kcl.ac.uk/ schools/pse/bioinform/ christos.ouzounis@ kcl.ac.uk
DESCRIPTION
artistic value in scientific results, a means for science communication creative king’s 10-mar-2009. http://www.kcl.ac.uk/ schools/pse/bioinform/ christos.ouzounis@ kcl.ac.uk. structure. BIOLOGY & BIOINFORMATICS visualization & interpretation of scientific results - PowerPoint PPT PresentationTRANSCRIPT
artistic value in scientific results,a means for science communication
creative king’s10-mar-2009
http://www.kcl.ac.uk/schools/pse/bioinform/
[email protected]™ and a
TIFF (Uncompressed) decompressorare needed to see this picture.
2
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
structure
• BIOLOGY & BIOINFORMATICS• visualization & interpretation of scientific results• who are we, the centre for bioinformatics• a crash course in biology• a movie: the inner life of a cell
• CREATIVITY IN SCIENCE• creativity, definitions• importance of creativity, co-occurrence of terms• artists on science, scientists on art• science communication, good examples
• ARTISTIC VALUE IN SCIENTIFIC RESULTS• importance of science?• neurobiology of perception• genome evolution, a case study• the importance of scales, and the media
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
3
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
structure
• BIOLOGY & BIOINFORMATICS• visualization & interpretation of scientific results• who are we, the centre for bioinformatics• a crash course in biology• a movie: the inner life of a cell
• CREATIVITY IN SCIENCE• creativity, definitions• importance of creativity, co-occurrence of terms• artists on science, scientists on art• science communication, good examples
• ARTISTIC VALUE IN SCIENTIFIC RESULTS• importance of science?• neurobiology of perception• genome evolution, a case study• the importance of scales, and the media
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
4
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
The storage, analysis and distribution of biological information, usually at the molecular but also at the supra-molecular levels of organization
A ‘dirty’ word:• more traditionally…
• sequence analysis• structure prediction• molecular evolution
• and more to the definition…
• data engineering [storage]• computational biology
[analysis]• network services [distribution]
Overlaps with…• all the way from theoretical
biology…• …to medical informatics and any
other -matics or -omics• driving force behind genomics
what is bioinformatics?
5
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
kcbiking’s college london centre for bioinformatics
structural genomics• fraternali
functional genomics• blanc
statistical genetics• schlitt
systems biology• tsoka
comparative genomics• ouzounis
http://www.kcl.ac.uk/schools/pse/bioinform/
6
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
School of Physical Sciences and Engineering
Professor Christos Ouzounis
Dr Sophia Tsoka
Paul Keeling, Sr Admin Officer, strategic planning
MRC Centre for Developmental Neurobiology
Dr Eric Blanc
Randall Division of Cell and Molecular Biophysics
Dr Franca Fraternali
Department of Medical and Molecular Genetics
Dr Thomas Schlitt
Department of Computer Science
Professor Maxime Crochemore
Professor Mark Harman
Professor Costas Iliopoulos
Dr Kathleen Steinhöfel
Division of Engineering
Dr Mark Miodownik
School of Medicine
Professor Frank Nestle
Dr Rebecca Oakey
Dr Roli Roberts
Dr Reiner Schulz
Institute of Psychiatry
Professor Simon Lovestone
MRC Centre for Developmental Neurobiology
Dr David Chambers
Mathematics Department
Professor Ton Coolen
Visiting Professors
Ben Blencowe, University of Toronto
Peter D. Karp, SRI International, Benlo Park CA
Nikos Kyrpides, Joint Genome Institute, Berkeley CA
Arthur Lesk, Penn State University, University Park PA
Alfonso Valencia, CNIO Madrid, Spain
core and associate members
7
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
a visual summary of our work
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
8
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
the very basics
the biological hierarchy• populations• organisms• systems• organs• tissues• cell types• cells• subcellular compartments• macromolecular complexes• macromolecules• small molecules• atoms• …
http://www.ehponline.org/members/2007/10373/fig1.jpg
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
http://kentsimmons.uwinnipeg.ca/cm1504/Image48.gif
9
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
from DNA to gene
measuring length:
Units of length for DNA moleculesBecause DNA is double-stranded, the lengths of molecules are described as so many base pairs (bp).A kilobase pair (kb) is 103 bp and a megabase pair (Mb) is 106 bp.A gigabase pair (Gb) is 109 Mb.
In summary:1 kb = 1000 bp1 Mb = 1000 kb = 1 000 000 bp1 Gb = 1000 Mb = 1 000 000 kb = 1 000 000 000 bp
Typically, genome sizes range from Mbs to Gbs - and they contain between 1,000 and 100,000 genes
http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=genomes.box.5275
10
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
a gene in ascii : acgt
ATGCCCGTTGCCCACGTTGCCTTGCCCGTTCCGCTTCCTCGTACCTTTGACTATCTGCTGCCAGAAGGCATGACGGTTAAAGCTGGGTGTCGCGTGCGCGTGCCGTTTGGCAAACAGCAGGAGCGCATCGGGATTGTGGTATCAGTTAGCGATGCCAGCGAACTGCCGCTCAATGAGCTAAAAGCGGTAGTCGAAGTGCTGGATAGTGAGCCGGTGTTTACTCACTCCGTCTGGCGATTGCTGCTATGGGCGGCAGATTACTATCATCATCCGATTGGCGATGTGCTGTTTCATGCCTTGCCGATTTTACTACGCCAGGGGCGGCCTGCGGCGAACGCGCCGATGTGGTACTGGTTTGCCACTGAACAAGGCCAGGCGGTGGATCTGAACAGCCTGAAACGCTCCCCCAAGCAACAACAGGCGCTGGCGGCGTTACGGCAAGGCAAAATCTGGCGCGACCAGGTCGCCACGCTCGAATTTAATGATGCCGCGTTGCAGGCGCTACGCAAAAAAGGTCTGTGTGATTTAGCAAGTGAAACACCAGAGTTTAGCGACTGGCGAACGAACTATGCCGTTTCTGGTGAGCGGTTGCGATTGAATACCGAACAGGCCACCGCCGTTGGCGCAATTCATAGCGCGGCAGATACTTTTTCTGCCTGGCTGCTGGCGGGCGTTACCGGTTCCGGTAAAACGGAGGTTTATCTCAGCGTACTGGAAAACGTGCTCGCTCAGGGCAAACAGGCGCTGGTGATGGTGCCGGAAATCGGCCTGACACCGCAAACTATCGCCCGTTTTCGTGAACGTTTTAATGCCCCCGTGGAAGTTCTGCATTCCGGCCTGAACGACAGCGAGCGTCTTTCGGCGTGGCTGAAAGCGAAAAATGGTGAGGCGGCGATTGTGATCGGCACCCGCTCCGCGCTGTTTACGCCGTTTAAAAATCTCGGCGTGATTGTCATTGATGAAGAGCACGACAGCTCCTACAAGCAGCAGGAAGGCTGGCGCTATCATGCCCGCGACCTGGCGGTGTATCGTGCGCACAGCGAGCAAATCCCGATTATTCTTGGCTCCGCAACGCCCGCGCTGGAAACGTTATGCAACGTCCAGCAGAAAAAATACCGCCTGCTGCGCCTGACCCGTCGGGCAGGGAATGCGCGTCCGGCAATTCAACATGTGCTGGATTTAAAAGGTCAGAAGGTGCAGGCAGGTCTGGCTCCGGCGTTAATCACTCGTATGCGCCAGCATTTACAGGCTGATAACCAGGTCATTCTCTTTCTTAACCGCCGTGGCTTTGCGCCTGCACTGCTGTGCCACGACTGTGGCTGGATTGCCGAATGCCCACGTTGCGATCACTACTACACGCTGCATCAGGCGCAGCACCATCTGCGCTGCCACCACTGTGACAGTCAGCGTCCGGTGCCGCGCCAGTGCCCTTCCTGCGGTTCCACGCACCTGGTCCCCGTGGGGCTGGGCACCGAACAGCTTGAACAGACGCTCGCGCCGTTGTTCCCCGGCGTGCCCATTTCTCGTATCGACCGCGATACCACCAGCCGCAAAGGGGCGCTGGAACAGCAACTGGCAGAAGTACATCGCGGCGGCGCGCGGATTTTGATTGGTACACAAATGCTGGCGAAAGGTCACCATTTCCCGGATGTGACGCTGGTTGCATTACTGGACGTGGACGGCGCGCTGTTTTCTGCCGATTTTCGCTCGGCAGAGCGTTTCGCTCAGCTTTACACCCAGGTCGCCGGTCGTGCCGGGCGTGCGGGTAAACAGGGCGAAGTGGTGCTGCAAACGCACCATCCGGAACATCCTCTGTTGCAAACGTTGCTCTATAAAGGCTACGACGCCTTTGCCGAACAGGCGCTGGCTGAGCGGCGAATGATGCAGCTACCGCCGTGGACCAGCCATGTGATTGTGCGTGCGGAAGATCATAACAATCAGCACGCGCCATTGTTCCTGCAACAACTGCGTAATCTGATCCTCTCCAGCCCACTGGCAGACGAGAAACTGTGGGTTCTCGGTCCGGTTCCGGCTCTGGCACCTAAACGTGGCGGTCGCTGGCGCTGGCAGATATTGTTGCAGCACCCTTCCCGCGTGCGCTTGCAACACATCATTAACGGTACGCTGGCGCTCATCAATACAATACCGGATTCCCGTAAGGTGAAATGGGTGCTGGATGTTGATCCGATTGAGGGTTAA
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
11
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
a protein in ascii : acdefghiklmnpqrstvwy
MPVAHVALPVPLPRTFDYLLPEGMTVKAGCRVRVPFGKQQERIGIVVSVSDASELPLNELKAVVEVLDSEPVFTHSVWRLLLWAADYYHHPIGDVLFHALPILLRQGRPAANAPMWYWFATEQGQAVDLNSLKRSPKQQQALAALRQGKIWRDQVATLEFNDAALQALRKKGLCDLASETPEFSDWRTNYAVSGERLRLNTEQATAVGAIHSAADTFSAWLLAGVTGSGKTEVYLSVLENVLAQGKQALVMVPEIGLTPQTIARFRERFNAPVEVLHSGLNDSERLSAWLKAKNGEAAIVIGTRSALFTPFKNLGVIVIDEEHDSSYKQQEGWRYHARDLAVYRAHSEQIPIILGSATPALETLCNVQQKKYRLLRLTRRAGNARPAIQHVLDLKGQKVQAGLAPALITRMRQHLQADNQVILFLNRRGFAPALLCHDCGWIAECPRCDHYYTLHQAQHHLRCHHCDSQRPVPRQCPSCGSTHLVPVGLGTEQLEQTLAPLFPGVPISRIDRDTTSRKGALEQQLAEVHRGGARILIGTQMLAKGHHFPDVTLVALLDVDGALFSADFRSAERFAQLYTQVAGRAGRAGKQGEVVLQTHHPEHPLLQTLLYKGYDAFAEQALAERRMMQLPPWTSHVIVRAEDHNNQHAPLFLQQLRNLILSSPLADEKLWVLGPVPALAPKRGGRWRWQILLQHPSRVRLQHIINGTLALINTIPDSRKVKWVLDVDPIEG
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
12
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
many genomes have been deciphered
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
13
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
domains of lifethere are three known domains / types of cells: archaea, bacteria, eukarya
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
http://tainano.com/Molecular%20Biology%20Glossary.files/image015.gif
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
http://www.biologyreference.com/Ar-Bi/Archaea.html
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
http://www.garlandscience.com/textbooks/0815341059.asp
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
14
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
genome trees
better trees are derived from whole-genome comparisons
15
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
the eukarya, useukarya are very diverse !
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
http://wiki.cotch.net/upload/5/5f/Eukaryoticlife.jpg
16
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
structure
• BIOLOGY & BIOINFORMATICS• visualization & interpretation of scientific results• who are we, the centre for bioinformatics• a crash course in biology• a movie: the inner life of a cell
• CREATIVITY IN SCIENCE• creativity, definitions• importance of creativity, co-occurrence of terms• artists on science, scientists on art• science communication, good examples
• ARTISTIC VALUE IN SCIENTIFIC RESULTS• importance of science?• neurobiology of perception• genome evolution, a case study• the importance of scales, and the media
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
17
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
creativity
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
18
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
creativity, co-occurrence terms
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
19
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
creativity barometer
education role of the leader
brain innovation leadership innovation manageme
nt
intelligence depression madness mental illness
1
10
100
1000
10000
100000
25300
8610 8270
3120
481 444 421293
233 229
20
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
creativity in society
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
21
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
visual arts in sciences
QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
22
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
artists on science, scientists on art
• a relevant dialogue, e.g. "Artists on science: scientists on art." Special section in Nature, 17 March 2005, pages 293-323
• distinction of “two cultures”, science & technology vs. art & poetry is somewhat outdated
• “… There is an economy of words and beauty of concept in poetry that is always found in the best science” (Garfield, 1989)• Creativity is a modern concept. Term was not coined until 1875, when it was used to refer to the poetic imagination.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
23
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
a piece of art from a famous scientist
“It may seem unusual to include Leonardo da Vinci in a list of paleontologists and evolutionary biologists. Leonardo was and is best known as an artist, the creator of such masterpieces as the Mona Lisa, Madonna of the Rocks, and The Last Supper. Yet Leonardo was far more than a great artist: he had one of the best scientific minds of his time. He made painstaking observations and carried out research in fields ranging from architecture and civil engineering to astronomy to anatomy and zoology to geography, geology and paleontology.”
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
http://www.ucmp.berkeley.edu/history/vinci.html
24
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
the importance of science communication
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
http://www.auburn.edu/~mathest/nufs2000_clip_image002_0000.jpg
http://www.flickr.com/photos/rafaerts/2817098501/
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
25
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
structure
• BIOLOGY & BIOINFORMATICS• visualization & interpretation of scientific results• who are we, the centre for bioinformatics• a crash course in biology• a movie: the inner life of a cell
• CREATIVITY IN SCIENCE• creativity, definitions• importance of creativity, co-occurrence of terms• artists on science, scientists on art• science communication, good examples
• ARTISTIC VALUE IN SCIENTIFIC RESULTS• importance of science?• neurobiology of perception• genome evolution, a case study• the importance of scales, and the media
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
26
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
the importance of science?
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Science pollPublished: Wednesday, 28 January 2009The public was asked what has the most impact in shaping their futures; 26% said science, putting it ahead of politics, family and religion. When asked to choose which group of people has the most effect on our daily lives, only 3% selected scientists.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
http://sciencesowhat.direct.gov.uk/
27
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
neurobiology of perception
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Elements of perspective, shadows, transparency, reflections: all understood in terms of visual computations in our brain
28
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
microphotography
http://www.nikonsmallworld.com/
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
29
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
a sense of scale
Genomes 377
Genes 1,315,558
Annotations 359,482
Similarities 384,579,409
Phylogenetic profiles
181,986
Families 82,692
Interactions 2,192,019
Pathways > 25,000
30
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
protein classification & similarity graphs
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
http://bioinformatics.icmb.utexas.edu/lgl/Images/scop_hie_full.jpg
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
http://bioinformatics.icmb.utexas.edu/lgl/Images/phg.jpg
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
31
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
more views of the similarity graph
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
http://bioinformatics.icmb.utexas.edu/lgl/PHN/phn.large.png
32
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
zooming into the unknown
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
33
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
a sense of scale
Genomes 377
Genes 1,315,558
Annotations 359,482
Similarities 384,579,409
Phylogenetic profiles
181,986
Families 82,692
Interactions 2,192,019
Pathways > 25,000
34
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
ancestral gene content
35
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
1708
36
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Gene content reconstruction: ancestral states
Both current and ancient genomes• HGT events on
tree
The enigmatic yellow sphere is the universal ancestor
Featured in Wired, Discover etc.
network of life
37
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
38
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
net of life, the movie
http://www.nature.com/embor/journal/v8/n10/full/7401074.html
39
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
the importance of scales, and the media• for artists, other scales do not provide typical material• there is a beauty in the microcosm, stunning views that need to be captured
• stunning representations of complex phenomena with artistic value• inaccessible in their usual form to wider communities
• including other scientists, artists and the general public
• these representations (“results”) are abstract notions• they do not correspond to the physical world• they do, however, provide the means for effective science communication
with the appropriate use of media and inter-disciplinary collaborations
• results of complex analyses can have both artistic content and scientific accuracy