jm castro & db dingwell nature 461 , 780 - 783 (2009) doi:10.1038/nature08 458

JM Castro & DB Dingwell Nature 461, 780-783 (2009) doi:10.1038/nature08458 H 2 O-saturated phase relations in the Chaitén rhyolite.

Upload: angeni

Post on 04-Jan-2016

28 views

Category:

Documents

1 download

Report

Download

Embed Size (px):

DESCRIPTION

H 2 O-saturated phase relations in the Chaitén rhyolite. JM Castro & DB Dingwell Nature 461 , 780 - 783 (2009) doi:10.1038/nature08 458. - PowerPoint PPT Presentation

TRANSCRIPT

JM Castro & DB Dingwell Nature 461, 780-783 (2009) doi:10.1038/nature08458

H2O-saturated phase relations in the Chaitén rhyolite.

Supplementary information - Nature · © 200 9 Macmillan Publishers Limited. ... 10.1038/nchem.290 Supplementary information 6 ... 10.1038/nchem.290 Supplementary information 7 Preparation

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

Published in Nature Materials (2016) doi:10.1038/nmat4569

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

GI Motility online (May 2006) | doi:10.1038/gimo12

Nature , 2008, Doi:10.1038/nature07103

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

XQ Wang et al. Nature 461 , 947 - 955 (2009) doi:10.1038/nature08 435

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

GI Motility online (May 2006) | doi:10.1038/gimo6

doi:10.1038/nature06481 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo46

Macroporous nanowire nanoelectronic scaffolds …cmliris.harvard.edu/assets/10.1038-nmat3404.pdfARTICLES PUBLISHED ONLINE: 26 AUGUST 2012 |DOI:10.1038/NMAT3404 Macroporous nanowire

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

doi:10.1038/nature05150 LETTERS

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

DOI: 10.1038/NPHYS3211 Supplementary Information for

17 September 2009 doi:10.1038/nature08355 LETTERS

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

1 November 2007 doi:10.1038/nature06221 LETTERS

DOI: 10.1038/ncomms1280 molecular dynamics of single

doi:10.1038/nature12886 Neanderthal from the Altai

Nature Biotechnology: doi:10.1038/nbt

Magma Degassing and Fragmentation: Recent Experimental ...pages.mtu.edu/~raman/papers2/MagmaDegasFrag.pdf · 2 Chapter 1: D.B. Dingwell /Magma Degassing and Fragmentation: Recent

GI Motility online (May 2006) | doi:10.1038/gimo48

DOI: 10.1038/NMAT4204 Supplementary Information...NATURE MATERIALS | . DOI: 10.1038/NMAT4204. , , – – |

Research and Innovation Research and Innovation Prof. Donald B. Dingwell ERC Secretary General ''Destination Europe'' conference, San Francisco, 6-7 December

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

SUPPLEMENTARY INFORMATION - Nature · SUPPLEMENTARY INFORMATION doi: 10.1038/nmat2460 nature materials ... Sulfur outside of structure of ... 10.1038/nmat2460 SUPPLEMENTARY INFORMATION

Magma Degassing and Fragmentation: Recent Experimental ...raman/papers2/MagmaDegasFrag.pdf · 2 Chapter 1: D.B. Dingwell /Magma Degassing and Fragmentation: Recent Experimental Advances