S1

SUPPORTING INFORMATION

Lead Sulfide Nanoparticles Increase Cell Wall Chitin Content and

Induce Apoptosis in Saccharomyces cerevisiae

M. Q. Sun a, Q. L. Yu

b, M.Y. Hu

c, Z.W. Hao

a, C.D. Zhang

a, and M.C. Li

b

a College of Environmental Science and Engineering, Nankai University, Tianjin,

China 300071 b Ministry of Education Key Laboratory of Molecular Microbiology and Technology,

Department of Microbiology, College of Life Science, Nankai University, Tianjin,

China 300071 c Affiliated High School of Nankai University

* Corresponding author:

Chengdong Zhang

Tel/fax: 86-22-66229517; E-mail: zhangchengdong@nankai.edu.cn

Mingchun Li

Tel/fax: 86-22-23508506 ; E-mail: nklimingchun@163.com

Supplementary Material

S2

Materials and Methods

1. Synthesis and characterization of PbS particles

Three types of PbS particles with different sizes, bulk PbS (named bulk-PbS),

large nano-PbS (named nano-PbS1), small nano-PbS (named PbS2), were synthesized

as Jiang’s methods with modification [1]. All chemicals were reagent grade and used

without further purification or modification.

To synthesize bulk-PbS, 0.0121 g L-cysteine (C3H7NO2S, A.R., molecular weight

121) were dissolved in 30 ml deionized water, 0.0379 g of Pb(AC)2·3H2O was added

and then 10 mL ethylene glycol was added. The resulting mixture was continually

stirred for 10 min and was then transferred into a 50 mL (capacity) Teflon-lined

stainless autoclave. The autoclave was sealed and maintained at 150°C for 17 h. The

system was then cooled to room temperature. The final product was collected, washed

with distilled water and absolute alcohol for several times, vacuum-dried, and kept for

further characterization.

For nano-PbS1 synthesis, 0.121 g L-cysteine (C3H7NO2S, A.R.) was dissolved in

30 mL deionized water, 0.379 g of Pb(AC)2·3H2O and 10 mL ethylene glycol was

added. The resulting mixture was continually stirred for 10 min and was then

transferred into a Teflon-lined stainless autoclave (50 mL capacity). The autoclave

was sealed and maintained at 150 °C for 17 h. The system was then cooled to room

temperature. The final product was collected, washed with distilled water and

absolute alcohol for several times, vacuum-dried, and kept for further

characterization.

S3

For nano-PbS2 synthesis, 0.3644 g hexadecyltrimethylammonium bromide

(CTAB, C16H33(CH3)3NBr, A.R.) and 0.152 g thioacetamide (CH3CSNH2, A.R.) were

dissolved in 40 mL deionized water, and 0.379 g of Pb(AC)2·3H2O was added to the

above solution under stirring. The resulting mixture was continually stirred for 10 min

and was then transferred into a Teflon-lined stainless autoclave (50 mL capacity). The

autoclave was sealed and maintained at 120°C for 14 h. The system was then cooled

to room temperature. The final product was collected, washed with distilled water and

absolute alcohol for several times, vacuum-dried, and kept for further

characterization.

The average diameter of the PbS crystallites was calculated by the Scherer’s

equation: D=α λ/(β cosθ), where D is the particle diameter of nanocrystallite, α is the

constant (0.9), λ is the X-ray wavelength (1.5405Å), β is the half-width of the

diffraction peak.

The particle size distribution and their state of agglomeration/dispersion were

determined by a ZetaPALS (ZETAPALS/BI-200SM, Brookhaven, USA) in YPD

medium. Various PbS particles were suspended in YPD medium to obtain the

concentration of 640 mg/L. After sonicated for 30 min, the suspensions were diluted

10 times in YPD medium for DLS measurements. Diluted samples were used to avoid

multiple scattering.

2. Growth inhibition by Pb2+

One milliliter of cell suspension was mixed with 1 mL Pb2+

solution (prepared

by dissolving Pb(NO3)2 in YPD medium) in glass tubes and the final concentrations of

S4

Pb2+

were 0, 6.3, 12.5, 25, 50, 100, 200 and 400 mg/L, respectively. The control

contained 2 mL of YPD medium only. The mixtures were then cultured at 30℃ with

shaking at 180 rpm for 24 h. Cells in each tube were counted with haemocytometers.

3. Time-dependent growth inhibition assay

One milliliter of cell suspension was mixed with 1 mL PbS suspension or

Pb(NO3)2 (prepared in YPD medium) solution and the final concentrations of PbS

particles and Pb2+

were 640 mg/L and 100 mg/L, respectively. The mixtures were then

cultured at 30℃ with shaking at 180 rpm for 0, 2, 4, 6, 8, 10, 12, 24 h. Cells at each

time point were counted with haemocytometers.

4. Effect of ascorbic acid on the cell growth

One milliliter of cell suspension was mixed with 1 mL nano-PbS2 suspension and

the final concentration of nano-PbS2 was 640 mg/L. Ten microliters of ascorbic acid

(20 mM, prepared in water, BBI, USA) were added into the mixture to the final

concentration of 100 μM. The mixtures were then cultured at 30℃ with shaking at

180 rpm for 24 h. Cells were counted with haemocytometers.

5. β-galactosidase assays

Cells were harvested and suspended in 1 mL working Z buffer (60 mM Na2HPO4,

40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, 0.27% (V/V) β-mercaptoethanol, pH

7.0). Ten microliters of cell suspensions were mixed with 990 μL of dH2O, and the

OD600 of the diluted suspensions was determined. Two hundreds microliter of

suspensions were permeabilized with 20 μL chloroform and 50 μL sodium

dodecylsulphate (0.1% (W/V), prepared in water), and equilibrated at 30℃ for 5 min.

S5

The permeabilized cells were mixed with 700 μL

O-nitrophenyl-β-D-galactopyranoside (5 mg/mL, prepared in working Z buffer, Sigma,

USA), and incubated at 30℃ for certain time (T). The reaction time (T) was

monitored, and when sufficient yellow color has developed the reaction were stopped

by the addition of 500 μL Na2CO3 (1 M). Suspensions were centrifuged at 12000 rpm

for 10 min, and the absorbance of supernatant at 420 nm (OD420) was determined.

Miller units of activity were calculated as (OD420×1000) / (OD 600×T×20) [2].

6. ROS detection

One milliliter of prepared cell suspensions (with OD600 of 0.5) was mixed with 4

μL of DCFH-DA (10 mg/mL, dissolved in ethanol, Sigma USA). After incubated at

30°C for 30 min, cells were harvested, washed and re-suspended in PBS buffer. The

cells were then examined by a fluorescence microscope with the green filter set. The

percent of DCFH-DA-positive (ROS-accumulated) cells was calculated as the number

of DCFH-DA-positive cells divided by the number of total observed cells. At least 20

examined fields were determined [3].

7. MMP measurement

The five hundred microliters of prepared cell suspensions were incubated with 5

μL of JC-1 (1 mg/mL, dissolved in DMSO, Sigma USA) for 30 min at 30℃[4]. The

MMP of stained cells were examined using a flow cytometer (CaLibar, Beckton

Dickson, USA). J-aggregate fluorescence was recorded by the flow cytometer in

fluorescence channel 2 (FL2) and monomer fluorescence in fluorescence channel 1

(FL1).

S6

8. MCA1 gene expression

Then treated cells were harvested, washed with dH2O, and suspended in LETS

buffer (10 mM Tris-HCl, 10 mM Na2EDTA, 10 mM LiCl, 0.2% SDS, dissolved in

diethypyrocarbonate-treated dH2O). Cells were then disrupted by glass beads with

vortex. Cell total RNA was isolated using Total RNA extraction kit (TIANGEN,

China) following the manufacturer’s instructions, then treated with DNaseⅠ(Takara,

China) to remove genomic DNA, and reversely transcribed to cDNA by M-MLV

reverse transcriptase (Promega, Madison, USA). RT-PCR reactions were performed

using TranStart Green qPCR SuperMix (Transgene, China) with 5 replicates, using

the primers MCA1-5RT (5’ GGATGCGCAACCCAATGA 3’) and MCA1-3RT (5’

AAATCTTCAGTTTGGCCACCAT 3’) [5]. The ACT1 gene was used as the

endogenous control. The PCR protocol consisted of a primary denaturation step at 94℃

for 3 min, followed by 40 cycles of denaturation at 94℃ for 20 s, annealing at 58℃

for 20 s, and extension at 68℃ for 30 s [6]. Results were analyzed using iQTM

5

software (Bio-Rad, Hercules, USA).

9. DAPI staining

The prepared cells were fixed with 1 mL of 4% (v/v) formaldehyde for 10 min,

then collected by centrifugation, washed with PBS buffer, re-suspended in 1 mL PBS

buffer, and stained with 1 μL of DAPI (10 mg/mL, prepared in dH2O, BBI, USA) for

20 min. The cells were then collected, washed 3 times with PBS buffer, and examined

by a fluorescence microscope (BX-41, Olympus, Japan) using the DAPI filter [7]. At

least 20 fields were examined.

S7

10. Membrane permeability assay

Yeast plasma membrane permeability was assayed according to Nargund’s

method [5]. One milliliter of yeast suspensions was mixed with 1 mL PbS suspensions

or Pb2+

solution to the final concentrations of 640 mg/L PbS particles or 100 mg/L

Pb2+

respectively. The suspensions were incubated at 30℃ with shaking at 180 rpm

for 6 or 12 h. Cells were harvested, washed, and re-suspended in YPD medium to

OD600 of 1.0. One milliliter of cell suspensions were stained with 2 μL of propidium

iodide (PI, 10 mg/mL, prepared in water, Sigma USA) at 30℃ for 2 h with shaking at

60 rpm. Cells were observed by a fluorescence microscope with the red filter set.

PI-positive and total yeast cells were counted. The percent of PI-positive cells against

the total cells were calculated. At least 20 fields were examined.

S8

Results and Discussion

Fig. S1. SEM images of bulk-PbS, nano-PbS1and nano-PbS2, respectively.

S9

Fig. S2. XRD patterns of various PbS particles.

The XRD patterns of the three PbS particles contain nine distinguishable peaks,

which correspond to the crystal planes of 111, 200, 220, 311, 222, 400, 331, 420 and

422. The XRD patterns are identical to reported PbS material [8], and did not show

signals from the precursor Pb (AC)2 or other derivatives. These results demonstrate

that high purity PbS particles were formed. In addition, the dominant and sharp peaks

indicated that the PbS particles were highly crystalline.

S10

Fig S3 Time-dependent growth inhibition of yeast cells incubated with 640 mg/L PbS

particles or 100 mg/L Pb2+

. The error bars indicate standard deviations, n = 5.

S11

Fig S4 Determination of chitin contents in the control cells as a function of time.

S12

Fig S5. Growth inhibition of yeast cells incubated with various concentrations of Pb

2+

for 24 h. The error bars indicate standard deviations, n = 5.

S13

Fig. S6. Fluorescence microscope images of yeast cells stained by FDA to evaluate

the cell viability. Before FDA staining the cells were incubated with 640 mg/L of PbS

particles or 100 mg/L Pb2+

for 6 h. The cells in the control were not treated with lead

material.

S14

Fig. S7 EDS of particles deposited on the surface and in the close vicinity of yeast

cells in Fig 3B and 3C.

S15

Fig S8 Florescence images of cells after CFW staining under the treatment of 640

mg/L bulk-PbS or 100 mg/L Pb2+

for 6 h.

S16

Fig. S9. Fluorescence microscope images of yeast cells stained by DCFH-DA to

evaluate ROS generation. Before DCFH-DA staining the yeast cells were incubated

with 640 mg/L PbS particles or 100 mg/L Pb2+

for 6 h. The control cells were not

treated with lead material.

S17

Fig. S10. Changes of mitochodrial membran potential (MMP) in yeast cells by flow

cytometry withour treatment or under the treatments of 640 mg/L PbS particles or 100

mg/L Pb2+

for 6 h; 100 μM of CCCP was used as a positive control. FL1-H, densities

of green fluorescence; FL2-H, densities of red fluorescence.

S18

Fig. S11. Changes of mitochodrial membran potential in yeast cells by flow cytometry

under the treatments of 160, 320, 640 and 1280 mg/L nano-PbS2 for 6 h, respectively.

FL1-H, densities of green fluorescence; FL2-H, densities of red fluorescence.

S19

Fig S12 Effect of the addtion of ascorbic acid on cell growth. Cells were incubated

with 640 mg/L nano-PbS2 for 24 h with or without 100 μM ascorbic acid addtion. The

error bars indicate standard deviations, n = 5. Identical letters indicate no statistical

differences among treatments (P < 0.05).

S20

Fig S13 The ratio of PI-positive cells to total cell numbers under the treatments of 640

mg/L PbS particles or 100 mg/L Pb2+

for 6 or 12 h. There was no statistical difference

(p > 0.05) between the untreated and treated cell. Error bars indicated standard

deviations, n = 20.

Reference

[1] Jiang, Y., Wu, Y., Xie, B., Yuan, S., Liu, X., Qian, Y., Hydrothermal preparation of

uniform cubic-shaped PbS nanocrystals, J Cryst. Growth, 231 (2001) 248-251.

[2] Q. Yu, H. Wang, N. Xu, X. Cheng, Y. Wang, B. Zhang, L. Xing and M. Li, Spf1

strongly influences calcium homeostasis, hyphal development, biofilm formation

and virulence in Candida albicans, Microbiology 158 (2012) 2272-2282.

[3] X. Ding, Q. Yu, N. Xu, Y. Wang, X. Cheng, K. Qian, Q. Zhao, B. Zhang, L. Xing

and M. Li, Ecm7, a regulator of HACS, functions in calcium homeostasis

maintenance, oxidative stress response and hyphal development in Candida

albicans, Fungal Genet. Biol. 57 (2013) 23-32.

[4] S. T. Smiley, M. Reers, C. Mottola-Hartshorn, M. Lin, A. Chen, T. W. Smith, G. D.

Steele-Jr and L. B. Chen, Intracellular heterogeneity in mitochondrial membrane

potentials revealed by a J-aggregate-forming lipophilic cation JC-1, Proc. Natl.

Acad. Sci. U S A 88 (1991) 3671-3675.

[5] A. M. Nargund, S. V. Avery and J. E. Houghton, Cadmium induces a

heterogeneous and caspase-dependent apoptotic response in Saccharomyces

cerevisiae, Apoptosis 13 (2008) 811-821.

[6] Q. Yu, X. Ding, N. Xu, X. Cheng, K. Qian, B. Zhang, L. Xing and M. Li, In Vitro

activity of verapamil singly and in combination with fluconazole or tunicamycin

against Candida albicans biofilms. Int. J. Antimicrob. Agents 41 (2013) 179-182.

[7] I. Hwang, J. Lee, J. H. Hwang, K Kim and D.G. Lee, Silver nanoparticles induce

apoptotic cell death in Candida albicans through the increase of hydroxyl radicals.

S21

FEBS J. 279 (2012) 1327-1338.

[8] J. Sun and W. E. Buhro, The use of single-source precursors for the

solution-liquid-solid growth of metal sulfide semiconductor nanowires, Angew.

Chem. Int. Edit. 47 (2008) 3215-3218.