (data not shown). There was no significant relationship 248

between cytotoxicity of C. difficile isolates and DNA typing group (PFGE type and PCR 249

ribotype) except toxin A−, B− strains (type P5/R5 and P11/R10) showed no cytotoxic 250

activities. Similarly, no correlation between the cytotoxicity and the incidence of recurrence 251

was seen (data not shown). 252

253

Antibiotic susceptibility 254

MIC50, MIC90 and the range of MIC of vancomycin, metronidazole, clindamycin, 255

ceftriaxone, erythromycin and ciprofloxacin against the 73 C. difficile isolates are all shown 256

in Table 4. All isolates were susceptible to vancomycin and metronidazole. Resistance 257

against clindamycin, ceftriaxone, erythromycin and ciprofloxacin were found in 87.7%, 258

93.2%, 87.7% and 100% of the isolates tested, respectively. 259

C. difficile isolates with PFGE types P1, P3, P4, P8 and P10 showed high-level resistance 260

against clindamycin (MIC50 > 256 mg/L), ceftriaxone (MIC50 ≥ 128 mg/L), erythromycin 261

(MIC50 > 256 mg/L) and ciprofloxacin (MIC50 > 32 mg/L) (Table 5), as well as ribotypes 262

R1, R2, R3, R4 and R8 (data not shown). On the other hand, the susceptibility of C. difficile 263

isolates to vancomycin and/or metronidazole was neither related to the PFGE type (Table 264


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

15/37

5) nor PCR ribotype (data not shown). 265

There was no correlation observed between the antibiotic susceptibility of the C. difficile 266

isolates to the above antimicrobial drugs and recurrence (data not shown). 267

268

Germination and sporulation 269

Due to the high resistance of spores against antimicrobial agents, a high sporulation rate 270

would contribute to persistence of C. difficile in the intestinal tract after treatment with 271

CDAD antibiotics. It is also likely that a high germination rate would give C. difficile a 272

growth advantage after the withdrawal of antibiotics and before restoration of normal gut 273

microbiota. For these reasons, we proposed that germination and/or sporulation rates of C. 274

difficile may be related to recurrence ability. 275

From preliminary experiments testing a variety of media and agar types, we chose the 276

GAM agar plate as testing medium for spore formation rate, as it yielded the highest 277

number of spores (data not shown). To determine the germination rate, GAM agar plates 278

with or without the C. difficile germination stimulant sodium taurocholate were used. 279

Mean spore formation rate of the 73 C. difficile isolates after 5 days was 32% (range, 280

<1.0 to 89%) and sporulation ability was not related to PFGE type (Fig. 3A). Similarly, 281

there was no significant correlation between sporulation ability and PCR ribotype (data not 282

shown) or recurrence (Fig. 4A). 283

Mean germination rate of the 73 isolates on GAM agar was 0.24% (range, 0.00094 to 284

3.1%) and the germination rate was elevated about 10 to 50,000 fold when supplemented 285

with sodium taurocholate (mean, 42.7% range, 5.7 to 103.7%) (Fig. 3B, C). The 286


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

16/37

germination rate of the isolates either in the presence or absence of sodium taurocholate 287

was not related to PFGE type (Fig. 3B, C) or PCR ribotype (data not shown). However, the 288

germination rate of strains isolated from relapse cases was significantly higher than those of 289

single and re-infection cases when sodium taurocholate was not added (Fig.4B), though this 290

was not observed with sodium taurocholate (Fig. 4C). This observation on germination rate 291

was reproducible and a similar result was obtained when GAM agar was replaced by BHI 292

agar (Fig. S1).293


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

17/37

Discussion 294

In this study, 73 clinical isolates of C. difficile were analyzed by PFGE and PCR 295

ribotyping to determine infection status and to relate this to microbiological characteristics. 296

PFGE and PCR ribotyping are popular methods of genetic characterization worldwide, and 297

have been found to correlate well (7, 14, 35). We categorized the 73 strains into 12 major 298

PFGE types (type P1 was further categorized into 7 subtypes) and 11 PCR ribotypes. A 299

good correlation between PFGE and PCR ribotyping was observed, and as previously 300

reported, PFGE was able to discriminate strains more accurately than PCR ribotyping (7). 301

PFGE and PCR ribotyping showed that 16 out of 20 recurrent CDAD patients (80.0%) 302

were relapse cases caused by the same strains. This relapse rate was high compared with 303

previous reports observing rates of 25 to 87.5% (the remaining suffering re-infection or a 304

combination of relapse plus re-infection) (2, 4, 9, 32, 41, 45). Although some relapse cases 305

may include re-infection from the original strain in the patient’s environment, some may 306

occur through persistence of the original C. difficile isolate in the intestinal tract despite 307

antibiotic treatment (2, 9, 41). In such cases, recurrence may occur more frequently with 308

strains that have advantageous phenotypic characteristics for intestinal survival. 309

Most pathogenic C. difficile strains produce the two large clostridial glucosylating toxins 310

A and B, and these toxins are the main virulence factors in CDAD (26, 35). Previously, it 311

was thought that toxin A was the only toxin essential for the pathogenesis of CDAD, and 312

early experiments in animal models showed that sole administration of toxin A caused 313

symptoms of CDAD, but administration of toxin B without toxin A had no effect (10, 27, 314

35). However, recent studies report outbreaks caused by A−/B+ strains and therefore 315


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

18/37

conclude that toxin B also plays an important role in the virulence of C. difficile (10, 26, 316

27). Toxin A−/B+ strains have been isolated in many countries with a prevalence of 0 to 317

97.9% and recently seem to be on the increase (10, 23). In this study, only 2 out of 73 318

isolates (2.7%) were A−/B+ strains and their DNA genotypes were P8/R8 and P10/R8. 319

Although it is not clear why the prevalence of A−/B+ strains was relatively low, it may be 320

associated with the fact that C. difficile strains isolated from recurrent CDAD cases made 321

up the majority of the isolates used in this study. 322

It is known that certain DNA typing groups are hyper-virulent, such as the C. difficile 323

BI/NAP1/027 strain (28, 35). However, no correlation between the cytotoxicity and PFGE 324

or PCR ribotype were observed in this study. Therefore, virulence determinants may be 325

independent of DNA typing group. 326

It is important to determine the current resistance status of C. difficile and to find out the 327

correlation between the DNA type and antimicrobial susceptibilities. We found that all of 328

the isolates were susceptible to vancomycin and metronidazole, and high resistance rates 329

were also observed against other antibiotics, such as clindamycin (87.7%), ceftriaxone 330

(93.2%), erythromycin (87.7%) and ciprofloxacin (100%). The resistance rates of C. 331

difficile isolates against these antibiotics in Europe and Korea have been shown to be 332

similar to the results in this study (23, 30, 33) and high susceptibility of C. difficile isolates 333

to vancomycin and metronidazole has been reported by many researchers (1, 23, 30, 33). 334

Isolates with PFGE types P1, P3, P4, P8 and P10 and PCR ribotypes R1, R2, R3, R4 and 335

R8 showed high-level resistance against clindamycin, ceftriaxone, erythromycin and 336

ciprofloxacin. Although our DNA typing data cannot be compared with other reports, these 337


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

19/37

results indicate that antibiotic selection pressure may cause the selection of certain 338

dominant DNA typing groups as reported by Taori et al. (42). 339

From the results of epidemiological studies on the antimicrobial susceptibilities of C. 340

difficile isolates, it is well known that oral antibiotics such as the commonly used 341

vancomycin or metronidazole are the most efficacious for the treatment of CDAD. 342

However, approximately 20% of patients suffer a recurrence of CDAD following cessation 343

of antibiotic treatment. Recurrences usually occur within 5 to 8 days after withdrawal of 344

antibiotics, but their onset can be delayed for several weeks. Recurrence of CDAD is a 345

serious and difficult clinical problem in terms of prolongation of the duration of 346

hospitalization and increasing treatment costs (4, 36, 40). 347

PFGE type P1 and PCR ribotype R2 strains were most frequently found in single and 348

relapse cases. However, there was no correlation between DNA typing groups and infection 349

status, indicating that the incidence of recurrence does not depend on the DNA type of 350

isolates in cases treated with vancomycin or metronidazole. No correlation between the 351

susceptibility of isolates against these antibiotics and DNA typing group was observed. 352

We postulated that the sporulation and germination abilities of C. difficile are likely to be 353

related to the incidence of relapse after treatment with antibiotics due to increased 354

persistence in the intestinal tract and rapid growth prior to restoration of the normal 355

intestinal flora. Indeed, it has been reported that epidemic strains of C. difficile produced 356

more spores than the non-prevalent strains, and sporulation rate was increased by exposure 357

to cleaning agent or germicide (11, 44). 358

We found no correlation between either sporulation or germination rate with PFGE type, 359


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

20/37

PCR ribotype or infection status. However, the isolates recovered from relapse cases 360

showed a significantly higher germination rate when incubated on GAM agar plates 361

without sodium taurocholate, though this difference was not observed when taurocholate 362

was present. Sodium taurocholate is known to stimulate germination of C. difficile spores 363

(38, 46, 47), and the presence of a putative receptor for taurocholate has been recently 364

reported (34). Compared to the isolates recovered from single or re-infection cases, relapse 365

strains may be more sensitive to co-germinants other than taurocholate in the test medium, 366

or may have an atypical spore coat structure which facilitates germination. 367

According to Ramirez et al. (34), it is thought that the concentration of active 368

taurocholate in the lower intestine is negligible due to deconjugation by the intestinal flora 369

into taurin and cholate, and that depletion of flora by strong antibiotic therapy may increase 370

the concentration of active taurocholate. Therefore, a high germination ability in the 371

absence of co-germinants such as taurocholate may contribute to the increased re-infection 372

rates observed in these CDAD cases. Further work may be required to investigate the 373

effects of other co-germinants and intestinal concentrations of these chemicals during the 374

first infective episode and recurrence, but our results suggest that the germination ability of 375

C. difficile strains may be a potential risk factor for the recurrence of CDAD. 376

377

Acknowledgements 378

We thank Ms MW Njoroge and Dr CC Bii, Kenya Medical Research Institute, Nairobi, 379

Kenya, for technical assistance.380


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

21/37

References 381

1. Ackermann, G., A. Degner, H. Cohen, J. Silva, Jr., and A. C. Rodloff. 2003. 382

Prevalence and association of macrolide-lincosamide-streptogramin B (MLSB) 383

resistance with resistance to moxifloxacin in Clostridium difficile. J. Antimicrob. 384

Chemother. 51:599-603. 385

2. Alonso, R., S. Gros, T. Peláez, D. García-de-Viedma, M. Rodríguez-Créixems, and 386

E. Bouza. 2001. Molecular analysis of relapse vs re-infection in HIV-positive patients 387

suffering from recurrent Clostridium difficile associated diarrhoea. J. Hosp. Infect. 2001. 388

48:86-92. 389

3. Baines, S. D., R. O'Connor, K. Saxton, J. Freeman, and M. H. Wilcox. 2008. 390

Activity of vancomycin against epidemic Clostridium difficile strains in a human gut 391

model. J. Antimicrob. Chemother. 63:520-525. 392

4. Barbut, F., A. Richard, K. Hamadi, V. Chomette, B. Burghoffer, and J. C. Petit. 393

2000. Epidemiology of recurrences or reinfections of Clostridium difficile-associated 394

diarrhea. J. Clin. Microbiol. 38:2386-2388. 395

5. Bartlett, J. G., T. W. Chang, M. Gurwith, S. L. Gorbach, and A. B. Onderdonk. 396

Antibiotic-associated pseudomembranous colitis due to toxin-producing clostridia. N. 397

Engl. J. Med. 298:531-534. 398

6. Bidet, P., V. Lalande, B. Salauze, B. Burghoffer, V. Avesani, M. Delmee, A. Rossier, 399

F. Barbut, and J. C. Petit. 2000. Comparison of PCR-ribotyping, arbitrarily primed 400

PCR, and pulsed-field gel electrophoresis for typing Clostridium difficile. J. Clin. 401

Microbiol. 38:2484-2487. 402


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

22/37

7. Brazier, JS. 2001. Typing of Clostridium difficile. Clin. Microbiol. Infect. 7:428-431. 403

8. Choi, H. K., K. H. Kim, S. H. Lee, and S. J. Lee. 2011. Risk Factors for Recurrence 404

of Clostridium difficile Infection: Effect of Vancomycin-resistant Enterococci 405

Colonization. J. Korean Med. Sci. 26:859-864. 406

9. Do, A. N., S. K. Fridkin, A. Yechouron, S. N. Banerjee, G. E. Killgore, A. M. 407

Bourgault, M. Jolivet, and W. R. Jarvis. 1998. Risk factors for early recurrent 408

Clostridium difficile-associated diarrhea. Clin. Infect. Dis. 26:954-959. 409

10. Drudy, D, S. Fanning, and L. Kyne. 2007. Toxin A-negative, toxin B-positive 410

Clostridium difficile. Int. J. Infect. Dis. 11:5-10. 411

11. Fawley, W. N., S. Underwood, J. Freeman, S. D. Baines, K. Saxton, K. Stephenson, 412

R. C. Owens, Jr, and M. H. Wilcox. 2007. Efficacy of hospital cleaning agents and 413

germicides against epidemic Clostridium difficile strains. Infect. Control Hosp. 414

Epidemiol. 28:920-925. 415

12. Garey, K. W., S. Sethi, Y. Yadav, and H. L. DuPont. 2008. Meta-analysis to assess 416

risk factors for recurrent Clostridium difficile infection. J. Hosp. Infect. 70:298-304 417

13. Gumerlock, P. H., Y. J. Tang, F. J. Meyers, and J. Silva, Jr. 1991. Use of the 418

polymerase chain reaction for the specific and direct detection of Clostridium difficile in 419

human feces. Rev. Infect. Dis. 13:1053-1060. 420

14. Janezic, S, and M. Rupnik. 2010. Molecular typing methods for Clostridium difficile: 421

pulsed-field gel electrophoresis and PCR ribotyping. Methods. Mol. Biol. 646:55-65. 422

15. Kamiya, S., and S. P. Borriello. 1992. A non-haemagglutinating form of Clostridium 423

difficile toxin A. J. Med. Microbiol. 36:190-197. 424


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

23/37

16. Kamiya, S, H. Ogura, X. Q. Meng, and S. Nakamura. 1992. Correlation between 425

cytotoxin production and sporulation in Clostridium difficile. J. Med. Microbiol. 426

37:206-210. 427

17. Kamiya S, K. Yamakawa, H. Ogura, and S. Nakamura. 1987. Effect of various 428

sodium taurocholate preparations on the recovery of Clostridium difficile spores. 429

Microbiol. Immunol. 31:1117-1120. 430

18. Kato, H., H. Kita, T. Karasawa, T. Maegawa, Y. Koino, H. Takakuwa, T. Saikai, K. 431

Kobayashi, T. Yamagishi, and S. Nakamura. 2001. Colonisation and transmission of 432

Clostridium difficile in healthy individuals examined by PCR ribotyping and 433

pulsed-field gel electrophoresis. J. Med. Microbiol. 50:720-727. 434

19. Kato, H., N. Kato, K. Watanabe, K. Ueno, H. Ushijima, S. Hashira, and T. Abe. 435

1994. Application of typing by pulsed-field gel electrophoresis to the study of 436

Clostridium difficile in a neonatal intensive care unit. J. Clin. Microbiol. 32:2067-2070. 437

20. Kato, H., N. Kato, K. Watanabe, N. Iwai, H. Nakamura, T. Yamamoto, K. Suzuki, 438

S. M. Kim, Y. Chong, and E. B. Wasito. 1998. Identification of toxin A-negative, 439

toxin B-positive Clostridium difficile by PCR. J. Clin. Microbiol. 36:2178-2182. 440

21. Kato, N., C.-Y. Ou, H. Kato, S. L. Bartley, V. K. Brown, V. R. Dowell, and L. Ueno. 441

1991. Identification of toxigenic Clostridium difficile by the polymerase chain reaction. 442

J. Clin. Microbiol. 29:33-37. 443

22. Kelly, C. P., C. Pothoulakis, and J. T. LaMont. 1994. Clostridium difficile colitis. N. 444

Engl. J. Med. 330:257-262. 445

23. Kim, H, S. H. Jeong, K. H. Roh, S. G. Hong, J. W. Kim, M. G. Shin, M. N. Kim, H. 446


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

24/37

B. Shin, Y. Uh, H. Lee, and K. Lee. 2010. Investigation of toxin gene diversity, 447

molecular epidemiology, and antimicrobial resistance of Clostridium difficile isolated 448

from 12 hospitals in South Korea. Korean J. Lab. Med. 30:491-497. 449

24. Kim, J. W., K. L. Lee, J. B. Jeong, B. G. Kim, S. Shin, J. S. Kim, H. C. Jung, and I. 450

S. Song. 2010. Proton pump inhibitors as a risk factor for recurrence of 451

Clostridium-difficile-associated diarrhea. World J. Gastroenterol. 16:3573-3577. 452

25. Klaassen, C. H., H. A. van Haren, and A. M. Horrevorts. 2002. Molecular 453

fingerprinting of Clostridium difficile isolates: pulsed-field gel electrophoresis versus 454

amplified fragment length polymorphism. J. Clin. Microbiol. 40:101-104. 455

26. Kuehne, S. A., S. T. Cartman, J. T. Heap, M. L. Kelly, A. Cockayne, and N. P. 456

Minton. 2010. The role of toxin A and toxin B in Clostridium difficile infection. Nature. 457

467:711-713. 458

27. Lyras, D, J. R. O'Connor, P. M. Howarth, S. P. Sambol, G. P. Carter, T. 459

Phumoonna, R. Poon, V. Adams, G. Vedantam, S. Johnson, D. N. Gerding, and J. I. 460

Rood. 2009. Toxin B is essential for virulence of Clostridium difficile. Nature. 461

458:1176-1179. 462

28. McDonald, L. C., G. E. Killgore, A. Thompson, R. C. Owens, Jr, S. V. Kazakova, S. 463

P. Sambol, S. Johnson, and D. N. Gerding. 2005. An epidemic, toxin gene-variant 464

strain of Clostridium difficile. N. Engl. J. Med. 353:2433-2441. 465

29. McFarland, L. V., G. W. Elmer, and C. M. Surawicz. 2002. Breaking the cycle: 466

treatment strategies for 163 cases of recurrent Clostridium difficile disease. Am. J. 467

Gastroenterol. 97:1769-1775. 468


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

25/37

30. Mutlu, E, A. J. Wroe, K. Sanchez-Hurtado, J. S. Brazier, and I. R. Poxton. 2007. 469

Molecular characterization and antimicrobial susceptibility patterns of Clostridium 470

difficile strains isolated from hospitals in south-east Scotland. J. Med. Microbiol. 471

56:921-929. 472

31. Nakamura, S, K. Yamakawa, J. Izumi, S. Nakashio, and S. Nishida. 1985. 473

Germinability and heat resistance of spores of Clostridium difficile strains. Microbiol. 474

Immunol. 29:113-118. 475

32. O'Neill, G. L., M. H. Beaman, and T. V. Riley. 1991. Relapse versus reinfection with 476

Clostridium difficile. Epidemiol. Infect. 107:627-635. 477

33. Pituch, H, P. Obuch-Woszczatynski, D, Wultanska, G. Nurzynska, C. Harmanus, A. 478

Banaszkiewicz, A. Radzikowski, M. Luczak, A. van Belkum, and E. Kuijper. 2011. 479

Characterization and antimicrobial susceptibility of Clostridium difficile strains isolated 480

from adult patients with diarrhoea hospitalized in two university hospitals in Poland, 481

2004-2006. J. Med. Microbiol. 60:1200-1205. 482

34. Ramirez, N, M. Liggins, and E. Abel-Santos. 2010. Kinetic evidence for the presence 483

of putative germination receptors in Clostridium difficile spores. J. Bacteriol. 484

192:4215-4222. 485

35. Rupnik, M, M. H. Wilcox, and D. N. Gerding. 2009. Clostridium difficile infection: 486

new developments in epidemiology and pathogenesis. Nat. Rev. Microbiol. 7:526-536. 487

36. Shah, D, M. D. Dang, R. Hasbun, H. L. Koo, Z. D. Jiang, H. L. DuPont, and K. W. 488

Garey. 2010. Clostridium difficile infection: update on emerging antibiotic treatment 489

options and antibiotic resistance. Expert. Rev. Anti. Infect. Ther. 8:555-564. 490


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

26/37

37. Shakov, R, R. S. Salazar, S. K. Kagunye, W. J. Baddoura, and V. A. DeBari. 2011. 491

Diabetes mellitus as a risk factor for recurrence of Clostridium difficile infection in the 492

acute care hospital setting. Am. J. Infect. Control. 39:194-198. 493

38. Sorg, J. A., and A. L. Sonenshein. 2008. Bile salts and glycine as cogerminants for 494

Clostridium difficile spores. J. Bacteriol. 190:2505-2512. 495

39. Stubbs, S. L., J. S. Brazier, G. L. O'Neill, and B. I. Duerden. 1999. PCR targeted to 496

the 16S-23S rRNA gene intergenic spacer region of Clostridium difficile and 497

construction of a library consisting of 116 different PCR ribotypes. J. Clin. Microbiol. 498

37:461-463. 499

40. Surawicz, C. M. 2004. Treatment of recurrent Clostridium difficile-associated disease. 500

Nat. Clin. Pract. Gastroenterol. Hepatol. 1:32-38. 501

41. Tang-Feldman, Y., S. Mayo, J. Silva, Jr., and S. H. Cohen. 2003. Molecular analysis 502

of Clostridium difficile strains isolated from 18 cases of recurrent Clostridium 503

difficile-associated diarrhea. J. Clin. Microbiol. 41:3413-3414. 504

42. Taori, S. K., V. Hall, and I. R. Poxton. 2010. Changes in antibiotic susceptibility and 505

ribotypes in Clostridium difficile isolates from southern Scotland, 1979-2004. J. Med. 506

Microbiol. 59:338-344. 507

43. Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H. 508

Persing, and B. Swaminathan. 1995. Interpreting chromosomal DNA restriction 509

patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. 510

J. Clin. Microbiol. 33:2233-2239. 511

44. Wilcox, M. H., and W. N. Fawley. 2000. Hospital disinfectants and spore formation by 512


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

27/37

Clostridium difficile. Lancet. 14:1324. 513

45. Wilcox, M. H. , W. N. Fawley, C. D. Settle, and A. Davidson. 1998. Recurrence of 514

symptoms in Clostridium difficile infection--relapse or reinfection? J. Hosp. Infect. 515

38:93-100. 516

46. Wilson, K. H. 1983. Efficiency of various bile salt preparations for stimulation of 517

Clostridium difficile spore germination. J. Clin. Microbiol. 18:1017-1019. 518

47. Wilson, K. H., M. J. Kennedy, and F. R. Fekety. 1982. Use of sodium taurocholate to 519

enhance spore recovery on a medium selective for Clostridium difficile. J. Clin. 520

Microbiol. 15:443-446. 521

48. Wultańska, D, A. Banaszkiewicz, A. Radzikowski, P. Obuch-Woszczatyński, G. 522

Młynarczyk, J. S. Brazier, H. Pituch, and A. van Belkum. 2010. Clostridium difficile 523

infection in Polish pediatric outpatients with inflammatory bowel disease. Eur. J. Clin. 524

Microbiol. Infect. Dis. 29:1265-1270. 525

526


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

28/37

Legends to the Figures 527

Fig. 1. PCR ribotype patterns of C. difficile isolates. Lanes R1 to R11 show the 528

representative pattern of each ribotype. Lane M and n. c. show 50bp size markers and 529

negative control, respectively. 530

531

Fig. 2. Dendrogram and PFGE patterns of C. difficile isolates. Lanes P1a to P12 show the 532

representative pattern of each PFGE type. M shows the Lambda ladder size marker. The 533

dendrogram was constructed with Fingerprinting II Software (Bio-Rad laboratories, Inc). 534

535

Fig. 3. Spore formation rate (A), germination rate on GAM agar without sodium 536

taurocholate (B) and germination rate on GAM agar supplemented with 0.1% sodium 537

taurocholate (C) of C.difficile isolates compared to PFGE subtype. 538

539

Fig. 4. Spore formation rate (A), germination rate on GAM agar without sodium 540

taurocholate (B) and germination rate on GAM agar supplemented with 0.1% sodium 541

taurocholate (C) of C.difficile isolates compared to infection status. S (n=20), Rl (n=43) and 542

Ri (n=10) indicate the isolates from single, relapse and re-infection cases, respectively. Bars 543

represent mean ± S.D. Asterisk denotes statistical significance (p < 0.05).544


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

29/37

Table 1. Typing of C. difficile isolates. 545

546

PFGE PCR

ribotype

Toxin

producing

type

No. of C. difficile isolates (No. of

patients)

Major

type Subtype TMGa KYb

P1 a R1 A+, B+

7 (5)

5 (3)

42 (23)

b R2 A+, B+ 1 (1) 20 (8)

R3 A+, B+ 3 (1)

c R1 A+, B+ 9e, f (7)

R2 A+, B+ 1c (1) 2 (2)

d R2 A+, B+ 2 (1)

e R2 A+, B+ 2 (1)

f R2 A+, B+ 3d (2)

g R3 A+, B+ 1 (1)

P2 R4 A+, B+ 1 (1)

P3 R4 A+, B+ 11d, f (8)

P4 R4 A+, B+ 1c (1)

P5 R5 A−, B− 3 (1)

P6 R6 A+, B+ 1 (1)

P7 R7 A+, B+ 1 (1)

P8 R8 A−, B+ 1 (1)

P9 R9 A+, B+ 1c (1)

P10 R8 A−, B+ 1e (1)

P11 R10 A−, B− 1 (1)

P12 R11 A+, B+ 2 (1) a Tokyo Metropolitan Geriatric Hospital. 547 b Kyorin University Hospital. 548 c, d, e, f Different strains were isolated from one patient.549


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

30/37

Table 2. Major PFGE type and the number of patients with single infection, relapse and 550 re-infection. 551 552

Major PFGE

type

Single

infection Relapse Re-infection* Total

P1 11 12 4 27

P2 1 0 0 1

P3 4 2 2 8

P4 0 0 1 1

P5 0 1 0 1

P6 1 0 0 1

P7 1 0 0 1

P8 1 0 0 1

P9 0 0 1 1

P10 0 0 1 1

P11 1 0 0 1

P12 0 1 0 1

Total 20 (20) 16 (16) 9 (4) 45 (40)

* : Cumulative number of patients. 553 ( ): Actual number of patients.554


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

31/37

Table 3. Toxin type of C. difficile clinical isolates compared to infection status. 555 556

Toxin type

Number of C. difficile isolates (%)

Single

infection Relapse Re-infection Total

A +, B + 18 (90.0) 40 (93.0) 9 (90.0) 67 (91.8)

A −, B + 1 (5.0) 0 (0.0) 1 (10.0) 2 (2.7)

A −, B − 1 (5.0) 3 (7.0) 0 (0.0) 4 (5.5)

Total 20 (100) 43 (100) 10 (100) 73 (100)

557


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

32/37

Table 4. Antibiotic susceptibility of C. difficile clinical isolates. 558 559

Antibiotic

MICs (mg/L) No. of

resistant

isolates

(n=73) MIC50 MIC90 Range Breakpoint

Vancomycin 2 4 1 – 8 ≥ 32 0 (0%)

Metronidazole 0.19 0.25 0.094 – 0.25 ≥ 32 0 (0%)

Clindamycin >256 >256 1 – >256 ≥ 8 64 (87.7%)

Ceftriaxone >256 >256 32 – >256 ≥ 64 68 (93.2%)

Erythromycin >256 >256 0.38 – >256 ≥ 8 64 (87.7%)

Ciprofloxacin >32 >32 6 – >32 ≥ 4 73 (100%)

560


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

33/37

Table 5. Comparison of antibiotic susceptibility with PFGE subtype. 561 562

PFGE

type

MIC50 (mg/L)

Vancomycin Metronidazole Clindamycin Ceftriaxone Erythromycin Ciprofloxacin

P1a 1.5 0.19 >256 >256 >256 >32

P1b 3 0.19 >256 >256 >256 >32

P1c 3 0.125 >256 >256 >256 >32

P1d 2 0.125 >256 >256 >256 >32

P1e 2 0.19 >256 >256 >256 >32

P1f 1.5 0.19 >256 >256 >256 >32

P1g 2 0.19 >256 >256 >256 >32

P2 1.5 0.19 2 48 0.5 6

P3 1.5 0.19 >256 >256 >256 >32

P4 2 0.19 >256 128 >256 >32

P5 2 0.25 1.5 96 0.5 12

P6 3 0.125 4 64 0.5 8

P7 1.5 0.19 2 32 0.38 6

P8 1.5 0.25 >256 192 >256 >32

P9 1.5 0.19 3 32 0.38 8

P10 1.5 0.25 >256 >256 >256 >32

P11 3 0.19 >256 64 >256 8

P12 1.5 0.125 1 32 0.38 6

563


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

34/37

Fig. 1. PCR ribotype patterns of C. difficile isolates. Lanes R1 to R11 show the 564

representative pattern of each ribotype. Lane M and n. c. show 50bp size markers and 565

negative control, respectively. 566

567

568 569


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

35/37

Fig. 2. Dendrogram and PFGE patterns of C. difficile isolates. Lanes P1a to P12 show the 570

representative pattern of each PFGE type. M shows the Lambda ladder size marker. The 571

dendrogram was constructed with Fingerprinting II Software (Bio-Rad laboratories, Inc). 572

573

574

575


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

36/37

Fig. 3. Spore formation rate (A), germination rate on GAM agar without sodium 576 taurocholate (B) and germination rate on GAM agar supplemented with 0.1% sodium 577 taurocholate (C) of C. difficile isolates compared to PFGE subtype. 578 579

580 581


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

37/37

Fig. 4. Spore formation rate (A), germination rate on GAM agar without sodium 582 taurocholate (B) and germination rate on GAM agar supplemented with 0.1% sodium 583 taurocholate (C) of C. difficile isolates compared to infection status. S (n=20), Rl (n=43) 584 and Ri (n=10) indicate the isolates from single, relapse and re-infection cases, respectively. 585 Bars represent mean ± S.D. Asterisk denotes statistical significance (p < 0.05). 586 587

588


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

700bp

600

500450400350

300

250

M R1 R2 R3 R4 R5 R6 M R7 R8 R9 R10 R11 n.c. M


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

776.0kb

727.5679.0630.5582.0533.5485.0436.5388.0339.5291.0242.5

194.0

145.5

97.0

48.5

M P1a P1b P1c P1d P1e P1f P1g P2 P3 P4 P5 P6 P7 P8 P9 P10 P11 P12 M

60

80

100

Sim

ilarity (%)


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

0

20

40

60

80

100

%

0

20

40

60

80

100

120

%

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

%

P1a 1c 1e 1g 3 5 7 9 111b 1d 1f 2 4 6 8 10 12

P1a 1c 1e 1g 3 5 7 9 111b 1d 1f 2 4 6 8 10 12

P1a 1c 1e 1g 3 5 7 9 111b 1d 1f 2 4 6 8 10 12


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

0

20

40

60

80

100

%

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

%

0

20

40

60

80

100

120

%


http://jcm.asm

.org/D

ownloaded from

http://jcm.asm.org/

jcm accepts, published online ahead of print on 28 december … · 1/37 1 title 2 molecular and...

Documents