journal of bioux~ical chemistry vol. 269, no. issue of ...structural motifs, the ala2* and argsse...

JOURNAL OF BIOUX~ICAL CHEMISTRY Vol. 269, No. 10, Issue of March 11, pp. 7587-7592, 1994 Printed in U.S.A.

Two Mutations in a Conserved Structural Motif in the Insulin Receptor Inhibit Normal Folding and Intracellular Transport of the Receptor*

(Received for publication, September 21, 1993)

37134 Verona, Italy

Insulin initiates its biological response by binding to the extracellular domain of the insulin receptor. The N-terminal half of the a-subunit contains several repeats of a loosely conserved motif consisting of a central glycine plus several hydrophobic amino acid residues upstream from the glycine, Hy+-Xaa-Xaa-Hy+-Xaa-Hy+- Hy+-Xaa-Gly (where Hy+ represents a hydrophobic amino acid residue). This structural motif has been proposed to be important in determining the three-dimensional structure of the insulin binding domain. We have identified two naturally occurring mutant alleles of the insulin receptor gene in an insulin-resistant patient, substitution of Ala for and Arg for GlgSe. The mutations alter conserved amino acid residues in two dis- tinct repeats of the structural motif described above. When mutant cDNAs were expressed in N”3T3 cells, both mutations severely impaired proteolytic processing of the proreceptor to mature a- and P-subunits. Transport of mutant receptors to the plasma membrane was also impaired. However, the minority (<10%) of receptors that were eventually transported to the plasma membrane retained the ability to bind insulin with normal affinity and to undergo insulin-stimulated phosphorylation. In conclusion, the effects of these naturally occurring mutations provide experimental support for the importance of the conserved glycine-containing structural motifs described above. By interrupting these structural motifs, the Ala2* and ArgSSe mutations pre- vent normal folding of the insulin receptor a-subunit, thereby inhibiting post-translational processing and intracellular transport of the mutant receptors.

Functionally important structural motifs in proteins can be identified by several complementary strategies. First, compari- son of the primary structure of related proteins may identify conserved amino acid sequences (1). Conservation of these sequences suggests the existence of selective pressure to preserve important functions of the protein. Second, random mutagen-

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

betes Foundation International. 5 Supported by a generous fellowship provided by the Juvenile Dia-

Milan, Italy. ll Present address: Dept. of Internal Medicine, Ospedale San Raffaele,

kins University School of Medicine, Baltimore, MD. ** Present address: Division of Geriatric Medicine, The Johns Hop-

Health, Bldg. 10, Rm. 83-239, Bethesda, MD 20892. Tel.: 301-496-4658; $$ To whom correspondence should be addressed: National Inst. of

Fax: 301-402-0573.

esis followed by selection for defects in function can identify “hot spots” for mutations. I t is likely that these hot spots rep- resent functionally important structural motifs. Such random mutagenesis can be carried out experimentally. Alternatively, in investigation of genetic diseases, one is observing the results of random mutations that have occurred spontaneously (2, 3). Any naturally occurring mutation that causes disease must necessarily impair an important biological function of the gene product.

The insulin receptor provides an excellent illustration of these principles. For example, at least two important amino acid sequence motifs have been identified in protein kinases, the Gly-Xaa-Gly-Xaa-Xaa-Gly sequence in the ATP binding site and the Arg-Asp-Leu-Xaa-Xaa-Xaa-Asn sequence in the “cata- lytic loop” of the enzyme. Both of these motifs were originally identified as conserved sequences in protein kinases (1, 4, 5). Subsequently, the functional roles of the motifs were inferred from x-ray crystallographic studies. Furthermore, several mutations causing genetic forms of insulin resistance have been mapped to these conserved sequence motifs ( 6 8 ) . The fact that these mutations cause disease provides direct evidence that the motifs are crucial to the protein’s function in vivo.

Previously, Bajaj et al. (9) identified an amino acid sequence that was loosely conserved in two families of receptor tyrosine kinases, the insulin receptor family and the epidermal growth factor receptor family. This motif is characterized by the presence of a central glycine residue that is hypothesized to allow for a turn in the secondary structure of the protein. Down- stream from the glycine residue is a sequence that is predicted to form P-sheet. Upstream from the glycine residue is a sequence that is predicted to form a-helix. Furthermore, there are several conserved hydrophobic amino acid residues at positions upstream from the glycine residue as follows: Hy+-Xaa- Xaa-Hy+-Xaa-Hy+-Hy+-Xaa-Gly, where Hy+ represents a hydrophobic amino acid residue. (The hydrophobic amino acid residue at position -3 is less highly conserved than the hydrophobic residues at positions -2, -5, and -8.) Receptors for insulin and epidermal growth factor both contain at least eight repeats of this motif. These repeats are organized into two noncontiguous domains, each of which contains at least four repeats.

In the present work, we characterized two naturally occurring mutations that were identified in a patient with lepre- chaunism, a genetic syndrome associated with extreme insulin resistance (10). Both of these mutations map to conserved amino acid residues in glycine-centered motifs. In one case, a central glycine (Gly366) is mutated to an arginine residue. In the other case, a hydrophobic residue (Valz8) is mutated to an alanine. Both mutations impair post-translational processing and intracellular transport of the receptors to the plasma mem-

7587

7588 Glycine-centered Motif in Insulin Receptor TABLE I

Sequences of synthetic oligonucleotides

Ullrich et al. (31). Nucleotides in introns are numbered with respect to Nucleotides (nt) in exons are numbered according to the system of

the distance from the junction with the neareast exons, Oligonucleo- tides, 1, 3, and 5 correspond to the nucleotide sequence of the sense strand of DNA. Oligonucleotides 2,4, and 6 correspond to the nucleotide sequence of the antisense strand of DNA. Oligonucleotides 4 and 5 have the sequence of the Ar$66 mutant allele. (The mutated nucleotide is printed in boldface type and is underscored.)

nucleotide Oligo- Sequence Location

1 CCCTGATCCTTCTGATGCAT nt - 70 + -50; intron 1 2 GCTTTCTAGAACAAGGCACGA nt + 55 + +34; intron 2 3 GTGAACTTCAGCTTCTGCCAGGAC nt 891 + 914; exon 3 4 TTTAGATACCOTGAAATTTCT nt 1236 + 1216; exon 5 5 AGAAATTTCA~GGTATCTAAA nt 1216 + 1236; exon 5 6 GCTCACTGTCTTCCGCCTGC nt 2052 - 2033; exon 9

brane. I t is likely that, by disrupting the glycine-centered motifs, these two mutations inhibit the folding of the proreceptor into its normal conformation. These observations support the hypothesis that the glycine-centered motif is important in determining the three-dimensional structure of the receptor.

EXPERIMENTAL PROCEDURES Expression of AlaZ8 and Mutant Receptors in NIH-3T3 Cells-

Exon 2 of the insulin receptor gene was amplified by polymerase chain reaction, using LepNer-1 genomic DNA as template and oligonucleotides 1 and 2 as primers (Table I). The polymerase chain reaction product was digested with KpnI and EcoRV, and the fragment (base pairs 167-615) containing the mutant codon (Ala2*) was exchanged into a plasmid containing full-length wild type insulin receptor cDNA. Ar$" mutant cDNA was constructed as follows. Two overlapping fragments of wild type insulin receptor cDNA (base pairs 891-1236 and 1216-2052) were amplified using two sets of primers (oligonucleotides 3 plus 4 and 5 plus 6) (Table I). After purification using a Centricon 100 ultrafiltra- tion device (Amicon; Beverly, MA), the two fragments of amplified cDNA were combined and were amplified by polymerase chain reaction using oligonucleotides 3 plus 6. The new product, spanning base pairs 891- 2052, was digested by EcoRI plus BglII, and the fragment (base pairs 1013-1582) was exchanged into a plasmid containing the full-length wild type insulin receptor cDNA. The presence of the mutations in both cloned cDNAs was confirmed by sequencing. The mutant cDNAs were ligated into an expression vector containing the bovine papilloma virus origin of replication and the murine metallothionein promoter (Phar- macia LKB Biotechnology Inc.). NIH-3T3 cells were transfected by the calcium-phosphate transfection method with a mixture of the expression vector (10 pg of either wild type or mutant insulin receptor cDNA) plus a vector (2.0 pg) containing the neomycin resistance gene. After selection for resistance to the antibiotic G418 (600 pg/ml; Life Technolo- gies, Inc.), stable transfectants expressing either wild type or mutant insulin receptors were cloned.

Insulin Binding--Transfected NIH-3T3 cells were cultivated in 24- well plates. The 1251-labeled insulin binding assay was camed out as described elsewhere (8). Briefly, on the day of the experiment, transfected cells were grown to confluence in 24-well plates. Cells were washed once with ice-cold phosphate-buffered saline (PBS)' and incubated overnight a t 4 "C in bindmg buffer (120 m NaC1,1.2 m MgSO,, 2.5 m KCl, 15 m Na acetate, 10 m glucose, 1 m EDTA, 50 m HEPES pH 7.8, 10 mg/ml bovine serum albumin) containing 0.1 ng/ml "%labeled insulin (receptor grade, 360 Ci/g; DuPont NEN) in the presence of varying concentrations of unlabeled insulin (1 ng/ml-10 pg/ml). Thereafter, the cells were washed twice with ice-cold PBS to remove unbound insulin, the cells were solubilized in 1 N NaOH for 2 h, and cell-associated radioactivity was quantitated in a y counter.

Labeling of Cell Surface Receptors by Biotinylation-NIH-3T3 cells expressing either wild type or mutant insulin receptor cDNAs were surface-labeled by biotinylation. Receptors were immunoprecipitated, run on SDS-polyacrylamide gel electrophoresis, and detected on elec- troblots incubated with enzyme-labeled streptavidin, as described elsewhere (8, 11).

Metabolic Labeling of Insulin Receptors in Dansfected Cells-Cells

The abbreviation used is: PBS, phosphate-buffered saline.

expressing wild type or mutant insulin receptors were incubated at 37 "C in methionine-free, cysteine-free Dulbecco's modified Eagle's medium (Biofluids, Rockville, MD) supplemented with 10% heat-inacti- vated bovine serum (Upstate Biotechnology Inc., Lake Placid, N Y ) , L- glutamine, and antibiotics (ABI, Columbia, MD). After 1 h, the medium was replaced with fresh medium containing 0.3-0.5 mCi/plate of [35Slmethionine + [35Slcysteine mixture (Tran35S-label; ICN Biomedi- cals, Inc., Irvine, Ca), and the cells were further incubated for 20 min at 37 "C. For the chase period, the cells were washed twice with PBS, and complete medium was added for the times indicated in each experiment. At each time point, cells were washed with ice-cold PBS and solubilized in buffer containing octyl glucoside (20 m), Triton X-100 (0.5%), NaCl (0.3 M), sodium phosphate (25 m, pH 7.4), and protease inhibitors. The supernatants were precipitated with anti-receptor antibody (rAb-50) directed against the P-subunit of the insulin receptor. The immunoprecipitates were analyzed by NaDodS0,-polyacrylamide gel electrophoresis followed by fluorography in the presence of 1 M sodium salicylate (pH 7.0) as enhancer.

Oligomeric Structure of Insulin Receptors in Dansfected Cells-Cells were lysed in lysis buffer (50 m HEPES, 150 m NaCl, 1% Triton X-100, 0.1 M sodium fluoride, 4 m sodium pyrophosphate, 2 m vanadate, and protease inhibitors) in the absence of reducing agents and in the presence of N-ethylmaleimide (5 m) to stabilize the disulfide- bonded oligomeric structures plus urea (3 M) for denaturation. The samples were incubated at room temperature for 15 min and prepared for NaDodS0,-polyacrylamide gel electrophoresis without boiling. The proteins were transferred by electroblotting onto nitrocellulose mem- branes. Insulin receptors were detected with polyclonal antibody against the @-subunit (1:1000, rAB50) in rinse buffer (PBS, 0.1% Tween- 20) with 10% nonfat milk. The blots were incubated overnight a t 4 "C. Then the blots were washed extensively with rinse buffer and incubated with horseradish peroxidase-conjugated, goat anti-rabbit I g G (1:10,000; Amersham, United Kingdom) for 30 min at room temperature. The blots were then washed again with rinse buffer followed by enhanced chemiluminescence (ECL; Amersham, UK).

Insulin-stimulated Receptor Phosphorylation in Intact Cells- Confluent cells were incubated in the presence or absence of 10"j M insulin for 1 min at 37 "C. The incubation medium was aspirated, and the cells were immediately frozen with liquid nitrogen. Cells were lysed in cold lysis buffer (50 m HEPES, 150 IILM NaCl, 1% Triton X-100, 0.1 M sodium fluoride, 4 m sodium pyrophosphate, 2 m vanadate, and protease inhibitors). Receptors were immunoprecipitated with anti-receptor antibody plus protein A-agarose beads. The beads were washed twice with cold washing buffer (50 mM HEPES, 150 m NaCl, 0.1% Triton X-100, 0.1% SDS, 1 m EDTA, 2 m vanadate). The immunoprecipitates were analyzed by NaDodS0,-polyacrylamide gel electrophoresis and transferred by electroblotting onto nitrocellulose mem- branes. Phosphotyrosine-containing proteins were detected with monoclonal anti-phosphotyrosine antibody (1:4000, Upstate Biotechnol- ogy Inc.) in rinse buffer containing 10% nonfat milk. The blots were incubated overnight at 4 "C. Then the blots were washed extensively with rinse buffer and incubated with horseradish peroxidase-conjugated, sheep anti-mouse IgG (15000; Amersham, U K ) for 1 h at room temperature. The blots were washed again with the rinse buffer followed by ECL (Amersham, U K ) detection.

RESULTS

Expression of Mutant Insulin Receptor in Dansfected NZH- 3T3 Cells-NIH-3T3 cells were stably transfected with cDNA encoding wild type (Va128/Gly366), Alaz8 mutant, or Ar$66 mutant insulin receptors. We assayed lZ5I-labeled insulin binding to the surface of clonal lines of transfected cells. As shown by the Scatchard plots, the number of insulin receptors on the surface of cells expressing Alazs mutant receptors was 5-10- fold lower than on the cells expressing wild type receptor (Fig. 1, left panel). However, there was no major change in the shape of the Scatchard plot. Thus, we conclude that the Alaz8 mutation did not have a major effect upon the affinity of insulin binding. The cells expressing Ar$66 mutant insulin receptors bound approximately 2-3-fold more lz5I-labeled insulin than the nontransfected cells. Nevertheless, there was a >20-fold decrease in lZ5I-labeled insulin binding as compared with the cells expressing wild type insulin receptors (Fig. 1, rightpanel). In fact, the level of binding was so low that it was difficult to estimate the affinity of insulin binding.

Glycine-centered Motif in Insulin Receptor 7589

0.6

E I - a v) C , 0.4 - -

In (Y I-

Q)

0.2 2 . U C

0 a m

0.0 0 .0 1 .o

Bound Insulin (ng)

0.6

E

a v) C , 0.4

I - - -

v) (Y v-

Q)

0.2 2 . U C

0 a m

0.0 0 . 0 1 .o

Bound Insulin (ng) FIG. 1. Scatchard plots of insulin binding to intact cells. Cells transfected with either wild type (WT) or mutant (Ala2*, left panel; Ar$=,

right panel) receptor cDNAs were plated on 24-well plates. The cells were incubated in the presence of 12SI-labeled insulin and increasing amounts of unlabeled insulin as described under "Experimental Procedures." The experiments were carried out in triplicate.

Labeling of Cell Surface Receptors-Cell surface labeling provides a measure of the number of receptors in the plasma membrane that does not depend upon the ability to bind insulin. Cells were incubated with NHS-LC-biotin to biotinylate cell surface proteins. Thereafter, insulin receptors were immunoprecipitated, and the immunoprecipitates were analyzed by NaDodS04-polyacrylamide gel electrophoresis followed by electroblotting. Receptors were detected by probing the blots with enzyme-labeled streptavidin. In the cells expressing wild type (Va128/Gly366) receptors, both a- and P-subunits were detected, with the a-subunit being labeled more intensely than the P-subunit (Fig. 2). In the cells expressing mutant receptors, both subunits were detected and had normal electrophoretic mobilities. However, there was a marked decrease in the inten- sity of labeling of both mutant receptors (Fig. 2), consistent with the marked decrease in the number of insulin binding sites as judged by 1251-labeled insulin binding studies (Fig. 1). As was observed in the studies of insulin binding (Fig. 11, the cells expressing the Arg366 mutant insulin receptors had -90% fewer receptors than the cells expressing Ala2* mutant receptors (Fig. 2).

Metabolic Labeling of Insulin Receptors-We hypothesized that the decrease in the number of receptors expressed on the cell surface might be due to a defect in post-translational processing and transport of receptors to the plasma membrane. To investigate receptor processing, cells were pulse-labeled for 20 min with [35S]methionine + [35S]cysteine followed by varying periods of chase (0-10 h) in the presence of unlabeled amino acids. At the end of the pulse period, the major labeled band immunoprecipitated by anti-receptor antibody corresponds to the receptor precursor (M, = 190,000). In cells expressing the wild type (Va128/Gly366) receptor, the precursor is processed rapidly (within 2.5 h) to mature a- and p-subunits (Fig. 3A) . We did not detect mature a- and P-subunits in cells expressing either Alaz8 (Fig. 3B) or Arg366 (Fig. 3C) in these metabolic labeling experiments. Nevertheless, as demonstrated by the more sensitive cell surface labeling technique (Fig. 21, a small percentage of mutant proreceptors are processed to mature receptors and are eventually transported to the plasma membrane.

Oligomeric Structure of Recombinant Insulin Receptors- Early in the course of post-translational processing, the prore-

Arg3@ NT Ala2* WT I II II II I

4 a

4 P

4 a

4i3

FIG. 2. Labeling of cell surface insulin receptors by biotinylation of transfected cells. Cell surface receptors were biotinylated as described under "Experimental Procedures." The following cell lines were studied: cells expressing mutant insulin receptors; nontransfected NIH-3T3 cells (NT) ; cells expressing Ala2" mutant insulin receptors; cells expressing wild type insulin receptors (WT). Cells were solubilized, insulin receptors were immunoprecipitated, and immunoprecipitates were analyzed by NaDodS0,-polyacrylamide gel electrophoresis. Proteins were transferred by electroblotting, blots were probed with streptavidin labeled with horseradish peroxidase, and bands were detected by enhanced chemiluminescence. To facilitate comparisons of band intensities, the blot was exposed to x-ray film for two different lengths of time (upper panel, 10 s; lower panel, 2 s). The arrowheads labeled a and 13 indicate the two subunits of the receptor.

ceptor dimerizes (3,12-14). Subsequently, proteolytic cleavage converts the proreceptor dimer (D) into the a2& heterote- trameric structure (T) characteristic of the mature receptor. Because there were defects in post-translational processing of both mutant receptors, we inquired whether the Alaz8 and Arg366 mutations inhibited assembly of the oligomeric forms of the receptor. Transfected cells were solubilized in the presence of N-ethylmaleimide to stabilize the disulfide-bonded oligomeric structures. The extracts were analyzed by immunoblotting using an antibody directed against the @-subunit of the receptor as a probe (Fig. 4). The majority of the wild type

7590 Glycine-centered Motif in Insulin Receptor

0 1 2.5 4 6 10 hrs

WT

, 4 proreceptor

4 a

4 P

r l 4 proreceptor

4 a

4 P

FIG. 3. Metabolic labeling of insulin receptors in transfected cells. Cells expressing either wild type insulin receptors (upper panel, WT), Ala2R mutant insulin receptors (middle panel), or Arew mutant insulin receptors (lower panel) were pulse-labeled with [35Slmethionine + [RsSlcysteine mixture for 20 min, followed by chase periods (0-10 h) in the absence of labeled amino acids. Thereafter, receptors were immunoprecipitated with anti-receptor antibody. The immune complexes were analyzed by NaDodS0,-polyacrylamide gel electrophoresis followed by fluorography.

receptors are assembled into oligomers, either proreceptor dimers ( D ) or a2P2 tetramers (2'). We analyzed four independ- ent clonal cell lines expressing wild type receptors. While they expressed variable amounts of receptor, the oligomeric forms ( D and 2') predominated in all four cell lines. Clone 3 of wild type cells (Fig. 4, lane 3) and cells expressing the Ala28 mutant receptor (Fig. 4, lane 5) were compared, because they bound similar quantities of 1251-labeled insulin. Similarly, clone 4 of wild type cells (Fig. 4, lane 4 ) and cells expressing the Ar$66

mutant receptor (Fig. 4, lane 6) were compared, because they bound similar quantities of 1251-labeled insulin. With both mutant receptors, the monomeric proreceptor (M) predominated. While a minority of the Ala2u mutant receptors were assembled into oligomeric structures (Fig. 4, lane 51, we did not detect oligomeric forms of the mutant receptor.

Insulin-stimulated Phosphorylation of Receptor in Duns- fected Cells-Despite the defect in post-translational processing and intracellular transport, both mutant receptors were expressed a t low level in the plasma membrane. Therefore, we inquired whether the mutant receptors on the cell surface were capable of insulin-stimulated autophosphorylation. Insulin in- creased the phosphotyrosine content of the receptor P-subunits in cells transfected with wild type (Va12u/Gly366), Ala28 mutant, and Art$j6'j mutant insulin receptors (Fig. 5A). The phosphotyrosine content was decreased (Fig. 5 A ) in the cells expressing the two mutant receptors, more or less in proportion to the decrease in the number of receptors expressed on the cell surface (Figs. 1 and 2). To facilitate direct comparisons, we inves-

I II II I1 I

kD 1

200, ,

97* t

' 4 D,T

r M

J 1 2 3 4 5 6 7

FIG. 4. Oligomeric structure of insulin receptors in transfected cells. Cells expressing various amounts of wild type insulin receptors (lanes 1 4 ) , mutant receptors (Ala2R, lane 5; kg3%, lane 6) , or nontransfected NIH-3T3 cells (lane 7 ) were analyzed for their ability to be processed and assembled from monomeric proreceptor (M) into oligomers, either proreceptor dimers (D) or a2P2 tetramers (7') . Total cell extracts were analyzed by NaDodS0,-polyacrylamide gel electrophoresis under nonreducing conditions as described under "Experimental Procedures." Insulin receptors were detected by anti-receptor antibodies and enhanced chemiluminescence. The clone of cells expressing wild type receptors shown in lane 3 and the cells expressing the Ala2* mutant receptors (lane 5) had similar numbers of cell surface receptors. Like- wise, cells expressing the wild type receptors shown in lune 4 bound similar quantities of 12"I-labeled insulin as the cells expressing mutant receptors (lane 6).

tigated receptor phosphorylation in several clonal cell lines expressing variable numbers of wild type insulin receptors on their cell surface (Fig. 5B). For example, the cells expressing Ala28 mutant receptors (Fig. 5B, lane 2) bound approximately the same amount of lZ5I-labeled insulin as the cells expressing wild type receptor shown in lane 5 (Fig. 5B). Similarly, the cells expressing Art$jsS mutant receptors (Fig. 5B, lane 1 ) bound approximately the same amount of 1251-labeled insulin as the cells expressing wild type receptor shown in lanes 3 and 4 (Fig. 5B). Thus, when we compared cells expressing similar numbers of insulin receptors on the cell surface constant, insulin-stimulated receptor phosphorylation appeared to be normal in the mutant receptors (Fig. 5B).

DISCUSSION

During the last decade, considerable progress has been made in defining structure-function relationships of the insulin receptor. Most of what is known has derived from mutational analysis of the receptor. In this investigation, we have focused upon the N-terminal half of the a-subunit, the region of the receptor that contains the insulin binding site ( lS17) . At least 10 missense mutations have been identified in the portion of the insulin receptor gene (exons 1-5) encoding this half of the receptor a-subunit in insulin-resistant patients (10,13-14," 26). Most of these mutations impair post-translational processing and intracellular transport of the receptor from the endoplasmic reticulum to the plasma membrane (13-14, 19-26). Three mutations are located in the cysteine-rich domain (14, 20, 22, 25). The remaining mutations are located in two domains (L1 and L2) that flank the cysteine-rich domain. Each of these two flanking domains contains four repeats of a glycine- centered sequence motif (9). There are several features that define this loosely conserved motif, e.g. a central glycine residue and hydrophobic amino acid residues located 2,3,5, and 8 amino acid residues upstream of the central glycine. In this report, we have studied two mutations that disrupt this conserved sequence motif. The Gly366-Arg mutation eliminates the central glycine in the third repeat of the motif in domain L2. The ValzU-+Ala mutation eliminates a conserved hydrophobic residue in the first repeat of the motif in domain L1. Pre-

Glycine-centered Motif in Insulin Receptor 7591

A ArgS6 NT WT Ala2*

Insulin 10'6M ~~~~ kD

L 1 2 3 4 5 6 7 8

J 4 6 9

4 P

1 2 3 4 5 6 7 FIG. 5. Ineulii-stimulated receptor phosphorylation in intact

cells. A, cells expressing the A@= mutant insulin receptors, nontransfected NIH-3T3 cells (NT), cells expressing wild type insulin receptors (WT), and cells expressingAlaZ8 mutant insulin receptors were serum- starved for several hours. The cells were then incubated in the presence (lanes 2 .4 , 6.8) or the absence (lanes I , 3.5, 7) of insulin (lo4 M) a t 37 "C for 1 min. The insulin receptors were immunoprecipitated by an antibody against the insulin receptor @subunit (rAb-50) and further analyzed by immunoblotting using anti-phosphotyrosine antibodies and enhanced chemiluminescence to detect the phosphorylated receptors. B, the autophosphorylation ability of cells expressing the mutant insulin receptor cDNAs (Arg3=, lane 1; Alaz8, lane 2 ) was compared with that of cells expressing various levels of wild type insulin receptors in their plasma membrane (lanes 3-7). The cells expressing mutant receptors (lane 1) and the cells expressing wild type receptors shown in lanes 3 and 4 had comparable levels of insulin binding. Likewise, the wild type cells shown in lane 5 had levels of insulin binding that were comparable with the cells expressing Alaz8 mutant receptors (lane 2). This experiment to measure receptor phosphorylation in the presence of insulin was carried out as described in the legend to panel A.

viously, a mutation has been described (Glf'+Arg) that re- moves the central glycine in the first repeat of the motif in domain L1. The fact that three naturally occumng mutations map to conserved amino acid residues in glycine-centered motifs strongly supports the suggestion that these motifs play an important role in determining the structure of the a-subunit.

Previously, we have proposed that the defects in post-translational processing and intracellular transport are due to ab- normalities in the folding of the insulin receptor (2, 3, 13, 14, 19, 24). Apparently, when the proreceptor does not fold normally, it is retained in the endoplasmic reticulum. This leads to inhibition of post-translational processing steps that normally would occur in the Golgi apparatus. Although several mutations in the insulin receptor gene share in common the fact that they impair post-translational processing and intracellular transport, the defects vary in severity. The Ar$66 mutation appears to cause a more severe defect in that there are fewer receptors expressed on the cell surface than was observed with the Ala2s mutation. Furthermore, in pulse-chase experiment, we did not directly detect the biosynthesis of mature a- and P-subunits. In this respect, the severity more closely resembled mutations such as the A r 9 O 9 mutation (14) but was more severe than the LysI5 and Val3s2 mutations (13, 19). Neverthe-

less, direct labeling of cell surface receptors by biotinylation did demonstrate the presence of fully processed Ar$'j6 and Alaz8 mutant receptors on the cell surface, even if the pulse-chase studies were not sufficiently sensitive to detect their biosynthesis.

Unlike several previously described mutations in the N-terminal half of the a-subunit (13, 27), the Ar$66 and Ala28 mutations do not appear to affect either the affinity of insulin binding or receptor autophosphorylation. Thus, the insulin resistance in the patient was caused by a decrease in the number of receptors on the cell surface. However, based upon the apparently normal function of cell surface receptors on transfected cells, it seems likely that the fully processed form of the Arg366 and Alaz8 mutant receptors retain the ability to mediate insulin action. Previous work has demonstrated that the het- erotetrameric a2P2 structure is required for ligand-stimulated receptor tyrosine kinase activity (28-30). Using immunoblotting to analyze the total cellular content of receptors, we demonstrated a decrease in the oligomeric form of the mutant receptor. Nevertheless, the Arg366 and Alaz8 mutant receptors located on the cell surface undergo normal insulin-stimulated autophosphorylation in intact cells. Thus, while the mutations cause a defect in oligomerization, the small fraction of mutant receptors that eventually reach the plasma membrane appear to have assembled normally.

Acknowledgments-We are grateful to Dr. Axel Ullrich for the generous giR of insulin receptor cDNA and to Drs. Domenico Accili, Rachel Levy-Toledano, and Carol Haft for helpful discussions. We also thank Dr. Domenico Accili for critical reading of the manuscript.

REFERENCES

2. Taylor, S. I. (1992) Diabetes 41, 1473-1490 1. Hanks, S. IC, Quinn, A. M., and Hunter, T. (1988) Science 241,4252

3. Taylor, S. I., Cama, A,, Accili, D., Barbetti, F., Quon, M. J.. Sierra, M. L., Suzuki, Y., Koller, E., Levy-Toledano, R., Wertheimer, E., Moncada, V. Y..

4. Knighton, D. R., Zheng, J. H., Ten Eyck, L. F., Ashford, V. A., Xuong, N. H., Kadowaki, H., and Kadowaki, T. (1992) Endocr. Reu. 13,566-595

5. Knighton, D. R., Zheng, J. H., Ten Eyck, L. F., Xuong, N. H., Taylor, S. S., and Taylor, S. S., and Sowadski, J. M. (1991) Science 253,407414

6. Odawara, M., Kadowaki, T., Yamamoto, R., Shibasaki, Y., Tobe, K, Accili, D., Sowadski, J. M. (1991) Science 253,414420

Bevins, C.. Mikami. Y., Matsuura, N.,AJcanuma, Y., Takaku, F.. Taylor. S. I.,

7. Moller, D. E., Yokota, A,, White, M., Pazianos, A. G., and Flier, J. S. (1990) J. and Kasuga, M. (1989) Science 245,6648

8. Cama, A,, Sierra, M. L., Quon, M. J., Ottini, L., Gorden, P., and Taylor, S. I. Bid. Chem. 265, 14979-14985

(1993) J. Bid . Chem. 268,80604069 9. Bajaj, M., Waterfield, M. D., Schlessinger, J., Taylor, W. R., and Blundell, T.

10. Barbetti, F., Gejman, P. V., Taylor, S. I., Raben, N., Cama,A., Bonora, E., Pizzo, (1987) Biochim. Biophys. Acta 916,220-226

11. Levi-Toledano R., Caro, L. H. P., Hindman, N., and Taylor, S. I. (1993) Endo- P., Moghetti, P., Muggeo, M., and Roth, J. (1992) Diabetes 41,408-415

12. Olson, T. S., Bamberger, M. J., and Lane, M. D. (1988) J. Biol. Chem. 263, crinology 133,1803-1808

13. Kadowaki, T., Kadowaki, H., Accili, D.. and Taylor, S. I. (1990) J. Biol. Chem. 7342-7351

14. Kadowaki, T., Kadowaki, H., Accili, D.. Yazaki, Y., and Taylor, S. I. (1991) J. 265, 19143-19150

15. Andersen,A. S., Kjeldsen, T., Wiberg, F. C., Christensen. P. M., Rasmussen, J. Biol. Chem. 266,21224-21231

S., Noms, K., Maller, K. B., and Msller, N. P. H. (1990) Biochemistry 29, 7363-7366

16. Kjeldsen, T., Andersen, A. S., Wiberg, F. C., Rasmussen, J. S., SchBffer, L., Balschmidt, P., Maller, K B., and Maller, N. P. H. (1991) Proc. Natl. Acad. Sci. U. S. A. 88,44044408

17. Schumacher, R., Mosthaf, L., Schlessinger, J., Brandenburg, D., and Ul1rich.A.

18. Kadowaki, T., Bevins, C. L., Cama, A,, Ojamaa, K, Marcus-Samuels, B.. Kad- (1991) J. Biol. Chem. 266, 19288-19295

owaki, H., Beitz. L., McKeon, C., and Taylor, S. I. (1988) Science 240, 787-790

19. Accili, D., Frapier, C., Mosthaf, L., McKeon, C., Elbein, S. C., Permutt, M. A., Ramos, E., Lander, E., Ullrich, A,, and Taylor, S. I. (1989) EMBO J . 8,

20. Winkhamer, M., Gmen, N. A., van der Zon, G. C. M., Lindhout, D., Sandkuyl, 2509-2517

L. A., Krans, H. M., Moller, W., and Maassen, J. A. (1989) EMBO J. 8, 2503-2507

21. Kadowaki, T., Kadowaki, H., Rechler, M. M., Serrano Rios, M., Roth, J., Gor- den, p., and Taylor, S. I. (1990) J. Clin. Invest. 86,254-264

22. Maassen, J. A., Van der Vorm, E. R., Van der Zon, G . C. M., Klinkhamer, M. P., Krans, H. M., and Moller. W. (1991) Biochemistry SO, 10778-10783

23. van der Vorm, E. R., van der Zon, G. C. M., Moiler, W., Krans, H. M. J.,

7592 Glycine-centered Motif in Insulin Receptor

24. Accili, D., Kadowaki, T., Kadowaki, H., Mosthaf, L., Ullrich, A., and Taylor, S. Lindhout, D., and Maassen, J. A. (1992) J. Biol. Chem. 267,66-71

25. Barbetti, F., Cordera, R., Cremonesi, L., Ferrari, M., Dozio, N., Micossi, P., and I. (1992) J. Biol. Chem. 267, 58G590

Camera, P. (1993) Programs &Abstracts ofthe 75th Anneal Meeting ofThe Endocrine Society 4SZ (Abstr. 1607)

26. Longo, N., Langley, S. D., Griffin, L. D., and Elsas, L. J. (1993) Proc. Natl.

27. Accili, D., Mosthaf, L., Ullrich, A,, and Taylor, S. I. (1991) J. Bwl. Chem. 266, Acad. Sci. U. S. A. 90, 6 M 4

434-439

28. Boni-Schnetzler, M., Rubin, J. B., and Pilch, P. F. (1986) J. Biol. Chem. 261, 15281-15287

29. Sweet, L. J., Momson, B. D., Wilden, P. A., and Pessin, J. E. (1987) J. Biol. Chem. 262,16730-16738

30. Boni-Schnetzler, M., Kaligian, A., Del Vecchio, R., and F’ilch, P. F. (1988) J. Biol. Chem. 263,68224828

31. Ullrich, A,, Bell, J. R., Chen, E. Y., Herrera, R., Petruzzelli, L. M., Dull, T. J., Gray, A,, Coussens, L., Liao, Y. C., Tsubokawa, M., Mason, A,, Seeburg, P., Grunfeld, C., Rosen, 0. M., and Ramachandran, J. (1985) Nature 313, 75G761

journal of bioux~ical chemistry vol. 269, no. issue of ...structural motifs, the ala2* and argsse...

Documents