Lecture 6: A Whirlwind Tour of Anonymous DNA Markers

Sept 8, 2006

Last TimeFinal introduction DNA in populations: HE, F-statistics, inbreeding

Allozymes

Population AdmixtureGene flow between differentiated populations

Separated populations have combined F>0 (deficiency of heterozygotes)

With complete merging, Hardy-Weinberg established in 1 generation: F=0

With directional gene flow, F<0: excess heterozygotes

Today: Anonymous DNA Markers

RFLP

RAPD and AFLP

IRAP and ISSR

Restriction EnzymesIsolated from bacteria: defense mechanism against viruses

Example: EcoRI: Identified from Escherichia colistrain RY13

Cut at 4 to 6 bprecognition sequences

Usually a palindrome

Generate 3’ or 5’overhangs (‘sticky ends’) or blunt ends

Restriction Enzyme Recognition Site Occurrence

Sites scattered throughout genome: probability of occurrence is 0.25n

, where n is length of recognition sequence (assuming random occurrence of bases in genome)

6-cutter should have 244 sites/Mb in genome

Poplar genome HindIII (GAATTC) sites: 301/Mb4-cutter should have 3,906 sites/Mb

Poplar genome MseI sites (TTAA): 11,594/MbGenome is AT-rich, so many more MseI sites than expected

Detecting Variation in Restriction Enzyme Sites

So many cut sites generate a continuous range of size fragments

Produces a big smear on agarose gel

Satellite bands

http://www.promega.com/enotes/applications/0102/images/ap0027_fig2.jpg

Southern Blots

Method for affixing DNA to nitrocellulose membrane and hybridizing with specific labeled probe

Probe usually labeled with radionuclides(32PdNTP) or nonradioactive dyes (e.g., streptavidin-biotin or fluorphores)

Probes labeled with Klenow fragment of DNA Polymerase I from E. coli, and random primers

Membranes can be stripped and reprobed with different probes

Named for originator, E.M Southern

http://www.accessexcellence.org/RC/VL/GG/southBlotg.html

RFLP: Restriction Fragment Length Polymorphism

Digest total genomic DNA with a restriction enzyme (or two)

Run on agarose gel

Perform Southern blot with specific probe

Lights up DNA fragments containing all or part of probe

Probe can be total DNA from organelle, a cloned gene fragment, or a random, low-copy nuclear sequence

Hillis et al. 1996

RFLP Advantages

Versatile approach that covers genome and gives markers with almost any mode of inheritance or level of polymorphism

Depends on the probe and restriction enzyme

Usually codominant

Directly tied to DNA sequence variation: molecular clock approaches possible

Highly repeatable and stable (except for methylation)

RFLP Disadvantages

Southern blots are evil

Time-consuming

Technically-challenging

Require substantial amount of DNA: 5-10 μg for typical genome

Epigenetic effects

DNA methylation inhibits cutting by some restriction enzymes

PCR and the Molecular Revolution

PCR: Polymerase Chain Reaction

Invented by Kary Mullis in 1983

Exponential amplification of a specific sequence of DNA

Most important molecular marker techniques involve PCR

Components: primers, nucleotides, template, thermostable polymerase

http://www.dnalc.org/ddnalc/resources/pcr.html

Important Factors in PCR

Annealing temperature (melting temperature of primers)

Mg2+ concentration

Annealing and extension time

Concentration of DNA template, primer, and enzyme

Primer design

3’ complementaritySelf-complementarityDegeneracy: multiple bases at particular positions

Random Amplified Polymorphic DNA (RAPD)

= arbitrary primer (e.g. ggcattactc)

Target Sequence

Amplify regions between priming sites by polymerase chain reaction

Uses short (usually 10mer) random primers with high GC content

Low annealing temperatures (37-42C)

Priming at multiple sites in genome generates many loci per primer

Polymorphisms in priming sites or insertion/deletion in target sequence

RAPD Detection and ScoringAgarose gel: usually 1.5 or 2%

Usually 5-10 polymorphisms per primer

Presence/absence

Avoid quantitative bands!

ISSR: Inter Simple Sequence RepeatsGlorified RAPD

Primer contains repetitive sequence: (CT)8-RG

Degenerate base (R: purine (A,G)

Amplify between simple sequence repeats

Target highly polymorphic parts of genome, get many products

Can be analyzed on agarose or polyacrylamide gels

Annealing temperature a bit higher than RAPD: more reliable?

GAGAGAGAGAGAGAGAGAGAGATCGGTAGATCGGG….GTCAGGTCAAGATCGGGGTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTAGCCATCTAGCCC.…CAGTCCAGTTCTAGCCCCAGAGAGAGAGAGAGAGAGA

CTCTCTCTCTCTCTCTAG

CTCTCTCTCTCTCTCTGG

RAPD Advantages

Cheap and fast!

Many loci can be generated with variable levels of polymorphism

Very little foreknowledge of genetics of your organism is required

Very little foreknowledge of molecular biology is required

RAPD Disadvantages

Reputation for extreme unreliability

Depends on choice of markersBe selective!

Dominant: presence/absence

What does absence mean?

Molecular clock difficult

Homoplasy: bands in the same position may not be allelic

No information about underlying sequence

Term Paper

Different criteria for undergrads and grad students

Milestones:

IdeaOutlineDraftFinalPresentation

Next Time

Sequence-tagged DNA Markers: AFLP, SCARs, SSR

Introduction to SNP