Hum Genet (2009) 124:579–591

DOI 10.1007/s00439-008-0593-6

REVIEW ARTICLE

Lactose digestion and the evolutionary genetics of lactase persistence

Catherine J. E. Ingram · Charlotte A. Mulcare · Yuval Itan · Mark G. Thomas · Dallas M. Swallow

Received: 6 August 2008 / Accepted: 6 November 2008 / Published online: 26 November 2008© Springer-Verlag 2008

Abstract It has been known for some 40 years that lactaseproduction persists into adult life in some people but not inothers. However, the mechanism and evolutionary signiW-cance of this variation have proved more elusive, and con-tinue to excite the interest of investigators from diVerentdisciplines. This genetically determined trait diVers in fre-quency worldwide and is due to cis-acting polymorphismof regulation of lactase gene expression. A single nucleo-tide polymorphism located 13.9 kb upstream from the lac-tase gene (C-13910 > T) was proposed to be the cause, andthe ¡13910*T allele, which is widespread in Europe wasfound to be located on a very extended haplotype of 500 kbor more. The long region of haplotype conservation reXectsa recent origin, and this, together with high frequencies, isevidence of positive selection, but also means that¡13910*T might be an associated marker, rather thanbeing causal of lactase persistence itself. Doubt about func-tion was increased when it was shown that the original SNPdid not account for lactase persistence in most Africanpopulations. However, the recent discovery that there are

several other SNPs associated with lactase persistence inclose proximity (within 100 bp), and that they all reside in apiece of sequence that has enhancer function in vitro, doessuggest that they may each be functional, and their occur-rence on diVerent haplotype backgrounds shows that sev-eral independent mutations led to lactase persistence. Herewe provide access to a database of worldwide distributionsof lactase persistence and of the C-13910*T allele, as wellas reviewing lactase molecular and population genetics andthe role of selection in determining present day distribu-tions of the lactase persistence phenotype.

Introduction

Lactase, the small intestinal enzyme responsible for cleav-ing lactose into its constituent absorbable monosaccharides,glucose and galactose, is essential for the nourishment ofnewborn mammals, whose sole source of nutrition is milk,in which lactose is the major carbohydrate component. Inadult mammals other than humans lactase productiondecreases signiWcantly in quantity following weaning (Bul-ler et al. 1990; Lacey et al. 1994; Sebastio et al. 1989).Although individual diVerences in the ability of humanadults to digest milk had been remarked upon in Romantimes, variation in expression of lactase was not establishedas a genetically determined trait until the second half of thetwentieth century. Indeed before this, expression of highlevels of lactase in adulthood was considered by people ofEuropean descent to be the ‘normal’ state of aVairs, andwidespread deWciency of lactase in adults was only appreci-ated in the early 1960s (Auricchio et al. 1963; Dahlqvistet al. 1963).

Here, we review all aspects of this polymorphism fromdescription of phenotype to molecular and evolutionary

Electronic supplementary material The online version of this article (doi:10.1007/s00439-008-0593-6) contains supplementary material, which is available to authorized users.

C. J. E. Ingram · C. A. Mulcare · Y. Itan · M. G. Thomas · D. M. Swallow (&)Department of Genetics Evolution and Environment, University College London, Wolfson House, 4 Stephenson Way, London NW1 2HE, UKe-mail: d.swallow@ucl.ac.uk

Y. ItanCentre for Mathematics and Physics in the Life Sciences and Experimental Biology, CoMPLEX, University College London, Wolfson House, 4 Stephenson Way, London NW1 2HE, UK

123

580 Hum Genet (2009) 124:579–591

genetics. Since we had noted that the population distribu-tion data available in many literature reviews containedanomalous information (as will be discussed below) wealso provide access to a newly constructed database of phe-notypic data taken from source publications.

Determination of lactase persistence status

People whose lactase persists at high levels throughoutadult life are said to be lactase persistent while those withlittle lactase as adults are described as lactase non-persis-tent (also referred to in the literature as primary adult hypo-lactasia). Since taking intestinal biopsies from healthypeople is invasive and not acceptable unless the person ishaving other investigations, lactase persistence status isoften inferred by a method depending on lactose digestion.This allows people to be classiWed as lactose digesters andmaldigesters. This diVerence in digestion is measured by atest traditionally known as a ‘lactose tolerance test’ andthus the terms tolerant and intolerant are sometimes used,though this can be confused with dietary intolerance.

The lactose tolerance test usually involves giving a lac-tose load after an overnight fast and then measuring bloodglucose or breath hydrogen. A baseline measurement ofblood glucose or breath hydrogen is taken before ingestionof the lactose, and then at various time intervals thereafter.An increase in blood glucose indicates lactose digestion(glucose produced from the lactose hydrolysis is absorbedinto the bloodstream), and no increase, or a ‘Xat line’ isindicative of a lactose maldigester (probable lactase non-persistent) phenotype. An increase in breath hydrogen indi-cates maldigestion and reXects colonic fermentation of thelactose, as described in the following section. In both casessomewhat arbitrary cut-oV points have to be set for distin-guishing the two phenotypes and both methods informupon the person’s ability to digest lactose rather than thegiven individual’s lactase expression. It must therefore beborne in mind that there will be an underlying error rate,leading to both false negatives and false positives. The rela-tive eYciency of the tests has been examined in more thanone study, and the breath hydrogen method was found themost accurate (Mulcare et al. 2004; Newcomer et al 1975;Peuhkuri 2000). It is also convenient and cheap. Lactaselevels can, however, be secondarily reduced by gastrointes-tinal disease, leading to secondary lactose intolerance andalso some people fail to produce hydrogen. In the clinicalsetting there are ways of improving the quality of the test.These include retesting, and giving a dose of a non-digestiblecarbohydrate, lactulose, to test for the presence of hydrogenproducing bacteria (see section below), and investigation ofother causes of the lactose intolerance, which might includeexamination of biopsy material.

Symptoms of lactose intolerance

Undigested lactose passing through the small intestineinto the colon has two physiological eVects. First, anosmotic gradient is set up across the gut wall, whichresults in an inXux of water, causing symptoms of diar-rhoea. Second, the lactose can be fermented by colonicbacteria, to produce fatty acids and gaseous by-products(including hydrogen, used in the tolerance test), poten-tially causing discomfort, bloating and Xatulence. How-ever most lactase non-persistent individuals can toleratesmall amounts of lactose (as in tea or coVee), and somecan consume a lot without ill eVects (Scrimshaw andMurray 1988; Suarez et al. 1997). Variation in the com-position of the gut Xora between individuals (Hertzleret al. 1997; Hertzler and Savaiano 1996), as well as apsychosomatic component (Briet et al. 1997; Peuhkuriet al. 2000; Saltzman et al. 1999) may account for someof the interindividual variation in symptoms.

Worldwide distribution of lactase persistence

Surveys of lactase persistence phenotype frequencieshave been carried out in many populations over theyears, so that the global distribution of lactase persis-tence is now fairly well characterised (Flatz 1987; Swal-low and Hollox 2000; Table 1 supplementaryinformation; Fig. 1a). This reveals that lactase non-per-sistence is the most common phenotype in humans (65%if one takes into account population census size asshown in Table 2 of the supplementary information),with lactase persistence being common only in certainpopulations with a long history of pastoralism and milk-ing (McCracken 1971; Simoons 1970). Lactase persis-tence is at highest frequency in north-western Europe,with a decreasing cline to the south and east. On theIndian subcontinent the frequency of lactase persistenceis higher in the north-west than elsewhere, and furthereast than India the lactase persistence frequency is gen-erally low. In Africa, the distribution is patchy, withsome pastoralist nomadic tribes having high frequenciesof lactase persistence compared with neighbouringgroups living in the same country (Bayoumi et al. 1981,1982), with a similar pattern observed between Bedouinand neighbouring populations in the Middle East (Fig. 2,Cook and al-Torki 1975; Dissanyake et al. 1990; Snooket al. 1976).

The noted correlation of lactase persistence phenotypewith the cultural practise of milking generated the hypothe-sis that this trait has been subject to strong positive selec-tion (Aoki 1986; Holden and Mace 1997; McCracken 1971;Simoons 1970, 1978).

123

Hum Genet (2009) 124:579–591 581

Fig. 1 Interpolated maps of the ‘old world’ showing the distri-bution of (a) lactase persistence data taken from the literature (Supplementary data Table 1), (b) -13910*T distribution (c) lactase persistence frequency predicted from -13910*T distri-bution, using the data collection to be found in Supplementary data Table 3. Maps were generated using PYNGL (http://www.pyngl.ucar.edu). Only includes individuals over 12 years of age, who are unrelated, and literature for which the original publications have been located and checked. Articles in which there was clear selection bias, and recent immigrant populations are ex-cluded, but the data can be found in Supplementary data Table 1. The Americas are excluded from all maps because of the paucity of data. Most data were obtained from lactose tolerance tests using either breath hydrogen or blood glucose, though in some cases enzyme assay data were available. Locations were either as described precisely in the publication, or taken from capital cities or central points of a country or region where precise location is not mentioned. Where more than one data set was available weighted averages of the data were taken. Predicted frequency taken to be p2 + 2pq, where p is the frequency of ¡13910*T. Data points are shown as dots. It should be noted that the interpolation is inaccurate where there are few data points. A colour version of this Wgure can be found in the electronic supplementary information

(a)

(b)

(c)

123

582 Hum Genet (2009) 124:579–591

Identifying the causes of lactase persistence

By the early 1970s it was established that the lactase persis-tence polymorphism in humans has a genetic cause, and isinherited in an autosomal dominant manner (Ferguson andMaxwell 1967; Metneki et al. 1984; Sahi 1974). Furtherevidence that lactase persistence is a genetic trait, and morespeciWcally that it is caused by a cis-acting element, wasproduced in the early 1980s. Ho et al. reported a trimodaldistribution of sucrase:lactase ratios in intestinal samplesfrom British adults of northern European ancestry. The tri-modal distribution was interpreted as attributable to groupsof individuals homozygous for lactase persistence (highestlactase activity), heterozygotes with mid-level activity andnon-persistent homozygotes with low lactase activity (Hoet al. 1982), and similar results were subsequently obtainedin individuals of German ancestry (Flatz 1984). The inter-mediate lactase activity observed in the heterozygotes indi-cated that only one copy of the lactase gene was being fullyexpressed. Evidence for transcriptional regulation (Escheret al. 1992) and conWrmatory evidence for the cis-acting

nature of this (Wang et al. 1995) was obtained from mRNAstudies.

Sequencing of LCT and the immediate promoter regionin Europeans showed no nucleotide changes that wereabsolutely associated with persistence/non-persistence(Boll et al. 1991; Lloyd et al. 1992; Poulter et al. 2003).However, several polymorphisms do exist across the 50 kbLCT gene and association studies revealed that very fewhaplotypes occur in most of the human populations tested,although greater diversity was observed in African popula-tions (Hollox et al. 2001). One combination of allelesdesignated the ‘A’ haplotype (Fig. 3) is particularly commonin northern Europe and is associated with lactase persis-tence (Harvey et al. 1998). A putative causative singlenucleotide polymorphism (C-13910 > T) was subsequentlyidentiWed 13.9 kb upstream of the LCT transcription initia-tion site (Enattah et al. 2002) (Fig. 3). It is located in anintron of an adjacent gene, MCM6, and occurs exclusivelyon the background of the A haplotype (Poulter et al. 2003).

The ¡13910*T allele was found to associate completelywith lactase persistence, ascertained directly by enzyme

Fig. 2 Examples of countries/geographic regions in which individual ethnic groups display large diVerences in lactose absorption capacity. See Supplementary data (Table 1) for details

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

Beja Jaali Baggara Nilotes Fulani Hausa Ibo Yoruba JordanianBedouin

Non-BedouinJordanians

SaudiBedouin

Non-BedouinSaudis

Middle EastNigeriaSudan

Lac

tose

dig

este

r fr

equ

ency

Fig. 3 Diagrammatic representation of the genes MCM6 and LCT.The arrow indicates the location of ¡13910*T, and the other allelesshown more recently to be associated with lactase persistence. Loca-tions of SNPs used for LCT core haplotype analysis are shown, with thepossible allelic combinations of the four common worldwide 11 SNP

haplotypes described in Hollox et al. (2001). The open circles indicatean ancestral allele and Wlled circles denote the derived allele at a locus.SNPs used for assessing haplotype background of the lactase persis-tence associated variants in our own studies are 4, 6, 9 and 10

LCTMCM6

U

ABC

1 2 3 4 5 6 7 10 118 9

-14010*C

-13915*G

-13910*T

-13907*G

…

123

Hum Genet (2009) 124:579–591 583

activity in 196 Finnish individuals, and subsequent studieshave conWrmed a tight but not absolute association between¡13910*T and lactase persistence as judged by lactose tol-erance testing in populations of northern European ancestry(Bernardes-Silva et al. 2007; Hogenauer et al. 2005; Kerberet al. 2007; Poulter et al. 2003) and there was also a correla-tion, but not absolute, between genotypes and enzymaticactivity (Poulter et al. 2003). However the A haplotypeextends far beyond the 50 kb LCT gene region, with carri-ers of the ¡13910*T allele having almost identical chromo-somes extending for nearly 1 Mb (Bersaglieri et al. 2004;Poulter et al. 2003).

Evidence for function of ¡13910*T

In vitro studies provided evidence that the ¡13910*T alleleincreases transcription in promoter–reporter constructassays in cell lines (Lewinsky et al. 2005; Olds and Sibley2003; Troelsen et al. 2003), suggesting that it may haveenhancer activity in vivo. A transcription factor, Oct-1, wasidentiWed which bound more strongly to the ¡13910*Tcontaining motif than to the alternative C allele, providing apossible mechanism for up-regulation of LCT (Lewinskyet al. 2005), and suggesting that the cause of lactase persis-tence had been identiWed (Rasinpera et al. 2004), althoughmany questions remain unanswered.

Population distribution of ¡13910*T: ¡13910*T does not account for lactase persistence worldwide and is rare in sub-Saharan African populations

Using carefully checked primary source literature data(Supplementary Table 1) we failed to obtain the tight corre-lation of ¡13910*T with published worldwide lactase per-sistence phenotype frequency reported elsewhere (Enattahet al. 2007), but it is clear that in Europe the frequency dis-tribution of ¡13910*T is in broad agreement with thatexpected from distribution of the phenotype (Fig. 1).Figure 1a shows an interpolated contour map depicting thedistribution of lactase persistence, prepared from pheno-typic data taken from all the available literature, in whichwe were conWdent of the phenotypic testing, and fromwhich children, family members, patients selected forlikely intolerance, and twentieth/twenty-Wrst century immi-grant status were excluded. Figure 1b shows the distribu-tion of ¡13910*T and details of the worldwide ¡13910*Tdata can be found in the supplementary information (Sup-plementary Table 3). Figure 1c shows predicted lactose tol-erance distribution taken from ¡13910*T frequencies,assuming that ¡13910*T is the sole cause of lactase persis-tence and is dominant (p2 + 2pq).

In contrast to the high frequency in Europe, ¡13910*Tis rare in sub-Saharan African populations (Fig. 1b) even inthose populations where lactase persistence frequency isreported to be high (Mulcare et al. 2004), and it is also rarein the Bedouins of the Arabian peninsula, who are also fre-quently lactose digesters (Ingram et al. 2007). The allelewas also absent from all but one of a series of phenotypedindividuals of Sudanese ancestry (Ingram et al. 2007). Anobvious interpretation was that -13910*T is not truly causalof lactase persistence, but is a very strongly associatedmarker of the causal element, which appeared on the lactasepersistence carrying (A haplotype) chromosome afterhumans had spread out of Africa. However there was alsono association with A haplotype in this African group andsubsequent research indicated genetic heterogeneity.

New variants in intron 13 of MCM6, and multiple causes of lactase persistence in Africa

Three studies revealed several new sequence variants invery close proximity (Figs. 3, 4; Table 1) to ¡13910*T(Enattah et al. 2008; Ingram et al. 2007; TishkoV et al.2007), two of which are clearly associated with lactase per-sistence in diVerent parts of East Africa (¡13915*G and¡14010*C). One of these, ¡13915*G, was also shown tobe associated with high lactase expression in Saudi Arabia(Imtiaz et al. 2007). A third SNP, ¡13907*G, showedmuch weaker evidence, but was found in several studies(Enattah et al. 2008; Ingram 2008; Ingram et al. 2007;TishkoV et al. 2007), and there were several other candi-dates found in lactase persistent or milk drinking people(Enattah et al. 2008; Ingram et al. 2007; Ingram 2008; Taget al. 2007; TishkoV et al. 2007). However, even takingthese additional variants into account, and supposing themall to be functional, association with phenotype was notcomplete. Although the occurrence of a few individualswho carried an allele but were lactose maldigesters couldbe explained by secondary lactase loss, individuals whowere digesters but carried no putative causative allele inthis genomic region still had to be explained, indicating thatthere may be more, as yet unidentiWed, causal variants. Thegenomic region may be particularly susceptible to muta-tions, and these ‘recent’ derived variants might simply bemarkers of a causal element elsewhere. However, the threenewly described SNPs all occur on diVerent haplotypebackgrounds from each other (using our old nomenclature:¡13907*G, on A, ¡13915*G, on C, and ¡14010*C proba-bly on B) (Enattah et al. 2008; Ingram et al. 2007; Ingram2008; TishkoV et al. 2007), although ¡13907*G is on thesame haplotype as ¡13910*T. In each case the haplotypesextend well beyond the »¡14 kb allele in both directions,showing clearly that the derived alleles cannot simply be

123

584 Hum Genet (2009) 124:579–591

markers for a single shared causal variant, and that theremust be several independent causes of lactase persistence.Each of the alleles has a diVerent geographic distribution,and the preliminary data suggest that -13915*G arose in theMiddle East, while ¡13907*G and ¡14010*C arose ineastern Africa.

Evidence of function for the alleles identiWed in Africa

It is important to critically evaluate the evidence for func-tion of these recently described alleles. Footprint analysis,to determine DNA–protein binding sites, of sequenceencompassing the intron 13 region revealed transcriptionfactor recognition sequences for Cdx-2, GATA, HNF3�/Fox and HNF4� along with Oct-1 (Lewinsky et al. 2005).Two of the newly identiWed SNPs are located within theOct-1 binding site (Fig. 4). Electrophoretic mobility shiftassays (EMSAs) used to ascertain the eVect of the new alle-les on Oct-1 binding showed that only the original allele,¡13910*T containing oligonucleotide probes boundstrongly to Oct-1, -13907*G bound to a much lesser extent(Enattah et al. 2008; Ingram et al. 2007), and that bindingof the other alleles was less still or undetectable. It cantherefore be concluded that the simple change in binding ofthe protein Oct-1 to this site is unlikely to play a criticalrole in causing lactase persistence. The identiWcation of theother associated allele, ¡14010*C, (TishkoV et al. 2007),situated 100 bp away from the predicted Oct-1 binding sitewould appear to conWrm this.

In vitro promoter/reporter analysis of the newly identi-Wed MCM6 intron 13 variant alleles however, lends somesupport to the idea that they do aVect enhancer activity.Transcriptional activity of the LCT core promoter wasenhanced up to tenfold by addition of sequences fromMCM6 intron 13 (Lewinsky et al. 2005; Olds and Sibley2003; TishkoV et al. 2007) which include the ancestral vari-ant. This activity increased further (by up to 25% more)when one of the variant alleles (¡14010*C, ¡13907*G or

¡13915*G) was present (TishkoV et al. 2007). This eVectis in fact small and the authors did not include ¡13910*Tas a positive control (previously shown to enhance tran-scription activity a further 80% compared to the ancestralallele (Troelsen et al. 2003). Although a recent paper ofEnattah et al. (2008) does conWrm an eVect for ¡13915*G,the results are hard to evaluate because additionalsequences are included in the construct, and the control¡13910*T shows very little eVect in this study. However,in the Enattah et al. (2008) paper the Caco-2 cells were notdiVerentiated, as they had been in some of the previousstudies (Troelsen et al. 2003). This also Xags the problem ofthe appropriateness of the cell model. Caco-2 is a colon cellline, and the only line known to express lactase and has fea-tures more comparable with fetal small intestine (Hauriet al. 1985).

The predictive value of these in vitro functional studieswith respect to the eVect exerted in vivo by particular alle-les is therefore uncertain, but the observations, togetherwith those made previously (Lewinsky et al. 2005; Oldsand Sibley 2003; Troelsen et al. 2003) do suggest, thoughdo not conWrm that this region is important in regulation ofLCT expression. But how it allows low expression infetuses, high expression in babies and then down-regulationin some but not other people is currently hard to envisage.Studies in mice Xag the complexities of interpretation of invitro studies, and indeed in vivo studies highlight the sub-tleties of tissue and developmental control (Bosse et al.2006a, b, 2007; van Wering et al. 2004). Unfortunatelythere are severe restrictions to animal models in elucidatingthis uniquely human polymorphism.

The role of other factors inXuencing lactase expression

The immediate promoter of LCT is moderately well charac-terised in rat, pig and human (Fang et al. 2000, 2001;Krasinski et al. 2001; Lee et al. 2002; Mitchelmore et al.2000; Spodsberg et al. 1999; Troelsen et al. 1994, 1997;

Fig. 4 Sequence of the enhancer region in intron 13 of MCM6 show-ing the positions of characterised transcription factor binding sites(Lewinsky et al. 2005) and the SNPs that have been shown to associatewith lactase persistence. Note that the protein binding region ¡13926to ¡13909 is comprised of two partially overlapping sites (Oct-1 and

GATA6 as indicated). Several other SNPs that have been identiWed byourselves and others, in this region, including ¡13913T > C are notshown since, as yet, no evidence of association with phenotype is avail-able

TTTATGTAACTGTTGAATGCTCATACGACCATGGAATTCTTCCCTTTAAAGAGCTTGGTAAGCATTTGAGTGTAGTTGTTAGACGGAGACGATCACGTC

ATAGTTTATAGAGTGCATAAAGAC TAAGTTACCATTTAATACCTTTCATTCAGGAAAAATGTACTTAGACCCTACAATGTACTAGTAGGCCTCTGCGCT

GGCAATACAGATAAGATAA GTAG CC TGGCCTCAAAGGAACTCTCCTCCTTAGGTTGCATTTGTATAATGTTTGATTTTTAGATTGTTCTTTGAGCCCT

GCATTCCACGAGGATAGGTCAGTGGGTATTAACGAGGTAAAAGGGGAGTAGTACGAAAGGGCATTCAAGCGTCCCATCTTCGCTTCAACCAAAGCAGCCC

TGCTTTTTCCTAGTTTTATTAATAGGTTTGATGTAAGGTCGTCTTTGAAA

CG

TG

CT

CG

Cdx-2

GATA6

Oct-1

HNF3α/Fox HNF4α

-13684

-14133

-14034

-13934

-13833

-13733

123

Hum Genet (2009) 124:579–591 585

van Wering et al. 2004; Wang et al. 2006), and there areseveral allelic variants within the Wrst kilobase of humansequence (Harvey et al. 1995; Hollox et al. 1999; Lloydet al. 1992). Although none of them is causal of persistence,it is just possible that variations in these SNPs aVect expres-sion under certain circumstances or at certain developmen-tal stages: one study shows that the allele -958*T(characteristic of the B haplotype) reduces binding to anuncharacterised transcription factor (Hollox et al. 1999).Whilst it has been well established that regulation of LCT ispredominantly under genetically determined transcriptionalcontrol there is evidence that other factors inXuence inter-individual diVerences in expression of the enzyme. Hetero-geneity of the lactase non-persistence phenotype wasreported by a number of research groups in their early studies.Some investigators observed individuals who show slower/abnormal processing of their lactase protein (Sterchi et al.1990; Witte et al. 1990) which may imply variation in post-translational controls such as proteolytic cleavage, glyco-sylation and/or transport to the cell surface, which areinvolved in the normal processing of lactase (Jacob et al.1994, 1995, 1996, 2002; Naim and Lentze 1992). Othershave made observations suggestive of epigenetic regulation(Maiuri et al. 1991, 1994). Although most non-persistentindividuals show no staining for lactase in the jejunal biop-sies of the small intestine (concordant with low lactaseactivity and transcriptional regulation of LCT), some indi-viduals show patchy expression of the enzyme in the intes-tinal epithelia (Maiuri et al. 1991, 1994). This mosaicexpression pattern might be attributable to somatic cellchanges in methylation, or histone acetylation but curiouslythis is not attributable to an ‘inherited’ change in expressionpattern from a single stem cell, since in that case ‘ribbons’of positively stained cells would be expected.

Evolutionary considerations

The original observations in the 1970s and 1980s of a posi-tive correlation between lactase persistence frequencies andmilk drinking led to the widely held notion that lactase per-sistence has been subject to positive selection. In the inter-vening years molecular evidence has accumulated whichwould appear to corroborate this hypothesis. Our group Wrstreported on the unusual pattern of lactase gene haplotypediversity across populations (Hollox et al. 2001). We foundonly four common 50 kb haplotypes outside Africa, withmany more within Africa, and a very high frequency of theA haplotype in northern Europe, and suggested that thevery diVerent haplotype frequencies observed in N. Europe-ans as compared to other populations are most probablyexplained by a combination of genetic drift and strong pos-itive selection for lactase persistence (Hollox et al. 2001).T

able

1D

etai

ls o

f SN

Ps

know

n to

be

asso

ciat

ed w

ith la

ctas

e pe

rsis

tenc

e as

of

July

200

8

Not

e th

at w

e an

d ot

hers

hav

e id

entiW

ed a

tota

l of t

en o

ther

alle

les

(inc

ludi

ng -

1391

3*C

) with

in th

e 13

0bp

reg

ion

-13,

900

to -1

4,03

0 fo

r whi

ch s

tudi

es o

f the

ir a

ssoc

iatio

n an

d fu

nctio

n ar

e on

goin

g

Pos

ition

of

SN

P (i

n bp

s up

stre

am o

f L

CT

)

Sub

stitu

tion

(anc

estr

al a

llele

Wrs

t, fr

om c

ompa

riso

n w

ith c

him

p)

rs N

umbe

rE

vide

nce

of a

ssoc

iatio

n w

ith

lact

ase

pers

iste

nce

Evi

denc

e of

fun

ctio

nH

aplo

type

(H

ollo

x et

al. 2

000

nom

encl

atur

e)

Geo

grap

hic

loca

tion

of

high

est o

bser

ved

freq

uenc

y

14,0

10G

>C

Not

incl

uded

in

dbS

NP

Tis

hkoV

eta

l. (2

007)

Tis

hkoV

eta

l. (2

007)

BK

enya

/Tan

zani

a

13,9

15T

>G

rs41

3803

47

Ingr

am e

tal.

(200

7),

Tis

hkoV

eta

l. (2

007)

, Im

tiaz

etal

. (20

07)

Tis

hkoV

eta

l. (2

007)

, Ena

ttah

etal

. (20

08)

CS

audi

Ara

bia

13,9

10C

>T

rs49

8823

5 E

natt

ah e

tal.

(200

2)T

roel

sen

etal

. (20

03),

Old

s an

d S

ible

y (2

003)

, L

ewin

sky

etal

. (20

05)

AE

urop

e

13,9

07C

>G

rs41

5257

47

Tis

hkoV

eta

l. (2

007)

In

gram

(20

08)

Tis

hkoV

eta

l. (2

007)

, Ena

ttah

etal

. (20

08)

AE

thio

pia/

Suda

n

123

586 Hum Genet (2009) 124:579–591

More recently it has been shown that ¡13910*T occurson an unusually extended haplotype background, which ispresent in the northern European population at very highfrequency (Bersaglieri et al. 2004; Poulter et al. 2003). Thisis consistent with a model of recent positive selection, inwhich alleles surrounding the causal variant ‘hitch-hike’rapidly to high frequency due to strong positive selection,and haplotype length is exaggerated, indicating a recentmutation event where recombination has not decayed theallelic associations in the region (reviewed in Sabeti et al.2006). The ¡13910*T carrying chromosome is a realoutlier in the context of molecular signatures of selectioncompared with the rest of the human genome (HapMap

Consortium 2003). Decreased diversity of microsatellitepolymorphisms (STRs) that occurs in the region of LCTand MCM6 was also found for the ¡13910*T carryingchromosomes, indicating that this allele has risen in fre-quency quickly and recently (Coelho et al. 2005; Mulcare2006) (Fig. 5).

In our own study (Mulcare 2006) we used a marker forA haplotype chromosomes so that we could compare Ahaplotype chromosomes which carry the ¡13910*T with Ahaplotype chromosomes which do not, thus reducing theeVect of pooling haplotypes of totally diVerent lineages.Interestingly, we can see from this that the microsatellitehaplotype that carries ¡13910*T is also the most frequent

Fig. 5 Pie charts showing microsatellite LCT/MCM6 haplotypes onchromosomes of diVerent SNP haplotype background: A haplotypecarrying ¡13910*T, A haplotype carrying ¡13910*C and non-A hap-lotype chromosomes. 5579*C (rs2278544), SNP 10 in Fig. 3, used asa marker for A haplotype and 5579*T as a marker for non-A haplotype,and the A haplotype chromosomes are subdivided into those that doand do not carry ¡13910*T. The lactase persistence associated SNP,¡22018*A (rs182549), originally described in Enattah et al. (2002)was tested on all samples and ¡22018*A correlated in all but onesample with ¡13910*T. Data taken from families and the haplotypesinferred from family structure. Data sets from: Irish n = 65 chromo-

somes, English n = 64, German, n = 60, French, n = 38, AshkenaziJews n = 96, Armenian, n = 88, Kuwaiti, n = 28, Algerian, n = 20,Ethiopian, Amharic n = 118; n values for main charts shown. The insetsmall charts show Ethiopian chromosomes only; n = 93 for non-A hap-lotype; n = 25 for A haplotype. It can be seen that both groups of A-haplotype chromosomes share the same modal haplotype as do bothgroups of non-A chromosomes. The microsatellites tested are locatedin intron 16 of MCM6, intron 1, 2 and 13 of LCT, respectively at posi-tions 13840816, 136804355, 136798196, 136763409, from the HumanGenome Browser (http://genome.cse.ucsc.edu/cgi-bin/hgGatewayJuly 2003 freeze (colour in online)

-13910*T A haplotype

-13910*C A haplotype,

-13910*C non-A haplotype

123

Hum Genet (2009) 124:579–591 587

of the ancestral A haplotype chromosomes in Europeans,and also in non-Europeans. It can also be seen that withinthe non-A lineages there is a fairly frequent microsatellitehaplotype which occurs in Europeans as well as non-Euro-peans (Fig. 5). It is associated with the B core haplotype inEuropeans, and non-persistence. These observations sug-gest demographic factors additional to selection for oneparticular allele, as proposed previously (Hollox et al.2001). Indeed, in the case of European lactase persistence,recent demic computer simulations indicate that the spreadof farming from the near east during the Neolithic transitionmay have contributed to the high frequencies and genetichomogeneity of lactase persistence on the continent(Y. Itan, M. Thomas et al. manuscript in preparation).

Historical origins of lactase persistence; dating of the lactase persistence associated alleles

Each of the microsatellite diversity studies used the micro-satellites to attempt to date the expansion of the ¡13910*Tallele and the date ranges were 7,450–12,300 (Coelho et al.2005), and 7,400–10,200 years ago (Mulcare 2006), andthis agrees with date estimates obtained from extended hap-lotypes of 2,188–20,650 years ago (Bersaglieri et al. 2004).These dates are consistent with models of selection for lac-tase persistence along with the recent practise of dairying,approximately 9,000 years ago in Europe. Ancient DNAdata obtained from human bones has shown that the¡13910*T allele was either absent, or present at low fre-quencies, in early Neolithic Europeans. This is consistentwith the -13910*T allele age estimates and supports amodel whereby the cultural trait of dairying was adoptedprior to lactase persistence becoming frequent (Burger et al.2007).

The newly discovered ¡14010*C allele is also reportedto occur as part of an unusually extended haplotype, sug-gesting that Africans too carry these signatures of recentpositive selection for lactase persistence. In this case theallele is estimated to be between 1,200 and 23,200 yearsold (TishkoV et al. 2007).

The identiWcation of the newly associated alleles them-selves suggests that lactase persistence has arisen and beenselected for independently in several diVerent human popu-lations, thus the ability to digest milk has been extremelyadvantageous, at least for some, in the last few thousandyears.

What were the evolutionary forces?

Because of the worldwide distribution of lactase persis-tence and the generally coinciding pattern of historically

milk-drinking populations, Simoons and McCracken inde-pendently suggested, more than 30 years ago, that milkdependence created strong selection for lactase persistence(McCracken 1971; Simoons 1970). This has becomeknown as the ‘culture historical hypothesis’, and suggeststhat the rise in lactase persistence co-evolved alongside thecultural adaptation of milk drinking, and its associatednutritional beneWts. Nevertheless, the correlation is notabsolute and there are exceptions in both directions. Forexample there are some ethnic groups who rely heavily onmilk products and for whom cows or camels play a veryimportant role in their lifestyle, but who have a lowreported frequency of lactase persistence, for example, theDinka and Nuer in Sudan (Bayoumi et al. 1982) and theSomali in Ethiopia (Ingram 2008). Statistical modellingshows that an incomplete correlation can be accommodatedif some lactase persistent populations have recently stoppedmilking or conversely have only recently adopted the habit,therefore allowing insuYcient time for lactase persistenceto be driven to high frequency (Aoki 1986). Populationmigration may also have played an important role. In addi-tion the cultural practise of milk fermentation (e.g. toyoghurt or cheese) reduces lactose content allowing non-persistent individuals to beneWt from milk products.

Holden and Mace using regression analyses and correct-ing for relatedness of diVerent populations claimed that lac-tose digestion capacity had most likely evolved as anadaptation to dairying, and concluded that high frequencylactose digestion capacity had never ‘evolved’ without theprior presence of milking (Holden and Mace 1997). Otherevidence suggested to be in support of the culture-historicalhypothesis has been provided by the observation that high-intra allelic diversity of cattle milk protein genes in Europecoincides with the geographic incidence of lactase persis-tence, which is consistent with large herd sizes kept fordairying and selection for high milk yields (Beja-Pereiraet al. 2003).

However, it is noteworthy that at least in the Somali, oneof us (CI) has obtained data to suggest that signiWcant quan-tities of fresh milk are consumed by many who are lactasenon-persistent (Ingram 2008) apparently without anyadverse eVects, and it seems likely that adaptation of thecolonic bacterial Xora allows digestion of lactose by thesepeople. This means that under normal circumstances lactasepersistence is unlikely to be under very strong selection inthis population, and Wts with the hypothesis that dairyingand milk drinking can emerge before the genetic adapta-tion. It is likely that only at certain times and under moreextreme circumstances, such as drought and famine, thatthe strong selective force operates. This is an extension ofthe arid climate hypothesis, Wrst suggested by Cook andal-Torki (1975). These authors speculated that in desertclimates (i.e. Middle and Near East) where water and food

123

588 Hum Genet (2009) 124:579–591

were scarce, nomadic groups could survive by utilizingmilk as a food source, and in particular, as a source ofclean, uncontaminated Xuid (Cook and al-Torki 1975). Thisscenario is particularly pertinent to desert nomads whosemajor source of milk is obtained from camels, as these ani-mals are able to survive up to 2 weeks without food andwater by metabolising the fat contained in their humps. ThebeneWts to persistent individuals may have become morepronounced during outbreaks of diarrhoeal disease, whennon-persistent individuals would be unable to utilize milkas a water source without exacerbating their condition.

More recent research sought to address the question ofwhy some populations and not others had adopted the cul-tural habit of milk drinking. The frequencies of lactose mal-absorption were greater in populations where environmentalconditions, such as extremes of climate or high incidence ofendemic cattle disease, made it impossible to raise livestock(Bloom and Sherman 2005). The exceptions to the generaldistribution were a number of African groups with high lac-tase persistence frequency who managed to circumventharsh environmental conditions by adopting a pastoralistway of life (Bloom and Sherman 2005).

Obviously, the beneWts of milk drinking cannot beexplained by the arid climate hypothesis in NorthernEurope. Here, the advantage of improved calcium absorp-tion has been suggested to explain the distribution of thetrait (Flatz and Rotthauwe 1973). The low light levels expe-rienced at high latitudes are associated with an increasedrisk of developing rickets and osteomalacia due to a lack ofvitamin D production (which is synthesized by the skin inthe presence of sunlight). Vitamin D is involved in the gutabsorption of calcium, which is itself an essential mineralrequired for bone health. In addition, calcium may help toprevent rickets by impairing the breakdown of vitamin D inthe liver (Thacher et al. 1999). Although lactase non-persis-tent individuals could obtain calcium from yoghurt orcheese, dairy foods that contain reduced lactose, milk pro-teins and lactose are believed to facilitate the absorption ofcalcium (for review see Gueguen and Pointillart 2000).Hence the ability to drink fresh milk which contains bothcalcium and components that stimulate its uptake (includ-ing small amounts of vitamin D) may have provided anadvantage to persistent individuals.

Just one hypothesis has been put forward which suggestsselection for lactase non-persistence. Since lactase non-per-sistence is the ancestral state, the need to invoke selectionfor non-persistence is counter-intuitive, but should not beignored. In this proposal the selective agent is thought to bemalaria (Anderson and Vullo 1994). This proposal camefrom the observations of high frequency of lactase non-per-sistence in regions where malaria is endemic, and that indi-viduals with Xavin deWciency are at a slightly reduced riskof infection by malaria. The consumption of milk, which is

rich in riboXavins, was therefore proposed to be unfavour-able since it would keep Xavin levels in the bloodstreamhigh. There is currently no support for this hypothesis(Meloni et al. 1998), and it seems unlikely to contribute tothe current distribution of lactase persistence.

Present day health and medical considerations

Lactose malabsorption can readily be confused with milkprotein allergy, which has quite diVerent causes (reviewedin Crittenden and Bennett 2005), and in recent times lactoseintolerance has been blamed for causing a variety of sys-temic conditions, often without clear evidence (Campbelland Matthews 2005; Matthews et al. 2005). Nonetheless itdoes appear that consumption of milk and milk products bythose who cannot digest lactose is a relatively commoncause of irritable bowel syndrome in Europe and the USA(Vesa et al. 2000). Many commercial dairy products andother foods (including yoghurts) contain high concentra-tions of lactose introduced in manufacturing, so that lactoseis more widespread in the diet than it was for that same per-son’s ancestors. Lactose tolerance testing can be a useful wayof detecting lactose malabsorption and enabling avoidance ofthe cause, but DNA testing is not yet useful, particularly fornon-Europeans (Swallow 2006; Tag et al. 2008; Weiskir-chen et al. 2007). In countries such as Finland, where thereis a high frequency of lactase non-persistence in compari-son with the rest of northern Europe, commercial lowlactose products are readily available (Harju 2003).

Many association studies have attempted to demonstratethe health beneWts of milk consumption in lactase persistentpeople, e.g. by providing protection against osteoporosis(Enattah et al. 2005a, b; Meloni et al. 2001; Obermayer-Pietsch et al. 2004), and others have claimed adverse eVectsof lactase persistence and associated high milk consump-tion (e.g. cataracts, ovarian cancer and diabetes) (Enattahet al. 2004; Larsson et al. 2006; Meloni et al. 2001; Meloniet al. 1999; Villako and Maaroos 1994). The often-contra-dictory Wndings are diYcult to evaluate because of the highrisk of confounding eVects such as mixed ancestry, dietaryintake and variation in gut Xora.

Conclusion

Lactase persistence has been one of the leading examples ofnatural selection in humans, and also one of the Wrst clearexamples of polymorphism of a regulatory element. Furtherinvestigation of the molecular mechanisms as well as theevolutionary forces is however needed to fully understandthis normal variation, which is providing an importantmodel for understanding gene/culture co-evolution and

123

Hum Genet (2009) 124:579–591 589

disease susceptibility. The information accrued so faralready illustrates the limitations of disease associationstudies and SNP tagging to Wnd functional genetic variationattributable to multiple mutations, even if they are locatedin a single gene, and highlights the potential importance ofdistant regulatory elements.

Acknowledgments CJEI and CAM were funded by BBSRC CASEstudentships and YI was funded by UCL Graduate school, UCL ORSand B’nai B’rith/Leo Baeck London Lodge scholarships. We thankNeil Bradman, The Centre for Genetic Anthropology, UCL, for accessto samples and Melford Charitable Trust for funding.

References

Anderson B, Vullo C (1994) Did malaria select for primary adultlactase deWciency? Gut 35:1487–1489

Aoki K (1986) A stochastic model of gene-culture coevolution sug-gested by the culture-historical hypothesis. Proc Natl Acad SciUSA 83:2929–2933

Auricchio S, Rubino A, Semenza G, Landolt M, Prader A (1963) Iso-lated intestinal lactase deWciency in the adult. Lancet 2:324–326

Bayoumi RA, Saha N, Salih AS, Bakkar AE, Flatz G (1981) Distribu-tion of the lactase phenotypes in the population of the DemocraticRepublic of the Sudan. Hum Genet 57:279–281

Bayoumi RA, Flatz SD, Kuhnau W, Flatz G (1982) Beja and Nilotes:nomadic pastoralist groups in the Sudan with opposite distribu-tions of the adult lactase phenotypes. Am J Phys Anthropol58:173–178

Beja-Pereira A, Luikart G, England PR, Bradley DG, Jann OC, Berto-relle G, Chamberlain AT, Nunes TP, Metodiev S, Ferrand N,Erhardt G (2003) Gene-culture coevolution between cattle milkprotein genes and human lactase genes. Nat Genet 35:311–313

Bernardes-Silva CF, Pereira AC, de Fatima Alves da Mota, Krieger JE,Laudanna AA (2007) Lactase persistence/non-persistence vari-ants, C/T_13910 and G/A_22018, as a diagnostic tool for lactoseintolerance in IBS patients. Clin Chim Acta 386:7–11

Bersaglieri T, Sabeti PC, Patterson N, Vanderploeg T, SchaVner SF,Drake JA, Rhodes M, Reich DE, Hirschhorn JN (2004) Geneticsignatures of strong recent positive selection at the lactase gene.Am J Hum Genet 74:1111–1120

Bloom G, Sherman PW (2005) Dairying barriers aVect the distributionof lactose malabsorption. Evol Human Behav 26:301–312

Boll W, Wagner P, Mantei N (1991) Structure of the chromosomalgene and CDNAs coding for lactase-phlorizin hydrolase in hu-mans with adult-type hypolactasia or persistence of lactase. Am JHum Genet 48:889–902

Bosse T, Piaseckyj CM, Burghard E, Fialkovich JJ, Rajagopal S, PuWT, Krasinski SD (2006a) Gata4 is essential for the maintenanceof jejunal–ileal identities in the adult mouse small intestine. MolCell Biol 26:9060–9070

Bosse T, van Wering HM, Gielen M, Dowling LN, Fialkovich JJ,Piaseckyj CM, Gonzalez FJ, Akiyama TE, Montgomery RK,Grand RJ, Krasinski SD (2006b) Hepatocyte nuclear factor-1alpha is required for expression but dispensable for histone acet-ylation of the lactase-phlorizin hydrolase gene in vivo. Am JPhysiol Gastrointest Liver Physiol 290:G1016–G1024

Bosse T, Fialkovich JJ, Piaseckyj CM, Beuling E, Broekman H, GrandRJ, Montgomery RK, Krasinski SD (2007) Gata4 and Hnf1alphaare partially required for the expression of speciWc intestinalgenes during development. Am J Physiol Gastrointest Liver Phys-iol 292:G1302–G1314

Briet F, Pochart P, Marteau P, Flourie B, Arrigoni E, Rambaud JC(1997) Improved clinical tolerance to chronic lactose ingestion insubjects with lactose intolerance: a placebo eVect? Gut 41:632–635

Buller HA, Kothe MJC, Goldman DA, Grubman SA, Sasak WV, Mat-sudaira PT, Montgomery RK, Grand RJ (1990) Coordinateexpression of lactase-phlorizin hydrolase mRNA and enzyme lev-els in rat intestine during development. J Biol Chem 265:6978–6983

Burger J, Kirchner M, Bramanti B, Haak W, Thomas MG (2007) Ab-sence of the lactase-persistence-associated allele in early Neo-lithic Europeans. Proc Natl Acad Sci USA 104:3736–3741

Campbell AK, Matthews SB (2005) Darwin’s illness revealed. Post-grad Med J 81:248–251

Coelho M, Luiselli D, Bertorelle G, Lopes AI, Seixas S, stro-Bisol G,Rocha J (2005) Microsatellite variation and evolution of humanlactase persistence. Hum Genet 117:329–339

Cook GC, al-Torki MT (1975) High intestinal lactase concentrations inadult Arabs in Saudi Arabia. Br Med J 3:135–136

Crittenden RG, Bennett LE (2005) Cow’s milk allergy: a complex dis-order. J Am Coll Nutr 24:582S–591S

Dahlqvist A, Hammond B, Crane R, Dunphy J, Littman A (1963)Intestinal lactase deWciency and lactose intolerance in adults: pre-liminary report. Gastroenterology 45:488–491

Dissanyake AS, El-Munshid HA, Al-Qurain A (1990) Prevalence ofprimary adult lactose malabsorption in the eastern province ofSaudi Arabia. Ann Saudi Med 10:598–601

Enattah NS, Sahi T, Savilahti E, Terwilliger JD, Peltonen L, Jarvela I(2002) IdentiWcation of a variant associated with adult-type hyp-olactasia. Nat Genet 30:233–237

Enattah NS, Forsblom C, Rasinpera H, Tuomi T, Groop PH, Jarvela I(2004) The genetic variant of lactase persistence C (¡13910) T asa risk factor for type I and II diabetes in the Finnish population.Eur J Clin Nutr 58:1319–1322

Enattah N, Pekkarinen T, Valimaki MJ, Loyttyniemi E, Jarvela I(2005a) Genetically deWned adult-type hypolactasia and self-re-ported lactose intolerance as risk factors of osteoporosis inFinnish postmenopausal women. Eur J Clin Nutr 59:1105–1111

Enattah NS, Sulkava R, Halonen P, Kontula K, Jarvela I (2005b)Genetic variant of lactase-persistent C/T-13910 is associated withbone fractures in very old age. J Am Geriatr Soc 53:79–82

Enattah NS, Trudeau A, PimenoV V, Maiuri L, Auricchio S, Greco L,Rossi M, Lentze M, Seo JK, Rahgozar S, Khalil I, Alifrangis M,Natah S, Groop L, Shaat N, Kozlov A, Verschubskaya G, ComasD, Bulayeva K, Mehdi SQ, Terwilliger JD, Sahi T, Savilahti E,Perola M, Sajantila A, Jarvela I, Peltonen L (2007) Evidence ofstill-ongoing convergence evolution of the lactase persistenceT-13910 alleles in humans. Am J Hum Genet 81:615–625

Enattah NS, Jensen TG, Nielsen M, Lewinski R, Kuokkanen M, Rasin-pera H, El-Shanti H, Seo JK, Alifrangis M, Khalil IF, Natah A,Ali A, Natah S, Comas D, Mehdi SQ, Groop L, Vestergaard EM,Imtiaz F, Rashed MS, Meyer B, Troelsen J, Peltonen L (2008)Independent introduction of two lactase-persistence alleles intohuman populations reXects diVerent history of adaptation to milkculture. Am J Hum Genet 82:57–72

Escher JC, de Koning ND, van Engen CG, Arora S, Buller HA, Mont-gomery RK, Grand RJ (1992) Molecular basis of lactase levels inadult humans. J Clin Invest 89:480–483

Fang R, Santiago NA, Olds LC, Sibley E (2000) The homeodomainprotein Cdx2 regulates lactase gene promoter activity duringenterocyte diVerentiation. Gastroenterology 118:115–127

Fang R, Olds LC, Santiago NA, Sibley E (2001) GATA family tran-scription factors activate lactase gene promoter in intestinal Caco-2 cells. Am J Physiol Gastrointest Liver Physiol 280:G58–G67

Ferguson A, Maxwell J (1967) Genetic aetiology of lactose intoler-ance. Lancet 2:188–190

123

590 Hum Genet (2009) 124:579–591

Flatz G (1984) Gene dosage eVect on intestinal lactase activity demon-strated in vivo. Am J Hum Genet 36:306–310

Flatz G (1987) Genetics of lactose digestion in humans. In: Harris H,Hirschhorn K (eds) Advances in human genetics, vol 16. PlenumPress, New York, pp 1–77

Flatz G, Rotthauwe HW (1973) Lactose nutrition and natural selection.Lancet 2:76–77

Gueguen L, Pointillart A (2000) The bioavailability of dietary calcium.J Am Coll Nutr 19:119S–136S

HapMap Consortium (2003) The International HapMap Project.Nature 426:789–796

Harju M (2003) Chromatographic and enzymatic removal of lactosefrom milk, IDF World Dairy Summit, Bruges, BELGIQUE(09/2003) 2004, no 389, pp 4–8

Harvey CB, Pratt WS, Islam I, Whitehouse DB, Swallow DM (1995)DNA polymorphisms in the lactase gene. Linkage disequilibriumacross the 70-kb region. Eur J Hum Genet 3:27–41

Harvey CB, Hollox EJ, Poulter M, Wang Y, Rossi M, Auricchio S, Iq-bal TH, Cooper BT, Barton R, Sarner M, Korpela R, Swallow DM(1998) Lactase haplotype frequencies in Caucasians: associationwith the lactase persistence/non-persistence polymorphism. AnnHum Genet 62(Pt 3):215–223

Hauri HP, Sterchi EE, Bienz D, Fransen JA, Marxer A (1985) Expres-sion and intracellular transport of microvillus membrane hydro-lases in human intestinal epithelial cells. J Cell Biol 101:838–851

Hertzler SR, Savaiano DA (1996) Colonic adaptation to daily lactosefeeding in lactose maldigesters reduces lactose intolerance. Am JClin Nutr 64:232–236

Hertzler SR, Savaiano DA, Levitt MD (1997) Fecal hydrogen produc-tion and consumption measurements—response to daily lactoseingestion by lactose maldigesters. Dig Dis Sci 42:348–353

Ho MW, Povey S, Swallow DM (1982) Lactase polymorphism in adultBritish natives: estimating allele frequencies by enzyme assays inautopsy samples. Am J Hum Genet 34:650–657

Hogenauer C, Hammer HF, Mellitzer K, Renner W, Krejs GJ, ToplakH (2005) Evaluation of a new DNA test compared with the lactosehydrogen breath test for the diagnosis of lactase non-persistence.Eur J Gastroenterol Hepatol 17:371–376

Holden C, Mace R (1997) Phylogenetic analysis of the evolution oflactose digestion in adults. Hum Biol 69:605–628

Hollox EJ, Poulter M, Wang Y, Krause A, Swallow DM (1999) Com-mon polymorphism in a highly variable region upstream of thehuman lactase gene aVects DNA–protein interactions. Eur J HumGenet 7:791–800

Hollox EJ, Poulter M, Zvarik M, Ferak V, Krause A, Jenkins T, SahaN, Kozlov AI, Swallow DM (2001) Lactase haplotype diversity inthe Old World. Am J Hum Genet 68:160–172

Imtiaz F, Savilahti E, Sarnesto A, Trabzuni D, Al-Kahtani K, KageviI, Rashed MS, Meyer BF, Jarvela I (2007) The T/G 13915 variantupstream of the lactase gene (LCT) is the founder allele of lactasepersistence in an urban Saudi population. J Med Genet 44:e89

Ingram CJE (2008) The evolutionary genetics of lactase persistence inAfrica and the Middle East. Ph.D. thesis University of London

Ingram CJE, Elamin MF, Mulcare CA, Weale ME, Tarekegn A, RagaTO, Bekele E, Elamin FM, Thomas MG, Bradman N, SwallowDM (2007) A novel polymorphism associated with lactose toler-ance in Africa: multiple causes for lactase persistence? Hum Gen-et 120:779–788

Jacob R, Brewer C, Fransen JA, Naim HY (1994) Transport, function,and sorting of lactase-phlorizin hydrolase in Madin–Darby caninekidney cells. J Biol Chem 269:2712–2721

Jacob R, Bulleid NJ, Naim HY (1995) Folding of human intestinal lac-tase-phlorizin hydrolase. J Biol Chem 270:18678–18684

Jacob R, Radebach I, Wuthrich M, Grunberg J, Sterchi EE, Naim HY(1996) Maturation of human intestinal lactase-phlorizin hydro-lase: generation of the brush border form of the enzyme involves

at least two proteolytic cleavage steps. Eur J Biochem 236:789–795

Jacob R, Peters K, Naim HY (2002) The prosequence of human lac-tase-phlorizin hydrolase modulates the folding of the mature en-zyme. J Biol Chem 277:8217–8225

Kerber M, Oberkanins C, Kriegshauser G, Kollerits B, senbach-Glan-inger A, Fuchs D, Ledochowski M (2007) Hydrogen breath test-ing versus LCT genotyping for the diagnosis of lactoseintolerance: a matter of age? Clin Chim Acta 383:91–96

Krasinski SD, van Wering HM, Tannemaat MR, Grand RJ (2001)DiVerential activation of intestinal gene promoters: functionalinteractions between GATA-5 and HNF-1 alpha. Am J PhysiolGastrointest Liver Physiol 281:G69–G84

Lacey SW, Naim HY, Magness RR, Gething M-J, Sambrook JF (1994)Expression of lactase-phlorizin hydrolase in sheep is regulated atthe RNA level. Biochem J 302:929–935

Larsson SC, Orsini N, Wolk A (2006) Milk, milk products and lactoseintake and ovarian cancer risk: a meta-analysis of epidemiologicalstudies. Int J Cancer 118:431–441

Lee SY, Wang Z, Lin CK, Contag CH, Olds LC, Cooper AD, Sibley E(2002) Regulation of intestine-speciWc spatiotemporal expressionby the rat lactase promoter. J Biol Chem 277:13099–13105

Lewinsky RH, Jensen TG, Moller J, Stensballe A, Olsen J, Troelsen JT(2005) T-13910 DNA variant associated with lactase persistenceinteracts with Oct-1 and stimulates lactase promoter activity invitro. Hum Mol Genet 14:3945–3953

Lloyd M, Mevissen G, Fischer M, Olsen W, Goodspeed D, Genini M,Boll W, Semenza G, Mantei N (1992) Regulation of intestinal lac-tase in adult hypolactasia. J Clin Invest 89:524–529

Maiuri L, Raia V, Potter J, Swallow DM, Ho MW, Fiocca R, Finzi G,Cornaggia M, Capella C, Quaroni A, Auricchio S (1991) Mosaicpattern of lactase expression in villous enterocytes in humanadult-type hypolactasia. Gastroenterology 100:359–369

Maiuri L, Rossi M, Raia V, Garipoli V, Hughes LA, Swallow D, NorenO, Sjostrom H, Auricchio S (1994) Mosaic regulation of lactasein human adult-type hypolactasia. Gastroenterology 107:54–60

Matthews SB, Waud JP, Roberts AG, Campbell AK (2005) Systemiclactose intolerance: a new perspective on an old problem. Post-grad Med J 81:167–173

McCracken RD (1971) Lactase deWciency—example of dietary evolu-tion. Curr Anthropol 12:479

Meloni T, Colombo C, Ruggiu G, Dessena M, Meloni GF (1998) Pri-mary lactase deWciency and past malarial endemicity in Sardinia.Ital J Gastroenterol Hepatol 30:490–493

Meloni GF, Colombo C, La VC, Ruggiu G, Mannazzu MC, AmbrosiniG, Cherchi PL (1999) Lactose absorption in patients with ovariancancer. Am J Epidemiol 150:183–186

Meloni GF, Colombo C, La VC, PaciWco A, Tomasi P, Ogana A, Mari-naro AM, Meloni T (2001) High prevalence of lactose absorbersin Northern Sardinian patients with type 1 and type 2 diabetesmellitus. Am J Clin Nutr 73:582–585

Metneki J, Cziezel A, Flatz SD, Flatz G (1984) A study of lactoseabsorption capacity in twins. Hum Genet 67:296–300

Mitchelmore C, Troelsen JT, Spodsberg N, Sjostrom H, Noren O(2000) Interaction between the homeodomain proteins Cdx2 andHNF1alpha mediates expression of the lactase-phlorizin hydro-lase gene. Biochem J 346(Pt 2):529–535

Mulcare (2006) The evolution of the lactase persistence phenotype.Ph.D. thesis University of London, London, UK

Mulcare CA, Weale ME, Jones AL, Connell B, Zeitlyn D, Tarekegn A,Swallow DM, Bradman N, Thomas MG (2004) The T allele of asingle-nucleotide polymorphism 13.9 kb upstream of the lactasegene (LCT) (C-13.9kbT) does not predict or cause the lactase-per-sistence phenotype in Africans. Am J Hum Genet 74:1102–1110

Naim HY, Lentze MJ (1992) Impact of O-glycosylation on the functionof human intestinal lactase-phlorizin hydrolase. Characterization

123

Hum Genet (2009) 124:579–591 591

of glycoforms varying in enzyme activity and localization ofO-glycoside addition. J Biol Chem 267:25494–25504

Newcomer AD, McGill DB, Thomas PJ, Hofmann AF (1975) Prospec-tive comparison of indirect methods for detecting lactase deW-ciency. N Engl J Med 293:1232–1236

Obermayer-Pietsch BM, Bonelli CM, Walter DE, Kuhn RJ, Fahrleit-ner-Pammer A, Berghold A, Goessler W, Stepan V, Dobnig H,Leb G, Renner W (2004) Genetic predisposition for adult lactoseintolerance and relation to diet, bone density, and bone fractures.J Bone Miner Res 19:42–47

Olds LC, Sibley E (2003) Lactase persistence DNA variant enhanceslactase promoter activity in vitro: functional role as a cis regula-tory element. Hum Mol Genet 12:2333–2340

Peuhkuri (2000) Lactose, lactase, and bowel disorders, Ph.D. thesis,University of Helsinki, Finland

Peuhkuri K, Vapaatalo H, Korpela R, Teuri U (2000) Lactose intoler-ance—a confusing clinical diagnosis. Am J Clin Nutr 71:600–602

Poulter M, Hollox E, Harvey CB, Mulcare C, Peuhkuri K, Kajander K,Sarner M, Korpela R, Swallow DM (2003) The causal element forthe lactase persistence/non-persistence polymorphism is locatedin a 1 Mb region of linkage disequilibrium in Europeans. AnnHum Genet 67:298–311

Rasinpera H, Savilahti E, Enattah NS, Kuokkanen M, Totterman N,Lindahl H, Jarvela I, Kolho KL (2004) A genetic test which canbe used to diagnose adult-type hypolactasia in children. Gut53:1571–1576

Sabeti PC, SchaVner SF, Fry B, Lohmueller J, Varilly P, ShamovskyO, Palma A, Mikkelsen TS, Altshuler D, Lander ES (2006) Posi-tive natural selection in the human lineage. Science 312:1614–1620

Sahi T (1974) The inheritance of selective adult-type lactose malab-sorption. Scand J Gastroenterol 9:1–73

Saltzman JR, Russell RM, Golner B, Barakat S, Dallal GE, Goldin BR(1999) A randomized trial of Lactobacillus acidophilus BG2FO4to treat lactose intolerance. Am J Clin Nutr 69:140–146

Scrimshaw NS, Murray EB (1988) The acceptability of milk and milkproducts in populations with a high prevalence of lactose intoler-ance. Am J Clin Nutr 48:1079–1159

Sebastio G, Villa M, Sartorio R, Guzzetta V, Poggi V, Auricchio S,Boll W, Mantei N, Semenza G (1989) Control of lactase in humanadult-type hypolactasia and in weaning rabbits and rats. Am JHum Genet 45:489–497

Simoons FJ (1970) Primary lactose intolerance and the milking habit:a problem in biological and cultural interrelations, II. A culturehistorical hypothesis. Am J Dig Dis 15:695–710

Simoons FJ (1978) The geographic hypothesis and lactose malabsorp-tion—a weighing of the evidence. Dig Dis 23:963–980

Snook CR, Mahmoud JN, Chang WP (1976) Lactose tolerance in adultJordanian Arabs. Trop Geogr Med 28:333–335

Spodsberg N, Troelsen JT, Carlsson P, Enerback S, Sjostrom H, NorenO (1999) Transcriptional regulation of pig lactase-phlorizinhydrolase. Involvement of HNF-1 and FREACs. Gastroenterol-ogy 116:842–854

Sterchi E, Mills P, Fransen J, Hauri H, Lentze M, Naim H, Ginsel L,Bond J (1990) Biogenesis of intestinal lactase-phlorizin hydrolasein adults with lactose intolerance. Evidence for reduced biosyn-thesis and slowed-down maturation in enterocytes. J Clin Invest86:1329–1337

Suarez FL, Savaiano D, Arbisi P, Levitt MD (1997) Tolerance to thedaily ingestion of two cups of milk by individuals claiminglactose intolerance. Am J Clin Nutr 65:1502–1506

Swallow DM (2006) DNA test for hypolactasia premature. Gut55:131–132

Swallow DM, Hollox EJ (2000) The genetic polymorphism of intesti-nal lactase activity in adult humans. In: Scriver CR, Beaudet AL,Sly WS, Valle D (eds) The metabolic and molecular basis ofinherited disease. McGraw-Hill, New York, pp 1651–1662

Tag CG, SchiZers MC, Mohnen M, Gressner AM, Weiskirchen R(2007) A novel proximal ¡13914G > A base replacement in thevicinity of the common-13910T/C lactase gene variation resultsin an atypical LightCycler melting curve in testing with the Mu-taREAL lactase test. Clin Chem 53:146–148

Tag CG, Oberkanins C, Kriegshauser G, Ingram CJ, Swallow DM,Gressner AM, Ledochowski M, Weiskirchen R (2008) Evaluationof a novel reverse-hybridization StripAssay for typing DNA vari-ants useful in diagnosis of adult-type hypolactasia. Clin ChimActa 392:58–62

Thacher TD, Fischer PR, Pettifor JM, Lawson JO, Isichei CO, ReadingJC, Chan GM (1999) A comparison of calcium, vitamin D, orboth for nutritional rickets in Nigerian children. N Engl J Med341:563–568

TishkoV SA, Reed FA, Ranciaro A, Voight BF, Babbitt CC, SilvermanJS, Powell K, Mortensen HM, Hirbo JB, Osman M, Ibrahim M,Omar SA, Lema G, Nyambo TB, Ghori J, Bumpstead S, PritchardJK, Wray GA, Deloukas P (2007) Convergent adaptation of hu-man lactase persistence in Africa and Europe. Nat Genet 39:31–40

Troelsen JT, Mehlum A, Olsen J, Spodsberg N, Hansen GH, Prydz H,Noren O, Sjostrom H (1994) 1 kb of the lactase-phlorhizin hydro-lase promoter directs post-weaning decline and small intestinal-speciWc expression in transgenic mice. FEBS Lett 342:291–296

Troelsen JT, Mitchelmore C, Spodsberg N, Jensen AM, Noren O, Sjo-strom H (1997) Regulation of lactase-phlorizin hydrolase geneexpression by the caudal-related homoeodomain protein Cdx-2.Biochem J 322(Pt 3):833–838

Troelsen JT, Olsen J, Moller J, Sjostrom H (2003) An upstream poly-morphism associated with lactase persistence has increased en-hancer activity. Gastroenterology 125:1686–1694

van Wering HM, Bosse T, Musters A, de Jong E, de Jong N, HogenEsch CE, Boudreau F, Swain GP, Dowling LN, Montgomery RK,Grand RJ, Krasinski SD (2004) Complex regulation of the lac-tase-phlorizin hydrolase promoter by GATA-4. Am J PhysiolGastrointest Liver Physiol 287(4):G899–909

Vesa TH, Marteau P, Korpela R (2000) Lactose intolerance. J Am CollNutr 19:165S–175S

Villako K, Maaroos H (1994) Clinical picture of hypolactasia and lac-tose intolerance. Scand J Gastroenterol Suppl 202:36–54

Wang Y, Harvey CB, Pratt WS, Sams VR, Sarner M, Rossi M, Auric-chio S, Swallow DM (1995) The lactase persistence/non-persis-tence polymorphism is controlled by a cis-acting element. HumMol Genet 4:657–662

Wang Z, Maravelias C, Sibley E (2006) Lactase gene promoter frag-ments mediate diVerential spatial and temporal expression pat-terns in transgenic mice. DNA Cell Biol 25:215–222

Weiskirchen, Tag CG, Mengsteab S, Gressner AM, Ingram CJE, Swal-low DM (2007) Pitfalls in LightCycler Diagnosis of the single-nucleotide polymorphism 13.9 kb upstream of the lactase genethat is associated with adult-type hypolactasia

Witte J, Lloyd M, Lorenzsonn V, Korsmo H, Olsen W (1990) Thebiosynthetic basis of adult lactase deWciency. J Clin Invest86:1338–1342

123