Legume-infecting Begomoviruses: Diversity and

Host Interaction

A dissertation submitted to Quaid-i-Azam University, Islamabad in

partial fulfilment of requirements for the degree of

DOCTOR OF PHILOSPHY

IN

BIOTECHNOLOGY

By

Muhammad Ilyas

National Institute for Biotechnology and Genetic Engineering

(NIBGE), Faisalabad

and

Quaid-i-Azam University Islamabad, Pakistan

2010

ii

This thesis submitted by Muhammad Ilyas is accepted in its present form by Quaid-i-

Azam University Islamabad as satisfying the thesis requirements for the award of the

degree of Doctor of Philosophy in Plant Biotechnology.

Supervisor -------------------------------------------------

(Dr. Rob W. Briddon) HEC Foreign Faculty

National Institute for Biotechnology and Genetic

Engineering, Faisalabad

Co-Supervisor -------------------------------------------------

(Dr. Shahid Mansoor) National Institute for Biotechnology and Genetic

Engineering, Faisalabad

External Examiner 1 -------------------------------------------------

(Dr. Abdul Rauf Shakoori) Distinguished National Professor,

School of Biological Sciences, University of the

Punjab (Quaid-e-Azam Campus), Lahore

External Examiner 2 -------------------------------------------------

(Dr. Asif Ali) Department of Plant Breeding and Genetics,

University of Agriculture Faisalabad

Director -------------------------------------------------

(Dr. Zafar Mehmood Khalid) National Institute for Biotechnology and Genetic Engineering, Faisalabad

iii

ABSTRACT

The legume yellow mosaic viruses (LYMVs) are members of the proposed

sub-genus “Legumovirus” within the genus Begomovirus of the family

Geminiviridae; single-stranded DNA viruses transmitted by the whitefly Bemisia

tabaci. The legumoviruses are evolutionarily distinct from all other begomoviruses

and are of interest for this reason as well as for the losses they cause to leguminous

crops across southern Asia. There are four LYMVs (Mungbean yellow mosaic virus

[MYMV], Mungbean yellow mosaic India virus [MYMIV], Dolichos yellow mosaic

virus [DoYMV] and Horsegram yellow mosaic virus [HgYMV]) that have been

shown to be responsible for yellow mosaic disease (YMD) of legumes across southern

Asia.

An analysis of the genetic diversity of LYMVs across Pakistan was conducted.

Samples were collected from 11 districts across Pakistan and 48 full-length

begomovirus components (25 DNA-A, 21 DNA-B) were cloned and sequenced in

their entirety. Analysis of these sequences showed that MYMIV is the most prevalent

causal agent of YMD in legume crops in Pakistan and shows phylogeographic

segregation; no other virus species was shown to cause YMD of leguminous crops.

MYMV, which is the major pathogen responsible for YMD of legumes in southern

and western India, was also identified in Pakistan but this was identified only in a

leguminous weed, Rhynchosia capitata. In addition a novel begomovirus, with less

than 70% nucleotide sequence identity to all other begomoviruses, was isolated from

another leguminous weed, Rhynchosia minima. This newly identified begomovirus

was shown to belong to the LYMV cluster and was tentatively named Rhynchosia

yellow mosaic virus (RhYMV). As well as the LYMV components, two virus species

not commonly identified in legumes (Pedilanthus leaf curl virus [PedLCV] and

Papaya leaf curl virus [PaLCuV]) as well as a betasatellite (Tobacco leaf curl

betasatellite [TbLCB]) were isolated from some legumes infected with MYMIV and

showing typical YMD symptoms.

Constructs for the Agrobacterium-mediated inoculation of representative

isolates of all begomovirus species and two isolates of MYMIV were produced. The

MYMV was shown to infect blackgram, inducing very mild symptoms. RhYMV was

shown to be infectious to some lines of soybean but not any of the other leguminous

iv

crops tested. The limited host range of these two viruses possibly explains their

absence in crops. In contrast, two isolates of MYMIV, isolated from soybean

(MYMIV-Sb) and mungbean (MYMIV-Mg) showed differing infectivities to

legumes. The soybean isolate showed high levels of infectivity to soybean but low

levels in blackgram, whereas the mungbean isolate was highly infectious to

blackgram but poorly infectious to mungbean. This suggests that isolates of this virus

are adapted to distinct hosts. None of the LYMVs examined was infectious to the

non-legume Nicotiana benthamiana, a species which is commonly used as an

experimentally host for all other dicot-infecting begomoviruses for which infectivity

has been investigated. This is the first time this lack of infectivity to N. benthamiana

has been reported. Similarly the viruses were not infectious to N. tabacum.

The identification of a betasatellite in legumes is of grave concern due to the

possibility of it increasing disease severity. TbLCB was shown to have the capacity

to be maintained by MYMIV, MYMV and RhYMV, the first time a betasatellite has

been shown to be trans-replicated by a LYMV, and to extend the host range of these

viruses to N. benthamiana. Although DNA-B of all three viruses had some role to

play in such infections (co-inoculation of DNA-B or expression of the DNA-B

encoded MP under the control of the 35S promoter increased infectivity of MYMIV

DNA-A and TbLCB from 60% to 100%), in the absence of DNA-B, TbLCB

complemented the usual functions of DNA-Bs of all three viruses. This ability of

TbLCB to complement DNA-B functions was shown to be a function of the only gene

product encoded by betasatellites, βC1. Expression of TbLCB βC1 from PVX or

transiently under the control of the 35S promoter allowed MYMIV to move

systemically in N. benthamiana. However, when βC1 was expressed transiently using

the 35S promoter, virus levels in systemically infected tissues were low and no

symptoms ensued, suggesting that the βC1 function that assists MYMIV infection acts

only at the site of inoculation and does not spread.

The results obtained indicate that the lack of the infectivity of MYMIV to N.

benthamiana is due to a lack of adaptation of the DNA-B-encoded products to this

host. Thus when complemented by TbLCB, or by one of several monopartite

begomoviruses (including PedLCV), MYMIV was able to efficiently spread

systemically. In addition, plant host-defense mediated by RDR6 was shown to play a

small role in limiting infection in N. benthamiana. However, silencing of this gene by

VIGS did not allow MYMIV to induce a symptomatic infection.

v

At this time the transformation of many legumes, particularly the grain

legumes, is problematic, precluding the use of legume-transformation for the study of

pathogen derived resistance to the LYMVs. Using a novel system, based upon the

complementation of MYMIV movement using TbLCB, N. benthamiana was shown to

potentially be a useful model host for such studies. Using transient expression of an

antisense Rep gene construct, the infectivity of MYMIV (in the presence of TbLCB)

was reduced by 90%. This indicates that RNAi may be a useful tool in reducing losses

to LYMVs across Asia and that the betasatellite assisted infectivity system provides a

means of selecting the most efficient constructs prior to efficient transformation

protocols for local legume species becoming available.

vi

This Humble Effort is Dedicated

to

My Parents, Wife and Children

vii

Acknowledgements

All thanks are for “ALLAH” whose blessings enabled me to seek knowledge

and invigorate me for this task. Words can’t express my feelings of thankfulness for

“ALLAH” almighty. I offer my salutations to The Holy Prophet Muhammad

(peace be upon Him), the source of guidance for humanity as a whole forever.

Special gratitude is due to Higher Education Commission of Pakistan for

providing financial support to my studies and making my dreams come true. I offer

my special thanks to Dr. Zafar Mehmood Khalid, Director NIBGE, for providing

me 24h available laboratories and NIBGE transport facility for sampling tours across

the country. I am also thankful to Dr. Yusuf Zafar (ex-Director NIBGE) for his full

support in early part of my PhD. It is my utmost pleasure to avail this opportunity to

extend my heartiest gratitude to my supervisor Dr. Rob W. Briddon whose presence

was always a source of confidence for me. I want to thank him from the core of my

heart for his personal interest, ample support, valuable guidance and suggestions and

help during this research work and writing of this manuscript. I shall always be

thankful to him for his affectionate behaviour towards me. He has always been a

source of inspiration, guidance and encouragement for me. I wish to express my deep

sense of gratitude for my co-supervisor Dr. Shahid Mansoor who has made a great

contribution for the successful completion of this work. His skilful advices, sincere

cooperation, and learned guidance enabled me to complete this work. I learned a lot

from him and he has been a very kind teacher and for him no acknowledge could ever

adequately express my obligation.

I am deeply indebted to Mr. Imran Amin for his cooperation, encouragement

and useful suggestions in accomplishment of this work. I have respectful appreciation

for Dr. Muhammad Saeed and Ms. Javaria Qazi for their all time available help

and sincere cooperation. I want to thank all my colleagues, Muhammad Shafiq

Shahid, Muhammad Tehseen Azhar, Luqman Amrao, Aamir Humayun Malik,

Nazia Nahid, Saiqa Andleeb, Rohina Bashir, Huma Mumtaz, Musarrat Shaheen,

Atiq ur Rehman, Nouman Tahir, Sohail Akhter, Irfan Ali, Zafar Iqbal,

Muhammad Yusuf, Ghulam Rasool Baloch, Ghulam Rasool, Khadim Hussain

and Muhammad Mubin.

viii

In the end I want to acknowledge the most important people, the lab

supporting staff, Yasmeen, Muhammad Asif, Ghulam Mustafa and Muhammad

Akhtar for their cooperation in lab work.

ix

ABBREVIATIONS

µL micorlitre

AAP acquisition access period

AD Anno Domini

asRNA anti-sense RNA

AVRDC Asian Vegetable Research and Development Centre

AZPs artificial zinc finger proteins

BC Before Christ

BND benzoylated naphthoylated DEAE

BSA bovine serum albumin

CaCl2 calcium chloride

cccDNA covalently closed circular DNA

CIAP calf intestine alkaline phosphatase

CLCuD cotton leaf curl disease

CP coat protein

CR common region

CTAB cetyl trimethyl ammonium bromide

DEAE diethylaminoethyl cellulose

DNA deoxyribonucleic acid

DNAi DNA interference

dNTP deoxyribonucleotide triphosphate

dsDNA double-stranded DNA

dsRNA double-stranded RNA

DTT dithiothreitol

EDTA ethylene diamine tetraacetic acid

EU European Union

FeSO4.7H2O ferrous sulphate hepta hydrate

GFP green fluorescence protein

GUS beta-glucuronidase

hpRNA hairpin RNA

HR hypersensitive response

ICTV International Committee on Taxonomy of Viruses

IPTG isopropyl-beta-D-1-thiogalactopyranoside

IR intergenic region

IRD iteron related domain

K2HPO4 dipotassium phosphate

KCl potassium chloride

kDa kilo Dalton

kV kilo Volt

LB Lauria broth

LIR large intergenic region

LYMV legume yellow mosaic virus

MCS multiple cloning site

mg milligram

MgSO4 magnesium sulphate

MgSO4.7H2O magnesium sulphate heptahydrate

miRNA microRNA

mM millimolar

x

MP movement protein

mRNAs messenger RNA

NaCl sodium chloride

NaH2PO4 sodium phosphate

NaOH sodium hydroxide

NARC National Agricultural Research Centre

ng nanogram

NH4Cl ammonium chloride

NIGAB National Institute for Genomics and Advanced Biotechnology

NLS nuclear localization signals

NSP nuclear shuttle protein

nt. nucleotide

NW New World

OD optical density ORF open reading frame

OW Old World

PCNA proliferating cell nuclear antigen

PCR polymerase chain reaction

PDR pathogen derived resistance

pH paviour of hydrogen

pre-miRNA precursor miRNA

PVP polyvinyl pyrrolidone

RCA rolling circle amplification

RCR rolling circle replication

RDR recombination-dependent replication

RdRP RNA dependent RNA polymerase

REn replication enhancer protein

Rep replication associated protein

RISC RNA-induced silencing complex

RNA ribonucleic acid

RNAi RNA interference

rpm revolutions per minute

SBS School of Biological Sciences

SCR satellite-conserved region

SDS sodium dodecyl sulphate

SIR small intergenic region

siRNA small interfering RNA

SSC standard sodium citrate

ssDNA single-stranded DNA

TAE tris-acetate EDTA

Taq Thermus aquaticus

ta-siRNAs trans-acting siRNAs

TGS transcriptional gene silencing

TrAP transcriptional activator protein

T-Rep truncated Rep

UV ultra violet

VIGS virus induced gene silencing

X-Gal 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside

YMD yellow mosaic disease

xi

VIRUSES AND BETASATELLITES

Abutilon mosaic virus (AbMV)

African cassava mosaic virus (ACMV)

Ageratum yellow leaf curl betasatellite (AYLCB)

Ageratum yellow vein betasatellite (AYVB)

Ageratum yellow vein Sri Lanka betasatellite (AYVSLB)

Ageratum yellow vein virus (AYVV)

Alternanthera yellow vein betasatellite (AlYVB)

Bean dwarf mosaic virus (BDMV)

Bean golden yellow mosaic virus (BGYMV)

Bean leaf curl China betasatellite (BLCCNB)

Bean yellow dwarf virus (BeYDV)

Beet curly top virus (BCTV)

Beet severe curly top virus (BSCTV)

Cabbage leaf curl virus (CabLCuV)

Cestrum yellow leaf curling virus (CmYLCV)

Chilli leaf curl betasatellite (ChLCB)

Chilli leaf curl virus (ChiLCV)

Citrus tristezia virus (CTV)

Corchorus golden mosaic virus (CoGMV)

Corchorus yellow vein virus (CoYVV)

Cotton leaf crumple virus (CLCrV)

Cotton leaf curl Gezira betasatellite (CLCuGB)

Cotton leaf curl Gezira virus (CLCuGV)

Cotton leaf curl Kokhran virus (CLCuKV)

Cotton leaf curl Multan betasatellite (CLCuMB)

Cotton leaf curl Multan virus (CLCuMV)

Cowpea golden mosaic virus (CPGMV)

Croton yellow vein mosaic betasatellite (CroYVMB)

Dolichos yellow mosaic virus (DoYMV)

East African cassava mosaic Cameroon virus (EACMCV)

East African cassava mosaic Zanzibar virus (EACMZV)

Erectites yellow mosaic betasatellite (ErYMB)

Eupatorium yellow vein betasatellite (EpYVB)

Euphorbia leaf curl virus (EuLCV)

Honeysuckle yellow vein betasatellite (HYVB)

Honeysuckle yellow vein Japan betasatellite (HYVJB)

Honeysuckle yellow vein Kobe betasatellite (HYVKB)

Honeysuckle yellow vein mosaic betasatellite (HYVMB)

Honeysuckle yellow vein Nara betasatellite (HYVNB)

Horesgram yellow mosaic virus (HgYMV)

Indian cassava mosaic virus (ICMV)

Kenaf leaf curl betasatellite (KLCuB)

Kudzu mosaic virus (KuMV)

Ludwigia leaf distortion betasatellite (LuLDB)

Maize streak virus (MSV)

Malvastrum leaf curl betasatellite (MaLCuB)

Malvastrum yellow vein Yunnan betasatellite (MaYVYnB)

xii

Mesta yellow mosaic betasatellite (MeYMB) Mungbean yellow mosaic India virus (MYMIV)

Mungbean yellow mosaic virus (MYMV)

Okra leaf curl betasatellite (OLCuB)

Papaya leaf curl betasatellite (PaLCuB)

Papaya leaf curl China virus (PaLCuCNV)

Papaya leaf curl Guangdong virus (PaLCuGuV)

Papaya leaf curl virus (PaLCuV)

Pedilanthus leaf curl virus (PedLCV)

Pepper leaf curl Bangladesh virus (PepLCBDV)

Potato virus X (PVX)

Rhynchosia yellow mosaic virus (RhYMV)

Sida leaf curl betasatellite (SiLCuB)

Sida yellow vein mosaic China betasatellite (SiYMCNB)

Siegesbeckia yellow vein betasatellite (SibYVB)

Soybean leaf crinkle virus (SbCLV)

Squash leaf curl virus (SqLCV)

Sri Lankan cassava mosaic virus (SLCMV)

Tobacco curly shoot betasatellite (TbCSB)

Tobacco leaf curl betasatellite (TbLCB)

Tobacco mosaic virus (TMV)

Tobacco yellow dwarf virus (TbYDV)

Tomato golden mosaic virus (TGMV)

Tomato leaf curl Bangalore betasatellite (ToLCBB)

Tomato leaf curl Bangalore virus (ToLCBV)

Tomato leaf curl Bangladesh betasatellite (ToLCBDB)

Tomato leaf curl Bangladesh virus (ToLCBDV)

Tomato leaf curl China betasatellite (ToLCCNB)

Tomato leaf curl China virus (ToLCCNV)

Tomato leaf curl Gujrat virus (ToLCGV)

Tomato leaf curl Karnatka virus (ToLCKV)

Tomato leaf curl New Delhi virus (ToLCNDV)

Tomato leaf curl Philippines virus (ToLCPV)

Tomato leaf curl virus (ToLCV)

Tomato mottle virus (ToMoV)

Tomato pseudo-curly top virus (TPCTV)

Tomato yellow leaf curl China betasatellite (TYLCCNB)

Tomato yellow leaf curl China virus (TYLCCNV)

Tomato yellow leaf curl virus (TYLCV)

Turnip crinkle virus (TCV)

Wheat dwarf virus (WDV)

xiii

Table of Contents CHAPTER 1: INTRODUCTION AND REVIEW OF LITERATURE ................................................. 1

1.1 Plant viruses ................................................................................................................ 1 1.2 Geminiviruses .............................................................................................................. 1 1.3 Classification of geminiviruses ..................................................................................... 4

1.3.1 Mastrevirus .......................................................................................................... 4 1.3.2 Curtovirus ............................................................................................................. 6 1.3.3 Topocuvirus .......................................................................................................... 7 1.3.4 Begomovirus ........................................................................................................ 8

1.4 Proteins encoded by geminiviruses ............................................................................ 14 1.4.1 Replication associated protein ............................................................................ 14 1.4.2 Transcriptional activator protein......................................................................... 15 1.4.3 Replication enhancer protein .............................................................................. 18 1.4.4 AC4..................................................................................................................... 19 1.4.5 Pre-coat protein ................................................................................................. 19 1.4.6 Coat protein ....................................................................................................... 20 1.4.7 Nuclear shuttle protein ....................................................................................... 21 1.4.8 Movement protein ............................................................................................. 22

1.5 DNA replication of geminiviruses .............................................................................. 23 1.6 Evolution of geminiviruses ......................................................................................... 26 1.7 Legumes .................................................................................................................... 29 1.8 Legume-infecting begomoviruses .............................................................................. 35

1.8.1 History of yellow mosaic disease of legumes in southern Asia ............................ 36 1.8.2 Host adaptation of the legume yellow mosaic viruses ........................................ 36 1.8.3 Relationship of legume yellow mosaic viruses to other begomoviruses .............. 38

1.9 Strategies for engineering resistance to geminiviruses .............................................. 38 1.9.1 Resistance by the expression of proteins ........................................................... 38 1.9.2 DNA interference ............................................................................................... 40 1.9.3 RNA interference ............................................................................................... 41 1.9.4 Aims and objectives of the study ....................................................................... 43

CHAPTER 2: MATERIALS AND METHODS ........................................................................... 44 2.1 Sample collection ...................................................................................................... 44 2.2 DNA extraction from plant tissue ............................................................................... 44

2.2.1 DNA extraction from legumes ............................................................................ 44 2.2.2 DNA extraction from Nicotiana benthamiana and N. tabacum ........................... 45

2.3 Quantification of DNA ............................................................................................... 46 2.4 Amplification of DNA ................................................................................................. 46

2.4.1 PCR amplification of DNA ................................................................................... 46 2.4.2 Rolling-circle-amplification ................................................................................ 49

2.5 Cloning of amplified DNA ........................................................................................... 49 2.5.1 Cloning of PCR product ...................................................................................... 49

2.6 Transformation of competent cells ............................................................................ 50 2.6.1 Transformation of heat-shock competent E. coli cells ......................................... 50 2.6.2 Transformation of competent Agrobacterium tumefaciens cells ......................... 50

2.7 Preparation of competent cells .................................................................................. 51 2.7.1 Preparation of heat-shock competent Escherchia coli cells ................................. 51 2.7.2 Preparation of electro competent Agrobacterium tumefaciens cells .................. 51

2.8 Plasmid isolation ....................................................................................................... 51 2.9 Digestion of plasmid DNA .......................................................................................... 52 2.10 Agarose-gel electrophoresis .................................................................................... 53 2.11 Preparation of glycerol stocks .................................................................................. 53 2.12 Purification of DNA .................................................................................................. 53

xiv

2.12.1 Gel extraction and PCR product purification ..................................................... 53 2.12.2 Phenol-chloroform extraction of DNA ............................................................... 54

2.13 Agroinoculation ...................................................................................................... 54 2.14 Plant growing conditions ........................................................................................ 55 2.15 Southern blot analysis ............................................................................................ 55 2.16 Sequencing and sequence analysis .......................................................................... 57 2.17 Photography and graphics ...................................................................................... 58

CHAPTER 3: BEGOMOVIRUSES OF LEGUMES IN PAKISTAN ............................................ 59 3.1 Introduction ............................................................................................................. 59 3.2 Methodology ............................................................................................................ 61 3.3 Results ...................................................................................................................... 62

3.3.1 Mungbean yellow mosaic India virus .................................................................. 72 3.3.2 Mungbean yellow mosaic virus ......................................................................... 81 3.3.3 Rhynchosia yellow mosaic virus ......................................................................... 84 3.3.4 Pseudo-recombination in legume-infecting begomoviruses ............................... 87 3.3.5 Non-legume viruses and betasatellite ................................................................ 89

3.4 Discussion ................................................................................................................. 96 CHAPTER 4: ANALYSIS OF THE INFECTIVITY OF LEGUME YELLOW MOSAIC VIRUS CLONES ......................................................................................................................................... 102

4.1 Introduction ........................................................................................................... 102 4.2 Methodology .......................................................................................................... 103 4.3 Results ........................................................................................................... 108

4.3.1 Infectivity of Mungbean yellow mosaic India virus isolated from mungbean .... 108 4.3.2 Infectivity of Mungbean yellow mosaic India virus isolated from soybean ........ 108 4.3.3 Infectivity of Mungbean yellow mosaic virus ..................................................... 109 4.3.4 Infectivity of Rhynchosia yellow mosaic virus ................................................... 109 4.3.5 Infectivity of Pedilanthus leaf curl virus, Papaya leaf curl virus and Tobacco leaf curl betasatellite ...................................................................................................... 113

4.4 Discussion ............................................................................................................... 116 CHAPTER 5: INTERACTION OF LYMVs WITH OTHER BEGOMOVIRUSES AND BETASATELLITES ......................................................................................................................................... 120

5.1 Introduction ........................................................................................................... 120 5.2 Methodology .......................................................................................................... 122 5.3 Results .................................................................................................................... 123

5.3.1 Interaction of MYMIV with betasatellites ......................................................... 123 5.3.2 Interaction of TbLCB with RhYMV and MYMV .................................................. 129 5.3.3 Interaction of MYMIV with Pedilanthus leaf curl virus ...................................... 135 5.3.4 Pseudo-recombination among legume-infecting begomoviruses ..................... 138

5.4 Discussion ............................................................................................................... 140 CHAPTER 6: PLANT RESPONSES TO TRANSIENT EXPRESSION OF MYMIV GENES AND A STUDY OF RNAi-MEDIATED RESISTANCE ...................................................... 146

6.1 Introduction ........................................................................................................... 146 6.2 Methodology .......................................................................................................... 148 6.3 Results .................................................................................................................... 150

6.3.1 Transient expression of MYMIV genes from the PVX vector ............................. 150 6.3.2 Expression of TbLCB βC1 gene from the PVX vector ......................................... 156 6.3.3 Mutation of MYMIV AV2 and replacement of CP gene with the GFP gene ........ 157 6.3.4 Silencing of RdR6 in Nicotiana benthamiana .................................................... 158 6.3.5 Investigation of the use of RNAi to provide resistance against MYMIV in plants 158

6.4 Discussion ............................................................................................................... 160 CHAPTER 7: GENERAL DISCUSSION................................................................................... 171 CHAPTER 8: REFERENCES .................................................................................................. 178

xv

FIGURES

Figure 1.1 Cryo-electron microscopy image reconstruction of a Maize streak virus

particle.

Figure 1.2 Diagram showing the typical genome arrangement of mastreviruses.

Figure 1.3 Genome organization of curtoviruses.

Figure 1.4 Genome organization of topocuviruses.

Figure 1.5 Genomic organization of begomoviruses.

Figure 1.6 Steps in DNA replication of geminiviruses.

Figure 1.7 Map showing the world production of grain legumes.

Figure 1.8 Map showing the world production of soybean.

Figure 1.9 Major legume-exporting countries in the world.

Figure 1.10 Major legume-importing countries in the world.

Figure 2.1 Southern blot assembly for the capillary transfer of DNA from agarose

gels to nylon membranes.

Figure 3.1 Map of Pakistan showing areas where virus infected legumes were

collected.

Figure 3.2 Field-collected legumes infected with begomoviruses.

Figure 3.3 Alignment of the intergenic regions of the DNA-A and DNA-B

components of the MYMIV isolates characterised in the present study

and an isolate from the database.

Figure 3.4 Alignment of the N-terminal amino acid sequences of the Rep proteins

of MYMIV isolates obtained in this study.

Figure 3.5 Phylogenetic dendrogram based upon an alignment of the complete

nucleotide sequences of the DNA-A components of legume-infecting

begomoviruses from the Old World and distribution of all MYMIV

isolates is shown on a geographical map of the southern Asia.

Figure 3.6 Phylogenetic dendrogram based upon an alignment of the complete

nucleotide sequences of the DNA-B components of legume-infecting

begomoviruses from the Old World and distribution of all MYMIV

isolates is shown on a geographical map of the southern Asia.

Figure 3.7 Distribution of MYMIV with DNA-A and DNA-B belong to group to

group I, group II and MYMIV with DN-A belongs to group I and

DNA-B belongs to group II in Indian sub-continent.

Figure 3.8 Alignment of the intergenic regions of DNA-A and DNA-B

components of MYMV characterized in this study and those of

obtained from the NCBI database.

Figure 3.9 N-terminal amino acid sequence of the Rep protein of MYMV isolated

from Rhynchosia capitata is aligned with that of selected MYMV from

data bank for comparison.

Figure 3.10 An alignment of the sequences of the common regions of the DNA-A

and DNA-B component sequences that are representative of the

LYMV species DoYMV, HgYMV, KuMV, MYMIV and MYMV in

comparison to RhYMV.

Figure 3.11 Comparison of N-terminal amino acid sequence of the Rep proteins of

RhYMV isolate obtained in this study with that of MYMIV, MYMV,

KuMV, HgYMV and DoYMV.

xvi

Figure 3.12 Comparison of the phylogenetic trees of the DNA-A and DNA-B of

LYMVs.

Figure 3.13 Alignment of the intergenic regions in genome of Pedilanthus leaf curl

virus and Papaya leaf curl virus characterized in this study and isolates

from the database.

Figure 3.14 Alignment of the N-terminal amino acid sequences of the Rep proteins

of PedLCV and PaLCuV isolates obtained in this study.

Figure 3.15 Phylogenetic dendrogram based upon alignments of complete

nucleotide sequences of Pedilanthus leaf curl virus and Papaya leaf

curl virus from Pakistan and selected monopartite viruses from NCBI

database.

Figure 3.16 Phylogenetic dendrograms based upon alignments of complete

nucleotide sequences of TbLCB from soybean and selected

betasatellites from NCBI database.

Figure 4.1 Structures of the partial direct repeat constructs in pBin19 produced for

the Agrobacterium-mediated inoculation of MYMIV-[PK:Isl:Mg:07]

DNA-A (clone MI15) and DNA-B (clone MI21).

Figure 4.2 Structures of the partial direct repeat constructs for the agroinoculation

of MYMIV-[PK:Nsh:Sb:07] DNA-A (clone MI18) and DNA-B (clone

MI17).

Figure 4.3 Structures of clones produced in the binary vector pBin19 for

agroinoculation of RhYMV-[PK:Lah:Rh:07] DNA-A (clone MI32)

and DNA-B (clone MI34).

Figure 4.4 Structures of the partial direct repeat constructs of the DNA-A and

DNA-B components of MYMV-[PK:Kun:Rh:06] which were

produced in the binary vector pBin19 for agroinoculation.

Figure 4.5 Structures of the partial direct repeat constructs of PedLCV-

[PK:Nsh:Sb:07] (clone MI1), PaLCuV-[PK:Kun:Rh:06] (clone MI69)

and TbLCB-[PK:Nsh:Sb:07] (clone MI22) in binary vector pBin19 for

Agrobacterium-mediated inoculation.

Figure 4.6 Symptoms exhibited by plants infected with Mungbean yellow mosaic

India virus isolated from mungbean (MYMIV-[PK:Isl:Mg:07]).

Figure 4.7 Symptoms exhibited by plants infected with Mungbean yellow mosaic

India virus isolated from soybean (MYMIV-[PK:Nsh:Sb:07]),

Mungbean yellow mosaic virus isolated from Rhynchosia capitata

(MYMV-[PK:Kun:Rh:06]) and Rhynchosia yellow mosaic virus

isolated form Rhynchosia minima (RhYMV-[PK:Lah:Rh:07]).

Figure 4.8 Symptoms exhibited by plants infected Pedilanthus leaf curl virus and

Tobacco leaf curl betasatellite.

Figure 5.1 Symptoms induced following the inoculation of Nicotiana

benthamiana with Mungbean yellow mosaic India virus (MYMIV) and

Tobacco leaf curl betasatellite (TbLCB) and its derivatives.

Figure 5.2 Southern hybridization of blots probed with MYMIV DNA-A, DNA-B

and TbLCB.

Figure 5.3 Southern hybridization of a blot probed with MYMIV DNA-B.

Figure 5.4 Phenotypic behaviour of N. benthamiana plants inoculated with (a)

MYMIV DNA-A, TbLCB and DNA-BΔNSP

(b) DNA-A, TbLCB and

DNA-BΔMP

(c) RhYMV DNA-A and TbLCB (d) RhYMV DNA-A,

DNA-B and TbLCB (e) MYMV DNA-A and TbLCB and (f) MYMV

DNA-A, DNA-B and TbLCB.

xvii

Figure 5.5 Southern hybridization of blots probed with RhYMV DNA-A MYMV

DNA-A and TbLCB.

Figure 5.6 Symptoms induced following agroinoculation of N. benthamiana

plants with (a) MYMIV and PedLCV, (b) MYMIV, PedLCV and

TbLCB, (c) MYMIV and CLCuMV and (d) PedLCV and TbLCB.

Figure 5.7 Southern blot analyses with probes of PedLCV, MYMIV DNA-A,

DNA-B and CLCuMV to show their presence in infected plants.

Figure 6.1 Photographs of healthy plants of N. benthamiana, N. tabacum and

plants of each species infected with PVX.

Figure 6.2 Photographs of N. benthamiana plants infected with PVX expressing

MYMIV AV2, PVX expressing the MYMIV coat protein and PVX

expressing the MYMIV AC5.

Figure 6.3 Symptoms induced by PVX expressing the TrAP of MYMIV in N.

benthamiana and in N. tabacum or the Rep of MYMIV in N.

benthamiana.

Figure 6.4 Symptoms induced by expression of AC4 and MP of MYMIV and βC1

of TbLCB from the PVX vector in N. benthamiana.

Figure 6.5 Southern blot probed for the presence of MYMIV DNA-A.

xviii

TABLES

Table 2.1 Names, sequences and brief description of primers used in this study.

Table 3.1 List of the begomovirus clones obtained in this study and a summary

of their features.

Table 3.2 Percent nucleotide sequence identity for pair wise sequence

comparisons of the sequences of the genomes (or DNA-A components)

of viruses isolated in this study and selected sequences from the

databases.

Table 3.3 Percent nucleotide sequence identity for pair wise sequence

comparisons of the sequences of DNA-B component of viruses

isolated in this study and selected sequences from the databases.

Table 4.1 Infectivity of the cloned viruses and betasatellite obtained in this study.

Table 5.1 Study of interaction of legume-infecting begomoviruses with

betasatellites.

Table 5.2 Results of the co-inoculation of the components of MYMIV with

PedLCV and CLCuMV.

Table 5.3 Study of infectivity of MYMIV, MYMV and RhYMV to legumes by

exchanging their components.

Table 6.1 Summary of the results of the expression of MYMIV genes from the

PVX vector in N. benthamiana.

Table 6.2 Study of mutation of CP and AV2 and their effect on infectivity of

MYMIV to plants.

1

Chapter 1

Introduction and review of literature

1.1 Plant viruses

Like all other viruses plant viruses are obligate intracellular parasites and they

are dependent on the molecular machinery of their host for their replication. The first

virus to be discovered was Tobacco mosaic virus (TMV). The discovery of TMV is

often attributed to Martinus Beijerinck who determined, in 1898, that plant sap

obtained from tobacco leaves with "mosaic disease" remained infectious when passed

through a porcelain filter. This was in contrast to bacteria, which were retained by the

filter. Beijerinck referred the infectious filtrate as a "contagium vivum fluidum",

which coined the modern term "virus". The purification (crystallization) of TMV was

first carried out by Wendell Stanley, who published his findings in 1935, although he

did not determine that RNA was the encapsidated nucleic acid. However, he received

the Nobel Prize in Chemistry in 1946.

In 1978 Luria gave a very reasonable definition of viruses as “entities whose

genomes are elements of nucleic acid that replicate in living cells using cellular

synthetic machinery and causing the synthesis of specialized elements that can

transfer the viral genome to other cells” (Luria et al., 1978). The International

Committee on Taxonomy of Viruses (ICTV) in its 8th report of classification and

nomenclature of viruses (edited by C. M. Fauquet, M. A. Mayo, J. Maniloff, U.

Desselberger and L. A. Ball., 2005) has approved 3 orders, 73 families, 9 subfamilies,

287 genera and ~1950 species of viruses. Of these, the plant viruses encompass 20

families, 88 genera and ~750 species. The genomes of some plant viruses are single-

stranded (ss) DNA or double-stranded (ds) DNA, whereas others have dsRNA

genomes. However, over 90% of plant viruses have ssRNA genomes. Caulimoviruses

(family Caulimoviridae) are dsDNA viruses whereas nanoviruses (Nanoviridae) and

geminiviruses (Geminiviridae) are ssDNA viruses.

1.2 Geminiviruses

The first description of a geminivirus disease may well have been documented

as early as 752 AD in the Man‟yoshu, a classical anthology of Japanese poetry. A

poem attributed to the Empress Koken which described the autumnal appearance of

2

Eupatorium plants in the summer, an observation that has been linked with yellow

vein disease of this perennial shrub (Inouye and Osaki, 1980). The disease of

Eupatorium has recently been shown to be caused by a geminivirus/betasatellite

disease complex (Saunders et al., 2003). Although diseases caused by geminiviruses

represent serious constraints to agriculture, little was known about the causal agents

of the diseases until the isolation of virus particles with a unique twinned, quasi-

isometric morphology associated with maize streak and beet curly top diseases (Bock

et al., 1974; Mumford, 1974). This characteristic provided the name “geminivirus”,

from Gemini, the sign of the zodiac symbolized by twins (Harrison et al., 1977), and

it has remained the unifying feature of this family of viruses (Fig.1.1).

Fig.1.1 Cryo-electron microscopy image reconstruction of a Maize streak virus particle. Image

reproduced from Zhang et al. (2001).

Recent structural analysis has demonstrated that the 22 x 38 nm particles

associated with Maize streak virus (MSV) consist of two incomplete T = 1 icosahedra

(Zhang et al., 2001), and a similar structure was subsequently observed for African

3

cassava mosaic virus (ACMV) (Böttcher et al., 2004). In groundbreaking research,

Harrison et al. (1977) and Goodman (1977a) demonstrated that the geminate particles

associated with cassava latent virus (now known as ACMV), MSV and Bean golden

mosaic virus (now known as Bean golden yellow mosaic virus [BGYMV]) contained

circular ssDNA, and that this genomic DNA was infectious when re-introduced to

plants by mechanical inoculation (Goodman, 1977b), setting geminiviruses apart from

all other plant viruses that had been characterized at that time. Evidence was provided

for BGYMV and Tomato golden mosaic virus (TGMV) to suggest that at least some

geminiviruses had divided genomes (Haber et al., 1981; Bisaro et al., 1982; Hamilton

et al., 1982). Shortly afterwards, the nucleotide sequence of ACMV was established,

and infectious clones were used to demonstrate a bipartite genomic structure (Stanley,

1983; Stanley and Gay, 1983). Later on the monopartite geminiviruses, MSV, Beet

curly top virus (BCTV) and Tomato pseudo-curly top virus (TPCTV) were similarly

characterized (Howell, 1984; Mullineaux et al., 1984; Grimsley et al., 1987; Stanley

et al., 1986a; Briddon et al., 1996), which resulted in the present-day recognition of

four genera (Mastrevirus, Begomovirus, Curtovirus and Topocuvirus) on the basis of

genome organization, insect vector and host range, in the family Geminiviridae by the

ICTV (Stanley et al., 2005).

Geminiviruses infect a wide variety of crop plants causing great economic

losses, and are the subject of immense concern worldwide. These viruses encode only

a few proteins for their replication and recruit most of their replication machinery

from their plant hosts (Hanley-Bowdoin et al., 1999). The geminivirus group was

established in 1979 (Matthews, 1979) and upgraded to the family Geminiviridae in

1995 (Murphy et al., 1995). Geminiviruses are widely distributed plant viruses

infecting everything from monocots, such as wheat and maize, to dicots, such as

cassava and tomato (Hanley-Bowdoin et al., 1999). There are now 199 officially

recognized geminivirus species of which 181 belong to the genus Begomovirus and

there are over 672 complete nucleotide sequences deposited in databases (Fauquet et

al., 2008), reflecting their economic importance and enormous diversity resulting

from their widespread geographic distribution and host adaptation.

Geminiviruses have been used for studying basic processes in plants and for

producing useful products. Virus induced gene silencing (VIGS) is based on a

silencing mechanism that regulates gene expression by the specific degradation of

RNA. Through this mechanism TGMV (Peele et al., 2001; Kjemtrup et al., 1998 ),

4

Cabbage leaf curl virus (CabLCuV) (Muangsan et al., 2004; Turnage et al., 2002),

ACMV (Fofana et al., 2004) and Tomato yellow leaf curl China betasatellite

(TYLCCNB) (Tao and Zhou 2004) have been used as silencing vectors. By over

expressing or downregulating the genes through geminivirus based vectors basic plant

processes can be studied. Geminivirus based vectors have been used for high level

expression of foreign proteins in plant cells. A high-level expression system has been

developed that utilizes elements of the replication machinery of Bean yellow dwarf

virus (BeYDV). The replication-associated protein (Rep) mediates release and

replication of a replicon from a DNA construct (LSL vector) that contains an

expression cassette for a gene of interest flanked by cis-acting elements of the virus.

By codelivery of a Rep-supplying vector and a GUS reporter-LSL vector, up to 40-

fold increase in expression levels was obtained when compared to delivery of the

reporter-LSL vectors alone. High-copy replication of the LSL vector was correlated

with enhanced expression of GUS (Mor et al., 2003). Similarly an expression system

based on BeYDV has been established which replicates and expresses foreign

proteins at high levels in tobacco, Arabidopsis, and other dicotyledonous plants. This

expression system is more universal than plant RNA virus-based expression systems,

which have restricted host ranges. The DNA-based nature of the BeYDV genome

renders it stable for the incorporation of large open reading frames. Using this

expression system, the rapid accumulation of a novel Arabidopsis-derived mitogen-

activated protein kinase to levels sufficient for standard biochemical analysis was

demonstrated (Hefferon et al., 2004).

1.3 Classification of geminiviruses

Geminiviruses are classified into four genera on the basis of host range,

genome organization and type of insect vector.

1.3.1 Mastrevirus

The genus Mastrevirus includes leafhopper-transmitted viruses with

monopartite genomes that infect either monocot or dicot plants (Boulton, 2002). MSV

and Wheat dwarf virus (WDV) are two well-studied monocot-infecting members in

this genus. BeYDV and Tobacco yellow dwarf virus (TbYDV) are dicot-infecting

mastreviruses. The genomes of mastreviruses are typically 2.6-2.8 kb from which four

5

conserved proteins are translated (Wright et al., 1997). The proteins associated with

viral replication, Rep and Rep A, are required early in the infection cycle, and are

produced from the complementary-sense transcripts. Rep A is encoded by open

reading frame (ORF) Rep A whereas Rep is encoded by ORFs Rep A and Rep B after

splicing of an intron (Fig. 1.2). Proteins associated with the later functions of

encapsidation and viral transport within, and between host cell (the coat protein [CP],

and movement protein [MP]) are translated from the virion-sense transcripts. A

characteristic feature of mastrevirus genomes is that virion- and complementary-sense

ORFs are separated by a large intergenic region (LIR) and a small intergenic region

(SIR), which are non-coding and contain regulatory elements (Fig. 1.2).

Fig. 1.2 Diagram showing the typical genome arrangement of mastreviruses. The position and

orientation of genes is indicated by arrows. The genes in the virion-sense encode the coat protein (CP)

and the movement protein (MP). The complementary-sense encodes the replication-associated protein

(Rep) which is translated from a spliced mRNA product of the Rep A and Rep B ORFs. The position of

the intron removed by splicing is indicated. The Rep A protein is translated from an unspliced

messenger RNA. Also indicated are two non-coding intergenic regions, the large intergenic region

(LIR), which contains a predicted hairpin structure with the nonanucleotide sequence (TAATATTAC)

forming part of the loop, and small intergenic region (SIR).

6

1.3.2 Curtovirus

Viruses of the genus Curtovirus are leafhopper-transmitted with monopartite

genomes that infect dicots. The genome of curtoviruses consists of one circular

ssDNA molecule of ~3.0 kb (Hur et al., 2007). In the genus Curtovirus, BCTV is the

well-studied example. Seven ORFs are transcribed in a bidirectional fashion from an

approximately 450 nt. intergenic region (IR) that contains the origin of viral DNA

replication (Baliji et al., 2004; Briddon et al., 1998; Klute et al., 1996; Stanley et al.,

1986a; Stenger, 1994a) (Fig. 1.3). The three virion-sense ORFs, V1, V2 and V3, are

highly conserved and encode the CP, a ss/dsDNA regulator and a MP, respectively.

The four complementary sense ORFs, C1, C2, C3 and C4, are more divergent and

encode the Rep, a product involved in a recovery phenotype, an enhancer of

replication and a product involved in symptom development, respectively (Briddon et

al., 1989; Hormuzdi and Bisaro, 1993; Latham et al., 1997; Stanley et al., 1992;

Stenger and Ostrow, 1996). The IR is also divergent among curtovirus species and

contains species-specific cis-acting sequences involved in replication and control of

gene expression.

Fig.1.3 The genomes of curtoviruses encode the coat protein (CP), a ss/dsDNA regulator (V2) and a

putative movement protein (V3) in the virion-sense and the replication-associated protein (Rep), a

product involved in a recovery phenotype (C2), an enhancer of replication (REn) and a product

involved in symptom development (C4) in the complementary-sense. The intergenic region contains a

putative hairpin structure with the nonanucleotide sequence (TAATATTAC) forming part of the loop.

7

1.3.3 Topocuvirus

The most recently established genus of the Geminiviridae, Topocuvirus,

contains a single dicot-infecting virus; Tomato pseudo-curly top virus (TPCTV)

isolated from Florida (Briddon et al., 1996). This virus is transmitted by the

treehopper (Micrutalis malleiffera) and has a monopartite genome. It encodes two

ORFs (CP and V2) in the virion-sense and four ORFs (Rep, C2 to C4) in the

complementary-sense (Fig. 1.4).The functions of these genes have not been

investigated. However, their similarity to the genes of the other dicot-infecting viruses

suggests that they encode similar functions. Analysis of TPCTV genome reveals

features typical of both mastreviruses and begomoviruses, consistent with it being a

natural recombinant (Briddon et al., 1996). In line with this hypothesis, TPCTV can

trans-complement the movement of the DNA-A component of two bipartite

begomoviruses (ACMV and TGMV), in the absence of their cognate DNA-B

components (Briddon and Markham, 2001b).

Fig. 1.4 The genome of Tomato pseudo-curly top virus encodes two ORFs (CP, V2) on virion-sense

strand, four ORF (Rep, C2, C3 and C4) on complementary-sense strand and contains a putative hairpin

structure in the intergenic region with the nonanucleotide sequence (TAATATTAC) forming part of

the loop.

8

1.3.4 Begomovirus

The largest genus of the family Geminiviridae, Begomovirus, derives its name

from Bean golden mosaic virus (van Regenmortel et al., 1997) which is now called

Bean golden yellow mosaic virus (BGYMV). These are dicotyledon-infecting,

whitefly-transmitted viruses. On the basis of genome organization begomoviruses are

divided into two main groups: bipartite and monopartite. Bipartite begomoviruses

contain two genomic components known as DNA-A and DNA-B and monopartite

begomoviruses genome consists of a single component homologous to the DNA-A

components of bipartite begomoviruses. Each component is 2.6–2.8 kb in length and

transcribed bidirectionally (Fig. 1.5). The DNA-A component of bipartite

begomoviruses and the genomes of monopartite begomoviruses encode four genes,

termed AC1 to AC4 (C1 to C4 in monopartite viruses), on the complementary-sense

strand. AC1 to AC3 encode the Rep, the transcriptional activator protein (TrAP), and

the replication enhancer protein (REn), respectively. AC4 is involved in host range

determination, symptom severity, and virus movement (Jupin et al., 1994; Laufs et

al., 1995c; Wartig et al., 1997). There are two genes termed AV1 and AV2 (V1 and

V2 in monopartite viruses) encoded on the virion-sense strand but the begomoviruses

from the New World lack the AV2. AV1 encodes the CP and AV2 may be involved

in movement. There is one gene (BV1) encoded on the virion-sense strand and one

gene (BC1) encoded on the complementary-sense strand of the DNA-B components.

BV1 encodes the nuclear shuttle protein (NSP) and BC1 encodes the MP, which act

cooperatively to move the virus cell-to-cell within plants. The DNA-A and DNA-B

components share little sequence similarity, except for ~170 nt. of sequence in the

intergenic region (IR), termed the common region (CR) (reviewed by Hanley-

Bowdoin et al., 1999). Although the CR sequence is usually almost identical in both

components, there are examples where the CRs differ substantially between DNA-A

and DNA-B. For example, the DNA-A and DNA-B CRs of Tomato leaf curl Gujarat

virus (ToLCGV) and Cotton leaf crumple virus (CLCrV) differ by 40% and 37%,

respectively (Chakraborty et al., 2003; Idris and Brown, 2004). Despite these

differences, sequences critical for replication are identical between components of

each individual virus.

Phylogenetic studies have shown that begomoviruses can be broadly divided

into two groups, the Old World viruses (those originating from Europe, Africa, Asia

and Australasia) and the New World viruses (those originating from the Americas)

9

(Padidam et al., 1999; Paximadis et al., 1999; Rybicki, 1994). Begomovirus genomes

have a number of characteristics that can distinguish Old World and New World

viruses. All New World begomoviruses are bipartite, whereas in the Old World most

of the viruses are monopartite and the majority of these associated with recently

identified satellite molecules (as described later) and very few are bipartite. In

addition, all Old World begomoviruses, with the exception of two viruses which will

be described shortly, have an extra ORF (AV2) in the DNA-A component that is not

present in New World begomoviruses (Rybicki, 1994; Stanley et al., 2005). New

World begomoviruses also have an N-terminal PWRLMAGT motif (a conserved

sequence of amino acids) in the CP encoded by AV1, which is absent from Old World

begomoviruses (Harrison et al., 2002). In most Old World begomoviruses, there are

two iterons (repeated elements in the CR specifically recognized by the Rep)

upstream of the AC1 TATA box, with a complementary iteron downstream. This

downstream iteron is not found in most New World begomoviruses (Arguello-Astorga

et al., 1994).

Rybicki (1994) proposed that most New World beomoviruses arose more

recently than Old World viruses and suggested that they may have evolved after the

continental separation of the Americas from Gondwana, approximately 130 million

years ago. The lack of diversity of New World begomoviruses, in comparison to those

originating from the Old World, supports this suggestion. He hypothesized that

whiteflies moving from Asia to the Americas may have transmitted viruses that were

the ancestors of New World viruses that we observe today. These viruses evolved

separately from Old World viruses and this evolution would also have been

accompanied by the early loss of the AV2 gene, which would explain its absence

from all New World viruses characterized to date. However, some recent findings

have shown that New World-like begomoviruses are present in the Old World.

Corchorus yellow vein virus (CoYVV) and Corchorus golden mosaic virus (CoGMV)

were identified in Vietnam and have characteristics typical of the New World viruses,

including the absence of the AV2 gene and N-terminal PWRLMAGT motif in the

CP. It has been suggested that these may be last remnants of a distinct lineage of Old

World begomoviruses which were introduced into the New World and subsequently

diverged to yield all extant New World begomoviruses (Ha et al., 2006; 2008).

10

Fig. 1.5 Genomic organization of begomoviruses. Bipartite begomoviruses have genomes consisting of

two components known as DNA-A (encoding replication-associated protein [Rep], coat protein [CP],

replication enhancer protein [REn], transcriptional activator protein [TrAP] and proteins possibly

involved in virus movement [AV2], pathogenicity determinat and a suppressor of RNA silencing

[AC4], viral genome replication [AC5]) and DNA-B (encoding nuclear shuttle protein [NSP] and

movement protein [MP]). The genomes of monopartite begomoviruses consist of one component

homologous to the DNA-A of the bipartite viruses and the majority of these are associated with

alphasatellites and betasatellites. Alphasatellites are self replicating molecules encoding their own Rep.

Betasatellites are dependent on their helper viruses for their replication and encode a single protein,

βC1, which upregulate replication of helper virus and suppress host defense. Both satellites have an A-

rich region and in addition to this betasatellites have a region of sequence conserved between all

examples known as the satellite conserved region (SCR).

Satellites are defined as viruses or nucleic acids that depend on a helper virus

for their replication but lack extensive nucleotide sequence identity to the helper virus

and are dispensable for its proliferation (Mayo et al., 2005). It was ToLCV-sat, the

first begomovirus satellite to be discovered, was isolated from tomato plants infected

with the monopartite begomovirus Tomato leaf curl virus (ToLCV) (Dry et al., 1997).

The circular satellite is small (682 nucleotides), encodes no proteins and has little

sequence similarity to its helper virus with the exception of sequences within the apex

of two stem-loop structures, one containing the ubiquitous geminivirus TAATATTAC

motif and the other containing a putative ToLCV Rep binding motif (Behjatnia et al.,

1998). ToLCV-sat is not required for ToLCV infectivity and has no effect on the

11

symptoms induced by the helper virus but is dependent on the helper begomovirus for

its replication and encapsidation and hence has the hallmarks of a satellite DNA.

Ageratum yellow vein virus (AYVV), the monopartite begomovirus, was isolated

from infected Ageratum conyzoides, and the single genomic component was shown to

be infectious in Nicotiana benthamiana (Tan et al., 1995). However, re-introduction

of the cloned genome into Ageratum produced only an asymptomatic infection

(Saunders and Stanley, 1999; Saunders et al., 2000) suggesting that, in contrast to

ToLCV, another factor was required to provide pathogenicity in the natural host. A

novel ssDNA component of approximately half the size of the helper begomovirus

was isolated and shown to induce the yellow vein phenotype when re-introduced with

AYVV into Ageratum conyzoides (Saunders et al., 2000). The component was named

DNA-β and more recently betasatellite (Briddon et al., 2008) because, in many

respects, it functionally resembled the DNA-B component of bipartite begomoviruses.

Transmission of these two components and propagation of the disease in Ageratum

using the whitefly vector confirmed the aetiology of the disease. Soon afterwards, a

betasatellite homologue isolated from cotton was used to show that CLCuD was

caused by a similar monopartite begomovirus/betasatellite complex (Briddon et al.,

2001a). Since then, many more such complexes have been identified in a wide variety

of plant species growing throughout Africa and Asia (Mansoor et al., 2001; Amin et

al., 2002; Briddon et al., 2003; Jose and Usha, 2003; Saunders et al., 2003; Shih et

al., 2003; Zhou et al., 2003a; 2003b; Bull et al., 2004; Cui et al., 2004a; 2004b; Jiang

and Zhou, 2004, 2005; Rouhibakhsh and Malathi, 2005; Were et al., 2005a, 2005b;

Wu and Zhou, 2005; Xiong et al., 2005).

Begomoviruses associated with betasatellites have been shown to be numerous

but, apparently, are confined to the Old World. Betasatellites encode an essential

pathogenicity determinant that has a role in increasing helper DNA replication and

overcoming host plant defences (Cui et al., 2005b; Saeed et al., 2004; Saunders et al.,

2004). Comparison of the growing number of betasatellites components has indicated

that they have a highly conserved structure (Fig. 1.4) with a region rich in adenine (A-

rich), a single gene (known as βC1) and a highly conserved sequence of

approximately 100 nucleotides, referred to as the satellite-conserved region (SCR).

The SCR includes a putative stem-loop structure which contains the TAA/GTATTAC

motif which, by analogy to geminiviruses and nanoviruses, is likely the site where

Rep introduces a nick during the initiation of virion-sense DNA replication.

12

Besides betasatellites, the majority of monopartite begomovirus-betasatellite

complexes are also associated with a further circular, ssDNA molecule termed DNA 1

(now referred to as alphasatellites). This satellite-like molecule, in common with

betasatellites, requires the helper begomovirus for movement within plants.

Alphasatellites encode a single product with similarity to the Rep-encoding

components of nanoviruses (Mansoor et al., 1999; Saunders and Stanely, 1999;

Briddon et al., 2004). Alphasatellites and nanoviruses also share a hairpin structure

with the loop sequence TAGTATTAC that likely forms the origin of virion-strand

DNA replication. Alphasatellites are capable of autonomous replication in host cells

and appear to have no role in symptom induction (Briddon et al., 2004).

Begomoviruses are transmitted by the whitefly, Bemisia tabaci (Gennadius).

Whiteflies were first described in the genus Aleyrodes (Homoptera) in 1889

(Gennadius, 1889), and was first reported as a pest in 1919 in India (Husain and

Trehan, 1933). It has a very wide host range, consisting of 500 species in 74 plant

families (Greathead, 1986). The whitefly is a vector of viruses in the Geminiviridae,

Potyviridae and Comoviridae families and the genera Carlavirus and Closterovirus.

Whitefly-transmitted diseases have been reported mostly on herbaceous plants, more

rarely on shrubs and trees. The main food crops affected by whitefly transmitted

geminiviruses are tomato, pepper, tobacco, bean, cotton, squash, beet and cassava

(Monsalve-Fonnegra et al., 2001). They are present mainly in tropical countries, but

are also known to occur in sub-tropical and more temperate agricultural areas.

Begomovirus particles ingested through the whiteflies stylet enter the

oesophagus and the digestive tract, penetrate the gut membranes into the

haemolymph, reach the salivary glands and finally enter the salivary glands from

where they are egested with the saliva. Using TYLCV-specific antiserum,

immunogold label was found in the stylets and was associated mainly with lumen of

the food canal. Label was also detected in the proximal part of the descending

midgut associated with food in the lumen and with electron-dense material in

microvilli-rich gut wall epithelial cells (Czosnek et al., 2002). Another study

reported the immunolocalization of TYLCV to the filter chamber and the distal part

of the descending midgut (Brown and Czosnek, 2002). These results suggest that the

microvilli are the sites rich in begomovirus receptors and may serve as the primary

site allowing internalization of virus particles. Geminiviruses do not replicate in

their insect vectors (Boulton and Markham, 1986). The CP is the only begomoviral

13

gene product that interacts with whitefly factors during the circulative transmission

of the virus and the specificity of geminivirus transmission from insect to plant

resides with the CP as replacement of CP gene of ACMV with that of BCTV alters

insect specificity (Briddon et al., 1990). Mutagenesis of CP of a non transmissible

isolate of AbMV showed that the exchange of two amino acids, at positions 124 and

149, was sufficient to obtain a whitefly-transmissible AbMV mutant (Höhnle et al.,

2001). In a similar study with Beat mild curly top virus, most CP C-terminal alanine

scanning mutants were not leaf-hopper transmittable (Soto et al., 2005). Whiteflies

feed on phloem sap by inserting its stylet into plant tissue and locating the vascular

tissue (Pollard, 1955). Whitefly mediated transmission of Tomato yellow leaf curl

virus (TYLCV) to tomato plants and observation of disease symptoms have

indicated that the minimum acquisition access period (AAP) and inoculation access

period were 15 to 30 minutes. A single insect is able to infect a tomato plant with

TYLCV following a 24 h AAP. However, using PCR TYLCV DNA can be detected

in a single insect as early as 5-10 minute after the beginning of the AAP (Atzmon et

al., 1998; Ghanim et al., 2001; Navot et al., 1992). Similarly, the viral DNA can be

detected at the site of inoculation in tomato after a 5 minute inoculation access

period (IAP; Atzmon et al., 1998). A single insect is able to infect a tomato plant

with TYLCV following a 24 h AAP, although not all plants inoculated in this way

will become infected. The efficiency of transmission reaches 100% when 5 to 15

insects are used (Cohen and Nitzany, 1966; Mansour and Al-Musa, 1992; Mehta et

al., 1994). A similar number of insects are necessary to achieve 100% transmission

of the New World bipartite geminivirus, Squash leaf curl virus (SqLCV) (Cohen et

al., 1983). The efficiency of acquisition and transmission of TYLCV varies with the

gender and age of whitefly. Nearly all 1-2 week old adult females were able to cause

an infection in tomato plants following a 48 h IAP. In comparison, only about 20%

of males of the same age were able to produce infected plants. Inoculation capacity

decreased with the age of the insect; 60% of 3 week old females were able to cause

an infection in plants, whereas no infected plants were obtained following

inoculation by males of the same age. Only 20% of the 6 week old females were

able to infect tomato plants. Although the rate of TYLCV translocation is similar in

males and females, it is possible that different amounts of virus translocate in two

genders (Ghanim et al., 2001), and the putative begomovirus receptors in males and

14

females differs. In contrast, male and female whiteflies transmitted SqLCV with the

same efficiency (Polston et al., 1990). The reason for these differences is unclear.

1.4 Proteins encoded by geminiviruses

1.4.1 Replication-associated protein (Rep)

This protein, of about 41 kDa, is encoded by ORF C1 (also called AC1 or

AL1) in all whitefly-transmitted geminiviruses and, due to its similarities with rolling

circle DNA replication initiator proteins of some prokaryotic plasmids (Koonin and

Ilyina, 1992), has been called „„Rep‟‟ protein (Laufs et al., 1995c). Rep is known to

possess modular functions (Campos-Olivas et al., 2002; Orozco et al., 1997). The N-

terminal part of Rep contains DNA-binding, nicking-ligation and oligomerization

domains, while the C-terminal half contains ATP-binding and ATPase activity

domains (Raghavan et al., 2004; Orozco et al., 1996; Desbiez et al., 1995). It helps

viral genome in replication (Lazarowitz et al., 1992; Fontes et al., 1992; 1994), and

represses its own expression (Sunter et al., 1993; Eagle et al., 1994). During rolling

circle replication (RCR), Rep binds to repeat elements near the stem loop structure,

makes a site-specific nick at TAATATT↓AC of the loop region of the hairpin

structure of the plus strand to initiate replication and binds to the 5′ end of the nicked

DNA via tyrosine residue. The 3′-OH end of the DNA is probably then used as a

primer for synthesis of the viral DNA (Heyraud-Nitschke et al., 1995). Rep also acts

as a replicative helicase by forming a large oligomeric complex and the helicase

activity is dependent on the oligomeric conformation (~24 mer) (Choudhury et al.,

2006). Mastreviruses encode two replication-associated proteins, RepA and Rep,

which are translated from messenger RNA splicing variants. The Rep protein of

mastreviruses is the functional homologue of Rep of begomoviruses (Heyraud-

Nitschke et al., 1995).

The three dimensional solution NMR structure has been elucidated for the

catalytic domain of the Rep protein of the begomovirus TYLCV (Campos-Olivas et

al., 2002). Structural analysis points towards a conserved architecture of the above

domain in prokaryotic and eukaryotic Rep proteins and in number of functionally

diverse proteins. Rep is also known to induce host replication machinery presumably

to enable the virus to replicate in differentiated cells (Egelkrout et al., 2002; Kong et

al., 2000). The protein binds with retinoblastoma related proteins (pRBR) involved in

15

cell cycle that prevent cell entry into S phase by sequestering transcription factors

(Collin et al., 1996). The Rep protein of TGMV binds to pRBR through an 80-amino

acid region that contains two predicted α-helices designated 3 and 4 (Arguello-

Astorga et al., 2004). It activates host transcription in mature leaves by relieving

pRBR/E2F repression. The pRBR binding activity of Rep and the ability of TGMV

infection to overcome E2F-mediated repression of the proliferating cell nuclear

antigen (PCNA; the processivity factor for DNA polymerase δ [Castillo et al., 2003])

promoter support a model whereby geminivirus replication proteins modulate host

gene expression through the pRBR/E2F pathway. According to this model, in mature

plant cells, E2F binds to the PCNA promoter and recruits pRBR, which in turn

recruits chromatin remodelling activities, such as histone deacetylases and SWI/SNF

like enzyme, to create a repressor complex (Zhang and Dean, 2001). In this case host

gene expression is activated, leading to the production of the requisite host DNA

replication machinery. Geminivirus replication proteins also interact with the

replication factor C (RFC) complex, the clamp loader that transfers PCNA to the

replication fork (Castillo et al., 2003; Luque et al., 2002). These interactions are likely

to represent early steps in the assembly of a DNA replication complex on the

geminivirus origin. ACMV Rep protein induces re-replication in fission yeast. Upon

expression of Rep, cells exhibited morphological changes. They were elongated

threefold on average and possessed a single, but enlarged and less compact nucleus in

comparison to non-induced cells. Rep expressing cells exhibited DNA contents

beyond 2C indicating ongoing replication without intervening mitosis (Kittelmann et

al., 2009). TGMV Rep also binds histone H3, a mitotic kinesin, a novel protein kinase

(GRIK) (Kong and Hanley-Bowdoin, 2002), and Ubc9, a component of the

sumoylation pathway (Castillo et al., 2004).

1.4.2 Transcriptional Activator Protein (TrAP)

The transcriptional activator protein (TrAP) resembles a typical transcription

factor in several respects: it has a nuclear localization signal (NLS), a zinc finger-like

domain composed of cysteine and histidine residues, and an acidic activation domain

(Dong et al., 2003; Hartitz et al., 1999; Shivaprasad et al., 2005; Van Wezel et al.,

2003). The TrAP protein encoded by begomoviruses is a transcriptional activator, a

silencing suppressor, and a suppressor of a basal defense. TrAP is a nuclear protein

(Sanderfoot and Lazarowitz, 1995) that transactivates virion-sense gene expression

16

(Sunter and Bisaro, 1992; Sunter et al., 1994). TrAP-mediated stimulation of these

promoters is complex and involves both activation and derepression mechanisms

(Sunter and Bisaro, 2003; 1997; 1992). This function of TrAP is in the case of

bipartite begomoviruses and curtoviruses while in the case of mastreviruses this

function is provided by Rep A (Collin et al., 1996). Various experiments established

that activation is at the level of transcription (Sunter and Bisaro, 1992). For example,

in transgenic plants containing virion-sense promoter-reporter fusions, TrAP activated

the promoter in mesophyll cells and derepressed it in phloem tissue (Sunter and

Bisaro, 1997). Similarly, ACMV infection activated a transgene that was under the

control of the promoter inducible by TrAP (Hong et al., 1997). Noris et al., (1996)

studied the in vitro binding activity of TYLCV TrAP. The protein was found to bind

both ssDNA and dsDNA but preferably ssDNA. Binding activity of TrAP was

sequence independent and might be unrelated to its trans-activation activity.

In addition to its core role in viral transcription, TrAP also is a pathogenicity

factor that suppresses more than one host defense pathway. Constitutive expression of

TGMV TrAP and C2 of BCTV (the TrAP homolog that is, for BCTV, not involved in

upregulation of the virion-sense promoter) in transgenic N. benthamiana plants

developed a novel enhanced susceptibility phenotype characterized by a reduction in

mean latent period (time to first appearance of symptoms) and by a decrease in the

inoculum concentration required to elicit infection without a significant increase in

disease symptoms or virus replication (Sunter et al., 2001). Enhanced susceptibility

correlates with the ability of TrAP/C2 to interact with and inactivate SNF1 kinase, a

global regulator of metabolism that responds to the cellular energy charge (Hao et al.,

2003). However, the exact nature of the defences mediated by SNF1, which appears

to influence the property of viral infectivity rather than virulence, remains

uncharacterized.

Begomovirus TrAP proteins and BCTV C2 protein also are suppressors of

RNA silencing, an antiviral defense first observed in plants (Baulcombe, 2004; Ding

et al., 2004; Roth et al., 2004; Voinnet, 2005). TrAP can reverse previously

established silencing when expressed from an RNA virus vector such as Potato virus

X (PVX) and also can inhibit silencing when expressed from plasmids delivered by

particle bombardment or by agroinfiltration of leaves (Trinks et al., 2005; Vanitharani

et al., 2004; Voinnet et al., 1999; Wang et al., 2005). TrAP of East African cassava

mosaic Cameroon virus (EACMCV), Tomato yellow leaf curl China virus

17

(TYLCCNV) and Indian cassava mosaic virus (ICMV) are suppressors of post-

transcriptional gene silencing (PTGS) (Vanitharani et al., 2004; van Vezel et al.,

2002a). The available evidence suggests that TrAP suppresses silencing of a gene by

both transcription-dependent and transcription-independent mechanisms (Bisaro,

2006). The transcription-dependent mechanism is supposed to involve the activation

of host genes (e.g., WEL-1) that may act as endogenous, negative regulators of RNA

silencing (Trinks et al., 2005). Not surprisingly, this mechanism requires an intact

NLS and activation domain, as well as the zinc- and DNA binding activities (Dong et

al., 2003; Trinks et al., 2005; Van Wezel et al., 2003). The second mechanism does

not require the activation domain and correlates with the ability of TrAP to interact

with and inactivate adenosine kinase (ADK), an enzyme primarily localized in the

cytoplasm (Wang et al., 2005; 2003). Because ADK is required for efficient

production of the methyltransferase cofactor S-adenosylmethionine, ADK deficiency

reduces cellular transmethylation activity ((Buchmann et al., 2009; Moffatt et al.,

2002). Methylation of DNA sequences complementary to target RNA or target gene

promoters is associated with PTGS and transcriptional gene silencing, respectively.

Thus, it is possible that TrAP acts in a transcription-independent manner to interfere

with RNA-directed methylation of the viral genome. Methylation has been shown to

markedly reduce the replication of geminivirus DNA in transfected protoplasts and to

inhibit the activity of geminivirus promoters when they are used in transgenes

(Brough et al., 1992; Seemanpillai et al., 2003).

TrAP interacts with itself and the zinc finger-like motif (CCHC) is required

but is not sufficient for TrAP self-interaction. Using bimolecular fluorescence

complementation, it was shown that TrAP:TrAP complexes accumulate primarily in

the nucleus, whereas TrAP:ADK complexes accumulate mainly in the cytoplasm.

Thus, TrAP self-interaction correlates with nuclear localization and efficient

activation of transcription, whereas TrAP monomers can suppress local silencing by

interacting with ADK in the cytoplasm (Yang et al., 2007). Following expression in

insect cells from a baculovirus vector, phosphorylated TrAP accumulates

predominately in the nucleus, while nonphosphorylated forms are found in both the

nucleus and the cytoplasm, suggesting that subcellular localization is influenced by as

yet unidentified cellular kinases (Wang et al., 2003).

TrAP is also reported to counter hypersensitive cell death. The NSP of

Tomato leaf curl New Delhi virus (ToLCNDV) is an avirulence determinant and

18

induces a hypersensitive response (HR) in N. tabacum and Lycopersicum esculentum

plants when expressed under the control of the Cauliflower mosaic virus 35S

promoter. Co-inoculation of all ToLCNDV-encoded genes pinpointed the TrAP as the

factor mediating the inhibition of cell death and deletion mutagenesis showed the

central region of TrAP, containing a zinc finger domain and NLS, to be important in

this inhibition (Hussain et al., 2007).

1.4.3 Replication Enhancer Protein (REn)

The replication enhancer protein (REn) facilitates the accumulation of high

levels of viral DNA (Sunter et al., 1990), possibly by modifying the activity of Rep

and/or aiding in the recruitment of the host replication enzymes (Castillo et al., 2003;

Settlage et al., 1996). It has been observed that REn protein is located in nuclei of

infected plant cells at levels similar to the Rep (Nagar et al., 1995), suggesting that it

might act with Rep during initiation of viral DNA replication. Experimental

observation suggested that REn protein might increase the affinity of Rep for the

origin (Mohr et al., 1990) while in the case of mastreviruses, it is possible that their

unique Rep A protein might serve a similar function since mastreviruses do not

encode the REn protein (Laufs et al., 1995b; Orozco and Hanley-Bowdoin, 1996).

REn is a highly hydrophobic small protein of only 134 amino acids, which is very

well conserved among all begomoviruses and most curtoviruses (Castillo et al., 2003).

REn also homo-oligomerizes and interacts with at least two host-encoded proteins,

PCNA and the pRBR. Analysis of REn of TYLCV in yeast two-hybrid assays

indicated that mutations that inactivate REn replication enhancement activity also

reduce or inactivate REn oligomerization and interaction with Rep and PCNA. In

contrast, mutated REn proteins impaired for pRBR binding were fully functional in

replication assays. Hydrophobic residues in the middle of the REn protein were

implicated in REn interaction with itself, Rep and PCNA, while polar residues at both

the C and N termini of the protein were shown to be important for REn-pRBR

interaction. These experiments established the importance of REn-REn, REn-Rep, and

REn-PCNA interactions in geminivirus replication. While REn-pRBR interaction is

not required for viral replication in cycling cells, it may play a role during infection of

differentiated cells in intact plants (Settlage et al., 2005). A recent study shows that

both ToLCV and TGMV REn interact with a transcription factor in the NAC family

and this interaction is necessary for enhancement of replication (Selth et al., 2005).

19

1.4.4 (A)C4

(A)C4 is present in dicot-infecting geminiviruses, except those in the genus

Mastrevirus, and overlaps with Rep. Mutation analysis of C4 of BCTV has shown

that this protein is involved in symptom development. Stanley and Latham (1992)

introduced a stop codon at two different locations in the C4 gene without affecting the

amino acid sequence of Rep. When inoculated into N. benthamiana, the mutant

produced stunting and yellowing of leaves and downward leaf curling but not vein

swelling and upward curling which are characteristic symptoms produced by the wild

type virus. The level of viral DNA of mutant virus was similar to the wild type virus.

The mutant caused symptomless infection in Beta vulgaris, although the levels of

viral DNA often reached those of wild type and the mutant virus was able to move

systemically in plants. The results suggested that C4 is the major determinant of

pathogenesis of the virus. The expression of C4 protein in transgenic N. benthamiana

produced virus-like symptoms which further confirmed its role in symptom

development (Latham et al., 1997).

Mutation analysis of this ORF in monopartite begomoviruses has shown that

it is involved in symptom development (Rigden et al., 1994; Jupin et al., 1994). Agro-

inoculation of a mutant of ToLCV produced drastically reduced symptoms, although

the level of viral DNA was similar to the wild type virus and suggests that C4 is not

required by ToLCV to replicate or to spread through the host plant but is involved in

symptom development (Rigden et al., 1994). Like the MP of bipartite begomoviruses,

C4 of TYLCV was localized to the cell periphery (Rojas et al., 2001). Mutation

analysis of C4 in bipartite geminiviruses such as ACMV and TGMV resulted in wild

type symptoms and no role could be ascribed to product of this gene (Etessami et al.,

1989; Elmer et al., 1988). However AC4 of ACMV and Sri Lankan cassava mosaic

virus (SLCMV) were found to be suppressors of PTGS (Vanitharani et al., 2004).

1.4.5 Pre-Coat Protein ([A]V2)

This gene is unique to Old World begomoviruses but absent in begomoviruses

from the New World. However, two newly discovered begomoviruses, CoYVV (Ha

et al., 2006) and CoGMV (Ha et al., 2008) from the Old World lack this gene. The

unusual nature and hypotheses regarding their relationship to New World

begomoviruses was described earlier. Padidam et al. (1996) showed by mutation

analysis that the pre-coat protein ([A]V2) is involved in the movement of bipartite

20

geminiviruses. The TYLCV V2 localized around the nucleus and at the cell periphery

and co-localized with the endoplasmic reticulum. These patterns of localization were

similar to that of the MP of bipartite begomoviruses (Rojas et al., 2001). Mutation of

the V2 of MSV resulted either in low levels of replication, in which all the DNA

forms associated with wild type infection were produced, or in no infection, in which

case CP production may also have been affected (Boulton et al., 1989). Disruption of

the V2 gene of ToLCV lead to symptomless, systemic infection with a reduced titre of

all viral DNA forms (Rigden et al., 1993). Mutagenesis of EACMZV has

demonstrated that AV2 is not essential for symptomatic infection of cassava, however

symptoms were attenuated. Furthermore both AV1 and AV2 mutants were

compromised for CP production suggesting a close structural and/or functional

relationship (Bull et al., 2007).

1.4.6 Coat Protein

The coat protein (CP) of geminiviruses is a multifunctional protein required

for a range of functions associated with encapsidation, accumulation of viral ssDNA,

insect transmission and both intracellular and intercellular movement. The most

important function of CP is to form the shell in which genomic ssDNA is

encapsidated. A study based on MSV revealed that geminate particles are assembled

from 110 protein subunits, organized as 22 pentameric capsomers (Zhang et al.,

2001). For geminiviruses, CP is also involved in the systemic movement of the virus.

Mutation in this gene lead to a decreased level of viral DNA in the infected plants

while the level of viral DNA is not affected in protoplast, suggesting impairment of

movement function (Boulton et al., 1991). The localization of the product of this ORF

in secondary plasmodesmata with the onset of viral lesions is consistent with its role

in the movement of monopartite geminiviruses (Dickinson et al., 1996). The TYLCV

CP localized to the nucleus and nucleolus and acted as nuclear shuttle, facilitating

import and export of DNA (Rojas et al., 2001). The CP of MYMV is thought to be

involved in transport of the viral genome in the nucleus. In this study two nuclear

localization signals were identified within the N-terminal part of CP. In vitro pull

down assays revealed interaction of MYMV CP with the nuclear import factor

importin α suggesting that CP is imported into the nucleus via an importin α-

dependent pathway (Guerra-Peraza et al., 2005). Nuclear localization of geminivirus

CPs has been described in TYLCV (Kunik et al., 1998; Rojas et al., 2001), MSV (Liu

21

et al., 1999) and ACMV (Unseld et al., 2001). Interruption in the CP of ToLCV

disrupted spread of the virus (Rigden et al., 1993). CP of BCTV is essential for its

infectivity (Briddon et al., 1989). MSV requires CP to produce symptomatic systemic

infection and mutants containing insertions or deletions in CP gene were able to

replicate to low levels, producing dsDNA although virion ssDNA was not detected

and symptoms were not observed (Boulton et al., 1989). Insect vector specificity of

geminiviruses is associated with the CP. Replacement of CP of ACMV with that of

BCTV changed to insect vector from whitefly to leafhopper (Briddon et al., 1990).

1.4.7 Nuclear shuttle protein

Since geminiviruses replicate in the nucleus, they require movement from cell-

to cell and from cytoplasm into the nucleus. DNA-B of bipartite geminiviruses

encodes two proteins called nuclear shuttle protein (NSP) and movement protein

(MP). These gene products have been implicated in local and systemic spread,

symptom development, host-range determination and virus transmission (putting the

virus where the insect feeds) by whiteflies. The requirement of DNA-B products for

above functions varies for different viruses and specific host-virus combinations.

Mutation in either of these genes eliminated virus infectivity but did not affect virus

replication or encapsidation (Brough et al., 1988; Etessami et al., 1988). Pascal et al.,

(1994) provided direct evidence that NSP binds strongly to ssDNA with high affinity

and localizes to the cell nucleus. NSP is also shown to have sequence independent

affinity for dsDNA (Hehnle et al., 2004). NSP is a very basic protein and contains two

NLSs. A mutation in either of the potential NLSs severely impaired or eliminated

viral infectivity. The C-terminus of NSP is required for interaction with MP

(Sanderfoot et al., 1996). A number of host factors that interact with NSP have now

been identified, including an Arabidopsis acetyltransferase and a receptor-like protein

kinase from tomato and soybean (Mariano et al., 2004; McGarry et al., 2003). Based

on differential interaction with NSP and CP, it has been proposed that acetylation may

be involved in the segregation of ssDNA for movement and encapsidation,

respectively (McGarry et al., 2003). Phosphorylation of NSP by the kinase may

regulate the movement of viral DNA, or mask the protein from triggering a host

resistance response (Mariano et al., 2004). In this regard, NSP has been shown to act

as an avirulence factor in common bean (Garrido-Ramirez et al., 2000). The synthesis

of NSP is regulated at the transcriptional level by TrAP transactivation (Sunter and

22

Bisaro, 1991) and unlike other begomoviruses NSP of ToLCNDV is a pathogenicity

determinant (Hussain et al., 2005).

1.4.8 Movement protein

The movement protein (MP) of begomoviruses is involved in virus

movement from cell to cell. It binds cooperatively to DNA in a form- and size-

specific manner (Noueiry et al., 1994; Rojas et al., 1998). MP is a plasmodesmatal

movement protein and mediates the movement of dsDNA (Noueiry et al., 1994;

Sudarshana et al., 1998). There are two hypotheses about the role of MP in viral DNA

movement. According to “relay race model” NSP transfers dsDNA from nucleus to

the cytoplasm from which it is delivered to the MP for plasmodesmatal crossing.

According to a second model which may be called “couple-skating model” viral

ssDNA is shuttled between the nucleus and the cytoplasm in an NSP-containing

complex, which then interact with MP to move from cell to cell. The requirement of

both proteins for intercellular movement was demonstrated for BDMV, where

mutation of the NSP and MP proteins restricted the cell to cell movement of viral

DNA (Sudarshana et al., 1998). Electron microscopic studies have shown that MP

promotes redirection of NSP of ABMV to plasma membrane in fission yeast

(Frischmuth et al., 2007). A minimal domain of MP (amino acids 117-160) has been

identified that is necessary and sufficient to target a reporter to the cell periphery

(Zhang et al., 2002). Sequence analysis of this domain revealed a putative

amphiphilic helix which could serve as an anchor of the protein in one leaflet of the

membrane, whereas no transmembrane helices or signal peptides were recognizable

(Zhang et al., 2002). The MP protein of BDMV increases the size exclusion limit

(SEL) of plasmodesmata of cells into which it is injected, and the protein mediates

viral DNA transport from cell to cell (Noueiry et al., 1994; Rojas et al., 1998). The

combined properties of the geminivirus-encoded MP and plasmodesmata were shown

to impose a strict limitation on the size of the viral genome at the level of cell-to-cell

movement (Gilbertson et al., 2003).

The MP of begomoviruses has been reported to be involved in symptom

development. The importance of the movement protein as a key pathogenicity factor

was demonstrated by constitutively expressing MP of SqLCV in N. benthamiana

(Pascal et al., 1993 ) and MP of Tomato mottle virus (ToMoV) in N. tabacum (Duan

et al., 1997), in which they induced phenotypes reminiscent of the wild-type virus

23

disease symptoms. In a related study, Pascal et al. (1993) expressed both MP and NSP

of SqLCV in transgenic plants. Their results showed that the expression of MP alone

is sufficient to cause mosaic and leaf curl symptoms, typical of SqLCV infection.

These results suggest a role of MP in symptom development in bipartite

geminiviruses.

1.5 DNA replication of geminiviruses

Geminiviruses replicate in the nucleus of infected cells by a rolling circle

mechanism (Saunders et al., 1991; Stenger et al., 1991) from a dsDNA intermediate,

produced by complementary-sense DNA synthesis that is initiated from a short RNA

primer (Donson et al., 1984; Saunders et al., 1992). A multifunctional Rep is

indispensable for the precise initiation and termination of this process. RCR occurs in

two stages; first by conversion of the genomic ssDNA into a dsDNA intermediate and

then replication by the RCR mechanism analogous to that found in a class of

eubacterial plasmids and in some bacteriophages and prokaryotic ssDNA replicons

(Bisaro, 1996; Noris et al., 1996; Saunders et al., 1991; Stenger et al., 1991;

Timmermans et al., 1994). The iterons are Rep binding sites in the

intergenic/common region that participate in the initiation of replication as well as the

control of complementary-sense gene expression (reviewed by Hanley- Bowdoin et

al., 1999). It has been proposed that iteron binding occurs prior to the introduction of

a nick within the virion-sense strand of the loop sequence (Laufs et al., 1995a; Orozco

and Hanley-Bowdoin, 1996), covalent attachment of Rep to the exposed 5′-terminus

(Laufs et al., 1995b) and elongation of the 3′-terminus using the complementary-sense

template following the recruitment of host factors (Nagar et al., 1995; Kong et al.,

2000; Luque et al., 2002; Selth et al., 2005). The sequence-specific nature of the high-

affinity binding site explains why Rep and the origin of replication of distinct

begomoviruses are usually incompatible.

For mastreviruses, the primer for complementary-strand DNA synthesis is

encapsidated in virions. The primer DNA fragments of MSV (Donson et al., 1984)

and WDV (Hayes et al., 1988) are about 80 nucleotides containing 5′ terminal

ribonucleotides. An RNA primer preceding the synthesis of the complementary DNA

of ACMV has been identified in the DNA replication intermediates of ACMV

infected tobacco plants (Saunders et al., 1992). Synthesis of the putative RNA primer

24

initiates somewhere between nucleotide 2581 to 221 of ACMV, a region that includes

the intergenic region (Saunders et al., 1992).

At the onset of virion-sense DNA synthesis, a nick is introduced in the plus

strand within the nonanucleotide TAATATT/AC (slash indicates nicking site) at the

origin of replication which is identical among all geminiviruses. This function is

provided by the Rep proteins (Laufs et al., 1995a) that remains bound to the 5' end of

the cleaved strand. The 3' terminus of the nicked DNA serves as a primer for DNA

synthesis; displacing the original virion-sense DNA as the template (complementary)

strand is copied. DNA polymerases that synthesize the virion strand continuously

circles around the complementary DNA template. As a unit-length virion strand is

synthesized, it is cut and ligated to form a close circular single stranded virion DNA

(Fig. 1.6). Laufs et al. (1995c) reported that the Rep protein also has a joining activity

that acts as a terminase and resolves the nascent viral single strand into genome sized

units. This close-circular ssDNA can either serve as template for replication or can be

encapsidated into virions. The cleavage activity is initiated by tyrosine-103 and this

tyrosine is the physical link between the Rep protein and its DNA origin (Laufs et al.,

1995a). However the RCR model is unusual as geminiviruses transcribe

bidirectionally, thus risking collision between replication and transcription complexes

(Brewer, 1988). Jeske et al. (2001) confirmed by two-dimensional gel analysis and

electron microscopy that AbMV uses rolling circle replication. However, only a

minority of DNA intermediates detected were consistent with this model. The

majority were compatible with a recombination-dependent replication (RDR)

mechanism (Fig. 1.6) (Jeske et al., 2001). During development of naturally infected

leaves viral intermediates compatible with RCR and RDR appeared simultaneously

whereas agroinoculation of leaf discs with AbMV lead to an early appearance of RDR

forms but no RCR intermediates. Inactivation of viral genes TrAP and REn delayed

replication, but produced the same DNA types seen in wild-type infection, indicating

that these genes were not essential for RDR in leaf discs. Geminiviruses from

different genera and geographic origins were analysed by using BND (benzoylated

naphthoylated DEAE) cellulose chromatography in combination with improved high

resolution two dimensional gel electrophoresis, and it was concluded that multitasking

(utilisation of both RCR and RDR mechanisms) in replication is widespread amongst

geminiviruses (Preiss and Jeske, 2003).

25

Fig. 1.6 DNA replication of geminiviruses. During rolling circle replication Rep recognises the origin

of replication (ori) (a), nicks the virion strand and binds to the 5′ end (b). New DNA is synthesised

using the 3′ end of the nicked virion strand as a primer, the complementary-sense strand as a template

and the host DNA replication machinery displacing the original virions-strand (c). Rep recognises the

next ori repeat and releases a ssDNA copy by nicking and joining. Whereas during recombination-

dependent replication an incomplete ssDNA (a) interacts with a covalently closed circular DNA

(cccDNA) at homologous site for homologous recombination (b). The loop form in this way migrates

and ssDNA elongates (c). After the elongation of ssDNA and formation of complementary DNA a

dsDNA is produced (d).

26

1.6 Evolution of geminiviruses

ToLCV has been shown to replicate in Agrobacterium tumefaciens, a soil-

borne prokaryote that can transfer exogenous DNA into plants where it becomes

integrated into the genome (Rigden et al., 1996). This observation implies that similar

fundamental processes occur in prokaryotic and eukaryotic backgrounds, prompting

the suggestion that geminiviruses may have originated from prokaryotic episomal

replicons that undergo RCR. Intriguingly, AbMV DNA has been shown to be

associated with plastids as well as the nucleus (Gröning et al., 1987), an observation

that may reflect a past functional relationship with these putative prokaryotic-like

endosymbionts. Various ssDNA viruses, geminiviruses and nanoviruses in plants and

circoviruses in animals, replicate by RCR. All share sequence and structural features

with prokaryotic RC replicators and their Rep is evolutionarily related, leading to

speculation that these viruses evolved from prokaryotic ssDNA replicons (Koonin and

Ilyina, 1992; Gibbs and Weiller, 1999). Kapitonov and Jurka (2001) suggest that

Helitrons (a new class of transposable elements; Poulter et al., 2003) are the missing

evolutionary link between prokaryotic RC elements and geminiviruses.

The evolutionary relationships between the different genera of geminiviruses

are difficult to sort out due in large part to the fact that genetic recombination has

probably featured prominently in the evolution of these genera. It is clear, for

example, that Rep sequences of begomovirus, topocuvirus and curtovirus share a far

more recent common ancestor than their CP sequences. As the CP sequences of

topocuviruses and curtoviruses share a slightly higher degrees of sequence similarity

with mastreviruses than with begomoviruses this has been interpreted as indicating

that the Topocuvirus and Curtovirus genera may have arisen through separate

recombination events between ancestral begomovirus and mastrevirus lineages

(Briddon et al., 1996; Stanley et al., 1986b; Rybicki, 1994). It has been determined,

for instance, that since the divergence of the Old and New World begomoviruses there

have been at least five separate inter-genus recombination events between

curtoviruses and begomoviruses in which viruses in both genera have served as either

donors or recipients of Rep sequences (Lefeuvre et al., 2007a; 2007b). Even if the

curtoviruses, begomoviruses and topocuviruses do share a more recent Rep common

ancestor and the mastreviruses, curtoviruses and topocuviruses share a more recent

CP common ancestor, this does not necessarily imply that topocuviruses and

curtoviruses are the recombinant offsprings of mastreviruses and begomoviruses. It is,

27

for example, possible that the ancestral mastrevirus had obtained a divergent Rep

from a geminivirus lineage that remained unsampled. Similarly, transfer of a

divergent CP from such a geminivirus lineage to the ancestral begomovirus might

explain the apparent uniqueness of this gene in begomoviruses.

Until recently, it was thought that New World viruses arose more recently than

Old World viruses and they evolved after continental separation of the Americas from

Gondwana (Rybicki, 1994). More recent studies have provided the evidence of New

World begomoviruses in the Old World and vice versa, which is probably due to the

increased range of the B-biotype of the whitefly vector and/or the distribution of

infected propagating material. For example, strains of TYLCV have been identified in

the New World (Caribbean Islands and Florida; reviewed by Czosnek and Laterrot,

1997; Polston et al., 1999) and the New World virus AbMV has been identified in

Abutilon spp. in the UK (Brown et al., 2001) and New Zealand (Lyttle and Guy,

2004). But these were apparently recent introductions and there were no known

examples of indigenous viruses from the Old World with genome organization similar

to the New World viruses and vice versa. Recently two viruses CoYVV (Ha et al.,

2006) and CoGMV (Ha et al., 2008) were identified indigenous to Vietnam and they

resemble New World begomoviruses more closely than those of the Old World. This

was based on absence of an AV2 ORF, presence of an N-terminal PWRLMAGT

motif in the CP and phylogenetic analysis. The presence of CoYVV and CoGMV in

Vietnam indicates that New World-like viruses were probably present in the Old

World for some considerable time and that the common ancestor of New World

viruses originated in the Old World. Both the New World and Old World

begomoviruses had evolved prior to continental separation and CoYVV and CoGMV

may be remnants from the population of New World begomoviruses that previously

existed in the Old World. Another possibility is the begomoviruses may have evolved

in the Old World, and a progenitor of the current New World begomoviruses moved

to the New World by whiteflies or by Asian ancestors of American Indians or very

early Chinese traders (Ha et al., 2008).

Bipartite begomoviruses might have evolved from an ancestral monopartite

virus by component duplication and the acquisition of novel genetic material. Thus,

homology between the CP and NSP and their similar locations on DNA-A and DNA-

B, respectively, could indicate a common evolutionary origin (Kikuno et al., 1984).

The propensity of DNA-A to rescue components by donating its origin of replication

28

(Roberts and Stanley, 1994) might provide a mechanism (component capture) to

acquire additional genetic material. For example, on the basis of the sequence and

biological properties of the DNA-A component, it has been suggested that SLCMV

evolved from a monopartite begomovirus by capturing the DNA-B component of the

bipartite begomovirus, ICMV in this manner (Saunders et al., 2002; Chakraborty et

al., 2003). In the same way, Ageratum yellow vein virus (AYVV), CLCuMV and

TYLCCNV have been shown to donate their origin of replication to their cognate

betasatellites (Saunders et al., 2001; Briddon et al., 2001a; Tao and Zhou, 2008), to

produce a biologically active recombinant that can induce a phenotype in plants. The

propensity for recombination between such diverse entities provides enormous scope

for diversification and modification of biological properties to allow adaptation to

new ecological niches.

Begomoviruses acquired betasatellite components at some point during their

evolution, although the origin of betasatellites remains unknown. However, the

presence of an A-rich region could indicate that betasatellite adapted from a

preexisting component, as suggested for the nanovirus-like alphasatellites. This might

have occurred either by association of betasatellite with a monopartite begomovirus or

by displacement of DNA-B from an Old World bipartite begomovirus as

demonstrated experimentally for SLCMV (Saunders et al., 2002). Irrespective of the

mechanism, the emergence of betasatellites as part of disease complexes probably

occurred after the divergence of New and Old World begomoviruses because, to date,

satellites have only been found in association with monopartite begomoviruses that,

until recently, have been confined to the Old World. Phylogenetic analyses of

betasatellite components and their associated begomoviruses suggest that the satellites

and their helper viruses have co-evolved as a consequence of geographic isolation and

host adaptation (Zhou et al., 2003a). The presence of a betasatellite remnant

associated with ToLCV (Dry et al., 1997) suggests that this monopartite begomovirus

derives from a disease complex following adaptation to a more permissive host. The

possibility that other tomato-infecting monopartite begomoviruses such as TYLCV

have also been associated with a betasatellite component at some point during their

evolution cannot be excluded. The recent identification of a TYLCV isolate that is

associated with a betasatellite supports this argument (Khan et al., 2008).

Available evidence suggests that these disease complexes are rapidly

expanding in terms of their geographical distribution and host range. For example,

29

CLCuD was originally a major problem in central Pakistan but is now causing

extensive damage in India. In the same region, new diseases are emerging in crops

such as tomato, tobacco, chillies and papaya. The presence of such a diverse

population of begomoviruses in a single region, coupled with the propensity of these

viruses to exchange genetic material by recombination (Padidam et al., 1999; Roberts

and Stanley, 1994; Saunders et al., 2002), increases the probability of new virus

diseases emerging to cause epidemics in previously unaffected crops, a problem that

will be compounded by monoculture, the movement of infected material and the

widespread introduction of the whitefly vector. In view of the continual growth in

international trade and travel, it might be only a matter of time before whitefly-

transmissible disease complexes reach the New World as recently happened with

TYLCV with such serious consequences (Polston et al., 1999).

Although arthropod-infecting circular ssDNA viruses have not yet been

identified, the intimate association of geminiviruses with their insect vectors during

circulative transmission (Czosnek et al., 2001) might also have provided the

opportunity to acquire genetic material. Phylogenetic analysis provides compelling

evidence to suggest that vertebrate circoviruses may have originated from plant

nanoviruses (Gibbs and Weiller, 1999), possibly facilitated by arthropod vector

intermediaries. Hence, it is not inconceivable that genetic material can also be

transferred in the opposite direction, to plants from animals or sap-sucking

arthropods.

1.7 Legumes

The history of legumes (family Fabaceae, also known as the Leguminosae) is

tied in closely with that of human civilization, appearing early in Asia, the Americas

(common bean) and Europe (broad beans) by 6,000 BC, where they became a staple,

essential for supplementing protein where there was not enough meat. Carbonized

remains indicate that chickpeas, lentils and peas were domesticated in the Near East

arc and were cultivated with the cereals as early as the seventh millennium BC

(Smartt, 1990). Legume plants are well known for their ability to fix atmospheric

nitrogen, an accomplishment attributable to a symbiotic relationship with certain

bacteria known as Rhizobia found in root nodules of these plants (Dixon and Kahn,

2004). The ability to form this symbiotic association reduces fertilizer costs for

30

farmers and gardeners who grow legumes, and means that legumes can be used in a

crop rotation to replenish soil that has been depleted of nitrogen (Fox et al., 2007).

Legume seeds and foliage have comparatively higher protein content than

non-legume material, probably due to the additional nitrogen that legumes receive

through nitrogen-fixation symbiosis. This high protein content makes them desirable

crops in agriculture (Modernell et al., 2008). Forage legumes are grown so that the

whole crop can be used to nourish animals, either by grazing or by the production of

silage or hay, or sometimes for industrial purposes. The clovers (Trifolium spp.) and

medics (Medicago spp.) and especially lucerne (alfalfa), are examples of forage

legumes. Grain legumes are crop plants which are cultivated for their seeds, harvested

at maturity and are rich in protein and energy. In the trade and industry sectors the

mature dry seeds of grain legumes are usually called pulses and they are used either

for human consumption or for animal feed. The term pulses excludes the „leguminous

oilseeds‟ such as soybeans that are used primarily for their high oil content.

Three-quarters of the world production of grain legumes (185 million tonnes)

is soybeans, grown primarily in the USA, Brazil, Argentina, Paraguay and Uruguay

(Fig. 1.8), for their fat content (20%) and the high-protein by-product soybean meal

destined for the animal feed industry. The world production of soybeans has increased

by 215% over the last 30 years compared with just 50% for other grain legumes. The

world production of grain legumes other than soybeans amounts to 57 million tones,

growing primarily in southern Asia and China (Fig. 1.7). Data from countries

involved in export and import of legumes is shown in Fig. 1.9 and 1.10.

31

Fig. 1.7 The world production of grain legumes shown by vertical bars. Colours in each bar represent

different legumes indicated in the key given on the left. The data is the average of five years (2000 to

2004) research provided by UNIP with Eurostat and FAO.

Fig. 1.8 The world production of soybean compared with other grain legumes (GL) shown by vertical

bars. Red colour in each bar indicates soybean and orange colour represents other legumes. The data

provided by UNIP with Eurostat and FAO is the average of five years (2000 to 2004) collection.

32

Fig. 1.9 Major legume-exporting countries in the world. Contribution of each country is indicated by

vertical bars and distinct colours in each bar are used to represent different legumes. Key of the colours

used to represent legume species is given on the left side. The data is the average of five year (2000 to

2004) study conducted by UNIP with Eurostat and FAO.

Fig. 1.10 Major legume-importing countries in the world. Import of each country in shown by vertical

bars and colours in each bar represent different legume species. The key for the colours associated with

each legume species is given. The data is the average of five year (2000 to 2004) work conducted by

UNIP with Eurostat and FAO.

33

Legumes are a significant component of nearly all terrestrial biomes. Some are

fresh water aquatics, but there are no truly marine species. The species within the

family range from dwarf herbs of arctic and alpine vegetation to massive trees of

tropical forests. The principal unifying feature of the family is the fruit, a pod,

technically known as a Legume. In terms of economic importance the Leguminosae is

the most important family in the Dicotyledonae. Legumes are second only to

Graminae (cereals) in providing food crops for world agriculture. The economic

importance of the family is likely to increase as human pressure places greater

demand on marginal land. Many legume species are characteristic of open and

disturbed places and are thus well adapted to grow under poor conditions.

In recent decades, cereal research and improved cultivation have led to more

cereals and fewer pulses being grown. This has meant that people, particularly the

poor, have lost a valuable source of protein. At the same time, monocropping of

cereals has exhausted soils and made cereal cultivation less sustainable. In Asia, the

green revolution concentrated exclusively on increasing cereal production and

neglected all other food crops, including pulses that had previously played an

important part in cereal cropping systems. Far less land was given over to pulses,

which were relegated to marginal areas where soils were less productive. Per capita

pulse yields (and therefore soil protein availability) declined. Consequently, soils that

supported one cereal crop after another started to lose their nutrients and deteriorate.

Continuous cereal production also made it easier for diseases and insects to establish

themselves on farmland, despite the increased use of fertilizers and pesticides. The

ratio of farm outputs to inputs (total factor productivity) attained by cereal farmers

declined dramatically. So, for developing countries of Asia, legumes are very

important crops and need more attention as they are not only a good source of protein

for nutrient deficient people but also prove to be excellent rotation crops to improve

soil fertility.

Legumes as food are consumed in varied forms. They are consumed as

vegetables and their seeds are consumed as fresh or in dried forms and their sprouts

are also eaten. Some of them are grown to yield edible oil. In Pakistan the most

common use of legumes as food is in the form of pulses. These are the dry beans of

legumes. Leguminous crops harvested green for food like snap beans and green peas

are classified as vegetable crops. Winter legumes grown in Pakistan are chickpea

(Cicer arietinum), grasspea (Lathyrus sativus) and lentil (Lens culinaris), while

34

summer food legumes are mungbean (Vigna radiata) and blackgram (Vigna mungo).

Fababean (Vicia faba), pigeonpea (Cajanus cajan), cowpea (Vigna unguiculata),

mothbean (Vigna aconitifolia) and kidneybean (Phaseolus vulgaris) are grown on a

very small scale.

Mungbean, Vigna radiata (L.) Wilczek belongs to subfamily Papilionoideae

of the Leguminosae. It is also referred to as green gram, golden gram and chop suey

bean. It is a widely adaptable, high yielding pulse and a major source of dietary

protein. Its seeds and sprouts are consumed as food and its shoots and leaves are

consumed as a vegetable. They are grown widely for use as human food but can be

used as a green manure crop and as forage for livestock. It is an early maturing bush

or vine like herb. The mungbean ancestors are annual plants with both short and long

day cultivars. They are warm season annuals, highly branched and having trifoliate

leaves like other legumes. Mungbean is a short duration crop that can be grown in

different soil conditions. Depending upon variety it takes about 90-120 days from

planting till maturity. Mungbean probably originated in India (De Candole, 1886;

Zhukovsky, 1950; Bailey, 1970) or the Indo-Burmese region (Vavilov, 1951; Sing et

al., 1970) and has been grown in India since ancient times. It is still widely grown in

Southeast Asia, Africa, South America and Australia. Mungbean seeds are sprouted

for fresh use or canned for shipment to restaurants. Sprouts are high in protein (21%–

28%), calcium, phosphorus and certain vitamins. Because they are easily digested

they replace scarce animal protein in human diets in tropical areas of the world.

Because of their major use as sprouts, a high quality seed with excellent germination

is required. The food industry likes to obtain about 9 or 10 grams of fresh sprouts for

each gram of seed. Larger seed with a glassy, green color seems to be preferred. If the

mungbean seed does not meet sprouting standards it can be used as a livestock food.

Mungbean can be processed into flour, candies, and sweets, both at the household and

industrial levels. Nearly 75% of world mungbean area and 58% of world mungbean

production are in southern Asia (AVRDC Report, 2001). In Pakistan mungbean is

grown during July to October and March to June seasons. In year 2000-2005, average

mungbean cultivated area was 239,500 hectares, average production was 125,800

tonnes, and per acre yield was 500 kg per hectares (Agricultural Statistics of Pakistan,

2005-2006). Mungbean cultivated area, production, and per acre has increased over

the years.

35

1.8 Legume-infecting begomoviruses

The viruses causing yellow mosaic disease of legumes across southern Asia,

four of which have been identified so far, are bipartite begomoviruses. Mungbean

yellow mosaic virus (MYMV), Mungbean yellow mosaic India virus (MYMIV),

Horsegram yellow mosaic virus (HgYMV) and Dolichos yellow mosaic virus

(DoYMV), collectively called the legume yellow mosaic viruses (LYMVs), like all

members of the Geminiviridae, have geminate twinned particles, 18-20 nm in

diameter, 30 nm long, apparently consisting of two incomplete T=1 icosahedra joined

together in a structure with 22 pentameric capsomers and 110 identical protein

subunits. Symptoms caused by LYMVs are largely dependent on host species and

susceptibility. In mungbean, for example, the first symptoms typically appear in

young leaves in the form of mild yellow specks or spots. The next leaf emerging from

the growing apex shows irregular bright yellow and green patches. Yellow areas

increase in the subsequent new growth and ultimately some of the apical leaves turn

completely yellow (Ahmad et al., 1973; Nariani, 1960). Diseased plants produce

fewer flowers and pods; pods remain small contain fewer and smaller seeds (Nariani,

1960). In blackgram the symptoms produced are of two kinds depending on variety:

“yellow mottle” (generalized yellowing of the leaves) and “necrotic mottle”

(yellowing restricted to small spots which turn necrotic) (Nene, 1973; Nair et al.,

1974). In dolichos initial symptoms include faint chlorotic specks on leaf lamina,

which later develop into bright yellow mosaic patches with small islands of green

tissue. The leaves are seldom deformed, but yields are reduced significantly (Capoor

and Varma, 1950). The symptoms in soybean appear as small yellow specks along the

veinlets developing into mosaic. In French bean young systemically infected leaflets

show downward curling without yellow mosaic and irregular chlorotic spots develop

rarely.

The LYMVs are closely related and have distinct but overlapping host ranges.

MYMV and MYMIV occur across the Indian subcontinent, with MYMV also

reported from Thailand and Cambodia, and affect the majority of legume crops

including mungbean, blackgram, pigeonpea, soybean (Glycine max), mothbean and

common bean (Phaseolus vulgaris). Additionally, MYMV is reported to infect yard-

long bean (Vigna sesquipedalis) and MYMIV to infect dolichos (Lablab purpureus).

DoYMV has only recently been recognized as a distinct species of begomovirus

(Maruthi et al., 2006). The virus is reported to have a very narrow host range

36

consisting of only the host from which it was isolated, dolichos. HgYMV is the least

well characterized of the four viruses; four complete sequences are available in the

databases but no publication has yet reported the infectivity or host range of the virus.

This virus occurs in horsegram (Macrotyloma uniflorum). LYMVs have gene

arrangements just like other begomoviruses as discussed earlier. However for

MYMIV the AC5 protein, encoded by a gene on the DNA-A component which is not

well conserved between begomoviruses, has been shown to have a possible function

in viral DNA replication (Raghavan et al., 2004). A recent in-depth analysis of the

gene expression strategy of MYMV has shown for the first time for a begomovirus

splicing of transcripts (Shivaprasad et al., 2005). Well documented for mastreviruses,

in being essential to express Rep (Wright et al., 1997), splicing in the case of MYMV

occurs in the leader sequence of the MP, removing some potentially inhibitory

sequences from the leader, which may up-regulate translation.

1.8.1 History of yellow mosaic disease of legumes in southern Asia

Yellow mosaic disease (YMD) was first reported from western India in the

late 1940s in Lima bean and later in mungbean in northern India (Capoor and Varma,

1948; Nariani, 1960). Similarly, in the regions of the subcontinent now forming part

of Pakistan, YMD was first reported in cowpea in the vicinity of Lyallpur (now

known as Faisalabad; Vasudeva, 1942). Virus particles were observed for the first

time in 1981 (Thongmeearkom et al., 1981) and purified later on by Honda et al.,

(1983). Across the subcontinent, including India, Bangladesh, Pakistan and Sri Lanka,

YMD is a major constraint to the production of most of the major legume crops. In

Thailand YMD is a minor sporadic problem in legumes. However, in northern

Thailand a severe outbreak of YMD in mungbean occurred in 1997. This caused

major losses to production and initiated a shift in cropping practices. Since this time

YMD has remained a minor problem and the first complete sequence of a YMD virus

was isolated from mungbean originating from this country (Morinaga et al., 1993).

1.8.2 Host adaptation of the legume yellow mosaic viruses

MYMV and MYMIV (the only LYMVs which have been studied in any

detail) are unusual in having highly variable DNA-B components, likely due to

pseudo-recombination. A blackgram isolate of MYMV (MYMV-[IN:Vig]) was

shown to be associated with two distinct types of DNA-B. The first type (KA27)

37

showed 97% sequence identity to the DNA-B of the MYMV isolate from Thailand.

The other type (represented by four clones, KA21, 22, 28 and 34) was only 71–72%

identical to the Thai isolate (Karthikeyan et al., 2004). Infectivity analysis showed the

DNA-A component of this virus to be able to support both DNA-B components at the

same time and to induce only mild symptoms in blackgram in the presence of DNA

KA27 but typical disease symptoms in this host in the presence of the other DNA-B

components. In agroinoculation experiments, symptom severity depended on the

DNA-B component used (Balaji et al., 2004; Karthikeyan et al., 2004). For an isolate

of MYMIV (MYMIV-[Cp]) from cowpea, the presence of a distinct DNA-B was

shown to extend the host range of this virus to cowpea. These clones were not well

adapted to blackgram, inducing severe symptoms but accumulating to only low levels

in this species (Malathi et al., 2005). Furthermore, an isolate of MYMV isolated from

soybean (MYMV-[IN:Mad:Sb]) is associated with a DNA-B with high sequence

identity to the DNA-B of HgYMV (96%). The DNA-B of HgYMV is the most

distinct amongst the LYMV DNA-Bs, showing only 70–73% identity to the DNA-B

components of MYMV and MYMIV. These findings indicate that component

exchange (so called pseudo-recombination) is common-place for the LYMVs, both

within and between species, and is probably an adaptation allowing a change in host

range. For bipartite begomoviruses the DNA-A and DNA-B components share a

region of sequence (~200 nucleotides) with high sequence identity that contains the

origin (ori) of virion-strand DNA replication.

The ori consists of a conserved hairpin structure containing the ubiquitous (for

geminiviruses) nonanucleotide motif (TAATATTAC; which is nicked by the virus-

encoded Rep to initiate virion-sense, rolling-circle DNA replication) and repeated

motifs „iterons‟ that are the sequence specific recognition sequences for Rep

(Argüello-Astorga et al., 1994). The interaction between Rep and the iteron is highly

specific, in most cases preventing interaction between components of distinct

begomovirus species (Chatterji et al., 2000; Fontes et al., 1992; 1994; Orozco et al.,

1998). Thus, the integrity of the bipartite genomes of begomoviruses is maintained by

each component having the same (or at least a closely related) ori containing the same

iterons. However, component capture between distinct species does occur if, by

recombination, the ori of DNA-B is replaced by that of the DNA-A (so-called „origin

donation‟). This appears to be the case for the HgYMV-like DNA-B of MYMV-

[IN:Mad:Sb], which contains the MYMV/MYMIV iteron motifs GGTGT (Girish and

38

Usha, 2005). However, this isolate was also associated with a DNA-B typically

associated with this species.

1.8.3 Relationship of legume yellow mosaic viruses to other begomoviruses

The four geminiviruses so far identified infecting legumes in southern Asia are

amongst the most unusual of the begomoviruses. They are distinct from the numerous

legume-infecting begomoviruses that occur in the Americas (as are all Old World

begomoviruses; Stanley et al., 2004). In phylogenetic analyses the LYMVs are always

basal to the Old World begomoviruses (Padidam et al., 1995). This is a feature the

LYMVs share with two other legume-infecting viruses, Cowpea golden mosaic virus

(CPGMV) (from Nigeria) and Soybean crinkle leaf virus (SbCLV) (a monopartite

begomovirus occurring in Japan; Samretwanich et al., 2001), as well as a group of

presumed monopartite viruses isolated from Ipomoea spp. (including sweet potato),

which are widespread and whose precise geographical origins remain unclear

(Lotrakul et al., 2002).

1.9 Strategies for engineering resistance to geminiviruses

1.9.1 Resistance by the expression of proteins

Both viral and non viral proteins can be used to engineer resistance against

viruses. Among the proteins encoded by geminiviruses the Rep is of prime

importance as some of the functions of Rep are virus non-specific and targeting of

Rep may provide broader resistance against different geminiviruses. Virus replication

was repressed in N. benthamiana protoplasts expressing N-terminally truncated Rep

(T-Rep; Hong and Stanley, 1995; Brunetti et al., 2001), and T-Rep transgenic plants

showed a degree of resistance (Hong and Stanley, 1996; Noris et al., 1996). T-Rep

expression in tomato plants also conferred resistance to the homologous virus by

tightly repressing the viral Rep promoter, whereas it affected a heterologous

geminivirus by the formation of dysfunctional complexes with the Rep of the

heterologous virus (Lucioli et al., 2003). Similar observations have been reported for

the expression of the N-terminal region of ToLCNDV Rep, encompassing the DNA

binding and oligomerization domain, in N. benthamiana plants and protoplasts. This

led to a decrease of more than 70% in DNA accumulation of the homologous virus,

but also afforded a 20–50% decrease with heterologous ACMV, Pepper huasteco

39

yellow vein virus (PHYVV) and Potato yellow mosaic virus (PYMV) (Chatterji et al.,

2001). Resistance under field conditions was observed with tomatoes expressing parts

of the Rep gene with the intergenic region of TYLCV (Yang et al., 2004a). However,

in this case expression of the Rep protein was not necessary for resistance. It is

believed that the dsRNA hairpin loops transcribed from the inverted repeats of the

intergenic region trigger PTGS. TGMV MP had a deleterious effect on systemic

infection of ACMV DNA-A in N. benthamiana plants (von Arnim and Stanley,

1992a). Tobacco plants expressing a mutated version of ToMoV MP also showed

resistance to ToMoV and CaLCuV infection (Duan et al., 1997). Non-functional MPs

may compete for NSP interaction or oligomerization (Frischmuth et al., 2004), and

this could explain the resistance observed in plants expressing mutated MP.

Expression of full-length and truncated Rep of MYMV inhibited viral replication in

transgenic tobacco plants (Shivaprasad et al., 2006).

Cell death can contain the virus at the site of inoculation. To engineer virus-

inducible cell death mechanisms to confine ACMV to the primary infection site,

attempts have been made by expressing a ribosome-inactivating protein (dianthin)

controlled by the ACMV DNA-A virion strand promoter, which is transactivated by

ACMV TrAP on infection (Haley et al., 1992; Hong et al., 1997). Susceptibility of

transgenic N. benthamiana plant to infection by ACMV isolates originating from

widely separated locations was greatly reduced. As homologous and heterologous

TrAP proteins (TGMV, ACMV and SqLCV) are able to activate virion strand

expression of the TGMV promoter (Sunter et al., 1994), this strategy may confer

resistance to a broad spectrum of geminiviruses. In a similar approach barnase and

barstar proteins have been used to develop resistance to geminiviruses. Barnase is a

110-residue extraceullular protein found in Bacillus amyloliquefaciens. It is a

ribonuclease whose potentially lethal functions within the cell are inhibited by barstar,

a 90-residue polypeptide. The barnase and barstar coding sequences from Bacillus

amyloliquefaciens were cloned under the control of the virion-sense and

complementary-sense promoters from ACMV, respectively (Zhang et al., 2003).

Theoretically, in the absence of geminivirus infection, the barnase and barstar

transgenes should be expressed at similar levels and no active barnase is available.

During infection, the Rep and TrAP proteins increase the barnase/barstar ratio,

leading to the production of barnase with RNase activity, local cell death and, finally,

inhibition of virus spread.

40

Sera and Uranga (2002) have produced artificial zinc finger proteins (AZPs)

with a high affinity and selectivity for the Rep dsDNA binding site in the viral

replication origins of TGMV and Beet severe curly top virus (BSCTV). Expression of

a six finger AZP with a nuclear localization signal (NLS) under the control of a

Cestrum yellow leaf curling virus promoter in Arabidopsis thaliana also produced

transgenic lines with reduced or no replication of BSCTV (Sera, 2005). This approach

is likely to generate stable resistance as the virus needs to evade the AZP effect by

simultaneously mutating both the Rep sequence and the origin of replication.

1.9.2 DNA interference

In addition to genomic components, often subgenomic DNAs occur naturally

in geminivirus-infected plants (Frischmuth and Stanley, 1993). Because of their

ability to delay and attenuate infection symptoms they behave as defective interfering

(DI) DNA (Stanley et al., 1990). ACMV-infected plants contained small amounts of

DNA-B of approximately twice and half the genomic DNA length (Stanley and

Townsend, 1985) and their concentrations were negatively correlated with the ACMV

multiplication in N. benthamiana. Plants transformed with a tandem repeat of

subgenomic defective ACMV DNA-B showed reduced symptoms compared with

untransformed plants on ACMV infection (Stanley et al., 1990). This phenomenon

was virus specific because no resistance phenotype could be observed when the

transgenic plants were challenged with BCTV and TGMV. Subgenomic DNAs of

BCTV comprised a heterogeneous population, varying in size from 800 to 1800

nucleotides (Stenger et al., 1990; Frischmuth and Stanley, 1992). N. benthamiana

transformed with partial repeats of subgenomic DNAs remained susceptible to

infection but showed ameliorated symptoms when agroinoculated with BCTV.

Symptom amelioration was associated with the mobilization of subgenomic DNA

from the host genome (Frischmuth and Stanley, 1994; Stenger, 1994). BCTV DI

DNA-mediated resistance was linked to its size (Frischmuth et al., 1997) and it was

suggested that during the early stages of infection of control plants viral genomic

DNA is replicated to suitably high levels and subsequently spreads within the plant. In

transformed plants the DI DNA is mobilised from the host genome and competes

with, and reduces, the level of genomic DNA, thus, the level of viral DNA available

for spread decreases. Because the subgenomic DNA competes also for spread proteins

fewer cells will receive viral DNA.

41

1.9.3 RNA interference

RNA interference (RNAi) is involved in the inhibition of viruses and silencing

of transposable elements in plants, insects, fungi and nematodes by small interfering

(si)RNAs (21-nt dsRNA) that are processed from dsRNA viral replication

intermediates (Waterhouse et al., 2001; Voinnet, 2001; Wilkins et al., 2005; Segers

et al., 2007). These siRNAs are loaded into RISC and target the fully complementary

viral RNAs for destruction or translational repression (Haasnoot et al., 2003).

RNaseIII-type enzymes, termed Drosha and Dicer (DCR) in animals or DCR-LIKE

(DCL) in plants, catalyze processing of siRNA precursors to 21- to 24-nt duplexes

(Bartel, 2004; Baulcombe, 2004). Distinct pathways are involved in the synthesis of

siRNAs. Heterochromatin-associated siRNAs (predominantly 24-nt) form through the

activities of RDR2, RNA polymerase IV, and DCL3 and require AGO4 for activity to

direct or reinforce cytosine methylation of DNA and histone H3 methylation at Lys-9

(Herr et al., 2005; Onodera et al., 2005; Xie et al., 2004; Hamilton et al., 2002;

Zilberman et al., 2003). Formation of post-transcriptionally active siRNAs from

exogenous (viral and transgenic) sources may involve RDR1 or RDR6 and, for some

viruses, DCL2 (Baulcombe, 2004). Endogenous, trans-acting small interfering (ta-si)

RNAs arise from PolII genes and guide cleavage of target messenger RNAs (Allen et

al., 2005; Peragine et al., 2004; Vazquez et al., 2004). ta-siRNAs require RDR6 and

suppressor of gene silencing 3 (SGS3) for precursor formation (Peragine et al., 2004;

Vazquez et al., 2004). ta-siRNA formation also requires DCL1, although the specific

role of DCL1 may be indirect (Allen et al., 2005; Peragine et al., 2004; Vazquez et

al., 2004). All known classes of endogenous small RNAs in Arabidopsis require

HEN1, an RNA methyltransferase that modifies the 3′ end (Yu et al., 2005). A.

thaliana has three known families of ta-siRNA-encoding genes, designated TAS1,

TAS2, and TAS3 (Allen et al., 2005; Peragine et al., 2004; Vazquez et al., 2004). The

TAS1 family is composed of three genes that encode a closely related set of ta-

siRNAs (for example, siR255 and siR480) that target four messenger RNAs encoding

proteins of unknown function (Allen et al., 2005; Peragine et al., 2004; Vazquez et

al., 2004). TAS2-derived ta-siRNAs (for example, siR1511) targets a set of

messenger RNAs encoding pentatricopeptide repeat proteins (Allen et al., 2005;

Peragine et al., 2004). The TAS3 locus specifies two ta-siRNAs that target a set of

messenger RNAs for several Auxin response factors (ARFs), including ARF3

(ETTIN) and ARF4 (Allen et al., 2005; Williams et al., 2005). Arabidopsis mutants

42

with defects in RDR6 and SGS3 lack ta-siRNAs and exhibit accelerated transition

from juvenile to adult phase during vegetative development (Peragine et al., 2004;

Vazquez et al., 2004), suggesting that ta-siRNAs regulate developmental timing,

presumably through regulation of ta-siRNA target genes.

micro RNAs are small non-coding RNAs that are expressed as primary

microRNAs and processed first by the protein Drosha and then by Dicer into a ~70 nt

stem-loop precursor micro (pre-mi) RNA and the mature microRNA of 21–25 nt,

respectively. microRNA is loaded into the RNA-induced silencing complex (RISC).

The guide strand (microRNA) targets RISC to messenger RNAs with partially

complementary sequences, triggering messenger RNA cleavage or translational

inhibition. It has recently been suggested that under stress conditions, the mode of

microRNA regulation can change and, by association with other proteins, can turn

into an activator of gene expression (Leung and Sharp, 2007). The exact criteria for

target recognition are currently not clear. However, pairing of the 5′ 7–8 nucleotides

of the micro RNA (seed region) to multiple sites in the 3′ untranslated region of a

target messenger RNA is in many cases sufficient to trigger translational inhibition

(Krek, 2005; Brennecke et al., 2005; Grimson, et al., 2007; Lewis et al., 2003).

Several lines of research indicate that RNA silencing is a general antiviral

defense mechanism in plants. The first indication came from the studies of pathogen

derived resistance (PDR) in plants. In PDR, resistance to a particular virus is

engineered by stably transforming plants with a transgene derived from the virus.

Eventually it became clear, that one class of PDR was the result of RNA silencing of

the viral transgene. Once RNA silencing transgene had been established, all RNAs

with homology with the transgene were degraded, including those derived from an

infecting virus (Lindbo et al., 1993). Thus plant viruses could be the target of RNA

silencing induced by a transgene. The same work demonstrated that plant viruses

could also induce RNA silencing. VIGS can be targeted to either transgenes or

endogenous genes (Ruiz et al., 1998) and the technique has been used to screen for

gene function using libraries of endogenous sequences cloned into a viral vector

(Vance and Vaucheret, 2001). Transient expression of reporter genes encoding either

green fluorescence protein (GFP) or red fluorescent protein from Discosoma was

specifically reduced by 58% and 47%, respectively, at 24 h after codelivery of

cognate siRNAs in BY2 protoplasts. In contrast to mammalian systems, the siRNA-

induced silencing of GFP expression was transitive as indicated by the presence of

43

siRNAs representing parts of the target RNA outside the region homologous to the

triggering siRNA. Codelivery of a siRNA designed to target the messenger RNA

encoding the Rep of the geminivirus ACMV from Cameroon blocked Rep messenger

RNA accumulation by 91% and inhibited accumulation of the ACMV genomic DNA

by 66% at 36 and 48 h after transfection. As with siRNA-induced reporter gene

silencing, the siRNA targeting ACMV Rep was specific and did not affect the

replication of EACMCV.

1.9.4 Aims and objectives of the study

Across southern Asia, including Pakistan, YMD of legumes is a significant

constrain to the production of some legume crops. Although there are reports of

resistance to the viruses causing YMD in the literature, obtained by conventional

breeding, these appear not to have reached the field or not to hold up in the field –

fields of legumes continue to show symptoms of severe YMD infection in summer

crops. Despite the importance of legumes (and particularly grain legumes) to the diets

of the peoples of southern Asia, the begomoviruses affecting these crops have only

been poorly investigated. The objectives of the study reported here were to determine

the precise diversity of begomoviruses infecting legumes in Pakistan. This was to be

achieved by producing full-length clones and determining the sequence of all

begomovirus components, from as many samples and as many legume species

(including weeds) as was feasible in the time available. Furthermore, the clones would

be used to produce constructs for infectivity of both legumes and experimental

(model) plants to investigate virus gene function (gene requirements for infectivity).

Additionally, such an infectivity system will, it is anticipated, in the future be useful

for screening legumes varieties for resistance (so called “molecular breeding”).

Experiments conducted during the study would investigate the feasibility of this idea.

Finally, the availability of virus clones (thus virus sequences) and an infectivity

system would be used to investigate the possibility of using the RNAi approach to

develop resistance to legume-infecting begomoviruses. This Thesis details the results

of the aforementioned study. Although it was not anticipated prior to beginning the

investigation, the identification of betasatellites in some legume samples provided an

interesting aside, the investigation of which provided some highly novel and

interesting findings.

44

Chapter 2

Materials and methods

2.1 Sample collection

Symptomatic plants were located in fields and photographed with a high

resolution camera. Young leaves of symptomatic plants were collected, kept in plastic

bags labelled with permanent marker, transported on ice and stored at -80 ˚C until

utilized.

2.2 DNA extraction from plant tissue

2.2.1 DNA extraction from legumes

For legumes DNA was extracted from leaf samples using the method

described by Porebski (1997) with some modifications. 500 mg of leaf tissue was

ground to a fine powder in a pestle and mortar in the presence of liquid nitrogen and

transferred to a 15 mL centrifuge tube. 5 mL of extraction buffer [100 mM tris, 1.4 M

NaCl, 20 mM EDTA (pH 8.0), 2% CTAB, 0.3% β mercaptoethanol] and 50 mg of

PVP was mixed with powdered tissue and incubated at 65˚C with constant shaking for

30-45 minutes. The slurry was centrifuged at 1800×g in a tabletop centrifuge

(Eppendorf centrifuge 5810R) for 10 minutes to pellet tissue debris. The liquid phase

was collected in a new tube and mixed with 6 mL chloroform:isoamyl alcohol (24:1)

to form an emulsion and centrifuged at 1800×g for 20 minutes at room temperature.

The upper aqueous phase was transferred to a fresh tube by using a wide-bore pipette

tip and the chloroform:isoamyl alcohol extraction was repeated until the supernatant

was clear, without cloudiness. A half volume of 5 M NaCl was added to the final

aqueous solution recovered, mixed well and two volumes of cold 100% ethanol was

added, mixed well and placed in -20 ˚C freezer for 10 minutes. The precipitated DNA

was pelleted by centrifugation at 3220×g for 6 minutes. After removal of the

supernatant the pellet was washed with 70% ethanol, dried at 37 ˚C in an incubator

and resuspended in 300 µL TE buffer. Dissolved DNA was transferred to a new 1.5

mL microcentrifuge tube and 3 µL of RNase A (10 mg/mL) was added. After

incubation at 37 ˚C for 1 hour, 3 µL proteinase K (1 mg/mL) was added and incubated

at 37 ˚C for 15 minutes. 300 µL phenol:chloroform (1:1) mixture was added to the

45

tube, vortexed briefly and centrifuged (Eppendorf centrifuge 5415D) at 16000×g for

10 minutes. The upper aqueous phase containing DNA transferred to a new

microcentrifuge tube and mixed with 1/10 volume of 3 M sodium acetate and 2

volumes of absolute ethanol and centrifuged at 16000×g for 10 minutes. The DNA

pellet was washed with 70% ethanol and air dried. Finally the pellet was dissolved in

sterile distilled (SDW) water and stored at -20 ˚C freezer.

DNA of some legume samples was isolated using a Nucleon Phytopure

genomic DNA extraction kit (GE Healthcare) according to the instructions provided

by the manufacturer. 100 mg leaf tissue was ground to a fine powder in a pestle and

mortar in the presence of liquid nitrogen and transferred to a microcentrifuge tube

using a chilled spatula. For cell lysis, the powder was mixed with 600 µL Reagent 1

before adding 200 µL Reagent 2. The contents of the tube were mixed by inversion

and incubated at 65 ˚C for 10 minutes with regular manual agitation. The sample was

placed on ice for 20 minutes and then mixed with 500 µL chilled chloroform and 100

µL Nucleon PhytoPure DNA extraction resin suspension. The tube was agitated

manually for 10 minutes at room temperature and centrifuged at 11200×g for 10

minutes. The upper DNA containing phase was transferred to a fresh microcentrifuge

tube, mixed with an equal volume of cold isoropanol and centrifuged at 16000×g for 5

minutes to pellet the DNA. The DNA pellet was washed with 70% cold ethanol, air

dried and re-suspended in TE buffer.

2.2.2 DNA extraction from Nicotiana benthamiana and N. tabacum

From Nicotiana benthamiana and N. tabacum tissues DNA was isolated by the

CTAB method described by Doyle and Doyle (1990). 100 to 200 mg of leaf tissue

was ground to a fine powder in liquid nitrogen in a pestle and mortar. In a

microcentrifuge tube the powdered tissue was mixed with 700 µL pre-warmed CTAB

buffer [100 mM Tris-HCl (pH 8.0), 20 mM EDTA, 1.4 M NaCl, 2% (w/v) CTAB and

0.2% (v/v) β-mercaptethanol] and incubated at 65 ˚C for 30 minutes. After lowering

the temperature of the sample to room temperature, an equal volume of

chloroform:isoamyl alcohol (24:1) was added, mixed well and centrifuged at 11200×g

for 10 min at room temperature. The upper DNA containing phase was transferred

into a new microcentrifuge tube and mixed with 0.6 volume isopropanol to precipitate

the DNA. DNA was pelleted by centrifugation at 16000×g for 10 minutes, washed

with 70% ethanol and air dried. Finally the pellet was dissolved in SDW.

46

2.3 Quantification of DNA

The concentration of dsDNA was determined by spectrophotometer

(SmartSpec Plus, BIORAD). The sample was diluted 10/100 in SDW and the

absorbance measured at 260 nm after zeroing the machine against SDW. An O.D260 of

1 is equivalent to 50 µg/mL of DNA.

2.4 Amplification of DNA

2.4.1 PCR amplification of DNA

For amplification of DNA by PCR a reaction mixture of 50 µL containing 10

pg-1µg template DNA, 5 µL 10X Taq polymerase buffer (Fermentas), 5 µL 2 mM

dNTPs , 1.5 mM MgCl2, 0.5 µM each of primers (Table 2.1) and 1.25 units Taq DNA

polymerase (Fermentas) was prepared in a 0.25 mL or 0.5 mL thin walled PCR tube.

The reaction mixture was incubated in thermal cycler (Eppendorf). The machine was

programmed for a preheat treatment of 94 ˚C for 5 minutes followed by 35 cycles of

94 ˚C for 1 min, 48 ˚C to 52 ˚C for 1 min and 72 ˚C for varying times (dependent

upon the length of fragment to be amplified; typically 1 min per 1000 nucleotides to

be amplified), followed by a final incubation of 10 min at 72 ˚C. Specific as well as

universal primers were used for DNA amplification. For diagnostic PCR the volume

of reaction mixture was reduced to 25 µL per tube by reducing the ingredients

accordingly.

47

Table 2.1 Names, sequences and brief description of primers used in this study.

Primer name Sequence Used for

DNA-A Forward1

DNA-A Reverse1

GTAAAGCTTACATCCTCCACCAAGTGG

TGTAAGCTTTACGCATAATGCTCAATAC

Amplification of DNA-A of

MYMIV

DNA-A Forward2

DNA-A Reverse2

GTAAAGCTTACATCCTCCACC

TGTAAGCTTTACGCATAATGTTC

Amplification of

DNA-A of MYMIV

DNA-A Forward3

DNA-A Reverse3

TGTGGGATCCATTGTTGAACGACTTTC

CAATGGATCCCACATTGTTAGTGGGTTC

Amplification of

DNA-A of

MYMIV

DNA-B Forward DNA-B Reverse

CCAGGATCCAATGATGCCTCTGGCA ATTGGATCCTGGAGATTCAATATCTC

Amplification of

DNA-B of

MYMIV

PedLCV Forward

PedLCV Reverse

GATAGGACTTGACGTCGGAGCTTGAC

CATGTCATTGTCCGTTAGTGCTTTG

PCR detection of

PedLCV

AV2 Forward AV2 Reverse

CCACCCGGGATGTGGGATCCATTGTTG CAGGTCGACTATACAGTCGGTAAAAC

Cloning of

MYMIV AV2 in

PVX.

CP Forward

CP Reverse

TCCCCCGGGATGCCCAAGCGGACTTAC

CAAGTCGACTTAATTCAATATCGAATC

Cloning of

MYMIV CP in

PVX.

AC5 Forward

AC5 Reverse

GTTCCCGGGATGGTTCTCATACCTCGC

ATGGTCGACTTATGTCGTGACAGACG

Cloning of MYMIV AC5 in

PVX.

REn Forward

REn Reverse

GCCCCCGGGATGGATTTTCGCACAGG

GATGTCGACTTAATAAAGTTTGTATTG

Cloning of

MYMIV REn in PVX.

TrAP Forward

TrAP Reverse

CTTCCCGGGATGCGGAATTCTACAC

ATAGTCGACTACGGAAGATCGATAAGATC

Cloning of

MYMIV TrAP in PVX.

Rep Forward

Rep Reverse

ACTCCCGGGATGCCAAGGGAAGGTCG

CAGGTCGACTCAATTCGAGATCGTCG

Cloning of

MYMIV Rep in

PVX.

AC4 Forward

AC4 Reverse

GAGCCCGGGATGAAGATGGACAACCTC

CCTGTCGACTCAATATAAGGAGGGCCTCC

Cloning of

MYMIV AC4 in

PVX.

NSP Forward

NSP Reverse

AACATCGATATGTTTAACCGGAATTATC

TTAGTCGACTTATCCAACGTATTTCA

Cloning of MYMIV NSP in

PVX.

MP Forward

MP Reverse

TCTGATCGATGGAGAATTATTCAGGAGC

TTTCCCCGGGTTACAACTGTTTGTTCAC

Cloning of

MYMIV MP in PVX.

βC1-PVX Forward βC1-PVX Reverse

TCACCCGGGATGACATATGAACACTCAC

AATGTCGACTTATACGGATGAATGCG

Cloning of

MYMIV βC1 in

PVX.

AV2 Forward

AV2 Reverse

CCACCCGGGATGTGGGATCCATTGTTG

CAGGAATTCTATACAGTCGGTAAAAC

Cloning of

MYMIV AV2 in pJIT163.

48

Table 2.1 continued

Primer name Sequence Used for

CP Forward

CP Reverse

TCCCCCGGGATGCCCAAGCGGACTTAC

CAAGAATTCTTAATTCAATATCGAATC

Cloning of MYMIV CP in

pJIT163.

AC5 Forward

AC5 Reverse

GTTCCCGGGATGGTTCTCATACCTCGC

ATGGAATTCTTATGTCGTGACAGACG

Cloning of

MYMIV AC5 in pJIT163.

REn Forward REn Reverse

GCCCCCGGGATGGATTTTCGCACAGG GATGAATTCTTAATAAAGTTTGTATTG

Cloning of

MYMIV REn in

pJIT163.

TrAP Forward

TrAP Reverse

CTTAAGCTTATGCGGAATTCTACAC

AATGGATCCTTACGGAAGATCGATAAG

Cloning of

MYMIV TrAP in

pJIT163.

Rep Forward

Rep Reverse

ACTAAGCTTATGCCAAGGGAAGGTCG

CAGGGATCCTCAATTCGAGATCGTCG

Cloning of MYMIV Rep in

pJIT163.

AC4 Forward

AC4 Reverse

GAGCCCGGGATGAAGATGGACAACCTC

CTTTGAATTCAATATAAGGAGGGCCTCC

Cloning of

MYMIV AC4 in

pJIT163.

NSP Forward

NSP Reverse

AACAAGCTTATGTTTAACCGGAATTATC

TTAGGATCCTTATCCAACGTATTTCA

Cloning of MYMIV NSP in

pJIT163.

MP Forward

MP Reverse

TTTCAAGCTTATGGAGAATTATTCAGG

TTTCCCCGGGTTACAACTGTTTGTTCAC

Cloning of MYMIV MP in

pJIT163.

βC1-35S Forward

βC1-35S Reverse

TCAAAGCTTATGACATATGAACACTCAC

AATGGATCCTTATACGGATGAATGCG

Cloning of

MYMIV βC1 in pJIT163.

BΔNSP

Forward B

ΔNSP Reverse

AAGCTTGATGTCTCTGGTGTG * AAGCTTAAGTTACTTGATGTAATCCCTAC *

Mutation of NSP of MYMIV.

MIGFPF

MIGFPR

GTCGACATGAGTAAAGGAGAAGAAC

ACGCGTTTATTTGTATAGTTCATCCATG

Amplification of

GFP

A6GFPF A6GFPR

ACGCGTTATGCAACTCTTAAAATTCGGATC GTCGACGGATGCGCAATACCTGAATTAAC

Amplification of

MYMIV DNA-A

without CP

MIBETAF MIBETAR

CTTGAATTCCCCTATATTAGACTCCTTG GGGAATTCAAGCAAGAAGACATGGTG

Amplification of TbLCB

RhYAF

RhYAR

ATGCGAAAGCGGAGCTACGATACG

TTAATTTGATATCGAATCGTAAAAATAG

Diagnosis of DNA-

A of RhYMV

RhYBF

RhYBR

ATGTTTAATCGTAATTTTCGCTCC

TTATCCCAAATATTTTAATTCAAATTG

Diagnosis of DNA-

B of RhYMV

MYMVAF

MYMVAR

ATGCCAAAGCGGAATTACGATACCGC

CAAACTTTATTAATTTGAAATCGAATC

Diagnosis of DNA-

A of MYMV

MYMVBF

MYMVBR

ATGTACAACCGTAACATACGAACCCCAG

TTATCCAATGTATTGTAGTTCAAATTG

Diagnosis of DNA-

B of MYMV

RdR6F RdR6R

ATAGTCGACTCGTAGTGACTCAAATTAGTG CTGATCGATGATGCCTTTGTGCAAAACCGC

To produce

antisense construct

of RdR6.

* Bold letters in primer sequences are nucleotides used to add mutations.

49

2.4.2 Rolling-circle amplification

For amplification of circular DNA molecules rolling-circle amplification

(RCA; Fire and Xu 1995; Liu et al. 1996; Lizardi et al. 1998) was used. Reaction

mixtures of 20 µl containing 100 to 200 ng of genomic DNA extracted from infected

plant samples was used as a template, 50 µM random hexamer primers, 2 µl 10X φ29

DNA polymerase reaction buffer (330 mM Tris-acetate [pH 7.9 at 37 ˚C], 100 mM

magnesium acetate, 660 mM potassium acetate, 1% [v/v] Tween 20, 10 mM DTT)

was prepared and incubated at 94 ˚C for 3 minutes to denature double-stranded DNA.

The mixture was cooled to room temperature and mixed with 1 mM dNTPs, 5-7 units

of φ29 DNA polymerase and 0.02 units of pyrophosphatase (to eliminate inhibitory

accumulation of pyrophosphate) and incubated at 30 ˚C for 18 to 20 h. Finally the φ29

DNA polymerase was inactivated at 65 ˚C for 10 minutes.

2.5 Cloning of amplified DNA

2.5.1 Cloning of PCR product

PCR amplified DNA was cloned using an InsTAclone PCR Cloning Kit

(Fermentas) according to the instructions provided by the manufacturer. In brief, a

reaction mixture of 30 µL containing 18 to 540 ng PCR product (dependent upon the

length of DNA fragment), 3 µL vector (pTZ57R/T), 6 µL 5X ligation buffer and 5

units T4 DNA Ligase, was prepared in a 1.5 mL microcentrifuge tube and incubated

at 16 ˚C overnight. The following day the ligation mixture was transformed into

competent Escherichia coli cells by the heat-shock method. Transformed cells were

spread on solid LB medium (1% tryptone, 0.5% yeast extract and 1% NaCl) plates

containing 100 µg/mL ampicillin, spread with 20 µL X-Gal (50 mg/mL) and 100 µL

IPTG (24 mg/mL) and incubated at 37 ˚C for 16 hours. White colonies were picked

using sterile tooth picks, inoculated into 5 mL aliquots of LB liquid media in

autoclaved test tubes and grown at 37 ˚C in a shaker overnight. Plasmids were then

isolated from E. coli cultures and screened for desired inserts by restriction analysis.

For cloning in PVX vector, movement deficient PVX vector or pJIT163, PCR product

cloned in pTZ57R/T was digested at specific restriction sites introduced in primers

and ligated into the desired vector.

For cloning of RCA products the concatameric DNA was digested with

restriction endonucleases to yield monomeric copies. A cloning vector (usually

50

pBluescript II KS/SK [+]) was also restricted with the same enzyme. Restricted RCA

product and vector were extracted with phenol-chloroform to remove proteins and

quantified. Vector and insert were ligated in a reaction mixture of 20 µL containing

75-150 ng vector and 200-500 ng insert (approx. a 1:3 ratio), 4 µL 5X ligation buffer

and 1 µL T4 DNA ligase. The ligation mixture was kept at 16 ˚C overnight and the

following day transformed into competent E. coli cells.

2.6 Transformation of competent cells

2.6.1 Transformation of heat-shock competent E. coli cells

Transformation of competent E. coli cells was carried out by the methods

described by Sambrook et al. (1989). The ligation mixture was added to thawed

competent cells (200 µL), mixed gently and incubated on ice for 30 min. The cells

were heat shocked at 42˚C in a dry bath. After 1-2 minutes cells were transferred to

ice and incubated for two minutes. 1 mL of LB liquid medium was added to each tube

and the tubes were placed in a shaker at 37˚C for 1 hour. Transformed cells were

spread on solid LB media plates with appropriate antibiotics and kept at 37˚C in an

incubator for 16 hours.

2.6.2 Transformation of competent Agrobacterium tumefaciens cells

2 µL of the plasmid or ligation mixture was mixed with electro-competent A.

tumefaciens cells on ice and transferred to a chilled electroporation cuvette. The

electroporator (BTX Harvards) was set at 1.44 kV and the cuvette was inserted into

the electric shock chamber and the start button was pressed. After the electric shock, 1

mL of LB liquid medium was added to the cells and the tube was placed in a shaker at

28 ˚C for 2 hours. The cells were finally spread on Petri plates containing AB minimal

medium (K2HPO4 3 g, NaH2PO4 1 g, NH4Cl 1 g, MgSO4.7H2O 0.3 g, KCl 0.15 g,

CaCl2 0.005 g, FeSO4.7H2O 0.0025 g, and glucose 20% [w/v] [pH 7.2] in a 1 L

volume) with agar 14 g and appropriate antibiotics, wrapped with aluminium foil and

placed in a 28 ˚C incubator for 48 hours.

51

2.7 Preparation of competent cells

2.7.1 Preparation of heat shock competent Escherichia coli cells

A single colony from a freshly grown plate of E. coli was picked and

transferred into 20 mL LB medium in a 50 mL flask and incubated at 37 C overnight

with vigorous shaking. The next day 2 mL of the overnight culture was added to

250 mL LB in 1 L flask and shaken vigorously at 37oC until an OD600 of 0.5-1. The

culture was chilled on ice for 30 minutes, transferred aseptically to sterile disposable

50 mL propylene tubes and centrifuge at 3220×g at 4oC for 5 minutes to pellet the

cells. The cell pellet was resuspended in 20 mL of 0.1 M MgCl2 and centrifuged

again. The pellet was resuspended in 20 mL of 0.1 M CaCl2, incubated on ice for 30

minutes and centrifuged. Finally the pellet was resuspended in 3-4 mL of 0.1 M CaCl2

and filter-sterilised cold glycerol (in approx. 3:1 ratio). The cells were stored in

aliquots of 200 μL at -80oC.

2.7.2 Preparation of electro competent Agrobacterium tumefaciens cells

A single colony from a freshly grown plate of Agrobacterium tumefaciens

(strain EHA105 or GV3101) was picked using a sterile toothpick and inoculated into

20 mL LB liquid medium with 25 µg/mL rifampicin in a 50 mL autoclaved flask and

placed in a shaker (160 rotations per minute) at 28 C for 48 hours. 5 mL of the culture

was inoculated into a 1 L flask containing 250 mL of LB medium with 25 µg/mL

rifampicin and placed in a shaker at 28 C until the OD600 of cells was 0.5-1. The cells

were transferred aseptically to ice cold 50 mL propylene tubes, incubated on ice for

10 minutes and centrifuged at 3220×g for 10 minutes at 4 C. The pellet was

resuspended in 50 mL of sterile cold SDW and centrifuged. Cells were again

resuspended in cold SDW and the wash was repeated. Then the cells were

resuspended in 10 mL cold SDW containing filter sterilized cold 10% [v/v] glycerol

and centrifuged. This wash was also repeated. Finally the cells were re-suspended in

3-4 mL of filter sterilized cold 10% [v/v] glycerol, aliquoted in 1.5 mL

microcentrifuge tubes and stored at –80oC.

2.8 Plasmid isolation

Using a sterile tooth pick, a single bacterial colony from a plate was picked

and inoculated into 5 mL of LB broth with appropriate antibiotic selection in a sterile

52

culture tube. The tube was incubated overnight at 37oC with shaking. After about

sixteen hours the culture was decanted into a 1.5 mL microcentrifuge tube and

centrifuged at full speed for two minutes in a microfuge to harvest the cells. The

supernatant was discarded and the pellet was resuspended in 100 µL Resuspension

solution (50 mM Tris-HCl [pH 8.0], 10 mM EDTA, 100 ug/mL RNase A) by

vortexing. 200 µL Lysis solution (1% [w/v] SDS, 0.2 M NaOH) was added and mixed

gently. 200 µL Neutralization solution (3.0 M potassium acetate [pH 5.5]) was added,

mixed thoroughly and centrifuged at 16000×g for 10 minutes in a microfuge. The

supernatant was transferred to new microcentrifuge tube and two volumes chilled

absolute ethanol was added, mixed to precipitate the DNA and centrifuged for 10

minutes to pellet the DNA. The DNA pellet was washed with 70% ethanol, air dried

and dissolved in SDW.

For DNA sequencing, plasmids were isolated using a GeneJET Plasmid

Miniprep Kit (Fermentas). Overnight cultures of E. coli were transferred to 1.5 mL

microcentrifuge tubes, centrifuged for 2 minutes and the supernatant removed using a

pipette. This step was repeated 2-3 times to remove all the culture medium. The pellet

was resuspended in 250 µL Resuspension Solution. Cells were lysed with 250 µL

Lysis Solution, neutralized with 350 µL Neutralization Solution and the tube was

centrifuged at 16000×g for five minutes. A mini-column provided with the kit was

inserted into a collection tube and the supernatant was transferred to the column. The

column was centrifuged for one minute to bind the DNA to the matrix and the flow-

through in the collection tube was discarded. The matrix was washed twice with

500 µL Column Wash Solution and subsequently the column was centrifuged for one

minute in a dry tube to remove residual ethanol. Finally the column was inserted into

a fresh microcentrifuge tube and the DNA in the column was eluted in 50 µL SDW

and recovered by centrifugation.

2.9 Digestion of plasmid DNA

Digestion of plasmid preparations and PCR products was achieved using

enzymes and their corresponding buffers in accordance with the supplier’s

(Fermentas) guidelines. A total volume of 10 μL (containing 500 ng DNA, 3 units

restriction enzyme, buffer and SDW) was used when screening plasmid preparations

for insert size and 20 μL (2 µg DNA, 10 units restriction enzyme, buffer and SDW)

for digestions for cloning. Reaction mixtures were kept at optimum temperatures for

53

1-3 hour. Sizes of DNA fragments in digested product were determined on ethidium

bromide stained gel.

2.10 Agarose-gel electrophoresis

DNA was mixed with 5X loading dye and electrophoresed in 1% [w/v]

agarose gels containing ethidium bromide (0.5 μg/ mL). Gels were prepared in a

minigel apparatus (12 x 9 cm) or midigel apparatus (18 x 15 cm), containing either 1X

TBE (89 mM Tris, 89 mM boric acid, 2 mM EDTA) or 0.5X TAE (20 mM Tris-

acetate and 0.5 mM EDTA [pH 8.0]) buffer. TBE gels were electrophoresed at

approximately 40 volts and TAE gels at 100 volts. The ethidium-stained DNA was

viewed using a short wavelength ultraviolet (UV) transilluminator (Eagle Eye-

Stratagene) and fragment length estimated by comparison with a co-electrophoresed 1

kbp DNA ladder (Fermentas).

2.11 Preparation of glycerol stocks

To preserve bacterial cultures, glycerol stocks were prepared. In 1.5 mL

Eppendorf tubes 300 µL filter sterilised glycerol and 700 µL of cell culture was mixed

and stored at -80 ˚C freezer. To recover bacterial cultures from glycerol stocks, a

small amount of the culture was streaked using a sterile loop on culture plates with

solid growth media and suitable antibiotics and incubated at suitable temperatures.

2.12 Purification of DNA

2.12.1 Gel extraction and PCR product purification

The digested or PCR amplified DNA was run on a 1% agarose gel stained

with ethidium bromide and the desired fragments were excised from the gel using a

scalpel on a UV transilluminator. DNA from the gel was isolated using a Wizard SV

Gel and PCR Clean-Up System (Promega) as described by the manufacturer. The gel

slice was weighed and placed in a 1.5 mL microcentrifuge tube. 10 µL of Membrane

Binding Solution per 10 mg of gel slice was added, vortexed and incubated at 55-65

˚C until the gel slice was completely dissolved. For PCR product purification, an

equal volume of Membrane Binding Solution was mixed with the PCR reaction

mixture. Dissolved gel mixture/ PCR product mixture was transferred to a

Minicolumn assembly, incubated at room temperature for 1 minute and centrifuged at

54

16,000×g for 1 minute. The flowthrough was discarded and the Minicolumn was

reinserted into a Collection Tube. 700 µL of Membrane Wash Solution was added and

centrifuged at 16,000×g for 1 minute. The flowthrough was discarded and 500 µL

Membrane Wash Solution was added to the column. After 5 minutes of centrifugation

at 16,000×g the Collection Tube was emptied and the Minicolumn, with the empty

Collection Tube, was centrifuged for 1 minute with the microcentrifuge lid open to

allow evaporation of any residual ethanol. The Minicolumn was transferred to a clean

microcentrifuge tube, 50 µL SDW was added to the Minicolumn, incubated at room

temperature for 1 minute and centrifuged at 16,000×g for 1 minute. The Minicolumn

was discarded and the DNA solution was stored at -20 ˚C.

2.12.2 Phenol-chloroform extraction of DNA

To remove proteins from DNA solutions phenol:chloroform (1:1) extraction

was used. An equal volume of phenol:chloroform was mixed with the DNA solution

and vortexed until the mixture turned milky. The solution was centrifuged at

16,000×g for 10 minutes and the upper aqueous phase was transferred to a clean tube

without disturbing the interface between the two phases. 1/10 volume 3 M sodium

acetate (pH 5.4) and 2.5 volumes chilled absolute ethanol was mixed with the

supernatant and placed at -20 ˚C for one hour. To pellet the DNA, the tube was

centrifuged at maximum speed in a microfuge. DNA pellet was washed with 70%

ethanol, air dried and dissolved in SDW.

2.13 Agroinoculation

Clones in the binary vector pBin19 were electroporated into Agrobacterium

strain EHA105 whereas clones in pGreen0029 or PVX vector pGR107 were

electroporated to Agrobacterium strain GV3101. For agroinoculation to legumes

glycerol stocks of Agrobacterium strain EHA105 with required clones were streaked

on solid AB minimal medium plates containing 12.5 µg/mL rifampicin and 50 µg/mL

kanamycin and incubated at 28 ˚C for 48 hours. A single colony of bacteria was

picked with a sterile wire loop and inoculated into 50 mL AB minimal containing the

required antibiotics and placed in a shaker (160 rotations per minute) at 28 ˚C until

the O.D600 of the culture was 1. The cells were harvested by centrifugation at 3220×g

for 8 minutes and resuspended in AB minimal medium (pH 5.6) containing

acetosyringone (final concentration 100 µM). For surface sterilization, seeds of

55

legumes were first treated with 80% ethanol for 30 minutes, dipped in SDW for 30

minutes and finally treated with 10% bleaching agent for 2-3 minutes. Surface-

sterilized seeds of legumes were germinated on wet filter paper in Petri plates.

Hypocotyls of germinated seedlings were punctured three or four times with a G30

syringe needle, soaked in Agrobacterium inocula in a 50 mL flask and kept in the dark

at 25 ˚C overnight. Inoculated seedlings were washed twice with distilled water and

grown in pots containing silt and sand in equal amounts with a small amount of

compost. Plants were kept at 25 ˚C for ten days and later on moved to a growth

chamber at 30 to 35 ˚C with supplementary lighting to give a 16 hours photoperiod.

For agroinoculation to N. benthamiana and N. tabacum, plants at the 4 to 5

leaf stage were not watered for 24 hours before inoculation. The Agrobacterium

inoculum was infiltrated into fully expanded leaves using a 5 mL sterile syringe.

Plants were grown in a growth room at 25 ˚C with supplementary lighting to give a 16

hour photoperiod.

2.14 Plant growing conditions

All plants were grown in controlled conditions in growth rooms. Legumes

were grown at 30 ˚C with 16 hour dark period/8 hour light period and 65% humidity

in big earthen pots containing compost, silt and sand in 1:4:4 ratio. N. benthamiana

and N. tabacum were grown at 25 ˚C with 16 hours dark period/8 hours light period

and 65% humidity in small 5 inch diameter plastic pots containing clay, silt, sand and

compost in equal proportions. All plants were watered on daily basis and with

Hoagland solution (0.75 mM MgSO4.7H2O, 1.5 mM Ca(NO3)2.4H2O, 0.5 mM

KH2PO4, 1.25 mM KNO3, micronutrients [50 µM H3BO3, 15 µM MnCl2.4H2O, 2.0

µM ZnSO4.7H2O, 0.5 µM Na2MoO4.2H2O, 1.5 µM CuSO4.5H2O] and Fe-EDTA [30

µM FeSO4.7H2O, 1 mM KOH, 30 µM EDTA.2Na] once a week.

2.15 Southern blot analysis

A 1% agarose gel was loaded with DNA samples and run slowly, to

avoid smearing of DNA samples, until the bromophenol blue marker contained in the

loading buffer was near the bottom of the gel. The gel was treated with depurination

solution (0.25 M HCl) for 15 minutes, denaturation solution (1.5 M NaCl and 0.5 M

NaOH) for 30 minutes and neutralization solution (1 M Tris [pH7.4], 1.5 M NaCl) for

30 minutes. The gel was rinsed briefly with SDW in between treatments and agitated

56

gently on a platform shaker. DNA in the gel was transferred to a nylon membrane

(Hybond, Amersham) in 5X SSC (0.75 M NaCl and 75 mM sodium citrate) by

capillary action, using the apparatus illustrated in Fig. 2.1.

Fig. 2.1 Southern blot assembly for the capillary transfer of DNA from agarose gels to nylon

membranes. The gel is placed on a wick spread on a solid support. Both edges of wick are dipped in

transfer buffer (5X SSC) in a shallow dish. The nylon membrane (Hybond) is placed on the gel and

covered with Whatman 3MM paper. The transfer buffer is absorbed by paper towels.

DNA on the nylon membrane was crosslinked to the membrane in a UV

crosslinker (CL-1000 Ultraviolet Crosslinker-UVP) at 120 mJ/cm2 energy. The

membrane was then washed in a solution containing 0.1X SSC, 0.5% SDS at 65 ˚C

for 45 minutes to remove residual agarose. Before hybridization the membrane was

treated with 0.2 mL/cm2 pre-hybridization solution (6X SSC, 5X Denhardt’s solution

[0.1% {w/v} each of BSA, Ficol {mol. wt. 70,000} and PVP {mol. wt. 40,000}],

0.5% SDS, 50% [v/v] deionized formamide and 50 µg/mL denatured salmon sperm

DNA) at 42 ˚C for 2-4 hours in a hybridizer, to block non-specific binding sites. The

DNA probe was prepared using a Biotin DecaLabel DNA Labeling kit (Fermentas)

according to the manufacturer’s instructions. In a 1.5 mL microcentrifuge tube a

44 µL reaction mixture was prepared by adding 100 ng to 1 µg DNA template

57

(usually purified PCR product), 10 µL decanucleotide in 5X reaction buffer and

SDW. The reaction mixture was vortexed briefly, centrifuged 3-5 sec. and incubated

in a boiling water bath for 5-10 minutes. After heating, the tube was cooled on ice,

centrifuged and contents of the tube were mixed with 5 µL biotin labeling mixture

and 1 µL Klenow fragment exo- (5units). After shaking, the tube was centrifuged for

3-5 sec and incubated at 37 ˚C for 1 to 20 hours. The reaction was stopped by adding

1 µL 0.5 M EDTA (pH 8.0).

After 2-4 hours treatment of the membrane with pre-hybridization

solution in a hybridizer at 42 ˚C, the biotin-labeled probe was denatured at 100 ˚C for

5 minutes, chilled on ice and mixed with prehybridization solution (25-100 ng/mL).

The blot was then incubated overnight in the hybridizer at 42 ˚C. The following day

the membrane was washed two times with 2X SSC, 0.1% [w/v] SDS at room

temperature for 10 minutes and then two times with 0.1X SSC, 0.1% [w/v] SDS at 65

˚C for 20 minutes. To detect the biotin-labeled probe the membrane was washed in 30

mL Blocking/Washing Buffer (provided in Biotin Chromogenic Detection Kit by

Fermentas) at room temperature. After 5 minutes the membrane was treated with 30

mL Blocking Solution for 30 minutes to block non specific binding sites on the

membrane. Streptavidin-AP conjugate was diluted in 20 mL Blocking Solution (1:49

ratios) and the membrane was incubated in it for 30 minutes. The membrane was

washed twice in 60 mL Blocking/Washing buffer for 15 minutes and incubated with

20 mL Detection Buffer for 10 minutes. Finally the membrane was treated with 10

mL freshly prepared Substrate Solution at room temperature in the dark until a blue-

purple precipitate became visible. To stop the reaction the Substrate Solution was

discarded and the membrane was rinsed in SDW.

2.16 Sequencing and sequence analysis

Selected plasmid clones were purified using a GeneJET Plasmid Miniprep Kit

(Fermentas) and sent to Macrogen (South Korea) for sequencing with universal

primers (M13F [-20] and M13R [-20]). To extend the sequence specific primers were

designed (primer walking). The sequence data were assembled and analysed with the

aid of the Lasergene package of sequence analysis software (DNAStar Inc., Madison,

WI, USA). Sequence similarity searches (Blast) were performed by comparing the

sequence to other begomovirus/betasatellite sequences in the database

(http://www.ncbi.nlm.nih.gov/BLAST/). Open reading frames (ORFs) were located

58

using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Final sequences

were submitted to the EMBL database (http://www.ebi.ac.uk/embl). Multiple

sequence alignments were performed using Clustal X (Thompson et al., 1997) and the

MegAlign program of Lasergene. Phylogenetic trees were constructed using the

Neighbour Joining algorithm of Clustal X and displayed, manipulated and printed

using Treeview (Page 1996). The recombination analysis was performed using the

recombination detection programme (RDP) version 3.34 (Martin and Rybicki, 2000).

2.17 Photography and computer graphics

A digital camera (Sony, DSC W50) was used to photograph plants. The

photographs were edited with Adobe Photoshop CS. The figures were produced using

CorelDRAW 13 (Corel Corp.).

59

Chapter 3

Begomoviruses of legumes in Pakistan

3.1 Introduction

Based on nucleotide sequence data of the genomic components of yellow

mosaic viruses, two distinct begomoviruses, Mungbean yellow mosaic India virus

(MYMIV; Mandal et al. 1997) and Mungbean yellow mosaic virus (MYMV;

Morinaga et al. 1993), are the major cause of yellow mosaic disease in legumes in

southern Asia. Some other less well characterized begomoviruses from legumes are

Dolichos yellow mosaic virus (DoYMV; Maruthi et al., 2005) from India, Soybean

crinkle leaf virus (SbCLV; Samretwanich et al., 2001) from Thailand, Cowpea golden

mosaic virus (CPGMV) from Nigeria, Horsegram yellow mosaic virus (HgYMV;

Muniyappa et al., 1987) from India, and Kudzu mosaic virus (KuMV; Ha et al., 2008)

from Vietnam. Most of the work published on LYMVs from India is based on

MYMIV and MYMV and data shows that both these viruses have distinct

geographical distributions. MYMIV is prevalent in northern and central regions

whereas MYMV is infecting legumes in southern and western regions (Usharani et

al., 2004).

Legumes, especially mungbean and blackgram, are grown on a large area in

summer and winter seasons in Pakistan and they are prone to severe attack of yellow

mosaic disease. However, there are not many published reports of DNA viruses of

legumes from Pakistan. Yellow mosaic disease was first reported in cowpea from

vicinity of Lyallpur (now known as Faisalabad; Vasudeva, 1942). Hameed et al.

(2004) reported, on the basis of sequence analysis, that MYMIV is the pathogen

infecting mungbean in Pakistan. In the same year Hussain et al. (2004) reported,

based on PCR, partial sequencing of the DNA-B and Southern hybridization, that

MYMIV is the causative agent of yellow mosaic disease in mungbean in Pakistan. In

2004 a complete nucleotide sequence of MYMV DNA-A was submitted to NCBI

database (accession no.AY269991) which was isolated from soybean. In 2006 Qazi et

al. reported that yellow mosaic disease of mothbean in Pakistan is caused by MYMIV

based upon NSP gene sequence.

All of the viruses reported from legumes in southern Asia are bipartite

begomoviruses with narrow host ranges and are believed to be genetically isolated

60

(Qazi et al., 2007). These viruses have host ranges limited to plants of the family

Fabaceae. Although there is ample evidence for genetic interaction between these

begomoviruses within the legumes, in the form of both classical recombination and

component exchange, there is little evidence for interaction with viruses that infect

other plants. This is indicative of genetic isolation, the viruses in legumes evolving

independently of the begomoviruses in plant species of other families.

The emergence of new viral diseases can cause considerable damages and it is

difficult to pinpoint the attributes responsible for the establishment and spread of

viruses. Ecological studies can provide good information about factors that are

important for the invasion of pathogens (Kolar and Lodge, 2001; Schrag and Wiener,

1995). However, involvement of genetic approaches in these studies is very less, even

though genetic variation may determine the success of invaders. For successful

emergence, viruses need to evolve rapidly to circumvent loss of genetic variation

normally associated with founder effects, and adapt to the novel environmental

conditions. Gene flow provided by recombination is frequently exploited by viruses to

increase their evolutionary potential and to achieve local adaptation (García- Arenal et

al., 2001; Michalakis and Roze, 2004; Moya et al., 2004; Roossinck, 1997).

Begomoviruses constitute a group of plant viruses that exploit gene flow by

recombination and a distinct form of recombination unique to multipartite viruses

known as pseudo-recombination (Chatchawankanphanich and Maxwell, 2002; Monci

et al., 2002; Padidam et al., 1999; Pita et al., 2001; Preiss and Jeske, 2003; Sanz et al.,

2000; Zhou et al., 1997). Therefore a continued study of genetic diversity of viruses is

necessary to plan future strategies for their control.

To study genetic diversity, a fundamental requirement in molecular biology is

the isolation and amplification of specific DNA sequences. Target sequences are

typically inserted into circular vectors, propagated in a biological host, and isolated by

physical methods (Sambrook et al., 1989). However, such methods are laborious,

costly, and not amenable to high-density formats. PCR is also used to amplify defined

sequences, but can introduce sequence errors and is limited to amplification of

relatively short DNA segments (Innis et al., 1990). In nature, the replication of

circular DNA molecules such as plasmids or viruses frequently occurs via a rolling

circle mechanism (Kornberg and Baker, 1992). As a laboratory method, linear rolling

circle amplification (RCA) (Fire and Xu, 1995; Liu et al., 1996; Lizardi et al., 1998)

is the prolonged extension of an oligonucleotide primer annealed to a circular

61

template DNA. A continuous sequence of tandem concatameric copies of the circle is

synthesized. Previously, RCA had been used to amplify small DNA circles

approximately 100 nt. in length. However, the rate for plasmid-sized targets is only

about 20 copies per hour, limiting the usefulness with plasmids or other circles larger

than 0.2 kb. Dean et al., 2001 described a technique called multiply-primed RCA that

uses the unique properties of φ29 DNA polymerase and random primers to achieve a

10,000-fold amplification. RCA has the advantage of not requiring a thermal cycling

instrument. A cascade of strand displacement reactions results in an exponential

amplification. φ29 DNA polymerase of the Bacillus subtilis bacteriophage (Blanco et

al., 1989; Dean et al., 2001) copies DNA with high fidelity (Esteban et al., 1993), has

a proofreading activity (Garmendia et al., 1992), and high processivity (Blanco et al.,

1989). For analysis of circular DNA viruses, rolling-circle amplification with φ29

DNA polymerase has a tremendous potential. In 2004, RCA was first applied to viral

genomes. Rector et al. (2004) showed that the papillomavirus genome, which is

composed of circular dsDNA, could be efficiently amplified from tissue samples

using this technique. At the same time, Inoue-Nagata et al. (2004) used this method

for cloning of geminiviruses. As specific primer sequences are not required for this

technique, many novel viruses have been discovered using the technique. In addition,

components like DNA-B can be amplified more easily than with common methods

used so far (Inoue-Nagata et al., 2004). Reaction products can also be used directly

for DNA sequencing after phosphatase treatment to inactivate unincorporated

nucleotides. Infectious clones which allow functional studies of the viral genome

sequences have been produced directly from RCA products, which are concatameric

(Ferreira et al., 2007).

No studies have been conducted to determine the diversity of legume-infecting

begomoviruses in Pakistan. To date only one sequence of a DNA-A component of

MYMV and six sequences of DNA-A components of MYMIV isolates are available

in the databases originating from Pakistan (Fauquet et al., 2008). No cognate DNA-B

component for these viruses originating from Pakistan has been obtained. A study of

the diversity of legume-infecting begomoviruses will thus be helpful in better

understanding the epidemiology of legume yellow mosaic disease and in developing

effective management practices, including the possibility of developing transgenic,

pathogen-derived resistance.

62

3.2 Methodology

To study begomoviruses of legumes and their diversity in Pakistan, leaves of

leguminous crops and weeds showing yellow mosaics were collected from different

areas of Pakistan in the years 2005 to 2008 (Fig.3.1). As there were earlier reports that

MYMIV is the causative agent of yellow mosaic disease in legume crops in Pakistan,

specific primers (Table 2.1) were used to amplify DNA-A and DNA-B components of

MYMIV from total genomic DNA of infected samples by PCR. Subsequently RCA

using φ29 DNA polymerase was employed to amplify circular DNA viruses. RCA has

the advantage, over PCR, that it amplifies all circular DNA molecules without the

selection that invariably occurs due to the primers that are used in PCR. Amplified

products were cloned, sequenced and analysed.

3.3 Results

Mungbean (Vigna radiata), blackgram (Vigna mungo), cowpea (Vigna

unguiculata) and soybean (Glycine max) with yellow mosaic disease (YMD; Fig 3.2a-

d) were sampled from Faisalabad, Narowal, Hyderabad, Nawabshah, Muzafargar,

Islambad, Mianwali, Bhakar, Layah and Multan districts in Pakistan (Fig. 3.1) and

used for amplification of DNA viruses. Amplified products of about 2.8 kb and 1.4 kb

were cloned and on the basis of restriction analyses 37 clones of ~2.8 kb and 2 clones

of ~1.4 kb sizes were selected for sequencing. The origins, features and database

accession numbers of the sequences obtained are listed in Table 3.1. The sequences

obtained were compared with sequences available in the NCBI database using

BLAST. Closely related sequences were downloaded and used for sequence

comparison in MegAlign by Clustal V method.

Out of 37 clones 19 had high levels of nucleotide sequence identity (between

93.8% and 99.5%) to the DNA-A component of isolates of MYMIV (Table 3.2)

whereas 17 clones had between 90.7% and 98.9% identity to DNA-B of isolates of

MYMIV (Table 3.3).The sequence of clone MI1 showed between 88.9% and 92.6%

nucleotide sequence identity to Pedilanthus leaf curl virus (PedLCV; a virus

sometimes referred to as Tomato leaf curl Pakistan virus). Two clones of ~1.4 kb in

size had 94% identity to Tobacco leaf curl betasatellite (TbLCB). Since the species

demarcation threshold for begomoviruses is 89% (Fauquet et al., 2008) and for

betasatellites is 78% (Briddon et al., 2008) the results indicate that all legume crops

from eleven districts were infected with MYMIV. Additionally one soybean sample

63

from Nawabshah (Province of Sind) infected with MYMIV was co-infected with

PedLCV and TbLCB. A further ten soybean samples, from different fields in two

districts in the Province of Sind were also checked for the presence of PedLCV and

TbLCB by PCR. For PedLCV specific diagnostic primers (Table 2.1) were designed

while universal primers (Briddon et al., 2002) were used to detect betasatellites. All

soybean samples from Nawabshah and Hyderabad were found to be co-infected with

PedLCV. However no betasatellite was amplified from any sample other than that

originating from Nawabshah. None of the other legume crop samples originating from

Punjab province were found to contain PedLCV, TbLCB or any other non-

leguminous geminivirus.

Fig. 3.1 Map of Pakistan showing areas where virus infected legumes were collected.

64

Fig. 3.2 Symptoms exhibited by field-collected legumes. Mungbean (a), blackgram (b) and cowpea (c)

infected with MYMIV collected from Multan, Narowal and Faisalabad respectively. Soybean (d) with

a multiple infection of MYMIV, PedLCV and TbLCB collected from Nawabshah, Rhynchosia capitata

(e) infected with MYMV and PaLCuV collected from Mianwali and Rhynchosia minima infected with

RhYMV collected from Lahore (f).

65

To identify possible alternate hosts of legume yellow mosaic viruses

(LYMVs), two leguminous weeds, Rhynchosia capitata (Fig.3.2e) and Rhynchosia

minima (Fig.3.2f), with yellow mosaics were examined for the presence of

begomoviruses. RCA amplified viral components of about 2.8 kb were cloned and

nine clones were selected for sequencing. Sequence analyses showed that one clone

(MI65) from Rhynchosia capitata had between 91.9% and 97.8% nucleotide sequence

identity to the DNA-A components of isolates of MYMV, whereas the highest level

of identity to the DNA-A components of other legume infecting viruses was 81.7%.

Based on the presently applicable species demarcation threshold (89%) for

distinguishing species from isolates, this indicates that MI65 is an isolate of MYMV.

Two further clones isolated from the same plant (MI66 and MI67) showed 58.9% to

87.5% identity to the DNA-B component of MYMV, but less than 63.0% to the

DNA-B components of other legume-infecting begomoviruses.

Clones MI68 and MI69 isolated from the same plant as clones MI65-MI67 had

between 88.3% and 93.8% identity to isolates of Papaya leaf curl virus (PaLCuV;

Table 3.2). PCR with specific diagnostic primers was used to check for the presence

of MYMV and PaLCuV in seven other R. capitata samples from same area. All

samples were positive for the presence of MYMV but no other sample was found to

contain PaLCuV.

Two clones (MI32 and MI33) obtained from Rhynchosia minima showed

between 67.8% and 69.5% nucleotide sequence identity to the DNA-A components of

isolates of MYMV but less than 69.1% identity to the DNA-A components of the

other LYMVs (Table 3.2). Two further clones from same sample (MI34 and MI35)

showed 49% to 49.6% identity to the DNA-B component of HgYMV but less than

49.5% identity to the DNA-B components of the other LYMVs (Table 3.3). Based on

the presently applicable threshold level for species demarcation of 89% nucleotide

sequence identity, this indicates that these clones represent a new species in genus

begomovirus. On the basis of the symptoms exhibited by the field-infected plants, the

virus was tentatively named Rhynchosia yellow mosaic virus (RhYMV). Open

reading frames (ORF) of each clone were identified using the ORF finder program on

the NCBI website. All ~2.8 kb size clones had typical patterns of ORFs for the DNA-

A and DNA-B components of begomoviruses and the ~1.4kb clone had multiple

ORFs but one, in the complementary-sense, typical of betasatellites. Sequences were

66

submitted to the databases and are available under the accession numbers given in

Table 3.1. This table also lists all features of each clone.

The study of the diversity of legume-infecting begomoviruses in Pakistan

identified three bipartite begomoviruses (MYMIV, MYMV, RhYMV), two

monopartite begomoviruses (PedLCV, PaLCuV) and one betasatellite (TbLCB). A

more detailed analysis of each is conducted in the following sections.

67

Table 3.1 List of the begomovirus clones obtained in this study and a summary of their features.

Virus Host/year/

locality

Coding sequences of genomic components▲ (coordinates/coding capacity (no. of amino acids)/predicted molecular weight (kDa)

DNA A DNA B

Accession no./

Clone name/

Size (nt.)

(A)V2 CP (A)C5 REn TrAP Rep (A)C4

Accession no./

Clone name/

Size (nt.)

NSP MP

MYMIV Mungbean/2005

/ Islamabad

FM208836/

A4*/ 2746

156-497/

113/ 13.09

316-1089/

257/ 29.99

984-733/

83/ 9.06

1490-1086/

134/ 15.57

1680-1228/

150/ 16.98

2626-1538/

362/ 41.42

2475-2176/

99/ 11.36

FM202440/

B13*/ 2670

415-1185/

256/ 29.2

2113-1217/

298/ 33.7

MYMIV Mungbean/2006

/ Islamabad

AM950268/

MI15/ 2746

156-497/

113/ 13.09

316-1089/

257/ 29.99

984-733/

83/ 9.18

1490-1086/

134/ 15.81

1680-1228/

150/17.0

2626-1538/

362/41.31

2475-2176/

99/11.4

AM992617/

MI21/ 2672

417-1187/

256/ 29.1

2115-1219/

298/ 33.7

MYMIV Mungbean/2008

/Multan

FM955600/

MI76/ 2746

156-497/

113/ 13.07

316-1089/

257/ 30.1

984-733/

83/ 9.16

1490-1086/

134/ 15.77

1680-1228/

150/ 17.19

2626-1538/

362/ 41.38

2475-2176/

99/ 11.45

FM955603/

MI71/ 2662

405-1175/

256/29.21

2103-1207/

298/ 33.8

MYMIV Mungbean/2008

/Multan - - - - - - - -

FM955605/

MI77/ 2663

406-1176/

256/29.29

2023-1208/

271/30.74

MYMIV Mungbean/2008

/Mianwali

FM955598/

MI75/ 2746

156-497/

113/ 13.17

316-1089/

257/ 29.93

984-733/

83/ 9.11

1490-1086/

134/ 15.58

1680-1228/

150/ 16.99

2626-1538/

362/ 41.42

2475-2176/

99/ 11.3

FM955606/

MI74/ 2671

415-1185/

256/29.22

2113-1217/

298/33.73

MYMIV Mungbean/2008

/Layah

FM955599/

MI72/ 2746

156-497/

113/ 13.11

316-1089/

257/ 29.99

984-733/

83/ 9.06

1490-1086/

134/15.79

1680-1228/

150/ 17.14

2626-1538/

362/ 41.49

2475-2176/

99/ 11.4

FM955604/

MI73/ 2662

406-1176/

256/29.14

2104-1208/

298/33.78

MYMIV Mungbean/2005

/ Faisalabad

FM208838/

A6G*/ 2751

161-502/

113/ 13.09

321-1094/

257/ 29.92

989-738/

83/ 9.12

1495-1091/

134/ 15.6

1685-1233/

150/ 17.0

2631-1543/

362/ 41.30

2480-2181/

99/11.4 - - -

MYMIV Mungbean/2005

/ Faisalabad

FM208837/

A6*/ 2746

156-497/

113/13.1

316-1089/

257/ 29.9

984-733/

83/ 9.1

1490-1086/

134/ 15.6

1680-1228/

150/17.02

2626-1538/

362/41.44

2475-2176/

99/11.3

FM202439/

B4*/ 2670

415-1185/

256/ 29.2

2113-1217/

298/ 33.7

MYMIV Mungbean/2006

/Muzafargarh

FM208839/

A14*/ 2746

156-497/

113/13.1

316-1089/

257/ 29.90

984-733/

83/ 9.07

1490-1086/

134/ 15.6

1680-1226/

150/17.0

2626-1538/

362/41.31

2475-2176/

99/ 11.4

FM958506/

MI30/ 2660

404-1174/

256/29.2

2102-1206/

298/33.7

MYMIV Mungbean/2006

Narowal

FM208843/

MI7/2747

157-498/

113/13.08

317-1090/

257/30.0ǁ

985-734/

83/ 9.21

1491-1087/

134/ 15.8

1681-1229/

150/17.0

2627-1539/

362/41.27

2476-2177/

99/11.4

FM202442/

MI5/ 2672

417-1187/

256/ 29.2

2115-1219/

298/ 33.7

MYMIV Mungbean/2006

/ Narowal - - - - - - - -

FM202443/

MI6/ 2672

417-1187/

256/ 29.2

2115-1219/

298/ 33.7

MYMIV Mungbean/2006

/ Narowal - - - - - - -

FM955609/

MI10/ 2672

417-1187/

256/29.17

2115-1219/

298/33.7◊

MYMIV Mungbean/2006

/ Narowal

FM208846/

MI2/ 2746

156-497/

113/13.09

316-1089/

257/ 30.09

984-733/

83/ 9.2

1490-1086/

134/ 15.8

1680-1228/

150/17.0

2626-1538/

362/41.17

2475-2176/

99/11.4

FM202441/

MI3/ 2674

418-1140/

240/ 27.3

2117-1221/

298/ 33.8

MYMIV Mungbean/2006

/ Narowal

FM208842/

MI9/ 2749

156-497/

113/13.06

316-1089/

257/29.9¶

984-733/

83/9.1¶

1490-1086/

134/ 15.8

1681-1229/

150/17.0

2627-1539/

362/41.30

2476-2177/

99/11.4

FM202444/

MI8/ 2660

405-1175/

256/ 29.3

2103-1207/

298/ 33.7

MYMIV Soybean/2006/

Hyderabad

FM208833/

A1*/ 2746

156-497/

113/13.19

316-1089/

257/29.82

984-733/

83/ 9.1

1490-1086/

134/15.8

1680-1228/

150/17.07

2626-1538/

362/41.47

2475-2176/

99/11.34 - - -

MYMIV Soybean/2006/

Hyderabad

FM208834/

A1E*/ 2746

156-497/

113/13.19

316-1089/

257/29.83

984-733/

83/ 9.1

1490-1086/

134/ 15.8

1680-1228/

150/17.1

2626-1538/

362/41.47

2475-2176/

99/11.3 - - -

67

68

Virus Host /year/

locality

Coding sequences of genomic components▲ (coordinates/coding capacity (no. of amino acids)/predicted molecular weight (kDa)

DNA A DNA B

Accession no./

Clone name/

Size (nt.)

(A)V2 CP (A)C5 REn TrAP Rep (A)C4

Accession no./

Clone name/

Size (nt.)

NSP MP

MYMIV Soybean/2006/

Nawabshah

AM992618/

MI18/ 2746

156-497/

113/13.08

316-1089/

257/29.98

984-733/

83/ 9.07

1490-1086/

134/ 15.8

1680-1228/

150/17.1

2626-1538/

362/41.25

2475-2176/

99/11.5

FM161881/

MI17/ 2674

417-1187/

256/ 29.2

2115-1219/

298/ 33.8

MYMIV Soybean/2006/

Nawabshah - - - - - - - -

FM202445/

MI16/ 2674

417-1187/

256/ 29.2

2115-1219/

298/ 33.8

MYMIV Cowpea/2005/

Faisalabad

FM208840/

A17*/ 2746

156-497/

113/13.14

316-1089/

257/29.92

984-733/

83/ 9.12

1490-1086/

134/ 15.6

1680-1228/

150/ 17.0

2626-1538/

362/ 41.44

2475-2176/

99/ 11.3

FM202446/

B3*/ 2660

404-1174/

256/ 29.2

2102-1206/

298/ 33.7

MYMIV Blackgram/

2006/Islamabad

FM208844/

MI12/ 2746

156-497/

113/13.12

316-1089/

257/30.0

984-733/

83/9.15

1490-1086/

134/15.8§

1680-1228/

150/17.1

2626-1538/

362/41.24

2475-2176/

99/11.4

FM202447/

MI20/ 2672

417-1187/

256/ 29.1

2115-1219/

298/ 33.7

MYMIV Blackgram/

2006/Islamabad

FM208845/

MI13/ 2745

156-497/

113/ 13.12

316-1089/

257/ 30.05

984-733/

83/ 9.15

1490-1086/

134/ 15.8

1680-1228/

150/ 17.0

2626-1538/

362/41.2 ‡

2474-2175/

99/11.5 - - -

MYMIV Blackgram/

2005/Faisalabad

FM208835/

A2*/ 2751

161-502/

113/ 13.09

321-1094/

257/ 29.92

989-738/

83/ 9.12

1495-1091/

134/ 15.6

1685-1233/

150/ 17.0

2631-1543/

362/ 41.31

2480-2337/

47/5.3 - - -

MYMIV Blackgram/

2006/ Narowal

FM208841/

A20*/ 2746

156-497/

113/13.07

316-1089/

257/29.9Δ

984-544/

146/16.1

1490-1086/

134/ 15.6

1680-1228/

150/17.0

2626-1538/

362/ 41.47

2475-2314/

53/5.8 - - -

RhYMV

Rhynchosia

minima/2007/

Lahore

AM999981/

MI33/ 2740

145-513/

122/ 13.75

305-1078/

257/ 29.9

973-557/

138/ 15.76

1482-1075/

135/ 15.46

1636-1223/

137/ 15.73

2624-1530/

364/ 41.31

2467-2174/

97/ 11.18

AM999982/

MI35/ 2639

415-1182/

255/ 8.83

2121-1225/

298/33.73

RhYMV

Rhynchosia

minima/2007/

Lahore

FM208847/

MI32/ 2741

185-514/

109/ 12.14

306-1079/

257/ 29.9

974-558/

138/ 15.76

1483-1076/

135/ 15.47

1637-1224/

137/ 15.73

2625-1531/

364/ 41.32

2468-2175/

97/11.18

FM208848/

MI34/ 2643

415-1182/

255/28.83

2121-1225/

298/33.71

MYMV

Rhynchosia

capitata/2007/

Mianwali

FM242701/

MI65/ 2737

148-498/

116/ 13.58

308-1081/

257/ 29.78 -

1482-1078/

134/15.62

1630-1220/

136/15.42

2618-1530/

362/ 40.88

2467-2168/

99/11.45

FM242702/

MI66/ 2676

421-1191/

256/ 29.0

2113-1217/

298/ 33.7

MYMV

Rhynchosia

capitata/2007/

Mianwali

- - - - - - - - FM955607/

MI67/ 2676

421-1191/

256/28.97

2113-1217/

298/33.7

PedLCV Soybean/2006/

Nawabshah

AM948961/

MI1/ 2760

149-505/

118/ 13.74

309-1079/

256/ 29.7

974-723/

83/9.46

1480-1076/

134/15.68

1625-1221/

134/15.16

2613-1528/

361/40.57

2462-2166/

98/10.89 - - -

PaLCuV

Rhynchosia

capitata/2007

Mianwali

FM955602/

MI68/ 2756

148-504/

118/ 13.73

308-1078/

256/ 29.7

973-722/

83/ 9.46

1479-1075/

134/15.6†

1624-1220/

134/15.1†

2612-1527/

361/40.4†

2584-2198/

128/14.3†

- - -

PaLCuV

Rhynchosia

capitata/2007/

Mianwali

FM955601/

MI69/ 2754

148-504/

118/ 13.75

308-1078/

256/ 29.68

973-722/

83/ 9.46

1479-1075/

134/ 15.68

1624-1220/

134/ 15.16

2612-1527/

361/ 40.43

2584-2198/

128/ 14.31 - - -

68

Table 3.1 continued

69

Footnote to Table 1.

* These clones were obtained by PCR. All other clones were obtained by RCA.

▲For clones with mutations of genes, the data given in the table is for a corrected sequence.

† Insertion of a G at position 1272 and A at position 2395 leading to a truncation of the TrAP and

REn genes, as well as a frame-shift fusing the N-terminal sequences of C4 with Rep.

‡ Truncation of the Rep gene due to deletion of C at position 2052 leading to a frame-shift and

premature stop codon at position 2017.

§ Truncation of the REn gene due to a transition (T to C in the virion-strand) at position 1428 leading

to a premature stop codon.

ǁ Truncation of the CP gene due to a transition (G to A) at position 469 leading to a premature stop

codon.

¶ Truncation of the CP gene due to insertion of a T at position 927 leading to a frame-shift and

premature stop codon at position 934. This also introduces a premature stop codon in the AC5 gene.

Δ Truncation of the CP gene due to a transition (G to A) at position 450 leading to a premature stop

codon.

◊ Truncation of the MP gene due to a transition (G to A) at position 1857 leading to a premature stop

codon.

70

Table 3.2 Percent nucleotide sequence identity for pair wise sequence comparisons of the sequences of the genomes (or DNA-A components) of viruses isolated in this

study and selected sequences from the databases.

MI76 A1 A1E A2 A4 A6 A6G A14 A17 A20 MI2 MI7 MI9 MI12 MI13 MI15 MI18 MI72 MI75 MI65 MI32 MI33 MI1 MI68 MI69 MYMIV MYMV KuMV HgYMV DoYMV CPGMV SbLCV PaLCuV PedLCV PepLCBDV (20)

* (10)

* (2)

* (5)

* (2)

* (2)

* (2)

*

*** 96.8 96.8 95.4 96.3 96.4 95.4 96.1 96.3 96.0 95.8 95.6 95.3 95.7 95.5 95.8 96.3 98.7 96.4 78.6 68.4 68.5 56.2 53.8 54.3 94.0-96.5 76.5-78.6 63.6 77.5 54.9-55.3 52.3 57.2 53.6-53.8 56.4 52.0-52.7 MI76

*** 100 96.1 97.5 97.5 96.0 97.1 97.5 97.3 95.7 95.6 95.3 95.8 95.6 95.8 97.3 97.3 97.5 79.4 68.1 68.2 56.3 54.0 54.4 94.3-97.7 77.3-79.2 63.7 77.6 55.0-55.2 52.6 57.0 53.9-54.2 56.6 52.3-53.1 A1

*** 96.1 97.5 97.5 96.0 97.0 97.5 97.2 95.7 95.5 95.3 95.7 95.5 95.8 97.3 97.2 97.5 79.4 68.1 68.2 56.2 54.0 54.4 94.3-97.6 77.3-79.2 63.6 77.6 54.9-55.2 52.6 57.6 53.8-53.9 56.5 52.3-53.1 A1E

*** 97.7 97.4 99.8 98.1 97.8 97.4 96.5 96.3 96.0 96.5 96.2 96.0 96.9 95.8 97.4 78.6 67.9 68.5 55.9 54.2 54.3 94.2-99.1 76.8-78.4 63.9 77.6 55.4-55.4 52.9 57.0 53.6-53.9 56.2 52.3-52.7 A2

*** 99.2 97.6 98.9 99.1 98.8 96.0 95.9 95.6 96.0 95.8 96.1 96.7 96.8 98.9 79.0 68.2 68.2 56.3 54.0 54.5 94.4-99.5 76.8-78.8 63.7 77.7 55.8-56.3 53.0 57.0 53.8-53.9 56.6 52.3-52.9 A4

*** 97.3 98.6 99.1 98.7 95.9 95.7 95.6 95.9 95.7 96.1 96.6 96.7 98.9 78.9 68.2 68.4 56.2 54.1 54.2 94.2-99.2 76.7-78.7 63.6 77.6 55.2-55.9 53.0 56.9 54.0 56.4 52.6-53.1 A6

*** 98.0 97.7 97.3 96.4 96.2 95.9 96.4 96.2 95.9 96.9 95.7 97.3 78.4 67.9 68.5 55.8 54.1 54.3 93.9-99.0 76.7-78.6 63.9 77.6 55.0-55.4 53.0 57.1 53.6-53.9 56.1-56.2 52.3-52.6 A6G

*** 98.6 98.4 96.4 96.3 96.0 96.4 96.2 96.1 97.3 96.5 98.5 79.0 67.9 68.0 56.4 54.3 54.7 94.1-99.0 77.0-78.8 63.5 77.7 55.5-56.0 52.9 57.5 54.1-54.2 56.6-56.8 52.4-53.1 A14

*** 98.9 96.0 95.8 95.6 96.0 95.7 96.1 96.7 96.7 99.0 78.8 68.1 68.2 56.2 54.0 54.2 94.2-99.2 76.7-78.7 63.4 77.5 55.5-55.9 53.0 56.8 53.9-54.1 56.4-56.5 52.4-53.0 A17

*** 95.5 95.4 95.1 95.5 95.3 95.7 96.4 96.4 98.7 78.5 67.7 67.8 55.7 53.6 53.8 93.8-98.8 76.7-78.4 63.2 77.4 55.3-55.8 53.0 56.6 53.5-54.0 56.0-56.2 52.1-52.8 A20

*** 99.3 99.0 99.5 99.2 98.3 96.6 96.1 95.8 79.0 68.6 68.8 56.7 54.2 54.4 94.3-99.5 77.2-78.9 63.9 78.6 55.1-55.6 53.3 57.9 53.9-54.3 56.6-56.9 52.5-53.1 MI2

*** 98.8 99.2 99.0 98.1 96.5 95.9 95.7 78.9 68.8 69.0 56.8 54.4 54.6 94.0-99.3 77.4-79.1 64.0 78.6 55.1-55.5 53.3 58.0 54.2-54.5 57.0-57.2 52.6-53.2 MI7

*** 98.9 98.7 97.7 96.2 95.6 95.4 78.6 68.7 68.9 56.5 54.2 54.7 93.8-99.1 76.9-78.7 63.6 78.6 55.3-55.6 53.3 57.9 54.0-54.6 56.6-56.9 52.4-52.8 MI9

*** 99.5 98.4 96.6 96.0 95.8 78.8 68.8 68.9 56.6 54.2 54.4 94.2-99.4 77.0-78.9 63.8 78.6 54.9-55.4 53.2 58.1 53.8-54.3 56.7-56.9 52.3-53.0 MI12

*** 98.2 96.4 95.8 95.6 78.2 68.6 68.8 56.2 54.3 54.5 94.5-99.2 77.0-78.3 63.8 78.5 54.7-55.2 51.9 57.5 53.9-54.3 56.6-56.7 52.4-52.9 MI13

*** 96.2 96.0 95.9 78.8 69.1 69.2 56.6 54.1 54.6 94.4-99.3 77.2-79.2 63.5 78.7 55.1-55.4 52.9 57.4 53.7-54.0 56.8-57.0 52.4-53.2 MI15

*** 96.7 96.6 78.8 68.3 68.4 56.9 54.6 54.9 94.8-97.5 76.9-78.7 64.0 77.7 54.9-55.4 52.9 57.5 54.1-54.6 57.0-57.2 52.5-53.2 MI18

*** 96.7 78.8 68.4 68.6 56.9 54.4 54.7 94.3-96.9 76.6-78.6 63.5 77.8 54.7-55.1 52.5 56.9 54.3-54.4 56.8-57.0 52.7-53.4 MI72

*** 78.9 68.4 68.6 56.2 54.0 54.2 94.1-99.0 76.8-78.8 63.5 77.7 55.4-55.8 53.1 57.2 53.9-54.3 56.3-56.4 52.3-52.9 MI75

*** 68.8 69.2 56.3 54.3 54.6 76.9-79.1 91.9-97.8 64.5 81.7 55.5-56.3 52.3 58.1 53.6-54.5 56.4-57.1 53.1-54.2 MI65

*** 99.8 58.4 56.3 56.4 66.7-69.0 67.8-69.1 64.6 68.1 56.6-57.4 51.2 59.2 55.2-55.4 58.0-58.8 54.5-56.1 MI32

*** 58.4 56.5 56.5 66.9-69.1 68.0-69.5 64.8 68.7 56.8-57.6 52.8 59.3 55.3-55.5 58.7-58.8 54.6-56.3 MI33

*** 88.7 87.5 55.2-57.0 55.7-57.1 57.7 56.7 48.8-54.3 57.3 72.8 79.4-84.9 88.9-92.6 77.0-78.8 MI1

*** 99.5 52.9-54.5 53.8-54.9 55.3 54.1 51.2-56.1 54.9 67.7 88.3-92.8 82.0-84.7 83.8-85.7 MI68

*** 53.3-54.8 54.3-55.3 55.8 54.0 50.9-56.4 55.6 68.1 88.7-93.2 82.5-83.8 84.1-86.1 MI69

*** 76.0-76.9 62.1 76.3 53.2-53.7 51.0 56.2 52.7-53.0 55.6-57.2 51.2-53.8 MYMIV (20)*

*** 63.1 76.9 54.6-54.9 52.6 57.6 53.2-53.4 55.9-57.5 52.6-55.8 MYMV (10)*

*** 78.2 55.0-55.4 53.4 57.4 53.6-53.8 56.9 54-54.8 KuMV

*** 55.8-56.3 53.1 57.1 53.9-54.0 57.2-57.3 53.8-55.5 HgYMV (2)*

*** 52.9 57.7 53.9-54.2 53.2-54.4 53.0-55.5 DoYMV (5)*

*** 58.3 54.1-54.6 57.4-58.0 55.3-55.8 CPGMV

*** 53.5-53.8 72.5-72.8 67.4-67.8 SbLCV

*** 78.7-82.5 83.0-85.1 PaLCuV (2)*

*** 76.8-78.3 PedLCV (2)*

*** PepLCBDV (2)*

71

*Figures in brackets indicate the numbers of isolates that were compared. Species for which more than one sequence was available the highest and lowest percentage identity is shown.

Table 3.3 Percent nucleotide sequence identity for pair wise sequence comparisons of the sequences of DNA-B component of viruses isolated in this study and selected

sequences from the databases.

MI77 B3 B4 B13 MI3 MI5 MI6 MI8 MI10 MI16 MI17 MI20 MI21 MI30 MI71 MI73 MI74 MI66 MI67 MI34 MI35 MYMIV MYMV KuMV HgYMV

(9)* (11)* (2)*

*** 93.1 91.7 91.7 91.6 91.9 91.9 92.3 91.8 95.0 94.8 91.6 91.9 93.3 98.1 98.6 92.3 62.0 61.8 47.0 47.3 78.1-93.1 59.7-83.9 44.8 59.7 MI77

*** 96.2 96.4 91.5 92.0 92.1 92.4 91.9 94.1 93.8 91.8 92.3 97.9 93.2 93.8 96.5 63.3 63.2 48.4 48.0 87.4-96.4 59.6-86.3 45.6 57.1 B3

*** 98.2 92.2 92.8 92.8 91.7 92.6 94.3 94.2 92.5 92.8 96.3 91.8 92.4 97.6 62.2 62.1 48.2 48.3 84.6-98.2 58.8-86.8 44.5 57.9 B4

*** 92.7 93.3 93.2 92.2 93.1 94.5 94.2 93.0 93.3 96.6 91.9 92.4 97.6 62.5 62.4 48.2 48.4 84.6-98.9 59.3-87.3 45.8 58.4 B13

*** 97.8 97.7 95.2 97.6 93.2 93.0 97.4 97.9 91.8 91.7 92.1 91.8 59.6 59.6 47.3 48.6 87.6-94.6 58.8-86.6 43.6 55.6 MI3

*** 99.6 96.3 99.5 93.8 93.5 98.5 98.9 92.5 91.8 92.2 92.4 61.3 61.3 47.6 47.2 84.2-95.1 59.1-86.5 45.0 58.6 MI5

*** 96.4 99.4 93.8 93.6 98.5 98.8 92.5 91.8 92.2 92.4 61.4 61.4 47.6 47.2 84.1-95.1 59.1-86.6 45.5 58.6 MI6

*** 96.2 92.6 92.1 96.0 96.5 92.9 92.4 92.8 91.5 63.2 62.0 47.0 46.7 86.5-93.8 60.3-85.5 44.4 58.1 MI8

*** 93.6 93.3 98.3 98.8 92.4 91.7 92.1 92.2 61.2 61.2 47.7 47.3 84.2-95.1 58.9-86.4 45.3 58.6 MI10

*** 98.2 93.3 94.0 94.1 95.2 95.6 94.8 62.4 62.3 47.3 47.1 84.3-95.0 59.4-87.4 44.8 57.6 MI16

*** 93.0 93.6 94.0 94.9 95.5 94.4 62.1 62.0 47.7 48.0 84.3-94.7 59.4-87.2 45.2 57.7 MI17

*** 98.6 92.2 91.7 92.1 92.3 61.3 61.3 47.7 47.3 83.9-95.0 59.3-86.8 45.7 58.3 MI20

*** 92.5 92.0 92.4 92.4 61.4 61.4 47.9 47.2 84.3-95.5 59.3-86.8 45.0 58.6 MI21

*** 93.4 93.9 96.6 63.3 63.2 48.9 47.7 87.6-96.6 59.7-86.4 45.9 59.7 MI30

*** 98.8 92.4 62.0 62.0 46.7 46.8 78.2-93.2 58.4-83.7 45.0 59.8 MI71

*** 92.9 62.2 63.7 47.0 47.1 84.2-93.7 60.2-84.6 45.3 59.9 MI73

*** 62.6 62.5 49.0 48.3 84.6-97.5 59.0-86.8 46.1 59.4 MI74

*** 99.9 47.0 46.1 57.1-63.0 58.4-87.5 46.1 60.4 MI66

*** 47.1 46.2 57.0-63.0 58.5-87.5 46.1 60.4 MI67

*** 97.0 47.1-49.2 45.3-49.4 48.4 49.6 MI34

*** 47.1-49.5 46.3-48.7 48.6 49.0 MI35

*** 54.0-90.9 43.9-46.0 55.1-60.2 MYMIV (9)*

*** 44.3-46.3 56.7-94.2 MYMV (11)*

*** 45.0 KuMV

*** HgYMV (2)*

*Figures in brackets indicate the numbers of isolates that were compared. Species for which more than one sequence was available the highest and lowest percentage identity is shown.

72

3.3.1 Mungbean yellow mosaic India virus

The genomic components of the MYMIV isolates cloned in this study range in

size from 2745 to 2751 nucleotides and 2660 to 2674 nucleotides for the DNA-A and

DNA-B, respectively. Like all other legume-infecting begomoviruses, MYMIV encodes

seven genes from DNA-A and two genes from DNA-B. A comparison of the nucleotide

sequences and predicted amino acid sequences of all encoded genes/proteins of MYMIV

showed that isolates from Pakistan have more conserved gene/protein sequences than

those of isolates from rest of the world. The Rep of geminiviruses contains conserved

motifs (Motif 1, Motif 2 and Motif 3) in the cleavage/ligation domain, Helix 1 and Helix

2 essential for DNA binding and cleavage (Orozco and Hanley-Bowdoin, 1998), Helix 4

involved in binding of Rep with pRBR and an oligomerization domain (Arguello-Astorga

et al., 2004). Similarly Zinc finger domains of the TrAP (Ruiz-Medrano et al., 1999) and

CP (Kirthi and Savithri, 2003) are involved in binding of these proteins to DNA. These

features were identified in the MYMIV isolates characterised here (results not shown).

Alignments of the intergenic region (IR) sequences of the DNA-A and DNA-B

components of the MYMIV isolates obtained here showed that the CR, the sequence

conserved between the DNA-A and DNA-B components, is approx. 126 nucleotides in

length and shows between 81 and 84.1% nucleotide sequence identity. The CR contains

the origin of replication, which consists of a conserved hairpin structure with the

nonanucleotide (TAATATTAC), a binding site for Rep (Argüello-Astorga et al., 1999)

consisting of five imperfect repeats of the motif (iterons) GGTGTA/C (four on the virion-

strand and one on the complementary-strand) and a TATA box that forms part of the Rep

promoter (Fig. 3.3).

An alignment of the predicted N-terminal amino acid sequences of the Rep

proteins of MYMIV isolates characterised here is shown in Fig. 3.4. This shows the

predicted iteron related domain (IRD; Argüello-Astorga et al., 2004), in common with

isolates of this species from the databases to be MPREGRFAIN. It is noticeable that,

although the IRD is highly conserved, sequences immediately downstream of the IRD

show considerable variability, adding weight to the idea that these sequences are

important. For none of the LYMVs have the predicted IRD or iteron sequences been

confirmed experimentally. All DNA-A isolated in this study had between 95.1% and

73

100% sequence identity among themselves and between 93.8% and 99.5% sequence

identity to MYMIV DNA-A sequences available in database (Table 3.2) whereas all

MYMIV DNA-B component sequences from this study had between 91.5% and 99.6%

sequence identity among themselves and between 90.7% and 98.9% to MYMIV DNA-B

sequences available in database (Table 3.3). However one DNA-B associated with

MYMIV, MYMIV-[IN:Ana:CpMBKA25:05](AY937196), was quite distinct and showed

a relatively low level of nucleotide sequence identity (83.8%-87.6%) with the other

DNA-B components of this species. Analysis of the aligned sequences of all MYMIV

DNA-A components for the presence of recombination using RDP identified some

intraspecific recombination events in the Rep, AV2 and CP regions of some isolates.

Although some potentially recombinant sequences were recognized for which no donor

parent could be identified, this could not be conclusively attributed to interspecific

recombination (results not shown).

A phylogenetic analysis based on an alignment of the DNA-A components of

MYMIV (Table 3.1) isolated in this study with DNA-A component (or the genome)

sequences of all legume-infecting begomoviruses from the Old World available in the

databases showed that these grouped with MYMIV sequences from India, Nepal and

Pakistan. The MYMIV DNA-As segregated into three groups, one small group (group

III) with three sequences and two large groups (group I and II). Sequences from Pakistan

were distributed between groups I and II (Fig. 3.5) and their segregation was associated

with their geographical origin. Isolates in group I (MI2, MI7, MI9, MI12, MI13, MI15)

originated from the north and north-eastern parts of the country (Islamabad, Narowal)

whereas isolates in group II (A1, A1E, A2, A4, A6, A6G, A14, A17, A20, MI18, MI72,

MI75, MI76) were distributed throughout the country (Multan, Layah, Nawabshah,

Hyderabad, Muzafargar, Faisalabad, Mianwali, Islamabad, Narowal; Fig. 3.5). Group I

also included sequences from Nepal and India (Srinagar, Jabalpur and New Delhi) and

group II also included sequences from India (Kanpur, Varanasi, New Delhi, Punjab).

Group III included one sequence from Bangladesh and two sequences from India.

A phylogenetic analysis based upon an alignment of the complete nucleotide

sequences DNA-B (Fig 3.6) components of MYMIV isolates from Pakistan with DNA-B

sequences available in databases gave results similar to that obtained with DNA-A. All

74

available sequences of DNA-B were distributed into one small group (group III; with one

sequence only) and two large groups (groups I and II). Group I contained sequences from

Islamabad (MI20, MI21) and Narowal (MI3, MI5, MI6, MI8, MI10) along with

sequences from India (Jabalpur and Akola). In group II sequences from Multan (MI71,

MI77), Layah (MI73), Nawabshah (MI16, MI17), Faisalabad (B3, B4), Muzafargar

(MI30), Mianwali (MI74) and Islamabad (B13) were distributed with sequences from

India (New Delhi, Srinagar and Varanasi). Group III included only a single sequence and

that was from India. Just like DNA-A, DNA-B sequences from Pakistan also had distinct

geographical distributions. Sequences in group I originated from the north and north-east

of the country, whereas sequences in group II were distributed throughout the country.

Phylogenetic analyses based on alignments of nucleotide and protein sequences of all

genes produced trees with essentially the same topology as that produced by the full-

length DNA-A and DNA-B sequences (results not shown).

Comparisons of the MYMIV sequences showed that for the most part the DNA-A

components in group I associated with DNA-B components of group I whereas group II

DNA-A components associated with group II DNA-B components. However, in a few

cases, group I DNA-A sequences associated with group II DNA-B sequences. No

instances of group II DNA-A sequences associating with group I DNA-B sequences were

detected. The geographic origin and their component groupings are indicated in Figure

3.7. It is evident that the A2/B2 class predominates across Pakistan whereas A1/B1

occurs in the north of the country. Both cases of A1/B2 occur in India (the DNA-A

components of MYMIV-[IN:ND:Sb2:99](AY049772) and MYMIV-

[IN:Sri:Mg1:96](AF416742) belong to group I but associate with DNA-B components

belonging to group II).

75

76

Fig. 3.3 Alignment of the intergenic regions of the DNA-A and DNA-B components of the MYMIV

isolates characterised in the present study and an isolate from the database (MYMIV-[IN:ND:Bg3:91]

DNA-A accession no. AF126406, DNA-B accession no. AF142440). Gaps (-) were introduced into the

sequences to optimise the alignment. Sequences conserved between the majority are surrounded by a black

box. Part of the alignment that does not form part of the common region (CR) is shaded grey. The positions

of the stem-loop structure (the two legs of which are highlighted in light green), which contains the loop

that includes the nonanucleotide sequence (TAATATTAC; highlighted in dark green), the TATA box of

the Rep promoter (highlighted in red) and the predicted iterons (indicated as F1, F2, F3 and F4 for the

virion-sense and R1 for the complementary-sense; highlighted in blue) are indicated. The nucleotide

coordinates for each sequence are indicated on the right.

Fig. 3.4 Alignment of the N-terminal amino acid sequences of the Rep proteins of MYMIV isolates

obtained in this study. The position of the predicted iteron related domain is highlighted in blue. The

sequence of MYMIV-[IN:ND:Bg3:91] (AF126406) is shown for comparison. Sequences conserved

between the isolates are boxed.

77

78

Fig. 3.5 Phylogenetic dendrogram (left) based upon an alignment of the complete nucleotide sequences of

the DNA-A components of legume-infecting begomoviruses from the Old World. Vertical branches are

arbitrary, horizontal branches are proportional to calculated mutation distances. Values at nodes indicate

percentage bootstrap values (1000 replicates). Begomovirus species used for comparison were Mungbean

yellow mosaic virus (MYMV), Mungbean yellow mosaic India virus (MYMIV), Dolichos yellow mosaic

virus (DoYMV), Horsegram yellow mosaic virus (HgYMV), Kudzu mosaic virus (KuMV), Cowpea golden

mosaic virus (CPGMV) and Soybean leaf crinkle virus (SbCLV). This tree was arbitrarily rooted on the

sequence of the DNA-A component of Tomato leaf curl New Delhi virus (ToLCNDV). The virus acronyms

used are as described in Fauquet et al. (2008). The database accession numbers are indicated and the

sequences produced as part of this study are highlighted. The groups of sequences labelled I, II and III are

discussed in the text. The distribution of all MYMIV isolates is shown on a map of southern Asia (right).

MYMIV isolates in each of the three phylogenetic groups are indicated on the map by coloured circles.

79

80

Fig. 3.6 Phylogenetic dendrograms (left) based upon complete nucleotide sequences of DNA-B of legume-

infecting begomoviruses from Old World. Vertical branches are arbitrary, horizontal branches are

proportional to calculated mutation distances. Values at nodes indicate percentage bootstrap values (1000

replicates). Begomovirus sequences used for comparison were Mungbean yellow mosaic virus (MYMV),

Mungbean yellow mosaic India virus (MYMIV), Horsegram yellow mosaic virus (HgYMV) and Kudzu

mosaic virus (KuMV). The tree was arbitrarily rooted on the sequences of Tomato leaf curl New Delhi

virus (ToLCNDV) DNA-B. The database accession numbers are indicated, and the clone names of viruses

isolated from Pakistan are highlighted by black boxes. The distribution of all MYMIV isolates is shown on

a map of southern Asia (right). MYMIV isolates in each of the three phylogenetic groups are indicated on

the map by coloured circles.

Fig. 3.7 Distribution of MYMIV with DNA-A and DNA-B belong to group to group I (A1/B1; indicated by

brown colour), group II (A2/B2; indicated by orange colour) and MYMIV with DN-A belongs to group I

and DNA-B belongs to group II (A1/B2; indicated by green colour) in Indian sub-continent. The plant

species which each isolate was obtained from is indicated.

81

3.3.2 Mungbean yellow mosaic virus

DNA-A and DNA-B components of MYMV with genome size 2737 nt. and 2676

nt. respectively, like many of the other begomoviruses, encodes eight genes (six on DNA-

A and two on DNA-B). Detailed sequence analysis found the usual conserved sequence

motifs in proteins encoded by MYMV (as described in section 3.2.1). Multiple

alignments of the IR between DNA-A and DNA-B components of MYMV showed that

the CR is 134 nucleotides long with 78.4% identity and contains the conserved

geminivirus stem-loop structure, the TATA box forming part of the Rep promoter and

three predicted iterons (ATC/TGGTG) upstream of the TATA box. It is noticeable that

sequences between the aforementioned motifs shows a higher levels of variability (a

larger number of sequence changes) than there are in the motifs, suggesting that these

predicted features are important for virus function and thus conserved (Fig. 3.8). The

DNA-B sequence of the isolate characterised here shares a large sequence insertion (18

nt. between coordinates 2632 and 2651 of the alignment) with a MYMV from India

([IN:Vam:VigKA27](AF262064)) and three others forming a distinct cluster in the

phylogenetic tree (Fig. 3.6) , as discussed later. Comparison of the predicted N-terminal

amino acid sequences of the Rep of MYMV isolates shows the predicted IRD to be

MPRQGRFAIN (Fig. 3.9) based upon the work of Argüello-Astorga et al. (2004) .

Recombination analysis using RDP identified no evidence for recombination in any

isolate of this species.

Phylogenetic analysis based on an alignment of the DNA-A component sequence

of MYMV (MI65) with DNA-A sequences of other legume-infecting begomoviruses

from the Old World showed that the cluster containing sequences of MYMV segregate

into two groups (Fig 3.5). One large group consists of the sequences of viruses from

India, Thailand and Cambodia. However, the sequences of MYMV from Thailand and

Cambodia, which are geographically far removed from the other isolates, are distinct

from those originating from India and Pakistan. The smaller group consists of two

sequences from Pakistan (including MI65) and one from India (Fig. 3.5). It is important

to note that the one MYMV isolate segregating with Pakistani isolates (MYMIV-

[IN:Har:01] AY271896) originates from Haryana state (India) which is geographically

82

close to the border with Pakistan and may thus explain the close relationship between

these two isolates.

A phylogenetic analysis based on an alignment of the sequences of the DNA-B

components of MYMV obtained in this study (MI66 and MI67) with the DNA-B

component sequences of all legume-infecting begomoviruses from the Old World showed

that, with the exception of MYMV-[IN:Mad:Sb](AJ867554) (which instead segregated

with the DNA-B of HgYMV), they formed two distinct clusters. One cluster, containing

all sequences from India, was more closely related, and basal, to the DNA-B components

of MYMIV. These DNA-B components likely are the result of pseudo-recombination

(MYMV isolates that have captured MYMIV DNA-Bs). The second cluster, which likely

represents the cognate DNA-B of MYMV, consists of isolates from India and Thailand,

as well as the MYMV DNA-B components identified in this study (MI66 and MI67). The

CRs of all these “cognate” MYMV DNA-B isolates have the insertion (as mentioned

earlier), with respect to the isolates of MYMV DNA-B that are more similar to the DNA-

Bs of MYMIV (results not shown). These newly identified DNA-B components are

distinct from, and basal to, all other MYMV DNA-B components (Fig. 3.6). These two

sequences represent the most westerly examples so far identified and it is likely that they

have diverged from the other MYMV DNA-B components due to the large geographic

distances between them. Nevertheless, despite the geographic distances and the time

between isolation of these DNA-B components (the first LYMV identified was a MYMV

isolate from Thailand that was cloned prior to 1993; Morinaga, Ikegami and Miura, 1993)

their sequences remained clearly related.

83

Fig. 3.8 Alignment of the intergenic regions of DNA-A (MI65, MYMV-[TH:Mg2] AB017341 and MYMV-[IN:Mah:Sb:99] AF314530) and DNA-B (MI66, MYMV-[IN:Vam:VigKA27] AF262064 and MYMV-[IN:Vig] AJ132574) components of MYMV characterized in this study and obtained from the NCBI

database. Gaps (-) were introduced into the sequences to optimize the alignment. Conserved sequences in the alignment are surrounded by black box. Part of the

alignment that is not included in the CR is shaded grey. Position of stem (highlighted in light green) and loop with nonanucleotide (highlighted in dark green),

TATA box of the Rep promoter (highlighted in red) and iterons (F1, F2 and F3; highlighted in blue) are indicated. The nucleotide coordinates for each sequence

are given.

84

Fig. 3.9 The N-terminal amino acid sequence of the Rep protein of MYMV isolated from Rhynchosia

capitata (MI65) is aligned with that of selected MYMV isolates from the databases (MYMV-

[TH:Mg2](AB017341), MYMV-[IN:Mah:Sb:99](AF314530) and MYMV-[IN:Vig](AJ132575)) for

comparison. The position of the predicted iteron related domain is highlighted in blue.

3.3.3 Rhynchosia yellow mosaic virus

Four clones (MI32-MI35) were determined to be 2741, 2740, 2643 and 2639 nt.

in length and like other legume-infecting begomoviruses DNA-A encodes seven genes

whereas DNA-B encodes two genes. Detailed analysis of the nucleotide sequences of

DNA-A and DNA-B showed that the CR (57.1-59.0%), TrAP (65.9-70.2%) and NSP

(52.2-55.1%) of RhYMV have the highest sequences identities to those of MYMIV.

Whereas the Rep (73.2-75.6%), AV2 (53.7-66.4) and AC4 (82.7-84.0%) are more closely

related to those of MYMV and the CP (75.8%), AC5 (75.5) and MP (69.9%) have

highest sequence similarity with those of HgYMV. The REn of RhYMV is most closely

related to that of KuMV (70.6% nucleotide sequence identity). RhYMV encodes

relatively larger AC5 gene with the capacity to encode a predicted 138 amino acid protein

with a predicted molecular weight of and 15.8kDa (Table 3.1). Proteins encoded by

RhYMV contain all the conserved sequences usually found in geminiviruses (as

described in section 3.2.1). Alignments of IR of DNA-A and DNA-B showed that the CR

shared between the components is 125 nucleotides long with 80.8% to 87.2% identity.

Along with stem-loop structure and TATA box of the Rep promoter, there are three

iterated elements (ATC/TGG). Comparison of CR of RhYMV with that of other legume-

infecting begomoviruses showed arrangement and sequences of iterons is distinct from

the other LYMVs (Fig. 3.10). Comparison of N-terminal part of Rep mapped the IRD to

be MPRQGRFAIN which is distinct from the predicted IRDs of all other legume-

infecting begomoviruses (Fig. 3.11).

85

Phylogenetic analysis based on sequences of DNA-A (MI32 and MI33) and DNA-

B (MI34 and MI35) of RhYMV with other legume-infecting begomoviruses from the Old

World showed that this virus is very distinct, segregating between KuMV and (being

basal to) the southern Asian LYMVs (Fig. 3.5 and 3.6). RhYMV is thus the most distinct

of the southern Asian LYMVs. Comparison of sequences of DNA-A and DNA-B of

RhYMV with those of other legume-infecting begomoviruses showed that the most

closely related viruses, MYMV, MYMIV, HgYMV and KuMV have less than 70%

nucleotide sequence identity (Table 2.2 and 2.3), consistent with it being a distinct

begomovirus species.

86

Fig. 3.10 An alignment of the sequences of the common regions of the DNA-A and DNA-B component sequences that are representative of the LYMV species

DoYMV, HgYMV, KuMV, MYMIV and MYMV in comparison to RhYMV. No sequence of the DNA-B of DoYMV has yet been deposited in the databases. In

each case the predicted iterons (as indicated in the colour key), predicted stem-loop structure with nonanucleotide sequence (light green and dark green) and

TATA box (red) of the Rep promoter are highlighted. The nucleotide coordinates for each sequence are indicated on the right.

87

Fig. 3.11 Comparison of N-terminal amino acid sequence of the Rep proteins of RhYMV isolate obtained

in this study with that of MYMIV-[IN:ND:Bg3:91] AF126406, MYMV-[TH:Mg2] AB017341, KuMV-

[VN:Hoa:05] DQ641690, HgYMV-[IN:Coi] AJ627904 and DoYMV-[IN:Ban:04] AM157412. The

position of the predicted iteron related domains are highlighted for each virus.

3.3.4 Pseudo-recombination in legume-infecting begomoviruses

Comparison of phylogenetic trees of the DNA-A and DNA-B components of

LYMVs showed that there is extensive evidence of pseudo-recombination for these

legume-infecting begomoviruses. In Fig. 3.12 lines are used to join cognate DNA-A and

DNA-B sequences. Lines that cross are indicative of possible pseudo-recombination

events. Thus the association of the DNA-Bs of MYMV-[IN:Mad:Sb](AJ867545),

MYMIV-[IN:ND:Bg:91](AF142440), MYMIV-[IN:Sri:Mg1:96](AF416741), MYMIV-

[IN:ND:Sb2:99](AY049771) with their cognate DNA-As are likely examples of pseudo-

recombination. Similarly among MYMIV isolates from Pakistan characterised as part of

the present study, the association of the DNA-B components B3, B4, B13 and MI10 with

the DNA-A components A17, A6, A4 and MI9, respectively, are possible examples of

pseudo-recombinations.

88

Fig. 3.12 Comparison of the phylogenetic trees of the DNA-A (left) and DNA-B (right) of LYMVs. Cognate DNA-A and DNA-B components are joined by

lines and crossing over indicates likely pseudo-recombination. The trees were arbitrarily rooted on the sequences of the DNA-A and DNA-B components of Tomato leaf curl New Delhi virus, respectively. Numbers at nodes indicate bootstrap confidence scores (1000 replicates).

89

3.3.5 Non-legume viruses and betasatellite

The DNA sequence of PedLCV was shown to be 2760 nucleotides in size and in

common with other Old World begomoviruses, its genome encodes six genes (two on

virion-sense strand and four on complementary-sense strand). Comparison of the IR

sequence of PedLCV with that of other isolates of the species showed that it has a stem-

loop structure (with a nonanucleotide TAATATTAC) and TATA box like other

begomoviruses. There are four iterons (ATC/TGGT) which are different in sequence and

position from those of the reported PedLCV isolates (Fig. 3.13). Comparison of N-

terminal part of the Rep of PedLCV mapped IRD to be KRFQIY (Fig. 3.14), which is the

same as isolate PedLCV-[PK:RYK1:04](DQ116884) but differs from isolate PedLCV-

[PK:Mul:04](AM712436). In view of the strictly maintained interaction between a Rep

and its cognate binding sequence (Argüello-Astorga et al., 2004), these differences may

indicate that these PedLCV isolates have distinct origins or have at some point

recombined to gain distinct Rep/iteron motifs.

The PaLCuV isolate obtained here was shown to have a genome consisting of 2754

nucleotides which encodes six genes (two on virion-sense strand and four on

complementary-sense strand) like other Old World begomoviruses. An alignment of IR

of PaLCuV with that of other isolates of the species has shown a stem-loop structure with

a nonanucleotide (TAATATTAC), Rep promoter-associated TATA box in common with

the other isolates and four iterons (GGGGAC) identical in sequence and position to those

identified in the other isolates of this species (Fig. 3.13). An alignment of N-terminal part

of the Rep of PaLCuV mapped the predicted IRD to be NSFCIN (Fig. 3.14), having a

single amino acid change with respect to the other isolates.

The two clones of TbLCB obtained from a single soybean sample obtained in this

study are each 1344 nucleotides in length and, in common with all previously

characterised betasatellites, have a single ORF conserved in sequence and position (βC1),

an A-rich sequence, a stem-loop structure with similarity to the origin of replication of

geminiviruses and a sequence conserved between all betasatellites (the SCR). Both

sequences of TbLCB (MI22 and MI23) were submitted to the databases and are available

under accession numbers AM922485 and FM955608, respectively.

90

Fig. 3.13 Alignment of the intergenic regions in genome of Pedilanthus leaf curl virus (MI1, PedLCV-[PK:RYK1:04] DQ116884, PedLCV-[ PK:Mul:04]

AM712436) and Papaya leaf curl virus (MI69, PaLCuV-PK[PK:Cot:02] AJ436992, PaLCuV IN[IN:Luc] Y15934) characterized in this study and isolates from

the database. Gaps (-) were introduced into the sequences for optimization of the alignment. Conserved sequences in the alignment are black boxed. Position of

stem (highlighted in light green) and loop with nonanucleotide (highlighted in dark green), TATA box of the Rep promoter (highlighted in red) and iterons

(highlighted in brown for PedLCV and in blue for PaLCuV) are indicated. The nucleotide coordinates for each sequence are given.

91

Fig. 3.14 Alignment of the N-terminal amino acid sequences of the Rep proteins of PedLCV and PaLCuV

isolates obtained in this study. The position of the predicted iteron related domain is highlighted in brown

for PedLCV and in blue for PaLCuV. The sequences of PedLCV-[PK:RYK1:04] DQ116884, PedLCV-

[PK:Mul:04] AM712436, PaLCuV-IN[IN:Luc] Y15934 and PaLCuV-PK[PK:Cot:02] AJ436992 are shown

for comparison. Sequences conserved between the isolates are boxed.

Phylogenetic analysis based on an alignment of the complete nucleotide

sequences of PedLCV and PaLCuV with selected monopartite begomoviruses showed

that both viruses were grouped in same cluster along with Cotton leaf curl Multan virus

(CLCuMV), Chilli leaf curl virus (ChiLCV), Pepper leaf curl Bangladesh virus

(PepLCBDV) and Euphorbia leaf curl virus (EuLCV). PedLCV was most closely related

to EuLCV, whereas PaLCuV was more closely related to PepLCBDV (Fig. 3.15).

Phylogenetic analysis of TbLCB (MI22 and MI23) with other betasatellites showed

that this betasatellite species is most closely related to and clusters with Papaya leaf curl

betasatellite and Chilli leaf curl betasatellite, although it is basal to these (Fig. 3.16).

However, in all respects it is a typical betasatellite.

92

93

Fig. 3.15 Phylogenetic dendrogram based upon alignments of complete nucleotide sequences of

Pedilanthus leaf curl virus (PedLCV-MI1) and Papaya leaf curl virus (PaLCV-MI68 and MI69) from

Pakistan and selected monopartite viruses from NCBI database. Vertical distances are arbitrary. Horizontal

distances are proportional to genetic distances (see scale bar). The number at nodes refer to number of

times (in percentages) in which the branching was supported. Monopartite virus sequences used for

comparison were Ageratum yellow vein virus (AYVV), Chilli leaf curl virus (ChiLCV), Cotton leaf curl

Gezira virus (CLCuGV), Cotton leaf curl Kokhran virus (CLCuKV), Cotton leaf curl Multan virus

(CLCuMV), Euphorbia leaf curl virus (EuLCV), Papaya leaf curl virus (PaLCuV), Papaya leaf curl China

virus (PaLCuCNV), Papaya leaf curl Guangdong virus (PaLCuGuV), Pepper leaf curl Bangladesh virus

(PepLCBDV), Tomato leaf curl Bangladesh virus (ToLCBDV), Tomato leaf curl China virus (ToLCCNV),

Tomato leaf curl Gujrat virus (ToLCGV), Tomato leaf curl Bangalore virus (ToLCBV), Tomato leaf curl

Karnatka virus (ToLCKV), PedLCV and Tomato leaf curl Philippines virus (ToLCPV). The tree was

arbitrary rooted on the sequence of Maize streak virus. The database accession numbers are indicated and

the viruses isolated from Pakistan are highlighted.

94

95

Fig.3.16 Phylogenetic dendrograms based upon alignments of complete nucleotide sequences of TbLCB

from soybean and selected betasatellites from NCBI database. Vertical distances are arbitrary. Horizontal

distances are proportional to calculated mutation distances. The numbers at nodes refer to number of times

(in percentages) in which the branch was supported in bootstrapping (1000 replicates). Betasatellites

sequences used for comparison were Ageratum yellow vein betasatellite (AYVB), Ageratum yellow vein

Sri Lanka betasatellite (AYVSLB), Ageratum yellow leaf curl betasatellite (AYLCB), Alternanthera

yellow vein betasatellite (AIYVB), Bean leaf curl China betasatellite (BLCCNB), Chilli leaf curl

betasatellite (ChLCB), Croton yellow vein mosaic betasatellite (CroYVMB), Cotton leaf curl Gezira

betasatellite (CLCuGB), Cotton leaf curl Multan betasatellite (CLCuMB), Erectites yellow mosaic

betasatellite (ErYMB), Eupatorium yellow vein betasatellite (EpYVB), Honeysuckle yellow vein Kobe

betasatellite (HYVKB), Honeysuckle yellow vein betasatellite (HYVB), Honeysuckle yellow vein mosaic

betasatellite (HYVMB), Honeysuckle yellow vein Nara betasatellite (HYVNB), Honeysuckle yellow vein

Japan betasatellite (HYVJB), Kenaf leaf curl betasatellite (KLCuB), Ludwigia leaf distortion betasatellite

(LuLDB), Malvastrum leaf curl betasatellite (MaLCuB), Malvastrum yellow vein Yunnan betasatellite

(MaYVYnB), Mesta yellow mosaic betasatellite (MeYMB), Okra leaf curl betasatellite (OLCuB), Papaya

leaf curl betasatellite (PaLCuB), Sida leaf curl betasatellite (SiLCuB), Siegesbeckia yellow vein

betasatellite (SibYVB), Sida yellow vein mosaic China betasatellite (SiYMCNB), Tobacco curly shoot

betastellite (TbCSB), Tobacco leaf curl betasatellite (TbLCB), Tomato leaf curl China betasatellite

(ToLCCNB), Tomato leaf curl Bangladesh betasatellite (ToLCBDB) and Tomato leaf curl Bangalore

betasatellite (ToLCBB). The betasatellites tree was arbitrary rooted on the sequence of alphasatellite

(AJ132344). The database accession numbers are indicated and the betasatellites isolated from soybean

(MI22 and MI23) are highlighted.

96

3.4 Discussion

The study presented here shows that MYMIV is the most prevalent pathogen

responsible for yellow mosaic disease of legumes across Pakistan and is the only

pathogen of leguminous crops. Nevertheless, at least two other LYMVs were identified

as occurring in the country, MYMV and the newly identified RhYMV. The identification

of a new, previously unrecognised species indicates that the diversity of this unusual

group of pathogens may be greater than we presently realise. This virus is the first of the

LYMVs identified in and isolated from a weed. All previous LYMVs have been

identified in crop species and no effort has been made to systematically screen

leguminous weeds and ornamental for their presence. It would seem likely that previous

efforts at identifying such viruses have selected only for the most common viruses and

those that affect crops. In view of the importance of these viruses to agriculture in

southern Asia, a greater effort to establish the actual diversity within this interesting

group of viruses is desirable.

MYMV is an important pathogen of crops in India but does not seem to be a

significant pathogen in Pakistan, having only been identified in a weed in the present

study. The reason for this anomaly is unclear. A single sequence of only a DNA-A

component of MYMV originating from Pakistan has previously been deposited with the

databases (acc no. AY269991). This was isolated from an experimental plot of soybean

being grown at a research institute in Islamabad. Soybean is not native to this region and

is postulated to have its origins in northern Asia (China) (Wang, 1985). It is thus possible

that soybean does not have a long association with the LYMVs and has thus not evolved

any resistance against them. Certainly reports from India indicate that wherever soybean

is grown it suffers from infection by LYMVs and there has been the suggestion that

soybean cultivation exacerbates LYMV problems in other legume crops (Usharani et al.,

2005). If this is the case, it suggests that LYMVs are host adapted and that the MYMV

“strain” present in Pakistan is not well adapted to the legume crops being cultivated in

this country. However, the presence of MYMV in the country and its potential to be able

to infect soybean do not bode well for soybean cultivation in Pakistan. Although soybean

is not presently cultivated in Pakistan, there are pilot studies underway looking at the

possibility of doing so.

97

The phylogeographic analysis indicates that MYMIV in Pakistan segregates into

two types. A2/B2 type is occurring across the country and the A1/B1 type occurring only

in the north of the country. The reason for this is unclear. Pakistan is the western most

country in which LYMVs have been identified. It is likely that the desert and

mountainous regions between Pakistan and its neighbours to the west (Iran and

Afghanistan) and north (China) provide a barrier to the further dissemination of these

viruses, at least so far; these viruses are exclusively vector transmitted and the vector, B.

tabaci, does not survive well in either dry or high altitude (with cold nights and winters)

regions. Intensive agriculture is a relatively new phenomenon in southern Asia (within

the last 50 years) in response to ever increasing population density (Atapattu and

Kodituwakku, 2009). The problems associated with LYMVs are thus a relatively recent

phenomenon; certainly MYMV was first reported as recently as 1993 (Morinaga et al.,

1993). Whether LYMVs were present in Pakistan prior to this is unclear. However, the

distribution of MYMIV types is consistent with the virus spreading into Pakistan from

India. During the summer months, the period when LYMVs are a problem in crops, there

is a constant wind, known as Deccan, that blows from the south-west to the north east

across the country. Since these viruses are only vector transmitted, any virus introduced

into Pakistan would thus spread northwards very quickly but less quickly westwards. A

virus introduced in the north would move southwards only very slowly. With this in mind

it would thus seem likely that the A2/B2 type, which occurs across the country, may have

been introduced in the south and have spread across the country from there. The more

limited distribution of the A1/B1 type can possibly be explained by this having

immigrated into Pakistan from India further north, where the summer winds restrict its

southward spread. Unfortunately the limited number of sequences available from India,

and particularly from states adjoining Pakistan, means that the evidence supporting this

hypothesis is limited. Nevertheless, the available evidence supports this hypothesis for

the present distribution of MYMIV in Pakistan. One further factor that may play a part is

that the area surrounding the border between Pakistan and India is cotton country. In the

summer months the predominant crop is cotton. Thus really only in the far south and the

far north are any other crops, including legumes, grown in any abundance during the

period when the virus is mobile due to the vector being active and present in appreciable

98

numbers. This thus provides two corridors through which MYMIV could be introduced

from India into Pakistan. A southern and a northern corridor is consistent with the

hypothesis regarding the present distribution of MYMIV types.

The genetic basis for the MYMIV isolates forming three distinct groups in

phylogenetic analyses is unclear. A closer inspection of the DNA-A alignment used to

derive the dendrogram shows nucleotide changes to, for the most part, be randomly

distributed throughout the component. However, there were a slight higher number of

changes evident in the N-terminal end of the Rep gene and the IR, corresponding for

group II isolates to the region identified as possibly recombinant. To ascertain whether

the recombination might determine the groupings, separate trees were constructed from

the sequences that are apparently recombinant and the remainder of the sequences.

Although for most of the isolates the groupings remained the same, some isolates

changed groupings based on whether the recombinant region or the non-recombinant

region was used to derive the tree. This suggests that, although the recombinant sequence

may play a part in determining the three groups, other sequences also play a part. The

precise genetic basis for the three groups thus remains unclear. For the alignment based

on DNA-B sequences, sequence changes were randomly distributed throughout the

component and it was not possible to determine what the basis for the groupings are.

There was also no strong correlation between host and the three groupings of MYMIV

isolates. We can thus only speculate that, for the two groups of MYMIV isolates

identified in Pakistan, these likely represent “types” (they do not meet the criteria

necessary for description as strains as defined by Fauquet et al. [2008]) of MYMIV that

have diverged, possibly due to geographic isolation (southern and northern types).

Whether host adaptation had a part to play in this divergence is unclear. The group II type

was likely introduced into Pakistan from India in the south, from where it spread across

the country. In contrast, the group I type was introduced in the north and remain

geographically constrained due to environmental conditions. The isolation and

characterisation of more viruses, particularly on the Indian side of the border, will be

required to be able to determine whether this scenario is likely to be correct or not.

Pseudo-recombination is a form of “sexual” genetic exchange that is unique to

multipartite viruses. Recombination (including pseudo-recombination) is recognised as a

99

strong driving force in the evolution of geminiviruses (Rojas et al., 2005). It has likely

played a part in determining the taxonomic structure of the family Geminiviridae and is

leading to the appearance of new strains and species of geminiviruses (Fauquet et al.,

2003). Pseudo-recombination between and within species of LYMVs is well documented.

Probably the most prominent examples in this regard is MYMV-[IN:Mad:Sb](AJ421642)

which is associated with a HgYMV-like DNA-B (AJ867554) and a group of MYMV

isolates that associate with MYMIV-like DNA-B components (Figure 3.6). Of the

isolates characterised as part of the study presented here, there are further examples of

possible pseudo-recombination between MYMIV. IRDs study of these viruses shows that

MYMV and MYMIV are quite similar with each other and HgYMV is quite similar to

MYMV and MYMIV (Fig. 3.11) whereas study of CR revealed that iterons of these

viruses are poorly aligned (Fig 3.10) which shows flexibility is on the part of iterons.

Although putative recombination events between the DNA-A components of MYMIV

isolates was detected using software, no conclusive evidence of recombination between

MYMIV and non-leguminous begomoviruses was evident, although some putative

recombinant fragments were highlighted for which no donor parent could be identified.

These results are consistent with the earlier suggestion that these legume-infecting

begomoviruses are genetically isolated (Qazi et al., 2007).

There have been no previous reports of betasatellites that are adapted to legumes.

To date betasatellites have been shown (experimentally) only to associate with

monopartite viruses (Briddon et al., 2003; Chattopadhyay et al., 2008), although there is

one begomovirus which can be either bipartite or monopartite/betasatellite associated

(Blawid et al., 2008). Nevertheless, here TbLCB was identified in one soybean and an

earlier study identified CLCuMB in cowpea. The symptoms exhibited by the plants from

which the betasatellites were isolated, yellow mosaics, would seem to indicate that a

LYMV is the major symptom determinant in each case. However, in both cases the

symptoms suggested that the betasatellite was possibly responsible for enhancing

symptoms. In the case of cowpea the plant exhibited enations which are typical of

CLCuMB (Rouhibakhsh and Malathi, 2005). The plant identified in the present study

exhibited some leaf crumpling which is not typical of MYMIV infection and may thus be

due to the TbLCB. No previous work has addressed the interaction of betasatellites with

100

LYMVs and a study to address this lack of knowledge is presented in Chapter 5. Both the

betasatellites in question have been identified previously and are, as far has been

determined, adapted to species in the Malvaceae (CLCuMB is responsible, in

conjunction with several distinct monopartite begomoviruses, for cotton leaf curl disease

across Pakistan and northern India, the major biotic constraint to cotton production in

these areas; Mansoor et al., 2003) and to plants in the Solanaceae (TbLCB has previously

been identified only in tobacco originating from Pakistan; Briddon et al., 2003). In view

of the problems that begomovirus-betasatellite complexes cause in non-leguminous

crops, the identification of betasatellites in legumes is of grave concern.

As well as the LYMVs that were isolated in this study, two viruses, PedLCV and

PaLCuV, that would not be expected to be encountered in legumes (having not

previously been identified in legumes and having host ranges, as far as has been

determined, limited to plants in the family Solanacaea) were nevertheless isolated, There

have been previous reports of apparently non-legume infecting begomoviruses isolated

from legume crops (Raj et al., 2005; 2006a; 2006b; Reddy et al., 2005). In one case the

virus, Cotton leaf curl Kokhran virus, was actually reported as causing the disease (Raj et

al., 2006). However, in none of these cases was the aetiology of the disease investigated

using infectious clones and for each the symptoms were indicative of infection by

LYMVs. It is thus far more likely that these viruses are “passengers” that are maintained

in the respective legumes by one of the LYMVs (complementation). PedLCV was

identified in all eleven soybean samples tested whereas PaLCuV was present in one out

of eight Rhynchosia capitata samples which shows that both viruses are at different

levels of adaptations to legumes. Nevertheless, the presence of these viruses in legumes

means that there is scope for recombination and the possibility of more severe variants

arising. It would thus appear that the genetic isolation of the LYMVs is being breached.

Whether the lack of evidence for genetic interaction between leguminous and non-

leguminous begomoviruses indicates that these have not yet occurred, or have not yet

been identified (possibly due to the low number of isolates that have actually been

sequenced) or there are some constraints imposed by legumes that mean that recombinant

viruses are less fit, is unclear. Whatever is the case, the appearance of these viruses and

the betasatellites in legumes is a cause for concern and further studies should be initiated

101

to monitor the situation and give early warning of changes in virus populations. The

study presented here has set a base-line for identifying any possible future changes that

occur in Pakistan.

102

Chapter 4

Analysis of the infectivity of Legume yellow mosaic virus clones

4.1 Introduction

While working on infectious disorders in man and animals, Robert Koch

introduced the pure culture technique by using solid media. After having established

microscopically that the isolated bacteria were identical with those in the diseased

organs, he was able to reproduce the disease by introducing the isolated bacteria into a

healthy host. He then formulated the conditions a microorganism has to fulfil to be

regarded as a pathogen (now known as Koch’s Postulates; Bos, 1981). Geminiviridae

is the largest family of plant DNA viruses infecting a wide range of plant species. To

fulfil Koch’s Postulates for geminiviruses the pathogen is introduced into the host by

biolistic, Agrobacterium-mediated or mechanical methods.

The viruses that cause yellow mosaic disease of legumes are not sap

transmissible. For this reason the ability to identify their host ranges depends mainly

on the efficacy of transmission and the behaviour of whiteflies, which varies with host

genotypes, vector biotypes and growth conditions. In such cases, agroinoculation is

suggested as an alternative to introduce viral nucleic acids into plants. For

agroinoculation, the viral genome is subcloned into binary vectors in the form of

partial direct repeats in which the viral origin of replication is duplicated which is

believed to aid replicational release of unit length viral DNA upon inoculation

(Stenger et al., 1991). An advancement in the production of agroinfectious clones is

the amplification of viral DNA by RCA, partial digestion with a unique cutter enzyme

and cloning of dimers into binary vectors (Ferreira et al., 2008). Agrobacterium-

mediated inoculation of bipartite geminiviruses is normally done by mixing two

Agrobacterium cultures that independently harbour partial tandem repeats of the

DNA-A and DNA-B components. Jacob et al. (2001) reported that a method that

utilizes one strain of Agrobacterium that harbours DNA-A and DNA-B partial tandem

repeats on two compatible replicons can give infectivity up to 100%. There are some

reports of infectivity of legume-infecting begomoviruses, MYMV and MYMIV, to

legumes. An isolate of MYMV induced yellow mosaic disease of leaves in blackgram

by agroinoculation (Mandal et al., 1997). Similarly, a cowpea isolate of MYMIV with

a DNA-B more closely related to the components of MYMV, was readily infectious

103

to cowpea, mungbean, blackgram and Frenchbean by agroinoculation (John et al.,

2008).

The study of diversity of legume-infecting begomoviruses in Pakistan has

shown that MYMIV is the most prevalent pathogen causing yellow mosaic disease of

legume crops. MYMV and RhYMV, in contrast, appear only to be present in

leguminous weeds (Chapter 3). There are earlier reports of the isolation and

sequencing of MYMV (a single sequence submitted to NCBI databank) and MYMIV

(Hameed and Robinson, 2004) from Pakistan but so far no studies of the infectivity of

the cloned viruses have been conducted.

4.2 Methodology

A construct for the Agrobacterium-mediated inoculation of the DNA-A

component of MYMIV-[PK:Isl:Mg:07] (clone MI15) was produced by cloning an

approximately 1.8kb HindIII and BamHI fragment into the binary vector pBin19. This

pBin19 plasmid, with a fragment of the DNA-A clone containing the origin of

replication, was linearised with HindIII and treated with calf intestine alkaline

phosphatase (CIAP) to prevent self ligation and ligated with the full length DNA-A

component which was released from pBluescript II KS/SK (+) by restriction with

HindIII (Fig. 4.1a).

A partial direct repeat construct of the DNA-B of MYMIV-[PK:Isl:Mg:07]

(clone MI21) was produced by releasing an approximately 1.6 kb fragment with

BamHI and ClaI which was ligated into pBluescript II KS/SK (+). This fragment was

then released by digestion with BamHI and SalI and cloned in pBin19. This partial

clone of DNA-B in pBin19 was linearised with BamHI and the full-length DNA-B

insert, released with BamHI, ligated into this (Fig. 4.1b).

For the DNA-A component of MYMIV-[PK:Nsh:Sb:07] (clone MI18), a

partial direct repeat construct was produced by the same method described above for

the clone MI15. In this case the partial length fragment with the origin of replication

was approximately 1.1 kb in size and was released with EcoRI and BamHI and the

full-length DNA-A was inserted at the BamHI site (Fig. 4.2a). The construct for the

DNA-B component of MYMIV-[PK:Nsh:Sb:07] (clone MI17) was produced by

exactly the same procedure described above for the clone MI21 (Fig. 4.2b).

104

Fig. 4.1 Structures of the partial direct repeat constructs in pBin19 produced for the Agrobacterium-

mediated inoculation of MYMIV-[PK:Isl:Mg:07] DNA-A (clone MI15) (panel a) and DNA-B (clone

MI21) (panel b) . The positions of restriction endonuclease recognition sites used, the approximate

sizes of fragments, the origin of replication of each begomovirus component (hairpin structure) and the

left (LB) and right (RB) borders of the pBin19 T-DNA are indicated.

Fig. 4.2 Structures of the partial direct repeat constructs for the agroinoculation of MYMIV-

[PK:Nsh:Sb:07] DNA-A (clone MI18) (panel a) and DNA-B (clone MI17) (panel b) . The restriction

endonucleases used, the approximate sizes of fragments, the origin of replication of each begomovirus

component (hairpin structure) and the left (LB) and right (RB) borders of the pBin19 T-DNA are

shown.

105

A construct for the inoculation of DNA-A component of RhYMV-

[PK:Lah:Rh:07] (clone MI32) was produced by digesting this with XbaI and BamHI

to release an approximately 1.2 kb fragment with the origin of replication and ligating

into pBluescript II KS/SK (+). From pBluescript this fragment was moved into

pBin19 at SacI and HindIII restriction sites. This partial clone was then linearised

with BamHI, treated with CIAP, and ligated with the full-length DNA-A component

released with XbaI, recircularised by self ligation and digested with BamHI (Fig.

4.3a).

The construct for the DNA-B component of RhYMV-[PK:Lah:Rh:07] (clone

MI34) was produced by digestion with XbaI and HindIII, releasing an approximately

1.1 kb DNA fragment which was cloned in pBluescript II KS/SK (+). This was

digested with SacI and HindIII and the fragment was transferred into pBin19. The

pBin19 clone was then digested with HindIII and the full-length component of DNA-

B, released with XbaI, recircularised by self ligation and digested with HindIII, was

inserted (Fig. 4.3b).

Fig. 4.3 Structures of clones produced in the binary vector pBin19 for agroinoculation of RhYMV-

[PK:Lah:Rh:07] DNA-A (clone MI32) (panel a) and DNA-B (clone MI34) (panel b). Restriction

endonuclease sites used to produce the constructs, approximate sizes of fragments, the position of the

hairpin structure and the left (LB) and right borders (RB) of the T-DNA in the binary vector are

indicated.

106

Partial direct repeat constructs of MYMV-[PK:Kun:Rh:06] DNA-A (clone

MI65) and DNA-B (MI66) were produced essentially as described above for the clone

MI15. For clone MI65 the fragment was approx. 2.0 kb in size and was released with

EcoRI and HindIII and full length DNA-A was inserted at HindIII site (Fig. 4.4a) and

for MI66 the fragment was 1.2 kb in size and was released with SmaI and HindIII and

full length DNA-B was inserted at HindIII (Fig. 4.4b).

Fig. 4.4 Structures of the partial direct repeat constructs of the DNA-A (panel a) and DNA-B (panel b)

components of MYMV-[PK:Kun:Rh:06] which were produced in the binary vector pBin19 for

agroinoculation. The approximate sizes of fragments, restriction sites used for their cloning, the origin

of replication (hairpin structure) and the left (LB) and right (RB) borders of the T-DNA in the binary

vector are shown.

A partial direct repeat construct of PedLCV-[PK:Nsh:Sb:07] (clone MI1) was

produced by the same procedure described above for clone MI18 (Fig. 4.5a).

Similarly a construct of PaLCuV-[PK:Kun:Rh:06] (clone MI69) was produced by the

method describe above for the clone MI18, except that the fragment used was 1.2 kb

in length (Fig. 4.5b). For TbLCB-[PK:Nsh:Sb:07] (clone MI22) a construct for

agroinoculation was produced by digesting the full-length clone with XbaI and EcoRI

107

to release a fragment of ~1.28kb which was cloned in pBluescript II KS/SK (+). This

partial length fragment was moved into pBin19 at restriction sites SacI and EcoRI.

The partial length clone of TbLCB in pBin19 was restricted with EcoRI, treated with

CIAP and ligated with full length insert of MI22 released with EcoRI (Fig. 4.5c).

Fig. 4.5 Structures of the partial direct repeat constructs of PedLCV-[PK:Nsh:Sb:07] (clone MI1)

(panel a), PaLCuV-[PK:Kun:Rh:06] (clone MI69) (panel b) and TbLCB-[PK:Nsh:Sb:07] (clone MI22)

(panel c) in binary vector pBin19 for Agrobacterium-mediated inoculation. The approximate sizes of

fragments, restriction sites used for their cloning, hairpin structures and left (LB) and right (RB)

borders of T-DNA in the binary vector are indicated.

108

4.3 Results

4.3.1 Infectivity of Mungbean yellow mosaic India virus isolated from

mungbean

The DNA-A (MI15) and DNA-B (MI21) components of the mungbean isolate

of MYMIV-[ PK:Isl:Mg:07] were agroinoculated to mungbean (Vigna radiata

Wilczek) var. 96006, blackgram (Vigna mungo) var. Qandhari mash, soybean

(Glycine max Merr) var. Ig6, N. benthamiana and N. tabacum. Symptoms resembling

those observed in field-infected mungbean (Chapter 3, Fig. 3.2) were induced in

mungbean. The symptoms were evenly distributed, diffuse yellow mosaics on leaves

that appeared after three weeks which subsequently increased in size and fused with

each other giving a typical yellow mosaic appearance (Fig. 4.6a). In blackgram the

yellowing initially appeared along the midrib and veins (which was not observed in

the field-infected blackgram; Chapter 3, Fig. 3.2) after four weeks and subsequently

(50 days post-inoculation) leaves became completely yellow (Fig. 4.6b). In soybean

symptoms were like that of field-infected plants (Chapter 3, Fig. 3.2) which were

yellow spots that appeared on leaves approximately eight weeks after inoculation and

gradually became more intense (Fig. 4.6c). In mungbean, blackgram and soybean the

infectivity rate was 55%, 77% and 63% respectively (Tabel 4.1) and all symptomatic

plants tested were positive for the presence of both components of MYMIV by PCR

and Southern blot analysis (results not shown). No virus was detected in inoculated,

non-symptomatic plants or healthy, non-inoculated control plants by Southern blot

analysis or PCR.

In contrast to the legumes, inoculation of N. benthamiana resulted in

symptomless infections in 20% of plants (Table 4.1). Both the DNA-A and DNA-B

components of MYMIV could be detected by PCR but not by Southern hybridization

approx. 25 days after inoculation. In N. tabacum the virus was not infectious; neither

component could be detected in this species at 25 days post inoculation using

diagnostic PCR (Table 4.1).

4.3.2 Infectivity of Mungbean yellow mosaic India virus isolated from soybean

The partial repeat constructs of DNA-A (MI18) and DNA-B (MI17)

components of MYMIV-[ PK:Nsh:Sb:07] isolated from soybean were agroinoculated

to mungbean (var. 96006), blackgram (var. Qandhari mash), soybean (var. Ig6) and N.

benthamiana. All three legume species were susceptible to this virus isolate and

109

developed typical yellow mosaics on leaves similar to the symptoms produced in

legumes infected with MYMIV-Mg (Fig. 4.7a-c). However, the virus was less

infectious to blackgram (40% of plants infected) than to soybean (80% of plants

infected). This isolate of MYMIV was also less infectious to blackgram than the

MYMIV-Mg (which infected approx. 77% of plants) (Table 4.1). In blackgram

yellowing appeared along the midrib and veins on leaves after five weeks and

symptoms did increase in intensity, remaining relatively mild in comparison to those

induced by MYMIV-Mg. In soybean yellow spots appeared on leaves eight weeks

after inoculation which intensified gradually and, at ten weeks after inoculation,

leaves were completely yellow. In N. benthamiana the behaviour of the virus was

similar to the MYMIV-Mg. There were symptomless infections in 20% of plants

(Table 4.1) and both the DNA-A and DNA-B components of MYMIV could be

detected by PCR (results not shown).

4.3.3 Infectivity of Mungbean yellow mosaic virus

Agroinoculation of partial tandem repeat constructs of the DNA-A and DNA-

B components of MYMV-[PK:Kun:Rh:06] to blackgram (var. Qandhari mash)

produced mild infection with yellow mosaic symptoms on leaves (Fig. 4.7d) in 43%

of inoculated plants (Table 4.1). Symptoms appeared after three weeks and persisted

without further enhancement until senescence of the plants. In symptomatic plants the

presence of both viral components was confirmed by PCR diagnostics, whereas the

virus could not be detected in inoculated non-symptomatic plants. In N. benthamiana

the behaviour of this virus was similar to that of MYMIV; all inoculated plants were

non-symptomatic and both components of the virus were detected by PCR in

systemic, non-inoculated leaves in 17% of inoculated plants (Table 4.1).

4.3.4 Infectivity of Rhynchosia yellow mosaic virus

Partial dimeric clones of RhYMV-[PK:Lah:Rh:07] were agroinoculated to

mungbean (var. 96006), blackgram (var. Qandhari mash), soybean (var. Ig6 and FS-

85), mothbean and N. benthamiana. In soybean var. Ig6 the virus induced small

yellow spots on leaves (Fig. 4.7e) in 20% of plants (Table 4.1) three months after

inoculation and DNA-A and DNA-B components of the virus was detectable by PCR

whereas mock inoculated plants were negative for both components. Approximately

fifteen days after the appearance of symptoms, the plants recovered, newly emerging

110

leaves showed no symptoms and no virus could be detected by PCR. In a second

soybean var. FS-85 severe infection resulted which caused yellow mosaics with

necrosis on leaves (Fig. 4.7f) in 36% of inoculated plants after two months.

Interveinal necrotic spots appeared along with yellow mosaics on young, newly

emerging leaves and gradually increased in severity. The presence of the virus in

symptomatic plants was confirmed by PCR but no virus was detected in inoculated,

non-symptomatic plants. RhYMV was not infectious to N. benthamiana and, in

contrast to MYMIV and MYMV, this virus did not produce symptomless infection;

PCR-mediated detection was unable to show the presence of either component in

young, emerging leaves of inoculated plants. Similarly the clones of RhYMV were

not infectious to blackgram, mungbean, mothbean and N. tabacum.

111

Fig. 4.6 Symptoms exhibited by plants infected with Mungbean yellow mosaic India virus isolated from mungbean (MYMIV-[PK:Isl:Mg:07]).

Symptoms of MYMIV infection to mungbean (a) and soybean (c) were a foliar yellow mosaic whereas in blackgram yellowing appeared along

the veins (b) which subsequently spread to interveinal tissues. Mock inoculated mungbean (d), blackgram (e) and soybean (f) plants were

symptomless. The photographs of mungbean and blackgram were taken approx. 25 days post inoculation and the photographs of soybean were

taken approx. 60 days post inoculation.

112

Fig. 4.7 Symptoms exhibited by plants infected with Mungbean yellow mosaic India virus isolated

from soybean (MYMIV-[PK:Nsh:Sb:07]), Mungbean yellow mosaic virus isolated from Rhynchosia

capitata (MYMV-[PK:Kun:Rh:06]) and Rhynchosia yellow mosaic virus isolated form Rhynchosia

minima (RhYMV-[PK:Lah:Rh:07]). Infection of mungbean (a), blackgram (b) and soybean (c) with

MYMIV induced typical yellow mosaics of leaves. Infection of blackgram with MYMV induced mild

yellow mosaics and leaf puckering (d). RhYMV induced faint yellow spots on leaves of soybean line

Ig6 (e) and severe symptoms with cell death on leaves of soybean line FS-85 (f). The photographs of

mungbean and blackgram were taken approx. 30 days post inoculation and the photographs of soybean

were taken approx. 60 days post inoculation.

113

4.3.5 Infectivity of Pedilanthus leaf curl virus, Papaya leaf curl virus and

Tobacco leaf curl betasatellite

The PedLCV construct was agroinoculated to tomato (var. Nagina), N.

benthamiana, N. tabacum, blackgram (var. Qandhari mash) and soybean (var. Ig6). In

tomato the virus induced mild leaf curl (Fig. 4.8b) in 15 out of 17 plants (88%)

inoculated (Table 4.1), 30 days after inoculation. In N. benthamiana it induced cell

death at the inoculation site and severe upward leaf curling in emerging leaves (Fig.

4.8d) of all 18 inoculated plants (Table 4.1), approx. 20 days after inculcation. The

virus was not infectious to N. tabacum or any of the legumes that were inoculated. In

tomato and N. benthamiana the presence of the virus was confirmed by PCR and

Southern hybridization.

Co-inoculation of PedLCV with TbLCB to N. benthamiana induced severe

downward leaf curling, vein yellowing and vein thickening but no enations (Fig. 4.8e)

in infected plants after eighteen days. After 25 days infected plants were severely

deformed and stunted. 18 plants were agroinoculated in three independent

experiments and all plants were infected in each experiment (Table 4.1). PedLCV

with TbLCB was not infectious to N. tabacum (Table 4.1).

The partial direct repeat construct of Papaya leaf curl virus (PaLCuV) was

agroinoculated to nineteen N. benthamiana plants in three independent experiments.

After 25 days 17 out of 19 plants inoculated (89%) (Table 4.1) showed symptoms of

infection consisting of a mild leaf crumpling (Fig. 4.8f) which did not increase in

severity with time. All symptomatic plants were positive for the virus by PCR

detection whereas the presence of the virus could not be demonstrated in non-

symptomatic control plants.

114

Fig.4.8 Leaf of a mock inoculated tomato plant (a) and a tomato plant infected with PedLCV exhibiting

leaf curling, a severe reduction in leaf size and vein thickening (b). A mock inoculated N. benthamiana

plant (c) and N. benthamiana plants infected with PedLCV (showing upward leaf curling and vein

thickening; d), PedLCV and TbLCB (exhibiting severe downward leaf curling; e) and PaLCuV (with

very mild leaf crumpling; f). The photographs were taken approx. 25 days post inoculation.

115

Table 4.1 Infectivity of the cloned viruses and betasatellite obtained in this study.

Inoculum Plant species

Infectivity

(plants infected/plants inoculated)

Symptoms Experiment

Total I II III

MYMIV-Mg

mungbean 6/10 5/10 11/20 22/40 Yellow mosaics on

leaves

blackgram 7/10 8/10 8/10 23/30 Yellow mosaics on

leaves

soybean 6/10 7/10 6/10 19/30 Yellow mosaics on

leaves

N. benthamiana 2/10 3/10 1/10 6/30 No symptom

N. tabacum 0/10 0/10 0/10 0/30 No symptom

MYMIV-Sb

mungbean 10/20 11/20 12/20 33/60 Yellow mosaics on

leaves

blackgram 4/10 3/10 5/10 12/30 Yellow mosaics on

leaves

soybean 8/10 9/10 7/10 24/30 Yellow mosaics on

leaves

N. benthamiana 1/6 2/7 1/7 4/20 No symptom

RhYMV

mungbean 0/10 0/10 0/10 0/30 No symptom

blackgram 0/10 0/10 0/10 0/30 No symptom

N. benthamiana 0/6 0/6 0/5 0/17 No symptom

soybean (var.Ig6) 2/10 3/10 1/10 6/30 Very mild yellow

mosaics on leaves

soybean (var.FS-85) 4/10 2/10 5/10 11/30 Yellow mosaics with

cell death on leaves

mothbean 0/10 0/10 0/10 0/30 No symptom

MYMV blackgram 4/10 4/10 5/10 13/30

Yellow mosaics on

leaves

N. benthamiana 1/6 2/10 1/7 4/23 No symptom

PedLCV

N. benthamiana 6/6 6/6 6/6 18/18 Severe upward leaf

curling

N. tabacum 0/6 0/6 0/6 0/18 No symptom

tomato 5/6 6/7 4/4 15/17 Mild leaf curling

soybean 0/20 0/20 0/20 0/60 No symptom

blackgram 0/30 0/30 0/30 0/90 No symptom

PedLCV + TbLCB

N. benthamiana 6/6 6/6 6/6 18/18 Severe downward

leaf curling

N. tabacum 0/6 0/6 0/6 0/18 No symptom

PaLCuV N. benthamiana 4/5 6/6 7/8 17/19 Mild leaf crumpling

116

4.4 Discussion

Although MYMIV is reported to infect many legume crops, the results

obtained here show that isolates of this virus have different levels of adaptation to

different legume species. Out of the three plant species (mungbean, blackgram and

soybean) studied, MYMIV-Mg was highly infectious to blackgram but less infectious

to mungbean. In contrast, MYMIV-Sb was highly infectious to soybean and less

infectious to blackgram. There is no published data available in direct support of these

results but, in a related study, a blackgram isolate of MYMIV has been shown to

produce a mild leaf curl symptoms in cowpea plants whereas a cowpea isolate and a

soybean isolate of the same virus species produced typical golden mosaic symptoms

and greenish yellow mosaic along with mottling symptoms respectively in cowpea

(Surendranath et al., 2005). In another report MYMIV isolate from soybean was

shown to be similar to a cowpea isolate of MYMIV (MYMIV-[IN:ND:Cp7:98]) in its

ability to infect cowpea but differed from blackgram and mungbean isolates which do

not infect cowpea (Usharani et al., 2005).

LYMV isolates show distinct differences in host ranges and this has in most

cases been attributed to differences in the DNA-B components. Balaji et al. (2004)

studied the infectivity of a related virus, a blackgram isolate of MYMV (MYMV-

[IN:Vig]) with two different DNA-B components, MYMV-[IN:Vig](AJ132574) with

a CR 95% identical and MYMV-[IN:Vam:VigKA27](AF262064) with a CR 85.6%

identical to that of the DNA-A (MYMV-[IN:Vig](AJ132575)) component, in

mungbean and blackgram. Using the MYMV-[IN:Vig] DNA-B, the virus was highly

infectious to blackgram whereas in the presence of MYMV-[IN:Vam:VigKA27]

DNA-B it was highly infectious to mungbean. A similar situation may be the case for

the MYMIV isolates used in the study here. The DNA-B components of the

mungbean and soybean isolates have 93.6% identity and in the phylogenetic analysis

these DNA-Bs segregate in different clusters, cluster I for the mungbean isolate and

cluster II for the soybean isolate (Chapter 3, Fig. 3.7). This may suggest that the

distinct host adaptation of these isolates is determined by the DNA-B components.

However, to rule out any possible involvement of the DNA-A in host range

determination of MYMIV, the infectivity of both DNA-B components with either of

the DNA-A components (pseudo-recombination) should be tested.

MYMV is the major causal agent of yellow mosaic disease of legumes in

southern and western India (Usharani et al., 2004). From northern and central India as

117

well as from Pakistan there has been no report of the occurrence of this virus with the

exception of an early submission of a sequence of DNA-A of MYMV isolated from a

soybean sample collected from Islamabad (Pakistan). In the study conducted here,

MYMV was not identified in crops, only in the leguminous weed R. capitata.

Sequence analysis showed that DNA-B associated with MYMV isolated from R.

capitata was distinct (Chapter 3, Section 3.3.2) and infectivity analysis showed that

this isolate is not well adapted to blackgram; it induced mild infections with light

yellow mosaics on leaves by agroinoculation. This finding, together with the fact that

MYMV was not detected in crops, even though it was found in a weed associated

with crops, indicate that possibly the “strain” of MYMV present in Pakistan is not

adapted to the legume crops grown in the country. However, the fact that MYMV

causes losses to cultivated legumes elsewhere in southern Asia indicates that this virus

species has the capacity to adapt. The presence of well adapted MYMIV in the

country means that there is the possibility of interaction between the two species (by

recombination or pseudo-recombination) to yield a MYMV that is adapted to

cultivated crops. The identification of a MYMV in soybean in Pakistan in the past is

possibly an indication of such future problems. However, it would seem more likely

that this earlier identification of MYMV in a leguminous crop was due to the

cultivation of a susceptible species (soybean) rather than due to genetic changes in the

virus. Nevertheless, this possibility of MYMV becoming a problem in the future

should be examined in more detail experimentally.

In common with MYMV, RhYMV was not identified in legume crops in the

study presented here. Infectivity analyses showed that RhYMV was not infectious to

mungbean, blackgram and mothbean, suggesting that its host range is very limited.

However, in soybean line Ig6, very mild symptoms appear initially and the plants then

recovered from the infection, suggesting that this variety has a level of resistance to

this virus. In recovered plants, the virus could not be detected by PCR diagnostics. In

another soybean line (FS-85) the infection was severe with yellow mosaic and

necrosis on leaves and plants did not recover.

Although RhYMV has a host range that extends to soybean, this crop is not

grown by farmers in Pakistan, rather it is limited to small fields in research stations.

This may explain why RhYMV has not been identified previously and is not found in

crops. However, were soybeans to be grown on a large scale, the results show that this

virus could become a problem. Since both MYMV and MYMIV occurring in Pakistan

118

have the capacity to infect soybean, this would open the door to interaction between

these three viruses (during co-infection), possibly leading to (pseudo)recombination

and the possibility of better adapted virus evolving.

RhYMV was not able to infect N. benthamiana at all, whereas both MYMIV

and MYMV produced asymptomatic infection in a few plants. This lack of infectivity

or poor infectivity of LYMVs to N. benthamiana is unusual since virtually all dicot-

infecting geminiviruses are infectious to this host; it is the model host of choice for

infectivity studies with these, and many other, viruses (Goodin et al., 2008). For

begomoviruses originating from the Old World, no legume-infecting begomovirus has

been reported from non-leguminous species and no clones have been shown to

experimentally infect species other than legumes. This suggests that these viruses

have very narrow host ranges which likely have resulted in genetic isolation (Qazi et

al., 2007). This lack of infectivity of LYMVs is further investigated in Chapter 5.

PedLCV (previously also known as Tomato leaf curl Pakistan virus) has

previously been identified in tomato (acc. no. DQ116884) and the ornamental shrub

Pedilanthus tithymaloides, after which the virus is named (Tahir et al., 2009).

Although the presence of a betasatellite was not investigated for the tomato isolate,

TbLCB (the same betasatellite species as identified with PedLCV here; Chapter 3)

was identified in association with the isolate from P. tithymaloides. However, for

neither isolate was infectivity of the obtained clones investigated. This is thus the first

demonstration of infectivity of clones of this species. Although PedLCV was isolated

from soybean it was not infectious to this species, even though it was shown to be

highly infectious, in both the presence and absence of TbLCB, to N. benthamiana.

The natural host range of PedLCV thus does not extend to soybean or any of the other

legumes tested and suggests that its presence in soybean in the field is dependent upon

the presence of MYMIV; possibly a synergistic extension of host range. The

interaction of the LYMVs with PedLCV is further investigated in Chapter 5.

The situation with PaLCuV is likely to be the same as with PedLCV. PaLCuV

was first identified in papaya originating from India (Saxena et al., 1998) and

subsequently in cotton in association with the CLCuD-associated betasatellite,

CLCuMB (Mansoor et al., 2003). The isolate from cotton was additionally shown, by

biolistic inoculation, to be infectious to cotton in the presence of CLCuMB and to

induce typical CLCuD symptoms. The presence of PaLCuV in the leguminous weed

R. capitata is thus likely due to the additional presence of MYMV. A number of

119

begomoviruses, which would not usually be expected to infect legumes, have been

reported from legumes; these include Tomato leaf curl Karnataka virus (Raj et al.,

2006a) and Cotton leaf curl Kokhran virus from soybean (Raj et al., 2006b), Tomato

leaf curl New Delhi virus from pigeonpea (Raj et al., 2005) and cowpea (Reddy et al.,

2005). Since the infectivity of none of the clones of these viruses was investigated in

the relevant legume hosts, and all legumes from which they were isolated showed

symptoms typical of infection by LYMVs, it would seem more than likely that the

presence of these viruses in legumes, as is the case with PedLCV reported here, is

supported by another begomovirus, one of the LYMVs.

The behaviour of PedLCV and TbLCB in N. benthamiana is identical to that

of AYVV and AYVB, the first betasatellite complex identified (Saunders et al.,

2000). In the absence of the betasatellite PedLCV causes a severe upward leaf curl in

N. benthamiana associated with vein swelling. In the presence of TbLCB, these

symptoms become a downward leaf curling with some leaf deformation and vein

swelling. This shows that this betasatellite and PedLCV have a “productive”

interaction; the virus is able to trans-replicate the betasatellite and moves it

systemically and that the expression of the βC1 protein encoded by the satellite leads

to the change in the symptom phenotype (Saunders et al., 2001). This thus shows that

PedLCV and TbLCB form a viable complex.

To identify resistant lines, breeders usually rely on field screening. This has

distinct limitations in that, in the case of begomoviruses, environmental conditions are

variable and whitefly transmission efficiency may consequently vary. Similarly, the

genetic make-up of the virus in the field may vary and the screening can only be

conducted once a year. The agroinoculation technique used here provides a means of

overcoming many of these limitations. The screening can be done, in glasshouses, at

any time of the year. This technique overcomes the variability due to the whitefly and

a defined (cloned) virus is inoculated every time. The brief study here, using two

soybean varieties with differing levels of resistance to MYMIV, demonstrates the

potential usefulness of this technique for the rapid screening of resistance in legume

varieties. Although it can not entirely replace field screening, there will always be a

need to assess the performance of new varieties in field conditions, it will be useful

for rapidly identifying promising resistant lines and should speed-up the introduction

of these.

120

Chapter 5

Interaction of LYMVs with other begomoviruses and betasatellites

5.1 Introduction

Component exchange, commonly referred to as pseudo-recombination for

geminiviruses, is common in legume-infecting begomoviruses (Qazi et al., 2007). For

example, an isolate of MYMV obtained from blackgram was shown to be associated

with two distinct types of DNA-B. The first (MYMV-[IN:Vam:VigKA27]

AF262064) showed 97% sequence identity to the DNA-B of the MYMV isolate from

Thailand. The other (represented by four clones, MYMV-[IN:Vam:VigKA21]

AJ439059, MYMV-[IN:Vam:VigKA22] AJ132574, MYMV-[IN:Vam:VigKA28]

AJ439058 and MYMV-[IN:Vam:VigKA34] AJ439057), had only 71-72% identity to

the Thai isolate (Karthikeyan et al., 2004). Infectivity analysis showed the DNA-A

component of this virus to be able to support both DNA-B components at the same

time and to induce only mild symptoms in blackgram in the presence of MYMV-

[IN:Vam:VigKA27] AF262064 but typical disease symptoms in this host in the

presence of the other DNA-B components. For an isolate of MYMIV from cowpea,

the presence of a distinct DNA-B was shown to extend the host range of this virus to

cowpea. These clones were not well adapted to blackgram, inducing severe symptoms

but accumulating to only low levels in this species (Malathi et al., 2005).

Furthermore, an isolate of MYMV isolated from soybean has been shown to be

associated with a DNA-B with high sequence identity to the DNA-B of HgYMV

(96%). The DNA-B of HgYMV is the most distinct amongst the LYMV DNA-Bs,

showing only 70-73% identity to the DNA-B components of MYMV and MYMIV.

Surendranath et al. (2005) showed that pseudo-recombinants between distinct

MYMIV isolates were highly infectious and produced typical symptoms in all

legumes hosts tested except cowpea. Extremely low viral DNA accumulation and

atypical leaf curl symptoms produced by reassortants in cowpea suggest barriers both

for replication and systemic movement despite genetic similarity.

Recently some begomoviruses have been shown to require the presence of

single-stranded DNA satellites to induce characteristic symptoms in some hosts

(Briddon et al., 2001a; Jose and Usha, 2003; Saunders et al., 2000). The satellites

have been identified, thus far, only in association with monopartite begomoviruses

from the Old World (Briddon et al., 2003; Bull et al., 2004; Zhou et al., 2003b). Full-

121

length clones of monopartite begomoviruses Ageratum yellow vein virus (AYVV)

from Singapore and Cotton leaf curl Multan virus (CLCuMV) from Pakistan,

although infectious in N. benthamiana (Briddon et al., 2001a; Saunders et al., 2000),

were unable to induce typical symptoms of yellow vein in Ageratum conyzoides and

leaf curl in cotton, respectively, and novel molecules, named DNA β (now

collectively known as betasatellites; Briddon et al., 2008), were shown to be

associated with both viruses, and to be essential for induction of characteristic

symptoms in Ageratum and cotton (Saunders et al., 2000; Briddon et al., 2001a). The

monopartite begomoviruses that associate with betasatellite can be divided into two

types according to whether or not their betasatellites are indispensable for induction of

symptoms in the hosts from which they were isolated. In most cases the

begomoviruses have an obligate interaction with their betasatellites; the viruses never

being identified infecting hosts in the field in the absence of the betasatellite (Zhou et

al., 2003a). For a minority, the associated betasatellite molecules do not appear to

play a key role in symptom induction and their relationship with the helper virus is

facultative and less well understood. These classes of monopartite begomoviruses

may represent evolutionary intermediates between the obligate betasatellite

interacting and true monopartite begomoviruses that have genomes consisting of only

a single genomic component homologous to the DNA-A component of bipartite

begomoviruses (Li et al., 2005).

Analysis of betasatellites has revealed that they are approximately half the size

of the genomes of their helper begomoviruses and, with the exception of the

TAATATTAC motif (the nonanucleotide sequence) contained within a conserved

stem-loops structure, have little sequence similarity to either the DNA-A or DNA-B

components of begomoviruses. Betasatellites require helper begomoviruses for

replication, encapsidation, insect transmission and movement in plants (Briddon and

Stanley 2006) and they contribute to the production of symptoms and enhance helper

virus accumulation in certain hosts. They might affect the replication of their helper

virus by either facilitating its spread in host plants or by suppressing host gene

silencing (Saunders et al., 2000; Saeed et al., 2007). The βC1 encoded by

betasatellites is the determinant of both pathogenicity and suppression of gene

silencing (reviewed by Briddon and Stanley, 2006).

Legume-infecting begomoviruses have host ranges limited to plants of the

family Fabaceae and there is ample evidence for genetic interaction between these

122

begomoviruses within the legumes, in the form of both classical recombination and

component exchange. However, there is little evidence for interaction of these viruses

with non-legume viruses. This is indicative of genetic isolation, the viruses in legumes

evolving independently of the begomoviruses in plant species of other families and

this may be the reason that these viruses are evolutionary distinct (Qazi et al., 2007).

There are reports of the isolation of non-legume begomoviruses from legumes with

yellow mosaic disease such as Tomato leaf curl Karnataka virus and Cotton leaf curl

Kokhran virus were isolated from soybean (Raj et al., 2006a; 2006b), Tomato leaf

curl New Delhi virus was isolated from pigeonpea (Raj et al., 2005) and cowpea

(Reddy et al., 2005). In this study PedLCV and TbLCB were isolated from soybean

and PaLCuV was isolated from Rhynchosia capitata (Chapter 3, Section 3.3). The

interaction of these non-legume viruses with LYMVs is investigated in this chapter.

5.2 Methodology

To mutate the MP gene encoded on DNA-B of MYMIV-[PK:Isl:Mg:07]

(clone MI21), NcoI was used. This is a single cutter enzyme at nucleotide position

1768 that cuts the MP gene in the centre. The DNA-B component was digested with

NcoI and the cohesive ends were in-filled by using Klenow fragment. In this way a

frame shift mutation was introduced by adding four nucleotides in the DNA and the

NcoI restriction site was lost. The mutation was confirmed by loss of the NcoI site

from the clone. This MP mutated DNA-B component (DNA-BΔMP

) was used to

produce a construct for Agrobacterium-mediated inoculation. DNA-BΔMP

was

digested with BamHI and ClaI and an approximately 1.6 kb DNA fragment was

cloned into the pBluescript II KS/SK (+) vector. This partial length fragment was

released with BamHI and SalI from pBluescript II KS/SK (+) vector and cloned into

pBin19. The pBin19 clone was then digested with BamHI and the full-length insert of

DNA-BΔMP

was cloned into this as a BamHI fragment, yielding a partial direct repeat

construct.

To mutate the NSP gene of DNA-B of MYMIV, mutagenic abutting primers

(BΔNSP

Forward and BΔNSP

Reverse; Table 2.1) were designed in such a way that

nucleotide A was replaced with G at position 710 to add a HindIII restriction site and

nucleotide T was replaced with A at position 703 to add a stop codon in the coding

sequence. These primers were used to amplify DNA-B by PCR and the amplified

product was cloned by InsTAclone PCR Cloning Kit (Fermentas) into pTZ57R/T. The

123

mutation was confirmed by digestion of the introduced HindIII restriction site. To

produce a partial direct repeat clone of DNA-B with mutated NSP (DNA-BΔNSP

). The

mutated clone was digested with BamHI and HindIII and the approx. 2.2 kb DNA

fragment was cloned in the binary vector pBin19. This partial clone of DNA-B was

digested with HindIII, treated with CIAP, and ligated with full length component of

DNA-BΔNSP

released as a HindIII fragment. A further mutant DNA-B was produced

in which both the MP and NSP genes were mutated (DNA-BΔMPΔNSP

) by the same

procedure described above for mutation of NSP; however for PCR amplification the

DNA-B clone with mutated MP was used as a template. A construct for

Agrobacterium-mediated inoculation of this mutant was made as described above for

DNA-BΔNSP

.

The βC1 gene of TbLCB was cloned in the binary vector pBin19 under the

control of the Cauliflower mosaic virus 35S promoter. To produce this construct, the

gene was amplified with specific primers (βC1-35S Forward and βC1-35S Reverse;

Table 2.1) and cloned in the expression vector pJIT163 (Guerineau et al., 1992) at

restriction sites HindIII and BamHI. The βC1-containing expression cassette with 35S

promoter and nos terminator was excised by digesting with restriction enzymes SacI

and EcoRV and ligated into pBin19 which was first digested with SacI and SmaI.

5.3 Results

To study the interactions of MYMIV with PedLCV and TbLCB, infectious

clones of MYMIV-[PK:Nsh:Sb:07] (clones MI18, MI17), PedLCV-[PK:Nsh:Sb:07]

(clone MI1) and TbLCB-[PK:Nsh:Sb:07] (clone MI22) were produced and infectivity

experiments were carried out in controlled conditions.

5.3.1 Interaction of MYMIV with betasatellites

Infectious clones of MYMIV (DNA A and B) and TbLCB were

agroinoculated to soybean. Typical symptoms of MYMIV infection of this host

appeared after 60 days (a yellow mosaic on newly emerging leaves; as described in

Chapter 4, Section 4.3.2). Analysis of the plants by PCR with primers specific for

each component showed the presence of both MYMIV components but not TbLCB

(Table 5.1). In control inoculations of TbLCB with PedLCV, to N. benthamiana,

typical symptoms (Fig. 5.6d) of infection appeared after 16 days and diagnostic PCR

showed the presence of TbLCB, confirming the viability of the betasatellite inoculum.

This showed that, at least under the experimental conditions used here, TbLCB is not

124

infectious to soybean in the presence of MYMIV. This is surprising, considering that

the TbLCB clone was isolated from a soybean plant infected with MYMIV. Whether

this indicates that the TbLCB clone is defective, or the inability of TbLCB to infect

soybean in the presence of MYMIV is a consequence of the, relatively, low efficiency

of the inoculation system (typically only 57% of inoculated soybean plants become

infected [Table 5.1]) is unclear. Further investigation will be required to answer this

question.

MYMIV was poorly infectious to N. benthamiana, all inoculated plants were

symptomless although in approx. 20% of inoculated plants the virus could be detected

in newly emerged leaves by PCR but not by Southern blot (Chapter 4, Section 4.3.1 ),

suggesting that virus levels in plants are low. Inoculation of DNA-A of MYMIV to N.

benthamiana also gave a similar result; symptomless plants and 3 out of 22 plants

positive for DNA-A (Table 5.1). When MYMIV DNA-A, DNA-B and TbLCB were

coinoculated to N. benthamiana, all plants were symptomatically infected after twelve

days with severe downward leaf curling, vein yellowing and thickening (Fig. 5.1c).

Co-inoculation of MYMIV DNA-A and TbLCB produced infected plants with the

same phenotype (Fig. 5.1b) but the infectivity was only 60% of inoculated plants

(Table 5.1) and symptoms started after eighteen days. The remaining 40% of plants

were symptomless and PCR-mediated diagnostics was unable to detect the presence

of either TbLCB or MYMIV DNA-A. The presence of MYMIV DNA-A, DNA-B and

TbLCB in systemically infected tissues was assessed by Southern hybridization (Fig.

5.2). There were very bright bands for DNA-A and TbLCB on the blot but for DNA-

B faint bands were produced even though equal amounts of DNA (10µg per well)

were load. All these experiments were repeated three times and produced reproducible

results. These results showed that the poor infectivity of MYMIV to N. benthamiana

is not due to a problem with virus replication since, in the presence of TbLCB, the

virus is highly infectious to this host. Rather the results suggest that this is either due

to restricted movement of the virus or because of a strong host defence response

against the virus by this host. TbLCB can complement the movement functions

encoded on DNA-B. Although the DNA-B of MYMIV appeared not to be well

adapted to N. benthamiana the results suggested it still had some role to play in

infection since, in its presence, infectivity increased from 60% to 100% in co-

infections with TbLCB. To determine the contribution of each of the genes encoded

by DNA-B in these TbLCB assisted infections, the MYMIV genes encoding NSP and

125

MP were cloned in the binary vector pGreen0029 under the control of the 35S

promoter. In the presence of 35S-NSP, MYMIV DNA-A and TbLCB infected 60% of

plants inducing typical betasatellite symptoms. However, in the presence of 35S-MP

all inoculated plants were infected (Table 5.1). This indicates that, in N. benthamiana,

it is likely the function of MYMIV NSP that is compromised.

To further investigate the specificity of interaction of MYMIV with

betasatellites, two further betasatellite clones, Cotton leaf curl Multan betasatellite

(CLCuMB) and Chilli leaf curl betasatellite (ChLCB) were assessed for their ability

to assist MYMIV in infecting N. benthamiana. Both betasatellite clones were

infectious to N. benthamiana with the helper virus CLCuMV (Table 5.1). However,

when coinoculated with the components of MYMIV, they did not facilitate the

infectivity of this virus (Table 5.1). This indicates that not all betasatellites are

capable of interacting with MYMIV. The lack of detection of either betasatellite in

systemic tissues in which the virus was detected, suggests that MYMIV is unable to

transreplicate these satellites.

Previous studies have indicated that all betasatellite functions are mediated by

the βC1 protein, the only product encoded by betasatellites (reviewed by Briddon and

Stanley, 2006). To study the role of the βC1 gene of TbLCB in the interaction with

MYMIV, a PVX vector expressing the TbLCB βC1 gene (βC1-PVX) was

coinoculated with MYMIV DNA-A and DNA-B to N. benthamiana. Symptoms of

infection, consisting of severe leaf curling, vein thickening, stem and petiole

deformation, enations on underside of the leaves along the veins, and dense hairs on

leaves and stems, appeared within 12 days of inoculation (Fig. 5.1f). βC1-PVX

infection alone also produced the same phenotype (Fig. 5.1d), indicating that MYMIV

made no contribution to the phenotype. MYMIV DNA-A and DNA-B components

moved systemically and accumulated to high levels in systemic leaves when

compared to control N. benthamiana plants inoculated with MYMIV alone (Fig. 5.2).

Similarly plants inoculated with MYMIV DNA-A and βC1-PVX also produced the

same phenotype as was obtained with βC1-PVX alone (Fig. 5.1e) and the DNA-A

was detected in systemically infected leaves. To study transient effect of βC1 protein

expression, a construct with the βC1 gene under the control of the 35S promoter (35S-

βC1) was co-infiltrated with MYMIV DNA-A and DNA-B to N. benthamiana leaves.

All inoculated plants remained symptomless and MYMIV was not detected by

Southern hybridization. However, by PCR diagnostics, all plants were shown to have

126

both components of MYMIV in systemic leaves. Similarly plants inoculated with

MYMIV DNA-A and βC1-35S were also symptomless but by PCR were shown to

contain MYMIV DNA-A in systemic leaves (Table 5.1).

N. benthamiana infected with MYMIV DNA-A, DNA-B and TbLCB

contained very low amounts of DNA-B in systemically infected leaves. To investigate

the involvement of proteins encoded by DNA-B in its low accumulation, the genes on

DNA-B were individually mutated. Agroinoculation of MYMIV DNA-A and DNA-

BΔMP

to N. benthamiana gave results similar to those obtained by inoculation with

MYMIV DNA-A and DNA-B which were very low levels of both components of the

virus in 20% of inoculated plants. Inoculation of MYMIV DNA-A, DNA-BΔMP

and

TbLCB produced symptomatic infection in 60% of plants (Table 5.1) with typical

betasatellite symptoms (Fig. 5.4b) and the accumulation of DNA-BΔMP

was slightly

increased, as it was detectable in infected tissues by Southern hybridization (Fig. 5.3).

Agroinoculation of MYMIV DNA-A and DNA-BΔNSP

to N. benthamiana produced

results similar to those obtained by inoculation of N. benthamiana with MYMIV

DNA-A and DNA-B; non-symptomatic plants in which only very few contained

detectable level of DNA-A and DNA-B. When MYMIV DNA-A, DNA-BΔNSP

and

TbLCB were co-inoculated to N. benthamiana, 60% plants were infected (Table 5.1)

and exhibited typical betasatellite symptoms (Fig. 5.4a). In infected tissues DNA-

BΔNSP

was detectable in small amounts by Southern hybridization (Fig. 5.3). All N.

benthamiana inoculated with MYMIV DNA-A, DNA-BΔMPΔNSP

and TbLCB were

symptomless and none of the plants was positive in newly emerging tissues, for any

of the inoculated components by PCR analysis (Table 5.1).

127

Fig. 5.1 Symptoms induced following the inoculation of Nicotiana benthamiana with Mungbean

yellow mosaic India virus (MYMIV) and Tobacco leaf curl betasatellite (TbLCB) and its derivatives.

Shown are a non-inoculated N. benthamiana plant for comparisons (a) and N. benthamiana plants

inoculated with MYMIV DNA-A and TbLCB (b), MYMIV DNA-A, DNA-B and TbLCB (c), βC1-

PVX (d), MYMIV DNA-A, βC1-PVX (e) and MYMIV DNA-A, DNA-B and βC1-PVX (f). Plants

were photographed approximately 20 dpi.

128

Fig. 5.2 Southern hybridization of blots probed with MYMIV DNA-A (a), DNA-B (b) and TbLCB (c).

DNA samples run on the gels were extracted from a mature, field-infected mungbean plant showing

clear yellow mosaic symptoms of infection by MYMIV (lane 1), healthy non-inoculated N.

benthamiana (lane 2). The samples run in lanes 3 to 8 were extracted from N. benthamiana plants

inoculated with MYMIV DNA-A and TbLCB (lane 3), MYMIV DNA-A, DNA-B and TbLCB (lane

4), MYMIV DNA-A and βC1-PVX (lane 5) MYMIV DNA-A, DNA-B and βC1-PVX (lane 6),

MYMIV DNA-A and 35S- βC1 (lane 7), MYMIV DNA-A, DNA-B and 35S- βC1(lane 8). Samples

were extracted approx. 25 dpi and approximately 10µg of DNA was loaded in each lane.

129

Fig. 5.3 Southern hybridization of a blot probed with MYMIV DNA-B. The DNA sample in lane 1 was

extracted from a mature, field-collected soybean plant with clear mosaic symptoms typical of infection

by MYMIV. Lanes 2 to 8 contained DNA extracted from a non-inoculated N. benthamiana plant (lane

2) or N. benthamiana plants inoculated with MYMIV DNA-A, DNA-B and TbLCB (lanes 3 and 4)

MYMIV DNA-A, DNA-BΔMP and TbLCB (lanes 5 and 6) and MYMIV DNA-A, DNA-BΔNSP and

TbLCB (lanes 7 and 8). Samples were extracted approx. 25 dpi and approximately 10µg of DNA was

loaded in each case.

5.3.2 Interaction of TbLCB with RhYMV and MYMV

To investigate whether the interaction of TbLCB is specific for MYMIV and

this betasatellite has the capacity to interact with other legume-infecting

begomoviruses, RhYMV and MYMV were similarly analysed for their ability to

interact with this betasatellite. Earlier infectivity analyses showed that, in common

with the other LYMVs, RhYMV was not infectious to N. benthamiana (Chapter 4,

Section 4.3.4). All plants inoculated with RhYMV DNA-A and DNA-B were

symptomless and the virus was not detectable in newly emerging tissues by PCR. To

study the potential for interaction between RhYMV and TbLCB they were

agroinoculated to N. benthamiana and after twelve days 60% of plants (Table 5.1)

developed symptoms of infection, consisting of leaf curling, vein yellowing and

thickening (Fig. 5.4d). RhYMV DNA-A was also co-inoculated with TbLCB to N.

130

benthamiana and 40% plants (Table 5.1) were symptomatic within 16 days of

inoculation with symptoms consisting of mild leaf curling, vein yellowing and

thickening (Fig. 5.4c). Southern blot analyses showed that the levels of DNA-A and

TbLCB replication were similar in plants with DNA-B and without DNA-B (Fig.

5.5a), whereas the level of DNA-B was very low; detectable by PCR but not by

Southern hybridization.

Infectivity analyses showed that MYMV is poorly infectious to N.

benthamiana (Chapter 4, Section 4.3.3), as all inoculated plants were symptomless

although in 10% to 20% plants the virus was detectable by PCR. MYMV was also

assessed for its ability to interaction with TbLCB in N. benthamiana. Inoculation of

plants with MYMV DNA-A, DNA-B and TbLCB induced leaf curling in 60%

inoculated plants approx. ten days after inoculation. (Table 5.1) and after sixteen days

plants were fully infected with severe leaf curling (Fig. 5.4f), symptoms

indistinguishable from the inoculation of this betasatellite with the other LYMVs.

DNA-A alone was also able to interact with TbLCB and 40% of inoculated plants

became symptomatic (Table 5.1), with leaf curl symptoms appearing after ten days

(Fig. 5.4e). By PCR diagnostics all three components were detected in

symptomatically infected tissues and by Southern blot analysis the levels of DNA-A

and TbLCB were similar in plants with or without DNA-B (Fig. 5.5b and c). However

DNA-B could not be detected by Southern blotting in symptomatic plants inoculated

with MYMV DNA-A, DNA-B and TbLCB.

131

Fig. 5.4 Phenotypic behaviour of N. benthamiana plants inoculated with MYMIV DNA-A, TbLCB and

DNA-BΔNSP (a) DNA-A, TbLCB and DNA-BΔMP (b) RhYMV DNA-A and TbLCB (c) RhYMV DNA-

A, DNA-B and TbLCB (d) MYMV DNA-A and TbLCB (e) and MYMV DNA-A, DNA-B and TbLCB

(f). Plants were photographed approximately 20 dpi.

132

Fig. 5.5 Southern hybridization of blots probed with RhYMV DNA-A (a) MYMV DNA-A (b) and

TbLCB (c). DNA samples immobilized on blot (a) were extracted from a mature, field-infected

Rhynchosia minima plant showing clear yellow mosaic symptoms of infection by RhYMV (lane 1),

healthy non-inoculated N. benthamiana (lane 2) and N. benthamiana inoculated with RhYMV (lane 3).

The samples run in lanes 4 to 8 were extracted from N. benthamiana plants inoculated with RhYMV

DNA-A and TbLCB (lanes 4 and 5) and RhYMV DNA-A, DNA-B and TbLCB (lanes 6-8). DNA

samples on blot (b) were extracted from field-infected Rhynchosia capitata plant showing yellow

mosaic symptoms of infection by MYMV (lane 1), healthy non-inoculated N. benthamiana (lane 2) and

N. benthamiana inoculated with MYMV (lane 3). The samples run in lanes 4 to 8 were extracted from

N. benthamiana plants inoculated with MYMV DNA-A and TbLCB (lanes 4 and 5) and MYMV DNA-

A, DNA-B and TbLCB (lanes 6 and 7). DNA samples on blot (c) were extracted from N. benthamiana

infected with MYMIV DNA-A, DNA-B and TbLCB (lane 1), healthy non-inoculated N. benthamiana

(lane 2) and N. benthamiana inoculated with RhYMV DNA-A, TbLCB (lanes 3 and 4), RhYMV

DNA-A, DNA-B and TbLCB (lanes 5 and 6), MYMV DNA-A and TbLCB (lane 7) and MYMV DNA-

A, DNA-B and TbLCB (lanes 8 and 9). Samples were extracted approx. 25 dpi and approximately

10µg of DNA was loaded in each lane.

133

Table 5.1 Study of interaction of legume-infecting begomoviruses with betasatellites.

Inoculum Plant species

Infectivity (plants infected/inoculated)

Symptoms Experiment Total

I II III

MYMIV DNA-A+ DNA-B+TbLCB

soybean

Positive for

MYMIV

(6/10),

Positive for

TbLCB (0/10)

Positive for

MYMIV

(5/10),

Positive for

TbLCB (0/10)

Positive for

MYMIV

(6/10),

Positive for

TbLCB (0/10)

Positive for

MYMIV

(17/30),

Positive for

TbLCB (0/30)

Yellow mosaics on leaves

MYMIV DNA-A N. benthamiana 2/10 1/8 0/4 3/22 None

MYMIV DNA-A+B N. benthamiana

Positive for DNA-A and

DNA-B, (2/10)

Positive for DNA-A and

DNA-B (3/10)

Positive for DNA-A and

DNA-B (1/10)

Positive for DNA-A and

DNA-B (6/30)

None

MYMIV DNA-A+ TbLCB

N. benthamiana

Positive for DNA-A and

TbLCB, (6/10)

Positive for DNA-A and

TbLCB, (5/10)

Positive for DNA-A and

TbLCB, (5/10)

Positive for DNA-A and

TbLCB, (16/30)

Severe leaf curling

MYMIV DNA-A+ DNA-B+TbLCB

N. benthamiana

Positive for DNA-A,

DNA-B and TbLCB, (10/10)

Positive for DNA-A,

DNA-B and TbLCB, (10/10)

Positive for DNA-A,

DNA-B and TbLCB, (9/10)

Positive for DNA-A,

DNA-B and TbLCB, (29/30)

Severe leaf curling

MYMIV DNA-A+ TbLCB+35S-MP

N. benthamiana

Positive for DNA-A and

TbLCB,

(10/10)

Positive for DNA-A and

TbLCB,

(6/6)

Positive for DNA-A and

TbLCB,

(5/5)

Positive for DNA-A and

TbLCB,

(21/21)

Severe leaf curling

MYMIV DNA-A+ TbLCB+35S-NSP

N. benthamiana

Positive for DNA-A and

TbLCB, (5/10)

Positive for DNA-A and

TbLCB, (3/6)

Positive for DNA-A and

TbLCB, (3/5)

Positive for DNA-A and

TbLCB, (11/21)

Severe leaf curling

MYMIV DNA-A+ TbLCB+35S-MP+

35S-NSP

N. benthamiana

Positive for DNA-A and

TbLCB, (10/10)

Positive for DNA-A and

TbLCB, (6/6)

Positive for DNA-A and

TbLCB, (5/5)

Positive for DNA-A and

TbLCB, (21/21)

Severe leaf curling

MYMIV DNA-A+βC1-PVX

N. benthamiana 8/8 7/7 7/7 22/22 Severe leaf curling and enations

MYMIV DNA-A+DNA-B+ βC1-PVX

N. benthamiana

Positive for DNA-A and

DNA-B,

(10/10)

Positive for DNA-A and

DNA-B

(9/9)

Positive for DNA-A and

DNA-B

(10/10)

Positive for DNA-A and

DNA-B

(29/29)

Severe leaf curling and enations

MYMIV DNA-A+ 35S-βC1

N. benthamiana 6/6 9/10 5/6 20/22 None

MYMIV DNA-A+ DNA-B+35S-βC1

N. benthamiana

Positive for DNA-A and

DNA-B

(6/7)

Positive for DNA-A and

DNA-B

(10/10)

Positive for DNA-A and

DNA-B

(9/10)

Positive for DNA-A and

DNA-B

(25/27)

None

MYMIV DNA-A+ DNA-BΔNSP

N. benthamiana

Positive for DNA-A and

DNA-B,

(1/10)

Positive for DNA-A and

DNA-B

(0/8)

Positive for DNA-A and

DNA-B

(2/10)

Positive for DNA-A and

DNA-B

(3/28)

None

MYMIV DNA A+ DNA BΔNSP+TbLCB

N. benthamiana

Positive for DNA-A,

DNA-B and TbLCB, (6/10)

Positive for DNA-A,

DNA-B and TbLCB,

(4/8)

Positive for DNA-A,

DNA-B and TbLCB, (5/10)

Positive for DNA-A,

DNA-B and TbLCB, (15/28)

Severe downward leaf curling

134

Table 5.1 continued

Inoculum Plant species

Infectivity (plants infected/inoculated)

Symptoms Experiment Total

I II III

MYMIV DNA-A+

DNA-BΔMP N. benthamiana

Positive for DNA-A and

DNA-B, (1/10)

Positive for DNA-A and

DNA-B (0/7)

Positive for DNA-A and

DNA-B (1/8)

Positive for DNA-A and

DNA-B (2/25)

None

MYMIV DNA-A+ DNA-BΔMP+TbLCB

N. benthamiana

Positive for DNA-A,

DNA-B and TbLCB,

(6/8)

Positive for DNA-A,

DNA-B and TbLCB, (6/10)

Positive for DNA-A,

DNA-B and TbLCB, (5/10)

Positive for DNA-A,

DNA-B and TbLCB, (17/28)

Severe downward leaf curling

MYMIV DNA-A+ DNA-BΔNSPΔMP+ TbLCB

N. benthamiana 0/6 - - 0/6 None

MYMIV DNA-A+ CLCuMB

N. benthamiana

Positive for DNA-A (1/5),

Positive for CLCuMB

(0/5)

Positive for DNA-A and CLCuMB

(0/5)

Positive for DNA-A and CLCuMB

(0/5)

Positive for DNA-A (1/15)

Positive for CLCuMB

(0/5)

None

MYMIV DNA-A+

DNA-B+CLCuMB N. benthamiana

Positive for MYMIV DNA-A, DNA-B

(1/4)

Positive for MYMIV DNA-A, DNA-B

(0/5)

Positive for MYMIV DNA-A, DNA-B

(1/5)

Positive for MYMIV DNA-A, DNA-B (2/14)

None

CLCuMV+CLCuMB N. benthamiana

Positive for CLCuMV, CLCuMB

(6/6)

- -

Positive for CLCuMV, CLCuMB

(6/6)

Severe leaf

curl of

emerging

leaves

MYMIV DNA-A+ ChLCB

N. benthamiana

Positive for MYMIV DNA-A

(1/5)

Positive for MYMIV DNA-A

(0/5)

Positive for MYMIV DNA-A

(2/5)

Positive for MYMIV DNA-A

(3/15)

None

MYMIV DNA-A+

DNA-B+ChLCB N. benthamiana

Positive for MYMIV DNA-A, DNA-B

(1/5)

Positive for MYMIV DNA-A, DNA-B

(1/5)

Positive for MYMIV DNA-A, DNA-B

(0/5)

Positive for MYMIV DNA-A, DNA-B (2/15)

None

CLCuMV+ChLCB N. benthamiana

Positive for CLCuMV,

ChLCB (6/6)

- -

Positive for CLCuMV,

ChLCB (6/6)

Severe leaf

curl of

emerging

leaves

RhYMV DNA-A N. benthamiana 0/6 0/6 0/5 0/17 None

RhYMV DNA-A+ DNA-B

N. benthamiana 0/5 0/5 0/5 0/15 None

RhYMV DNA-A+ TbLCB

N. benthamiana

Positive for RhYMV DNA-A,

TbLCB (3/8)

Positive for RhYMV DNA-A, TbLCB (5/10)

Positive for RhYMV DNA-A, TbLCB (4/10)

Positive for RhYMV DNA-A, TbLCB (12/28)

Mild leaf curling

RhYMV DNA-

A+DNA-B+TbLCB N. benthamiana

Positive for RhYMV DNA-A, DNA-B,

TbLCB (4/6)

Positive for RhYMV DNA-A, DNA-B,

TbLCB (5/7)

Positive for RhYMV DNA-A, DNA-B,

TbLCB (3/7)

Positive for RhYMV DNA-A,

DNA-B, TbLCB (12/20)

Downward

leaf curling

MYMV DNA-A N. benthamiana 1/6 0/6 1/6 2/18 None

135

Table 5.1 continued

Inoculum Plant species

Infectivity (plants infected/inoculated)

Symptoms Experiment Total

I II III

MYMV DNA-A+ DNA-B

N. benthamiana

Positive for MYMV

DNA-A, DNA-B

(1/6)

Positive for MYMV

DNA-A, DNA-B

(1/6)

Positive for MYMV

DNA-A, DNA-B

(0/6)

Positive for MYMV

DNA-A, DNA-B (2/18)

None

MYMV DNA-A+TbLCB

N. benthamiana

Positive for MYMV DNA-A,

TbLCB (3/7)

Positive for MYMV DNA-A,

TbLCB (3/8)

Positive for MYMV DNA-A, TbLCB (4/10)

Positive for MYMV DNA-A, TbLCB (10/25)

Severe leaf curling

MYMV DNA-A+ DNA-B+TbLCB

N. benthamiana

Positive for MYMV DNA-A,

DNA-B, TbLCB (5/8)

Positive for MYMV DNA-A,

DNA-B, TbLCB (4/8)

Positive for MYMV DNA-A, DNA-B, TbLCB (6/10)

Positive for MYMV DNA-A, DNA-B, TbLCB (15/26)

Sever leaf curling

5.3.3 Interaction of MYMIV with Pedilanthus leaf curl virus

Analyses showed that the soybean sample from Sind province, infected with

MYMIV and PedLCV, had relatively low amounts of PedLCV DNA, although it was

at levels detectable by Southern hybridisation in some samples (Fig.5.7a). To study

the interaction of MYMIV with PedLCV, infectious clones of both viruses were

agroinoculated to soybean. Plants developing yellow mosaic disease were assessed for

the presence of MYMIV and PedLCV. PedLCV could not be detected in any plant;

however MYMIV was shown to be present in all symptomatic samples. The inoculum

of PedLCV was viable, as it was infectious to N. benthamiana in control inoculations

(Table 5.2).

MYMIV and PedLCV were also inoculated to N. benthamiana and all plants

showed typical symptoms of PedLCV which were severe upward leaf curling typical

of PedLCV in this host (Fig. 5.6a). Total genomic DNA of all inoculated plants was

extracted and assessed for the presence of MYMIV DNA-A, DNA-B and PedLCV by

PCR. All symptomatic plants were positive for MYMIV DNA-A and PedLCV,

whereas MYMIV DNA-B could not be detected. The presence of MYMIV DNA-A

and PedLCV was also confirmed by Southern hybridization (Fig. 5.7 b and d). N.

benthamiana plants inoculated with MYMIV DNA-A, DNA-B, PedLCV and TbLCB

showed downward leaf curling (Fig. 5.6b) and all four components were found in

systemically infected tissues by PCR. However by Southern hybridization MYMIV

136

DNA-B could not be detected, indicating that it was accumulating at levels below the

detection threshold of Southern hybridisation (Fig. 5.7b, c and d).

To see whether MYMIV has the capacity to interact with any other

monopartite begomoviruses, Cotton leaf curl Multan virus (CLCuMV; AJ496461)

and MYMIV were co-inoculated to N. benthamiana. All inoculated plants showed

typical symptoms of CLCuMV; downward leaf curling of emerging leaves (Fig. 5.6c).

All plants were found positive for MYMIV DNA-A, DNA-B and CLCuMV by PCR.

Southern blot analysis showed that the amount of MYMIV DNA-A and CLCuMV

was very high in infected tissues whereas the amount of DNA-B was very low, hardly

detectable on Southern blot hybridization (Fig. 5.7c).

Fig. 5.6 Symptoms induced following agroinoculation of N. benthamiana plants with MYMIV and

PedLCV (a), MYMIV, PedLCV and TbLCB (b), MYMIV and CLCuMV (c) and PedLCV and TbLCB

(d). Plants were photographed approximately 20 dpi.

137

Fig. 5.7 Southern blot analyses with a probe of PedLCV (a) to show presence of PedLCV in soybean

sampled from Sind province (lanes 3-6). Healthy soybean was used as a negative control (lane 2) and

N. benthamiana infected with PedLCV was used as a positive control (lane 1). Southern blot analysis

with a probe of MYMIV DNA-A (b) to show its presence in N. benthamiana inoculated with MYMIV

and PedLCV (lanes 3-5) MYMIV and CLCuMV (lanes 6-8). Soybean infected with MYMIV was used

as a positive control (lane 1) and healthy N. benthamiana was used as a negative control (lane 2).

Southern blot analysis with a probe of MYMIV DNA-B (c) to show its presence in N. benthamiana

inoculated with MYMIV and PedLCV (lanes 3 and 4), MYMIV, PedLCV and TbLCB (lanes 5 and 6),

MYMIV and CLCuMV (lanes 7 and 8). Soybean infected with MYMIV was used a positive control

(lane 1) and DNA extracted from a healthy N. benthamiana was used a negative control (lane 2).

Southern blot analysis with a probe of PedLCV (d) to show its presence in N. benthamiana inoculated

with MYMIV and PedLCV (lane 2-4) MYMIV, TbLCB and PedLCV (lanes 5-7). DNA extracted from

a healthy N. benthamiana was used a negative control (lane 1). Southern blot probed with CLCuMV

(e) to show presence of the virus in N. benthamiana inoculated with MYMIV and CLCuMV (lanes 2-

5). DNA extracted from a healthy N. benthamiana was used as a negative control (lane 1).

138

Table 5.2 Results of the co-inoculation of the components of MYMIV with PedLCV

and CLCuMV.

Inoculum Host species

Infectivity (plants infected/inoculated)

Symptoms Experiments Total

I II III

PedLCV N. benthamiana 6/6 5/5 6/6 17/17

Severe

upward leaf

curl

MYMIV+

PedLCV soybean

Positive for

MYMIV

(5/10),

Positive for

PedLCV (0/10)

Positive for

MYMIV

(5/10),

Positive for

PedLCV (0/10)

Positive for

MYMIV

(6/10),

Positive for

PedLCV (0/10)

Positive for

MYMIV

(16/30),

Positive for

PedLCV (0/30)

Yellow

mosaics on

leaves

MYMIV+

PedLCV

N. benthamiana

Symptomatic

(3/3), positive

for MYMIV-

A (3/3),

positive for

MYMIV-B

(0/3)

Symptomatic

(5/5), positive

for MYMIV-

A (5/5),

positive for

MYMIV-B

(0/5)

Symptomatic

(5/5), positive

for MYMIV-

A (5/5),

positive for

MYMIV-B

(0/5)

Symptomatic

(13/13),

positive for

MYMIV-A

(13/13),

positive for

MYMIV-B

(0/13)

Severe

upward leaf

curl

MYMIV+

PedLCV+ TbLCB

N. benthamiana

Symptomatic

(3/3), positive

for MYMIV-

A (3/3), positive for

MYMIV-B

(3/3)

Symptomatic

(3/3), positive

for MYMIV-

A (3/3), positive for

MYMIV-B

(3/3)

Symptomatic

(5/5), positive

for MYMIV-

A (5/5), positive for

MYMIV-B

(5/5)

Symptomatic

(11/11),

positive for

MYMIV-A

(11/11), positive for

MYMIV-B

(11/11)

Severe

downward leaf curl

MYMIV+

CLCuMV

N. benthamiana

Symptomatic

(10/10),

positive for

MYMIV-A

(10/10),

positive for

MYMIV-B

(9/10)

Symptomatic

(5/5), positive

for MYMIV-

A (5/5),

positive for

MYMIV-B

(5/5)

Symptomatic

(8/8), positive

for MYMIV-

A (8/8),

positive for

MYMIV-B

(8/8)

Symptomatic

(23/23),

positive for

MYMIV-A

(23/23),

positive for

MYMIV-B

(22/23)

Mild leaf

curl of

emerging

leaves

PedLCV+

TbLCB

N. benthamiana

6/6 3/3 3/3 12/12

Severe

downward leaf curl

5.3.4 Pseudo-recombination among legume-infecting begomoviruses

The ability of the components of MYMV, MYMIV and RhYMV to produce

viable reassortants (pseudo-recombinants) was examined by making reciprocal

exchanges (Table 5.3) in legumes. This study could not be carried out in the

experimental plant N. benthamiana since all three viruses were either non-infectious

139

or poorly infectious to this host. The results show that no combination of DNA-A and

DNA-B component, other than the cognate combinations, were viable and produced

systemic infections of legumes. The earlier analysis of iteron/IRD sequences of the

viruses showed that all three are different from each other (Chapter 3, Section 3.3.1 to

3.3.3) and the lack of interaction is most likely due to this Rep-iteron incompatibility.

Table 5.3 Study of infectivity of MYMIV, MYMV and RhYMV to legumes by

exchanging their components.

Inoculum Plant species

Infectivity (plants infected/inoculated)

Symptoms Experiments Total

I II III

MYMIV blackgram 7/10 8/10 8/10 23/30

Yellow

mosaics on

leaves

MYMV blackgram 4/10 4/10 5/10 13/30

Yellow

mosaics on

leaves

RhYMV soybean 4/10 2/10 5/10 11/30

Yellow mosaics with

cell death on

leaves

MYMIV DNA-A

and MYMV

DNA-B

blackgram 0/10 0/10 0/10 0/30 None

MYMIV DNA-A

and RhYMV

DNA-B

blackgram 0/10 0/10 0/10 0/30 None

MYMV DNA-A

and MYMIV

DNA-B

blackgram 0/10 0/10 0/10 0/30 None

MYMV DNA-A

and RhYMV

DNA-B

soybean 0/10 0/10 0/10 0/30 None

RhYMV DNA-A and MYMIV

DNA-B

soybean 0/10 0/10 0/10 0/30 None

RhYMV DNA-A

and MYMV

DNA-B

soybean 0/10 0/10 0/10 0/30 None

140

5.4 Discussion

At first glance the legume-infecting begomoviruses appear to be typical Old

World, bipartite begomoviruses. However, evidence is accumulating which suggests

that they are not typical of the rest of the bipartite begomoviruses. The LYMVs have

been shown to be genetically distinct from all other begomoviruses and are thought to

represent an evolutionarily ancient lineage. The lack of evidence for recombination

between the LYMVs and the other begomoviruses has been taken to indicate that they

are genetically isolated; possibly legumes not being hosts to the other viruses and

LYMVs not having a host range that extends to non-leguminous species (Qazi et al.,

2007). However, extensive evidence has been published showing the genetic

interaction between distinct LYMVs in the form of component exchange (also known

as pseudo-recombination). The LYMVs are thus interesting for study not only due to

the losses they cause to crops, but also due to their unusual biological characteristics.

Although component exchange is well documented for the LYMVs (reviewed

by Qazi et al., 2007) the experiments conducted here were unable to demonstrate

pseudo-recombination for the three viruses used in this analysis. For viruses with

multipartite genomes it is important for there to be a strong mechanism of maintaining

genome integrity, despite the long term evolutionary advantages of component

exchange (Jeske, 2009). For bipartite begomoviruses this is mediated by the highly

specific interaction between the Rep (specifically the iteron related domain at the N-

terminus of Rep; Argüello-Astorga and Ruiz-Medrano, 2001) and the Rep binding

sequences (the iterons; Argüello-Astorga et al., 1994) which are contained within the

CR shared by the two components. Analysis (Chapter 3, Section 3.3) showed that the

three viruses included in the analysis have very distinct predicted iterons and IRDs. It

is likely the lack of compatibility between the distinct iterons and IRDs, preventing

initiation of replication of heterologous components, is responsible for the lack of

pseudo-recombination, although the relatively low infectivity of the viruses to

legumes by Agrobacterium-mediated inoculation could also play a part in this.

Analysis of cases where pseudo-recombination has been shown to occur (in the

literature) indicates that in each case this is due to exchange of the CR from a DNA-A

component to an heterologous DNA-B component (known as “origin donation” [Qazi

et al., 2007] or “regulon grafting” [Saunders et al., 2002]). In these cases the DNA-B

has been made compatible by introducing suitable iterons into the DNA-B component

(from the DNA-A component) by recombination. Similar origin exchanges have also

141

been noted for the begomovirus-associated betasatellites (Saunders et al., 2001;

Briddon et al., 2001; Tao and Zhou, 2008) indicating that it is a general evolutionary

adaptation. Although, judging from the literature, one might conclude that for

LYMVs origin exchange occurs frequently, the results presented here suggest this

might not be the case. Certainly in one round of inoculation, no pseudo-recombination

was detected (no plants became infected). Possibly by using a more susceptible and

longer living host (such as a perennial leguminous weed), by inoculating a much

larger number of plants or by using a forced recombination system (as reported by

Schnippenkoetter et al., 2001) it may be possible to achieve a pseudo-recombination

event experimentally and thus gain some idea of the frequency of this occurring.

N. benthamiana is the model host of choice for the investigation of the

infectivity of many viruses, including the dicot-infecting geminiviruses. At least for

RNA viruses the highly susceptible nature of N. benthamiana has been attributed to it

encoding a mutant (possibly defective) variant of the RNA-dependant RNA

polymerase 1; a gene involved in anti-viral defense (Yang et al., 2004) All dicot-

geminiviruses investigated have been shown to be infectious to this host with the

exception of the LYMVs. Although relatively little work on the infectivity of LYMVs

to plants has been published, of the work that has been published, none reports

infectivity to N. benthamiana and only one report trying N. benthamiana as a host

(Maruthi et al., 2006 ). The reason for this now becomes clear, N. benthamiana is not

a host for the LYMVs. At very low efficiency, the viruses are able to move

systemically in this host but do not induce any noticeable symptoms. It has previously

been shown for a number of bipartite begomoviruses that, at low efficiency, the DNA-

A is capable of systemic infection in N. benthamiana in the absence of DNA-B

(Klinkenberg et al., 1989; Evans and Jeske, 1993; Briddon and Markham, 2001).

DNA-A is capable of autonomous replication in host cells (Evans and Jeske, 1993;

Regers et al., 1986; Townsend et al., 1986) whereas the DNA-B provides movement

functions (Noueiry et al., 1994; Frischmuth et al., 2007; Sanderfoot and Lazarowitz,

1995). The phenomenon of independent infection by DNA-A was attributed to the

method of inoculation (using Agrobacterium) since it did not occur following

inoculation by the biolistic method. Klinkenberg et al. (1989) suggested that

Agrobacterium-mediated inoculation induced cell division leading to shedding of

encapsidated DNA-A into the phloem. This was then able to spread in the phloem and

re-infect cells, at low efficiency, distal to the inoculation site. Due to the absence of

142

DNA-B, however, the infection was unable to spread further and induce symptoms.

The situation with the LYMVs is very similar, with the exception that, even in the

presence of DNA-B, a symptomatic infection does not ensue. This thus suggests that

the defect in LYMVs, with respect to lack of symptomatic infection of N.

benthamiana, rests with their DNA-B components. It is likely their DNA-B encoded

movement proteins (MP and NSP) are not well adapted to function in a non-

leguminous host and are unable to mediate movement of the viruses.

Inoculation of any of the LYMV DNA-A components with TbLCB led to a

full, symptomatic systemic infection, indicating that this betasatellite can complement

movement in N. benthamiana. This finding is in agreement with the results of Saeed

et al. (2007) who showed that CLCuMB can complement the movement functions of

ToLCNDV DNA-B by mediating the movement of the DNA-A in N. benthamiana.

This was the first evidence showing a possible virus movement function encoded by

betasatellites. The details of the mechanism of movement mediated by betasatellites

remain unclear. However, thus far, all functions encoded by betasatellites have been

shown to be mediated by βC1, the only gene product encoded by these satellites; this

includes suppression of post-transcriptional gene silencing (Gopal et al., 2007) and

symptom determination/pathogenicity (Saunders et al., 2004). The ability of TbLCB

βC1 expressed from a PVX vector to similarly mediate the movement of MYMIV

DNA-A (in both the presence and absence of DNA-B) confirmed this was due to βC1.

Further evidence for βC1 possessing a virus movement function was

provided by transient expression of this gene. Expressed under the control of the 35S

promoter, βC1 increased the numbers of plants in which DNA-A (or DNA-A and

DNA-B) was detectable in systemic leaves in comparison to experiments where DNA

A (or DNA-A and DNA-B) was/were inoculated in the absence of βC1. However, the

amount of DNA in infected tissue of plants was less than when βC1 was expressed

from the PVX vector, indicating that PVX itself has some part to play in this

phenomenon. Interestingly, when expressed transiently in the presence or absence of

MYMIV components, the plants remained symptomless, suggesting that the βC1

protein does not have the capacity to move systemically. This finding differs from the

results of a similar study involving CLCuMB βC1 and ToLCNDV DNA-A, which

induced mild systemic symptoms (Saeed et al., 2007). Since βC1 is a strong symptom

determinant, and the symptoms induced in their experiment were not typical of this

protein, it is possible that the differences in their results in comparison to our findings

143

are due to the different viruses used. ToLCNDV is well adapted to plants of the

Solanaceae and it is thus possible that the DNA-A of this virus has some ability to

move out of the phloem and replicate in additional tissues distal to the inoculation site

and thus induce symptoms.

Lack of infectivity of MYMIV to N. benthamiana is probably due to lack of

adaptation of the products encoded by DNA-B which have limited ability to mediate

virus movement in this host. However DNA-B appears to have some role to play

since its presence increases the infectivity of DNA-A and TbLCB from 60% to 100%

of inoculated plants. Based on the hypothesis put forward by Klinkenberg, Ellwood

and Stanley (1989), as described earlier, it would appear that despite its lack of

adaptation to N. benthamiana, the DNA-B may be able to provide some movement

function in this host, possibly pushing more virus into the phloem. This is supported

by the fact that inoculation with the MP gene under the control of the 35S promoter

increased infectivity of DNA-A and TbLCB from 60% to 100% of inoculated plants.

Since expression of NSP had no effect on proportion of plants infected, it also shows

that the effect is mediated by MP. For bipartite begomoviruses, MP is the major

symptom determinant, and the expression of this protein induces disease-like

symptoms (Brough et al., 1988; Duan et al., 1997; Etessami, et al., 1988; Hou et al.,

2000; Ingham et al., 1995; Pascal 1993). Here we have shown that expression of the

MP of MYMIV from a PVX vector in N. benthamiana induces cell death at the site of

inoculation and severe leaf curling (as will be presented in Chapter 6, Section 6.3.1)

in systemic leaves which is an indication of its importance in pathogenicity.

To further investigate the reason for the restricted movement of DNA-B of

LYMVs in N. benthamiana, the genes encoded by MYMIV DNA-B were individually

mutated and inoculated with DNA-A. No significant effect of these mutations was

observed on infectivity of MYMIV to N. benthamiana. However, DNA-B with a

double mutation produced somewhat unexpected results. All N. benthamiana

inoculated with DNA-A, DNA-BΔNSPΔMP

and TbLCB were symptomless and no viral

DNA was detected in systemic leaves by PCR. This was surprising since inoculation

of DNA-A with TbLCB typically gave an infectivity of 60% in plants. Since in this

case neither of the DNA-B gene products is expressed, it is likely that this lack of

spread of MYMIV DNA-A is due to interference in replication. Nevertheless the lack

of any detectable viral DNA in systemic leaves is surprising and difficult to explain

without further investigation. A possibly similar situation, of replicational interference

144

has been encountered with betasatellites. Saunders et al. (2001) showed that in

infections of Ageratum conyzoides involving AYVV and a recombinant betasatellite,

containing the origin of replication of AYVV, symptoms were less severe and virus

DNA levels were less than in infections involving the cognate betasatellite, Ageratum

yellow vein betasatellite. For a similar recombinant betasatellite of Tomato yellow

leaf curl China betasatellite (TYLCCNB) and Tomato yellow leaf curl China virus

(TYLCCNV), Tao and Zhou (2008) showed that infections involving the recombinant

betasatellite, TYLCCNV and TYLCCNB led to reduced accumulation of viral DNA,

presumably due to replicational interference. It is thus possible that in the case

described here, involving MYMIV DNA-A, TbLCB and a DNA-B with both genes

mutated, that maintenance of two molecules (DNA-B and the betasatellite) with

distinct but compatible origins of replication reduce virus replication to such an extent

that insufficient betasatellite is produced and hence insufficient βC1 is expressed to

allow systemic spread. However, care needs to be taken in interpreting all these

results with mutants of DNA-B of MYMIV since the differences in numbers of plants

infected systemically are small and a far greater number of plants would need to be

analysed to obtain statistically significant results.

Complementation of movement for bipartite begomoviruses has been

investigated in some depth. For example, Frischmuth et al. (1993) investigated the

ability of Old and New World bipartite begomoviruses to trans-complement the

movement of heterologous DNA-A components in the absence of the cognate DNA-B

component. They concluded that there was an evolutionary divergence between Old

and New World begomoviruses, based on the demonstration that an Old World virus

could complement the movement of New World DNA-A components but that the

reciprocal was not successful. Also, Briddon et al. (2001) demonstrated that a

curtovirus and a topocuvirus could complement the movement of the DNA-A

components of both a New World and an Old World bipartite begomovirus in the

absence of their cognate DNA-B components. Here we have extended these earlier

findings to show that monopartite begomoviruses can facilitate the movement of a

bipartite begomovirus. PedLCV and CLCuMV can complement movement of

MYMIV in N. benthamiana. Since the host range of MYMIV does not extend to N.

benthamiana (as discussed earlier), the findings also show that the complementation

by monopartite begomoviruses (and possibly bipartite begomoviruses, although that

possibility was not investigated here) also has the capacity to increase the host range

145

of LYMVs. Thus in this case the components of MYMIV were able to systemically

infect N. benthamiana at high efficiency in the presence of either PedLCV or

CLCuMV. This has important epidemiological implications. It suggests that, in spite

of their strict host range limitation (to legumes), LYMVs can use non-leguminous

plant species as intermediate hosts, and possibly also as “overwintering” hosts, by

associating with begomoviruses that infect non-leguminous hosts. Of course this

requires that a polyphagous B. tabaci biotype (one that feeds on leguminous as well as

non-leguminous plants) be present for transmission of the viruses. The presence of

PedLCV (Chapter 3), Tomato leaf curl Karnatka virus (Raj et al., 2006a) and Cotton

leaf curl Kokhran virus (Raj et al., 2006b) in soybean, Tomato leaf curl New Delhi

virus in pigeonpea (Raj et al., 2005) and cowpea (Reddy et al., 2005) may be

evidence supporting this theory. These viruses possibly being the “helper viruses” that

were used by the LYMVs to overwinter in a non-leguminous host prior to infection of

the legume crop in which they were identified.

146

Chapter 6

Plant responses to transient expression of MYMIV genes and a study

of RNAi-mediated resistance

6.1 Introduction

A gene is the basic unit of heredity in a living organism. It expresses itself in

the form of protein and plays its role. While whole genome sequences are the basis of

further characterization, the identification of gene functions is needed for further

functional genomics based on genome sequences. In addition to comprehensive

expression analysis with a DNA microarray to characterize gene expression, the

ectopic expression of a target gene in heterologous host cells is useful for

understanding gene functions. RNA virus based vectors such as Potato virus X (PVX)

have been proved a very useful tool for this purpose. The PVX vector (pGR107; Lu et

al., 2003) itself gives very mild symptoms in solanaceous plants such as N.

benthamiana and N. tabacum. However, when a gene is inserted in the vector under

the control of the duplicated coat protein promoter it is expressed along with the other

PVX proteins during infection. The PVX vector has been used to express numerous

foreign genes in many host plants (Roggero et al., 2001). For example, PVX-mediated

expression of the CP gene of Turnip crinkle virus mediates suppression of RNA

silencing (Thomas et al., 2003). Similarly a chimaeric virus PVX-p22 containing p22

of Tomato bushy stunt virus (TBSV) trans complement TBSV cell-to-cell movement

mutant and PVX-p19 containing p19 of same virus induced systemic necrosis in N.

benthamiana (Scholtof et al., 1995).

Gene silencing techniques are also good for characterizing gene functions in

target cells since the disruption of gene expression often shows a more critical

phenotype. In geminiviruses, Tomato golden mosaic virus (Peele et al., 2001;

Kjemtrup et al., 1998 ), Cabbage leaf curl virus (Muangsan et al., 2004, Turnage et

al., 2002), African cassava mosaic virus (Fofana et al., 2004) and Tomato yellow leaf

curl China betasatellite (Tao X and Zhou, 2004) have been used as silencing vectors.

The PVX vector is also used as Virus-Induced Gene Silencing (VIGS) vector

(Lacomme and Chapman, 2008; Faivre et al., 2004) in which plant endogenous genes

are silenced using viruses. One example of the use of the PVX as a VIGS vector was

in the down regulation of RdR6 in N. benthamiana. This silencing made N.

147

benthamiana susceptible to many RNA viruses (Qu et al., 2005). RDR6 is a putative

RNA dependent RNA polymerase (RdRP) originally identified as required for RNA

silencing of transgenes (Dalmay et al., 2000; Mourrain et al., 2000). RDR6 has been

shown to be necessary for the continued silencing of a transgene after the complete

elimination of inducer RNA, the cell-to-cell movement of the RNA silencing signal,

and the spread of silencing along the target RNA to sequences beyond the region that

is homologous to the trigger molecule (Dalmay et al., 2001; Himber et al., 2003;

Klahre et al., 2002; Vaistij et al., 2002). VIGS differs from transgene-mediated

silencing at the initiation stage because the primary dsRNA inducer is generally

thought to be the viral double-stranded replication intermediates, hence circumventing

the requirement of a host RdRP. However, virus-induced silencing is similar to

transgene-mediated silencing at the maintenance stage in that both require siRNA

amplification and an intercellular silencing signalling. Indeed, several studies have

shown that plant viral silencing suppressors function primarily by preventing the

movement of silencing signals out of the initially infected cells (Havelda et al., 2003;

Qu and Morris, 2002; Qu and Morris, 2003; Voinnet et al., 2000). Therefore, plants

encoding defective RDR6 would be expected to become more susceptible to virus

infections.

Gene silencing through RNA interference (RNAi) is also used for the

development of resistance in plants against viruses. In RNAi double-stranded RNA

(dsRNA) molecules are generated. The resulting dsRNA molecules are digested into

21-25 nucleotide-long small interfering RNA (siRNA) by Dicer (an RNaseIII like

enzyme). This siRNA acts as a template for the targeted degradation of messenger

RNA (mRNA) by RISC (RNA-induced silencing complex). In general RNAi has two

potential mechanisms for down-regulating gene expression; post transcriptional gene

silencing (PTGS) through either mRNA degradation or translational arrest, and

transcriptional gene silencing (TGS) via the methylation of DNA (Baulcombe, 2004).

The suppression of gene expression by RNAi was used before the discovery of the

mechanisms of gene silencing. Plants carrying a transgene derived from the replicase

genes of PVX (Mueller et al., 1995), Cowpea mosaic virus (Sijen et al., 1995) and

Pepper mild mottle tobamovirus (Tenllado et al., 1995, 1996) were resistant to related

viruses. Tobacco plants expressing a transgene encoding the CP of subgroup II strain

of Cucumber mosaic virus were resistant to the strain of same subgroup (Jacquemond

et al., 2001). PTGS of the p23 silencing suppressor of Citrus tristeza virus confers

148

resistance to the virus in transgenic Mexican lime (Fagoaga et al., 2006). RNAi has

also been used for resistance against geminiviruses.

In their response to pathogens, plants sometimes respond with programmed

cell death, known as hypersensitive response (HR), at the site of contact. HR occurs in

race-specific disease resistance mediated by a host disease R (resistance) gene and the

corresponding pathogen avr (avirulence) gene in an allele-specific manner (Flor,

1971). It is characterized by rapid calcium and other ion fluxes, an extracellular

oxidative burst, and transcriptional reprogramming (Scheel, 1998). HR and disease

resistance are intricately linked in plants, exemplified by the simultaneous induction

of disease resistance and activation of cell death upon pathogen recognition by R

proteins. A number of signalling molecules are involved in disease resistance

including reactive oxygen species (ROS), salicylic acid (SA), and nitric oxide

(Shirasu and Schulze-Lefert, 2000). ROS accumulate preceding cell death during HR,

with biphasic oxidative bursts (Lamb and Dixon, 1997).

6.2 Methodology

MYMIV potentially encodes nine genes on its two genomic components. All

these genes were individually amplified by PCR with specific primers (Table 2.1)

from cloned DNA-A (MI15) and DNA-B (MI21) components; clones which were

previously shown to be infectious to legumes (Chapter 4). Each gene was cloned in

pTZ57R/T using an InsTAclone PCR Cloning Kit (Fermentas) and then transferred to

the PVX vector pGR107 and a movement deficient version of this PVX vector. The

movement deficient PVX was kindly provided by Ms. Javaria Qazi who mutated the

25K movement protein essentially as described by Morozov et al. (1997). AV2, CP,

AC5, REn, TrAP, Rep and AC4 were cloned in the PVX and the movement deficient

PVX vector at SmaI and SalI using restriction sites introduced in the primers.

Similarly NSP was cloned at ClaI and SalI and MP was cloned at ClaI and SmaI

restriction sites. For cloning of the βC1 gene from TbLCB in the PVX vector, it was

amplified with specific primers (βC1-PVX Forward and βC1-PVX Reverse; Table

2.1) and cloned in pTZ57R/T by using an InsTAclone PCR Cloning Kit (Fermentas)

and then transferred to the PVX vector at SmaI and SalI restriction sites. All PVX

constructs were transferred to Agrobacterium strain GV3101 and agroinoculated to

Nicotiana benthamiana and Nicotiana tabacum.

149

To replace the CP gene of MYMIV DNA-A (MI15) with GFP, specific

primers (A6GFPF and A6GFPR; Table 2.1) were used to amplify DNA-A without the

CP gene. Restriction sites MluI and SalI were included in the forward and reverse

primers respectively. The amplified product was cloned in pTZ57R/T in such a way

that the SacI restriction site in the MCS of pTZ57R/T was adjacent to the MluI site of

amplified fragment. The GFP gene (Kindly provided by Dr. Saeed) was amplified

with primers (MIGFPF and MIGFPR; Table 2.1) with a SalI site included in the

forward primer and an MluI site in the reverse primer. The product of about 0.7 kb

was cloned in pTZ57R/T in such a way that the SacI restriction site in the MCS of

pTZ57R/T and the MluI site in the amplified product were on opposite ends. The GFP

gene was excised from pTZ57R/T with MluI and SacI, gel purified and ligated with

linearized (digested with MluI and SacI) DNA-A without CP in pTZ57R/T. In this

way a 2.7 kb DNA-A component was produced in which CP had been replaced with

GFP and the AV2 gene was truncated (DNA-A-GFPΔAV2

). To produce a partial dimeric

clone of DNA-A-GFPΔAV2

, it was digested with SalI and EcoRI and an approx. 1.25 kb

DNA fragment was cloned in the binary vector pBin19 (Bevan, 1984). This partial

fragment of DNA-A in pBin19 was digested with SalI and the full length insert of

DNA-A-GFPΔAV2

was ligated into it to produce a partial direct repeat construct of the

component. DNA-A-GFPΔAV2

along with DNA-B of MYMIV was agroinoculated to

blackgram and soybean and both components along with TbLCB were agroinoculated

to N. benthamiana.

The AV2 gene encoded by the DNA-A component of MYMIV from

mungbean (MI15) was mutated using a unique BamHI restriction site (nucleotide

position 161). The full-length insert of clone MI15 was cloned in a pBluesript vector

lacking a BamHI site in the MCS. The unique BamHI site was digested and the 3′

recessed ends of the DNA were in-filled by using Klenow fragment in a reaction

mixture of 20 µl containing 0.1-4 µg digested DNA, 2 µl of 10X Klenow reaction

buffer (500 mM Tris-HCl [pH8.0 at 25 ˚C], 50 mM MgCl2, 10 mM DTT) 0.05 mM

dNTPs and 1-5u Klenow fragment. The reaction mixture was incubated at 37 ˚C for

10 minutes and the reaction was stopped by heating to 75˚C for 10 minutes. In this

way a frame shift mutation was introduced by adding four nucleotides in the DNA

and the BamHI restriction site was lost. This AV2 mutated DNA-A component

(DNA-AΔAV2

) was used to produce a partial direct repeat construct for

agroinoculation. DNA-AΔAV2

was digested with HindIII and BamHI and an approx.

150

1.8 kb DNA fragment was cloned in pBin19. This partial clone of DNA-AΔAV2

in

pBin19 and full length clone of DNA-AΔAV2

in pBluescript II KS/SK (+) vector were

digested with HindIII and full length insert of DNA-AΔAV2

was ligated into the

linearised pBin19 clone.

To silence the RNA-dependent RNA polymerase 6 (RdR6) in N. benthamiana,

specific primers (RdR6F and RdR6R; Table 2.1) were designed on the basis of the

sequence of RdR6 from N. benthamiana (accession no.AY722008; Qu et al., 2005).

A 1003 nucleotides long N-terminal fragment of RdR6 was PCR amplified and cloned

in the PVX vector (pGR107) in antisense orientation at SalI and ClaI sites. This clone

was transferred to Agrobacterium strain GV3101.

An antisense construct of the Rep gene encoded by the DNA-A component of

MYMIV (MI15), was produced by digesting the clone with ClaI and XhoI to yield a

409 nt. fragment. This was cloned in the PVX vector pGR107 in an antisense

orientation (asRep-PVX) at ClaI and SalI sites and transferred to Agrobacterium

strain GV3101.

6.3 Results

6.3.1 Transient expression of MYMIV genes from the PVX vector

The AV2 gene (also known as the pre-coat protein gene) when expressed from

the PVX vector in N. benthamiana induced a hypersensitive response (HR),

characterised by cell death, at the site of inoculation one week after inoculation (Fig.

6.2a). The first symptoms of infection (mild leaf curling) appeared ten days after

inoculation. After two weeks there was severe downward leaf curl of emerging leaves

(Fig. 6.2b) and plants exhibited stunted growth and flower setting started early. This

contrasted with plants inoculated with the PVX vector (with no insert) which showed

a very mild vein yellowing on leaves (Fig. 6.1b) appearing ten days after inoculation.

There was no effect of AV2 expression on N. tabacum. Plants exhibited only

symptoms typical of PVX (mild vein yellowing) in this host (Fig. 6.1d).

Expression of the MYMIV coat protein (CP) in N. benthamiana from PVX

induced mild leaf crumpling approx. thirteen days after inoculation which gradually

increased in severity. Emerging leaves were severely deformed and showed a

pronounced vein yellowing (Fig. 6.2d). Growing points of the plants were severely

affected and growth ceased (Fig. 6.2c). There was no effect of CP expression on N.

tabacum, with Plants only expressing the symptoms typical of PVX.

151

In N. benthamiana PVX-mediated expression of AC5 gave a mild leaf curl

and light green mosaics across the leaf lamina approx. twelve days after inoculation.

Mosaics continued to increase in size with time and fused with each other leaving just

a few dark green islands (Fig. 6.2e and f). However, in N. tabacum no obvious

phenotype resulted from AC5 expression with only symptoms typical of PVX evident.

PVX-mediated expression in N. benthamiana of the MYMIV TrAP gave HR

at inoculation site after one week (Fig.6.3a). Leaf curling appeared in emerging leaves

and after approximately thirteen days necrosis was evidenced along the veins in

mature leaves (Fig. 6.3b). After three weeks leaves were severely necrotic and

bleached (Fig. 6.3c). In N. tabacum expression of TrAP induced only an HR at the

site of inoculation (Fig. 6.3d).

Expression of Rep of MYMIV from the PVX vector in N. benthamiana

induced cell death at inoculation site on leaves after one week. No other symptoms

appeared until approx. fifteen days after incoulation when a mild necrosis became

evident along the veins of emerging leaves. Mild leaf curling was also seen in some

leaves (Fig. 6.3e and f). Necrosis persisted for 4 to 5 days without further increase in

severity and after this symptoms on affected leaves gradually faded and newly

emerging leaves were symptomless. Expression of Rep in N. tabacum induced no

discernable phenotype beyond the typical symptoms of PVX.

In N. benthamiana infected with PVX expressing the AC4 gene the first

symptoms (mild leaf curling and vein yellowing) appeared after ten days. At fifteen

days post-inoculation there was a pronounced downward leaf curling, vein yellowing

and thickening and necrosis along the veins, particularly at the base of the leaves

(Fig.6.4a and b).

Expression of the MP induced an HR at the site of inoculation on leaves in N.

benthamiana (Fig.6.4c). This was followed by a severe downward leaf curling and

necrosis along the veins on leaves (Fig. 6.4d) after eleven days. Expression of MP in

N. tabacum induced no phenotype except the typical symptoms of PVX.

MYMIV REn and NSP expressing from the PVX vector did not result in a

phenotype in N. benthamiana and N. tabacum beyond that induced by the vector

alone. The results of the expression of the genes of MYMIV from the PVX in N.

benthamiana are summarised in Table 6.1. Additionally the MYMIV genes were

cloned in a version of the PVX vector with the triple gene block 25K gene mutated.

When inoculated to N. benthamiana none of the MYMIV gene products were able to

152

complement the 25K mutation; none of the genes allowed PVX to spread systemically

as judged by the production of symptoms on newly emerging leaves.

Fig. 6.1 Photographs of healthy plants of N. benthamiana (a), N. tabacum (c) and plants of each species

(N. benthamiana [b], N. tabacum [d]) infected with PVX. Photographs were taken approx. 20 days

after inoculation.

153

Fig. 6.2 Photographs of N. benthamiana plants infected with PVX expressing the MYMIV AV2 (a and

b), PVX expressing the MYMIV coat protein (c and d) and PVX expressing the MYMIV AC5 (e and

f). Photographs were taken approx. 20 days after inoculation.

154

Fig. 6.3 Symptoms induced by PVX expressing the TrAP of MYMIV in N. benthamiana (a-c) and in

N. tabacum (d) or the Rep of MYMIV in N. benthamiana (e and f). Photographs were taken approx. 20

days after inoculation.

155

Fig. 6.4 Symptoms induced by expression of AC4 (a and b) and MP (c and d) of MYMIV and βC1 (e

and f) of TbLCB from the PVX vector in N. benthamiana. Photographs were taken approx. 20 days

after inoculation.

156

Table 6.1 Summary of the results of the expression of MYMIV genes from the PVX

vector in N. benthamiana.

Gene Latent period *(days) Symptoms

PVX (no insert) 10 Mild veins yellowing and thickening and very light

mosaics on lamina.

AV2 10

Cell death at inoculation site, severe downward

curling of top leaves, stunted growth, early

flowering.

CP 13 Mild leaf crumpling, emerging leaves were

deformed and vein yellowing.

AC5 12 Mild leaf curling, appearance of light green angular

mosaics across the leaf .

REn 10 Only PVX symptoms

TrAP 13

Cell death at the site of inoculation, leaf crumpling

and necrosis along the veins, after three weeks

leaves exhibited a severe chlorotic mosaic.

AC4 10

Downward leaf curling, vein yellowing and

thickening. Necrosis along the veins, particularly at

the base of the leaves.

Rep 15 Cell death at the site of inoculation, mild necrosis

along the veins, symptoms recovered after 25 days.

NSP 10 Only PVX symptoms

MP 11 Cell death at the site of inoculation, severe

downward leaf curling and necrosis along the veins.

*Time between inoculation and appearance of first symptoms.

6.3.2 Expression of TbLCB βC1 gene from the PVX vector

The βC1 gene of TbLCB when expressed from the PVX vector induced very

severe leaf curling, stem deformation and enations on underside of leaves in N.

benthamiana (Fig. 6.4e and f). There was no response to expression of this gene in N.

tabacum with only symptoms typical of PVX evident.

157

6.3.3 Mutation of MYMIV AV2 and replacement of CP gene with the GFP gene

To study the importance in infectivity of MYMIV to legumes and as a

potential candidate for replacement with reporter genes, the CP gene was replaced

with the GFP gene. However in this replacement the AV2 coding sequence was also

truncated. A partial tandem repeat construct of MYMIV DNA-A-GFPΔAV2

along with

the DNA-B was agroinoculated to mungbean, blackgram and soybean but no infection

resulted and no GFP expression could be seen in inoculated plants under UV

illumination. The construct was also inoculated to N. benthamiana along with TbLCB

but again no infectivity was evident and no GFP expression was detected.

Bull et al. (2007) showed that for EACMZV CP and AV2 expressions were

closely linked and mutation of AV2 down regulated CP expression. Plants infected

with the mutant had low levels of viral DNA accumulation. To study the importance

of AV2 in the infectivity of MYMIV to legumes the AV2 gene was mutated. The

mutant virus, DNA-AΔAV2

, and DNA-B of MYMIV were agroinoculated to

blackgram. All inoculated plants remained symptomless and no virus could be

detected in newly emerging leaves of inoculated plants by PCR. However control

plants inoculated with wild type MYMIV were infected (Table 6.2).

Table 6.2 Study of the effect of the mutation of the CP and AV2 on infectivity of

MYMIV to plants.

Inoculum Plant species

Infectivity (plants infected/plants

inoculated)

Symptoms Experiment Total

I II III

MYMIV DNA-A

+ DNA-B

blackgram 7/10 8/10 8/10 23/30

Yellow mosaics

on leaves

MYMIV DNA-A-GFPΔAV2

+ DNA-B

blackgram 0/20 0/20 0/20 0/60 None

MYMIV DNA-A

+ DNA-B

soybean 6/10 7/10 6/10 19/30

Yellow mosaics

on leaves

MYMIV DNA-A-GFPΔAV2

+ DNA-B

soybean 0/20 0/20 0/20 0/60 None

MYMIV DNA-A

+ DNA-B + TbLCB

N. benthamiana 6/6 6/6 6/6 18/18 Leaf curling

MYMIV DNA-A-GFPΔAV2

+ DNA-B + TbLCB N. benthamiana

0/6 0/6 0/6 0/18 None

MYMIV DNA-A-ΔAV2

+ DNA-B

blackgram 0/20 0/20 0/20 0/60 None

158

6.3.4 Silencing of RdR6 in Nicotiana benthamiana

In contrast to all other dicot-infecting geminiviruses, MYMIV does not

systemically infect N. benthamiana. The analyses conducted in Chapter 5 have shown

that this lack of infectivity is likely due to poor adaptation of the gene products

encoded by MYMIV DNA-B. Thus, although the virus can replicate in N.

benthamiana, it appears unable to spread from the site of inoculation. This is despite

the fact that N. benthamiana has a mutant (possibly non-functional) RDR1, which is

believed responsible for the highly susceptible nature of this plant species to a range

of phytopathogenic viruses (Yang et al., 2004b). Qu et al. (2005) showed that down-

regulation of RDR6 in N. benthamiana led to an enhanced susceptibility of this

species to a range of RNA viruses. To investigate the possible involvement of this

gene in the lack of infectivity to N. benthamiana of MYMIV, RdR6 was silenced by

VIGS using the PVX vector. RdR6 silenced plants were agroinoculated with MYMIV

infectious clones and after three weeks tested for the presence of the virus. All

inoculated plants were showing the typical symptoms of PVX infection and 9 out of

20 (45%) plants were positive (by PCR diagnostics) for both components of MYMIV

in systemic tissues. Control plants, which were inoculated with the components of

MYMIV and just the PVX vector (with no additional gene) also showed the presence

of the virus in 6 out of 20 (30%) plants. Plants which were inoculated only with

MYMIV were symptomless and 3 out 20 plants (15%) were positive for the virus.

This indicates that RDR6 has an effect on the ability of MYMIV to infect N.

benthamiana. Down-regulation of the expression of this gene leads to an increase in

the numbers of plants that ultimately contain MYMIV in systemic tissues.

6.3.5 Investigation of the use of RNAi to provide resistance against MYMIV in

plants

Due to the problem of stable transformation, RNAi studies are difficult in

legumes. The lack of infectivity of MYMIV to N. benthamiana (Chapter 4) precludes

using this model host for investigating the use of RNAi to obtain resistance to

MYMIV. A novel strategy was thus adopted to investigate the potential use of RNAi

to provide resistance against this virus in N. benthamiana. TbLCB, which was shown

to mediate full symptomatic systemic infection of MYMIV (or even only the DNA-A

component of this virus; Chapter 5), was used to assist the virus in N. benthamiana,

159

allowing RNAi constructs which target the DNA-A component to be tested transiently

for their ability to provide resistance against the virus.

An antisense construct of the central region of the Rep gene of MYMIV was

produced in the PVX vector (asRep-PVX). Plants were agroinoculated with asRep-

PVX, the DNA-A and DNA-B components of MYMIV and TbLCB. Twenty days

after inoculation 2 out of 20 (10%) plants showed the symptoms typical of infection

of MYMIV supported by TbLCB, exhibiting severe leaf curling (as discussed in

Chapter 5). The remainder of the plants showed only enhanced PVX-like symptoms

(vein yellowing, thickening and mosaics on lamina), symptoms also exhibited by

plants inoculated with only asRep-PVX. In contrast, all plants (twenty in number)

inoculated with the components of MYMIV and TbLCB showed the severe symptom

phenotype. Southern blot analysis showed that in the plants co-inoculated with

MYMIV, TbLCB and the asRep-PVX construct, MYMV DNA-A could be detected

at low levels in a small number but was no detectable in others. However, in plants

inoculated with only the components of MYMIV and TbLCB viral DNA levels were

high (Fig 6.5).

This brief study thus shows that firstly the use of TbLCB to overcome the lack

of infectivity of MYMIV to N. benthamiana can be useful for assessing the efficacy

of resistance in this model host plant species and secondly that RNAi-mediated

resistance has the potential to yield resistance to MYMIV. Further experiments are

now required to demonstrate the reproducibility of these results.

160

Fig. 6.5 Southern blot probed for the presence of MYMIV DNA-A. Samples run on the gel were total

nucleic acids extracted from N. benthamiana plants co-agroinoculated with the DNA-A and DNA-B

components of MYMIV, TbLCB and asRep-PVX (lanes 3-6) or MYMIV DNA-A, DNA-B and

TbLCB (lanes 7-10). Nucleic acids in lanes 1 and 2 were extracted from a soybean plant

experimentally infected with MYMIV and a healthy N. benthamiana, respectively. Approximately 10

µg of total DNA was loaded in each case. The position of ssDNA is indicated by an arrow.

6.4 Discussion

The work described here represents the first study of the phenotypes induced

by the transient expression of each of the genes of MYMIV in N. benthamiana in the

absence of other geminiviral proteins. N. benthamiana is not a host for MYMIV

(Chapter 4, Section 4.3.1) and therefore this study may provide an insight into virus-

non-host interactions, possibly providing information on the lack of adaptation of this

virus to N. benthamiana.

Of the MYMIV genes only two, REn and NSP, did not induce a phenotype in

N. benthamiana, when expressed from PVX, above and beyond the mild vein

yellowing symptoms induced by the vector itself. REn is a protein required by the

majority of dicot-infecting geminiviruses for optimal genome replication (Settlage et

al., 2005), although it is not essential for replication. It is a homo-oligomer that

interacts with Rep and at least three host encoded proteins, PCNA, pRBR and a

transcription factor in the NAC family (Settlage et al., 2005; Selth et al., 2005).

161

Evidence suggests that REn acts by protein-protein interactions since no catalytic

activity has been demonstrated for this protein. TGMV mutants with the REn gene

mutated replicated far less efficiently than their wild-type counterparts (giving lower

viral DNA levels) with delayed and attenuated symptoms (Sunter et al., 1990).

Expression of the ToLCV REn gene from a TMV vector caused stunting in N.

benthamiana (Selth et al., 2004) which may be due to the protein interfering with cell-

cycle, possibly by interactions with pRBR. The lack of apparent effect due to similar

expression of the MYMIV REn protein from a PVX vector may thus indicate that this

is unable to interact with one or more host factors and hence could be the reason for

poor replication of the virus in N. benthamiana. However experiments have shown

that MYMIV DNA-A can replicate to normal level in the presence of TbLCB in this

host (Chapter 5), suggesting that this is not the case. The lack of a phenotype induced

may thus indicate either that REn does not contribute significantly in replication of

MYMIV in N. benthamiana or that it can interact with host factor without affecting

the normal phenotype of the plant. It is possible that the effects of REn expression are

minor, not evident at the whole plant level, requiring microscopy to detect. Future

studies should investigate this possibility.

Although PVX-mediated expression of MYMIV NSP in N. benthamiana did

not elicit a phenotype, expression of the MP induced downward leaf curling, necrosis

at the site of inoculation and a systemic veinal necrosis. This is consistent with a

number of previous studies of (bipartite) New World begomoviruses (Duan et al.,

1997; Hou et al., 2000; von Arnim and Stanley, 1992b; Smith and Maxwell, 1994)

and indicates that MP is a symptom determinant. However, these results differ from a

similar study of the bipartite Old World begomovirus Tomato leaf curl New Delhi

virus (ToLCNDV; Hussain et al., 2005), using both PVX expression and stable

transformation, that showed the NSP to be the pathogenicity determinant and the MP

to induce no noticeable effects. This may thus suggest that MYMIV is more similar to

New World begomoviruses, in its behaviour with respect to the DNA-B encoded

genes, than to the Old World viruses. However, there are few bipartite begomoviruses

identified in the Old World and no others have yet been studied and it is thus

premature to draw any definite conclusions from this.

In common with the NSP of ToLCNDV and the MP of Bean dwarf mosaic

virus (the pathogenicity determinants of each of these viruses), expression of the MP

of MYMIV induces necrosis. This indicates that in N. benthamiana the MYMIV MP

162

is an avirulence determinant that induces a hypersensitive response (HR). The HR is

associated with specific recognition (of the pathogen-encoded avirulence gene) and

resistance (determined by a host-encoded resistance [R] gene) to infection by a range

of plant pathogens. This gene-for-gene interaction is often accompanied by the

collapse of challenged host cells (Morel and Dangl, 1997; Dangl et al., 1996)

resulting in a necrotic lesion that is believed to contribute to containment of the

pathogen. However, there are examples in which the HR and resistance have been

uncoupled (Kim and Palukaitis, 1997; Morel and Dangl, 1997). This thus suggests

that N. benthamiana encodes an R gene that recognises the MP (the avirulence

determinant) of MYMIV. However, inoculation of MYMIV to N. benthamiana does

not induce an HR. Possibly this is due to the low level of replication of MYMIV

DNA-B in this species (as discussed in Chapter 4) or that MP is expressed at such low

levels that the HR is not visible. The expression of geminivirus genes is strictly

controlled during virus infection and it is thus possible that insufficient MP is

expressed to induce a prominent HR. Alternatively it is possible that the virus encodes

a second factor which is able to overcome (prevent) the HR, as has been documented

for ToLCNDV (Hussain et al., 2005). It is noticeable that the HR is unable to contain

the PVX expressing MYMIV MP, leading to systemic veinal necrosis. Nevertheless,

it is possible that the host response of N. benthamiana to MYMIV MP plays some

role in the lack of infectivity of this virus to this plant species.

The AV2 gene sequence is well conserved among begomoviruses from the

Old World (Padidam et al., 1996) but its phenotypic behaviour in plants is variable.

Expression of AV2 of MYMIV from PVX induces HR at the inoculation site but this

recognition does not prevent PVX spreading systemically and the virus can move on

and induce severe downward curling of new leaves and stunted growth. AV2 of

EACMCV induces a mild mottling (Reddy et al., 2008), V2 of CLCuKV exhibits

downward leaf curling, yellowing of leaves and systemic necrosis and V2 of ToLCV

caused stunting of N. benthamiana (Selth et al., 2004). Although the V2 of different

viruses appear to interact with host factors in different ways they seem to provide

similar function to monopartite and bipartite viruses such as overcoming host

defences mediated by post transcriptional gene silencing as well as movement

(Zrachya et al., 2006; Rojas et al., 2001; Rothenstein et al., 2007). Earlier results, that

MYMIV with the AV2 gene disrupted was not infectious to legumes (as mentioned

above in section 6.3.3) and these results that transient expression of AV2 of MYMIV

163

induce host response are consistent with the involvement of this protein in virus

movement.

Expression of the CP of ToLCV from a Tobacco mosaic virus based vector in

Nicotiana spp. induced no discernable phenotype (Selth et al., 2004). This is the only

report of the transient expression of a CP of a geminivirus in plants that is available in

the literature. However, much earlier studies, using the CPs of ACMV and TYLCV,

produced transgenic N. benthamiana and tomato, respectively, constitutively

expressing these genes (Frischmuth and Stanley, 1998; Kunik et al., 1994). Neither

paper specifically refers to any phenotype due to the transgenic expression of the CP.

Similarly Shivaprasad et al. (2006) produced transgenic N. tabacum lines

constitutively expressing the CP of MYMV which were phenotypically normal. The

demonstration here that PVX-mediated expression of the MYMIV CP induces leaf

crumpling and vein yellowing in N. benthamiana, is thus somewhat unusual. The

effects on the plant were very severe with severely deformed young leaves that were

greatly reduced in size, and plants ceased growth. The CP is the only structural

protein of geminiviruses; it forms the typical geminate particles from which the

family derives its name. It is vector determining and thus has to interact with both

plant hosts and arthropod vectors (Briddon et al, 1990). It plays a part in virus

movement. For monopartite begomoviruses it is essential and mutation of this gene

abolishes infectivity (Boulton et al., 1989; Briddon et al., 1989; Hormuzdi and Bisaro,

1993; Rigden et al., 1993). Although it is not essential for the movement of bipartite

begomoviruses in some cases, viruses with mutations in the CP gene show extended

latent periods, indicating that even for these viruses CP plays a part in movement

(Pooma et al., 1996). The CP has sequence non-specific DNA binding properties (Liu,

Boulton and Davies, 1997; Priyadarshini and Savithri, 2009; Kirthi and Savithri,

2003; Palanichelvam et al., 1998) and it is likely that CP-ssDNA interactions are

required for particle formation. Studies with TYLCV have shown that the CP acts as a

functional homolog of the bipartite begomovirus NSP, having both NLS (Kunik et al.,

1998) and nuclear export signals (Rhee et al., 2000) and interacts in planta with a

karyopherin α that likely is involved in transport into the nucleus (Kunik et al., 1999).

Of direct relevance to the study presented here, Guerra-Peraza et al. (2005), using

GFP tagging and N. plumbaginifolia protoplasts, showed that the CP of MYMV

contains two NLSs and interacts with karyopherin α. However, none of these earlier

studies provides us with any concrete indication as to why MYMIV CP affects plant

164

development or why the CP of this virus is different from all others so far examined.

By deletion mutations in CP, the domain(s) of the protein involved in affecting plant

development should be located for further study.

The common feature of the TrAP of begomoviruses studied so far is their

transient expression induces cell death resembling an HR and this recognition by the

host does not contain the virus-vector at the inoculation site (Selth et al., 2004). In this

study the TrAP of MYMIV was found to induce HR at inoculation site, curling of

emerging leaves and necrosis and bleaching of mature leaves. The TrAP of TYLCV

induced necrotic lesions and some veinal necrosis on inoculated leaves of N.

benthamiana. New leaves exhibited severe veinal necrosis extending into vascular

regions (Selth et al., 2004). Similar symptoms have been observed when TrAP from

ACMV was transiently expressed in N. benthamiana using a PVX-based vector

(Hong et al., 1997). TrAP of TYLCCNV induces necrotic ringspots on inoculated

leaves and necrotic vein banding on systemically infected leaves (Van Wezel et al.,

2001). TrAP has a key role in infection of begomoviruses as it is a transcriptional

activator, a silencing suppressor and suppressor of basal defense and it can suppress

local silencing by interacting with a host factor ADK and can suppress basal defense

by interacting with another host factor SNF1 kinase (Yang et al., 2007). The results

obtained here with the TrAP of MYMIV are thus entirely consistent with earlier

reports.

The geminivirus-encoded Rep protein plays a pivotal role in the viral infection

cycle probably the most important of which are its multiple functions in RCR and its

interference in the host cell-cycle (reviewed by Hanley-Bowdoin et al., 2004; 1999).

Generally overexpression of Rep leads to cell death (van Wezel et al., 2002b; Selth et

al., 2004), likely due to the interaction of this protein with pRBR which is required to

repress cell cycle progression. Downregulation of pRBR expression by VIGS has

been shown to induce developmental abnormalities and cell death (Jordan et al.,

2007). Despite this there are several reports of the production of transgenic plants

expressing the Rep proteins of various begomoviruses without any phenotypic effects

(Hanley Bowdoin et al., 1990; Hong and Stanley, 1996; Shivaprasad et al., 2006) but

few reports of an inability to regenerate transgenic plants expressing Rep (Selth et al.,

2004). This apparent anomaly may possibly be explained by a finding reported by Jin

et al. (2008) that a single amino acid change in Rep can abolish the cell-death

response. None of the reports of the successful production of Rep-expressing

165

transgenic plants mention having sequenced the transgene following insertion,

meaning that it is possible that the transformation protocols followed selected for Rep

mutations that did not elicit the cell-death response. The results of the PVX-mediated

expression of MYMIV Rep are thus wholly consistent with earlier reports that this

protein elicits cell-death. However, a TMV vector expressing ToLCV Rep was

localised to the site of inoculation and did not spread systemically, whereas the PVX

vector expressing MYMIV Rep was not restricted and spread systemically inducing

mild necrosis and leaf curling. There are two possible explanations for this anomaly.

First there may be different host responses due to the two distinct vectors used.

Alternatively it is possible that the PVX vector that spread systemically from the site

of inoculation was no longer expressing Rep or, more likely, was expressing a

mutated Rep. Chung et al. (2007) demonstrated that virus vectors carrying foreign

sequences are subject to a high frequency of deletions of the inserted sequences. It is

interesting to note that for ACMV and TYLCCNV Rep genes expressed from a PVX

vector, although this induces necrosis at the site of inoculation, the product

overlapping (A)C4 gene is required for systemic necrosis, indicating that a strong host

defense mechanism operates to counter Rep-induced necrosis (van Wezel et al.,

2002b). The construct used for expression of MYMIV Rep here also contains an

intact AC4 and would thus be expected to induce systemic necrosis, suggesting either

that the host response to ToLCV Rep by N. benthamiana is very strong or possibly

that ToLCV AC4 is not efficient at inhibiting the host defense response in the

systemic phase. Further investigation will need to be conducted to answer these

questions.

The precise function of the product of the AC4 (known as C4 in monopartite

viruses) gene of dicot-infecting geminiviruses (with the exception of the dicot-

infecting mastreviruses, which do not encode a homolog of this gene) remains unclear

and may differ between viruses. Disruption of the C4 gene of monopartite

begomoviruses results in attenuated symptoms and low infectivity, suggesting that it

is involved in either symptom development, virus movement, or both (Jupin et al.

1994; Rigden et al. 1994). The C4 of cutoviruses is an important symptom

determinant and induces hyperplasia although it is not essential for infectivity

(Latham et al., 1997), interacts with the brassinosteroid signalling pathway (Piroux et

al., 2007) and up-regulates host RKP, a protein that may interact with cell-cycle

inhibitor ICK/KRP proteins, thereby interfering in the cell-cycle (Lai et al., 2009). In

166

contrast, early studies of the AC4 of bipartite viruses by mutagenesis concluded that

this gene is either non-functional, or functionally redundant; mutants were infectious

and produced wild-type symptoms (Elmer et al., 1988; Etessami et al., 1991;

Hoogstraten et al., 1996; Pooma and Petty, 1996). However, van Wezel et al. (2002b)

showed that for both a monopartite and a bipartite begomovirus the (A)C4 may

overcome a host defense mechanism that confines Rep induced HR and the gene

product for some viruses acts as a suppressor of PTGS (Vanitharani et al., 2004).

Expression of the AC4 gene of MYMIV from the PVX vector induces virus-like

symptoms (vein yellowing and leaf curl) which contrasts with the results for the

expression of AC4 of ACMV and C4 of TYLCCNV from PVX which resulted in no

symptoms above those induced by PVX (van Wezel et al., 2002b). The MYMIV

results are more similar to the TMV-mediated expression of ToLCV C4 in N.

tabacum, which resulted in virus-like symptoms, which the authors attributed to a

possible interference by this protein in cell-cycle. Whether this is the case also for the

MYMIV will require further investigation.

The AC5 ORF is not well conserved between begomoviruses and is only

consistently seen in LYMVs. For this reason little attention has been paid to this

potential gene and only a single study has investigated its potential role in virus

infection. Studies in a yeast model have shown that the AC5 of MYMIV has a

possible function in viral DNA replication, although it provided no indication of what

that function might be (Raghavan et al., 2004). It is interesting to note that, although

no study has mapped the transcripts of MYMIV, a study of the closely related

MYMV did not identify transcripts spanning the AC5 ORF (Shivaprasad et al., 2005).

However, this was not an exhaustive study, aiming to identify only the major

transcripts, and it is thus possible that minor transcripts suitable for translation of the

AC5 were not characterised. In the present study expression of the AC5 gene of

MYMIV from the PVX vector in N. benthamiana induced mild leaf curl and light

green mosaics on systemically infected leaves. This indicates that the product of the

AC5 gene has an effect on cellular metabolism but gives no indication of what the

basis for that effect might be. Nevertheless, the identification of an effect indicates

that further studies are warranted to investigate the potential contribution this gene

product has on the viral infection cycle. The affect of mutagenesis of this gene on

virus infectivity now needs to be investigated to determine whether it has any function

in the virus infection cycle.

167

All functions thus far ascribed to betasatellites have been shown to be

mediated by the single, complementary-sense gene, βC1, they encode. βC1 is a

pathogenicity determinant (Saunders et al., 2004), a suppressor of PTGS (Gopal et al.,

2007), binds DNA without size or sequence specificity (Cui et al., 2005b) and may be

involved in virus movement (Saeed et al., 2007). Constitutive expression of βC1 in

transgenic plants, in the absence of helper virus, induces “virus-like” symptoms but

these do not resemble the typical symptoms of the intact betasatellite in association

with its helper begomovirus (Cui et al., 2004b; Gopal et al., 2007; Saunders et al.,

2004). For example, expression of the βC1 gene of Ageratum yellow vein betasatellite

(AYVB) yielded N. benthamiana plants with severe developmental abnormalities

(severely twisted stems and petioles) and vein greening (Saunders et al., 2004),

whereas infection of AYVB in the presence of its cognate helper begomovirus,

AYVV, results in N. benthamiana plants with a severe downward leaf curling

phenotype. These symptoms are very similar to the symptoms induced in this host by

PedLCV and TbLCB, although they are slightly less severe and show a slight upward

curling of the edges of the deeply downwardly cupped (curled) leaves (Chapter 4,

Section 4.3.5). The symptoms induced by expression of the TbLCB βC1 from the

PVX vector in N. benthamiana, leaf-like enations, are thus unusual. Qazi et al. (2007)

showed that near identical symptoms to those produced by TbLCB βC1 here, result

from the expression of the Cotton leaf curl Multan betasatellite (CLCuMB) βC1 from

the PVX vector in N. tabacum; the same symptoms were also produced by the

CLCuMB βC1 PVX construct in N. benthamiana (J. Qazi, personal communication).

These symptoms closely resemble the “Cotton leaf curl disease” symptoms induced

by CLCuMB with its cognate helper begomovirus (Cotton leaf curl Multan virus) in

cotton. This indicated that, although the βC1 is the major symptom determinant, the

bona fide disease symptoms are only produced when this is expressed in the correct

tissues, with the implication that PVX and CLCuMV have similar tissue specificities.

Since a PedLCV/TbLCB infection of N. benthamiana does not induce leaf-like

eantions, this suggests that the tissue specificities of PedLCV and CLCuMV (and

PVX) differ. The results also suggest that possibly all βC1 genes have the capacity to

induce these unusual leaf-like enation symptoms, if expressed in the correct tissues,

something that has previously only been shown for the “Malvaceae” betasatellites (a

phylogenetic grouping proposed by Briddon et al. [2003]) such as CLCuMB. A study

by Yang et al. (2008) has suggested that it is the interaction of βC1 Asymmetric

168

Levels 1 (AS1), a factor known to regulate leaf development that may be responsible

for the pathogenicity of this gene product.

Mutagenesis studies have shown that for monopartite geminiviruses the coat

protein is essential for systemic movement in infected plants Boulton et al., 1989;

Briddon et al., 1989; Rigden et al., 1993). In contrast, bipartite begomovirus coat

protein gene mutants are systemically infectious, although typically the infections are

attenuated and the latent period extended. These results were obtained whether viruses

were assayed in the host plant from which they were originally isolated (Azzam et al.,

1994; Padidam et al., 1995, Ingham et al., 1995), or in the experimental host N.

benthamiana (Padidam et al., 1995; Ingham et al., 1995; Stanley et al., 1986b;

Brough et al., 1988; Gardiner et al., 1988). Replacement of the CP of MYMIV with

GFP, which interrupts the AV2 coding sequence as well as deleting the CP gene,

renders the virus clones non-infectious to legumes. This indicates that one or both of

the genes are important for infectivity of MYMIV in legumes. To further extend the

study a mutation was introduced into only the AV2 coding sequence. This mutant also

was not infectious to legumes indicating that the product of this gene is indispensible

for the infectivity of MYMIV to legumes. Earlier studies with bipartite

begomoviruses originating from the New World (thus viruses lacking the AV2 gene)

have shown that the dispensability of the CP is correlated with the degree of virus–

host adaptation. TGMV is well adapted to N. benthamiana and does not require CP to

infect this host systemically, whereas BGMV is poorly adapted to N. benthamiana

and requires the CP (Pooma et al., 1996). However, we must assume that MYMIV is

well adapted to legumes, since this is the major host and the species from which this

clone of the virus was isolated. Mutation of the AV2 of EACMZV (a bipartite Old

World begomovirus) resulted in attenuated symptoms in cassava (the natural host of

this virus) and affected the expression of CP and accumulation of viral DNA in plants

suggesting a close structural and/or functional relationship between these coding

regions or their protein products (Bull et al., 2007). It is thus possible that, in legumes,

MYMIV has a more strict requirement for the CP as well as the AV2 gene product

than other bipartite begomoviruses do in their natural host. Unfortunately time

constraints prevented extending the study to N. benthamiana, using TbLCB to

overcome host constraints, which may shed more light on the requirement of MYMIV

for the CP and AV2 gene products. Nevertheless, the results indicate that using

MYMIV as a CP replacement vector for gene expression (or as a VIGS vector) will

169

not be as straight forward as for some other begomoviruuses. The intention was to use

a MYMIV CP replacement vector expressing GFP to study the movement of the virus

in legumes; following the example of Sudarshana et al. (1998) who used a GFP

expressing Bean dwarf mosaic virus CP replacement vector to non-invasively follow

the infection of this virus in common bean. This clearly will not be possible, although

the results here do not rule out the possibility that a CP replacement that leaves the

AV2 coding sequence intact (thus a CP translation fusion rather than the CP

transcription fusion approach use here) might work.

The RNA-dependant RNA polymerases RdR1 and RdR6 are important

constituents of the plant gene silencing pathway. RdR1 is salicylic acid inducible and

is required for basal defense against viruses (Yang et al., 2004b) whereas RDR6 has

been shown to be necessary for the continued silencing of a transgene after the

complete elimination of inducer RNA, the cell-to-cell movement of the RNA

silencing signal, and the spread of silencing along the target RNA to sequences

beyond the region that is homologous to the trigger molecule (a phenomenon known

as transitivity; Dalmay et al., 2001; Himber et al., 2003; Klahre et al., 2002; Vaistij et

al., 2002). N. benthamiana encodes an aberrant, possibly non-functional, RdR1 which

may explain its susceptibility to many viruses (Yang et al., 2004b). Despite this

“hole” in N. benthamiana defences, MYMIV is not infectious to this species and

raised the question as to what role RdR6 might play in this. The role of RDR6 in

antiviral defenses of plants has been less firmly established than for RdR1, with only

a few viruses having been shown to be more infectious in its absence (Dalmay et al.,

2000; Mourrain et al., 2000). VIGS-mediated down-regulation of RdR6 in N.

benthamiana resulted in a higher proportion of plants ultimately showing systemic

movement of MYMIV, although not the hoped for symptoms of infection, indicating

that although RdR6 has a part to play, the lack of infectivity of this virus to N.

benthamiana is not greatly affected by this gene product; implying that it is not the

silencing pathway that is the major contributor. However, due to technical constraints

it was not possible to actually demonstrate, by for example showing the production of

siRNA against the RDR6 gene, that the VIGS silencing of the gene was actually

occurring. Further studies will thus need to be conducted before definite conclusions

can be drawn. Nevertheless the effect on MYMIV infectivity levels in PVX-RdR6

inoculated plants is good circumstantial evidence that silencing of this genes was

170

occurring. However this is the first evidence of the involvement of RdR6 of N.

benthamiana in resistance against a DNA virus.

RNAi has become the technology of choice for developing transgenic

resistance in plants against viruses. There are many reports of use of RNAi, by the

expression of either sense, antisense or hairpin constructs, to deliver transgenic

resistance against begomoviruses infecting hosts such as cotton, tomato and cassava

but not, for the most part, in legumes. Legumes, and particularly the grain legumes

mungbean and blackgram, are recalcitrant to Agrobacterium-mediated transformation.

It is for this reason that all previous investigations of the use of RNAi to provide

resistance to the LYMVs have used transient expression methodologies. Pooggin et

al., (2003) produced a hairpin construct against the promoter region of MYMV and

showed that in blackgram bombardment of this on gold particles into MYMV infected

blackgram gave a 68%-77% recovery of seedlings from the virus infection. Making

use of the discovery that TbLCB can make MYMIV infectious to N. benthamiana

(Chapter 5) it was possible to show that an antisense Rep construct, expressed from

PVX, provides resistance. Although it was not specifically demonstrated, this

mechanism is likely RNAi. Although further experiments are required to fully

validate this procedure, this will provide a much simpler system for rapidly screening

constructs for resistance to LYMVs than have previously been available, particularly

those infecting the grain legumes. This will then allow only the most promising

constructs to be carried forward into transformation procedures once they become

available for these hosts.

171

Chapter 7

General discussion

Grain legumes are referred as “gold from the fields” as they are the cheapest

source of high-quality protein that can help the poor in combating malnutrition. They

are also vital in restoring and building soil health due to their nitrogen fixing

properties, particularly in rice-wheat areas where productivity is declining. One of the

major threats to legume production in southern Asia is YMD which was first reported

from India and Pakistan in 1940s. YMD can cause a significant reduction in crop

production, particularly if plants are infected soon after germination. Despite its high

economic value and the large numbers of people that rely on them for their dietary

protein intake, very little attention has been given to this biotic stresses that hamper

the production of grain legume crops across southern Asia. Increasing number of

legume-infecting begomoviruses, more chances for their pseudo-recombination and

relentless damage to crop yields, demand more interest in understanding different

aspects of this group of plant viruses and requires planning of strategies for long

lasting disease management practices. Other reasons to carry out this study were to

explore the natural resistance mechanisms of many legume species against

begomoviruses and exploration of diversity of these genetically isolated and

evolutionarily distinct viruses.

The small scale phylogeographic analysis conducted as part of the study has

shown that in Pakistan the problematic legume-infecting begomovirus is MYMIV.

This contrasts with India where both MYMIV and MYMV cause problems to

leguminous crops. Although the reasons for this disparity are unclear, there is strong

circumstantial evidence to suggest that the cultivation of soybean could have a part to

play. Although MYMV occurs in Pakistan, the only time it was identified in a crop

was in an experimental plot of soybean. In many cases where non-leguminous

begomoviruses have been identified in legumes across the sub-continent, this has been

in soybean. Soybean is cultivated widely across India but, at this time, soybean is only

being considered as a crop in Pakistan and is thus grown only in small experimental

plots. The reasons for this unusual behaviour of soybean with respect to the LYMVs

172

are unclear. Although it is native to Asia, and is believed to have originated from

northern Asia, it is possible that it was not, during its evolution, exposed to

begomoviruses and thus has not evolved resistance to them. Alternatively it is

possible that the varieties being grown have been selected for yield characteristics and

not resistance and have thus lost their natural resistance to begomoviruses. Whatever

the reason, it is clear that, should the decision be taken to introduce soybean as a crop

in Pakistan, that problems with LYMVs can be expected and that this is likely to lead

to greater problems with viruses in the other legumes also.

The LYMVs, since their first identification, have posed something of a

conundrum. Although during the 1990s they appeared to be entirely normal bipartite

begomoviruses, at a time when only few sequences were available, they always were

basal to all other OW begomoviruses in phylogenetic analyses (Howarth and

Vandemark, 1989; Rybicki, 1994; Padidam et al., 1995). A more recent analysis has

highlighted the unusual behaviour of the legume-infecting begomoviruses from the

OW (for which the collective name Legumovirus is being suggested) and has shown

that there are other groups of begomoviruses with unusual behaviour (Briddon et al.,

2009). The Corchorus-infecting viruses (bipartite begomoviruses – for which the

collective name Corchovirus) and the Ipomea-infecting viruses (apparently

monopartite begomoviruses – for which the collective name Sweepovirus is being

proposed) are basal to all begomoviruses in phylogenetic analyses. The “Study Group

on the Taxonomy of Geminiviruses” of the ICTV is at this time considering defining

these three groups as distinct sub-genera within the genus Begomovirus. Although it is

apparent that these viruses are unusual, the reason for this unusual behaviour is far

less clear. For the LYMVs it has been proposed that their unusual behaviour is due to

genetic isolation – the LYMVs (and likely also the other legume-infecting OW

begomoviruses) having co-evolved with their legume hosts and having been shielded

from interaction with the other OW begomoviruses (Qazi et al., 2007). A similar

“genetic isolation” hypothesis can possibly also be invoked to explain the unusual

nature of the corchoviruses and the sweepoviruses. However, this provides us with no

indication of what the mechanism for this unusual interaction between legumes and

OW legume-infecting begomoviruses is.

Certainly the behaviour of all LYMV isolates obtained as part of this study,

including the new species RhYMV, is consistent with the unusual behaviour of all the

other Legumoviruses in phylogenetic analyses (segregating basal to all OW

173

begomoviruses, results not shown). However, the results provide no indication of why

these viruses have these unusual characteristics. Although it is not possible to rule out

the possibility that the “genetic isolation” of LYMVs is due to host range limitations

of the vector (a possible “legume specific” race of B. tabaci that does not feed on non-

leguminous species transmitting these viruses and the vector race(es) that transmit all

other begomoviruses not being able to transmit begomoviruses to/from legumes), this

would seem unlikely in view of the fact that Agrobacterium-mediated inoculation

overcomes this limitation, the LYMVs are not infectious to non-legumes and the other

begomoviruses appear not to infect legumes even when this method is used (Chapter

4). One would thus have to assume that either there is something unusual about

legumes or that there is something unusual about the OW begomoviruses (with

respect to the infection of legumes) in comparison to the NW begomoviruses (many

of which do seem to readily infect legumes).

Although the OW legume-infecting begomoviruses are unusual, segregating

basal to all OW begomoviruses in phylogenetic analyses and having a bipartite

genome arrangement (whereas the majority of OW begomoviruses are monopartite

and associate with betasatellites) this is not the case for NW legume-infecting

begomoviruses. The legume-infecting viruses originating from the NW do not

segregate, but rather are polyphyletic for both their DNA-A and DNA-B components.

This indicates that distinct viruses have adapted to infect legumes, a major contrast to

the situation with the OW legume-infecting viruses. It is difficult to see how this

situation might have arisen. Possibly, during the explosive speciation following the

introduction of begomoviruses to the NW, a lineage evolved that was equally able to

infect both legumes and non-leguminous plant species. Alternatively, did the

“inoculum” of begomovirus(es) that was introduced into the NW, from which all

extant NW begomoviruses are postulated to have evolved, contain some legume

infecting virus(es)? The constituents of this “inoculum” and the method of its

introduction we can only speculate upon. The best, and only, available evidence are

the corchoviruses; NW-like bipartite begomoviruses occurring in the OW. These

viruses were isolated from species in the genus Corchorus. This genus includes

species which provide jute (for rope and cloth making) and species which are (were)

used across North Africa and Asia as a leaf vegetable. Thus two good reasons for

early travellers to the Americas to carry both seed and live plants of Corchorus spp.

(remembering that geminiviruses are not seed transmitted). Unfortunately the host

174

ranges of the corchoviruses and whether they are able to infect legumes have not been

investigated (Ha et al., 2006). It is interesting to note that Corchorus is a genus in the

family Malvaceae and that there is a difference between OW and NW begomoviruses

infecting species in this family. With the exception of the corchoviruses, all

malvaceous begomoviruses identified in the OW require a betasatellite, whereas there

are numerous bipartite begomoviruses that infect plants of the family Malvaceae in

the NW.

Could there be a fundamental biochemical difference between NW and OW

originating legumes? This would seem unlikely since some of the NW begomoviruses

appear to readily infect OW legumes such as soybean (Méndez-Lozano et al., 2006).

Overall the evidence appears to point to this phenomenon (the unusual behaviour of

OW begomoviruses with respect to legumes) being due to a deficiency in the OW

begomoviruses (that do not infect legumes) and that only one lineage, the

legumoviruses, retained the ability to infect species in the family Fabaceae

(Leguminoseae) but with a loss of the ability to infect species in the other families.

The answer to this question will only come from a more detailed analysis of the host

range determinants of the Legumoviruses and a comparison of these with the other

OW begomoviruses and legume-infecting NW begomoviruses.

Although it was not the intention of the project to investigate the host range

limitations of LYMVs, the results obtained have shed some light on the factors

involved. No previous reports have mentioned the lack of infectivity of cloned

LYMVs to non-leguminous hosts and, in particular, the “universal” experimental host

for dicot-infecting viruses N. benthamiana. Likely this is due to the fact that negative

results are not usually reported. Nevertheless, Maruthi et al. (2006) were unable to

infect this host (and numerous other non-leguminous hosts) with DoYMV by whitefly

transmission. However, this is not very informative since, even amongst LYMVs,

DoYMV is known to have a very limited host range (Maruthi et al., 2006). The results

obtained in Chapter 5 indicate that the major blockage to LYMVs infecting N.

benthamiana lies with the DNA-B components of these viruses. The DNA-A

component is well able to mediate a systemic infection when provided with a suitable

“helper” component – in this case a betasatellite. The TbLCB thus extend the host

range of three viruses examined to N. benthamiana. Similar results were previously

obtained with Sri Lankan cassava mosaic virus, the DNA-A of which became

infectious to Ageratum conyzoides in the presence of Ageratum yellow vein

175

betasatellite (Saunders et al., 2002). The mutation studies did not show significant

differences between mutation in the NSP and MP genes suggesting that both may lack

full functionality in N. benthamiana. The induction of an HR by MP when expressed

from the PVX vector is not unusual; the MPs of other begomoviruses induce a similar

response. Nevertheless, such a strong defence response could play a part in limiting

the spread of an already disabled virus. Similarly VIGS of RDR6 showed that this

gene appears to play a part in limiting the infectivity of these viruses. RDR6 is part of

the gene silencing pathway and gene silencing has a well established role in

countering virus infection (Qu et al., 2005). However, even when RDR6 is down-

regulated, MYMIV remains unable to induce a symptomatic infection, suggesting that

it is the lack of adaptation of the DNA-B genes to this host that is the main factor

preventing infectivity. To further investigate the host range limiting determinants of

these viruses it would be interesting to produce chimeric DNA-B components with

NSP and MP genes derived from non-legume infecting begomoviruses. Alternatively

these genes from a non-legume-infecting begomovirus could be, at least initially,

expressed transiently to try and complement the defect(s) in the LYMVs’ DNA-B.

Determination of the molecular basis for the lack of infectivity of LYMVs to non-

leguminous species, as well as the lack of infectivity of non-leguminous

begomoviruses to legumes, would be of interest as it may allow us to devise novel

resistance mechanisms.

The term “genetic isolation”, as it is applied to the LYMVs, means that there

has been no genetic exchange, at least as far as I have been able to detect using

relevant software, between the viruses that infect legumes and the viruses that infect

other plants. This contrasts with the multitude of unequivocal examples of

recombination between begomoviruses that infect species in other plant families, the

prime example here being the viruses that are associated with cotton leaf curl disease

on the sub-Continent (Sanz et al., 2000). The LYMVs were not recognised (or at least

not reported) until the 1940s (Vasudeva, 1942), from which point on they have

increased in geographic spread and severity of losses caused. It would seem likely that

prior to this these viruses were sporadic (minor) problems in cultivated legumes,

possibly having originated from local leguminous weeds, and that not until the early

part of the 20th Century did agriculture become intensive enough for the viruses to

become a major problem. Possibly before this agriculture in southern Asia was still

too small scale and cultivated land too fragmented for the viruses to become

176

established as major problems across a wide area. Whatever the reason for their

sudden appearance it would be naive to assume that agricultural intensification did not

have some part to play.

The identification of several non-leguminous begomoviruses in legumes,

including the two viruses reported here for the first time, is an indication that the

genetic isolation is under threat; in other words that the prerequisite for genetic

interaction (recombination), that is co-infection, is occurring. However, despite this

there still remain no reports of recombination, possibly indicating that recombination

between legume-infecting and non-legume infecting begomoviruses does not lead to

hybrid viruses with a selective advantage in legumes. However, the real evidence of

the breakdown of genetic isolation is with the identification of a productive

interaction between LYMVs and betasatellites. The work of Rouhibakhsh and Malathi

(2004) showed the production of enations on cowpea plants that contained a

betasatellite (CLCuMB) and MYMIV. Enations are typical of CLCuMB and indicate

a productive interaction (expression of βC1). Similarly the work here has shown that

LYMVs can transreplicate TbLCB and that the interaction enhances symptoms and

alters host range (although it was unfortunately not possible to repeat these

experiments in legumes). The relatively small numbers of plants that contained

betasatellite in this study, and its apparent limitation to soybean, indicates that the

new begomovirus-betasatellite complex has not yet become fully established.

Nevertheless, this is a grave threat to legume cultivation across southern Asia and

possibly also to all other areas around the World where legumes are grown and B.

tabaci is endemic.

The project presented here has, at least in a small way, examined the diversity

of LYMVs occurring across Pakistan. The project identified one new begomovirus

species affecting legumes and it is likely that further diversity is present. There is thus

a good reason for conduction of further studies of this nature in the country, since

these viruses pose a threat to legume production; the potential of the newly identified

virus to infect legumes, specifically soybean, was demonstrated. The phylogeographic

data detailed here provides a baseline from which changes in the virus populations,

both in terms of their make-up and geographic spread, can be monitored. Early

identification of changes, either the appearance of new species/strains or epidemics

(spatial changes), will allow suitable control measures to be introduced. Having

established the diversity of the LYMVs in the country, monitoring of the viruses can

177

possibly be conducted using a PCR-restriction fragment length polymorphism

diagnostic procedure (PCR-RFLP; or a derivation of this based upon RCA), which

would overcome the need for sequencing; a technique that in Pakistan remains too

expensive (and technically demanding) for use on a large scale. PCR-RFLP has been

used extensively to investigate the distribution and diversity of cassava mosaic

begomoviruses in Africa (Bull et al., 2006; Sserubombwe et al., 2008).

At this time, natural resistance and insecticides (countering the vector) remain

the main weapons in preventing losses. Although the very brief investigation of the

possibility of using RNA silencing-based resistance against these viruses showed

promise, at this time the lack of efficient transformation protocols for the main

leguminous crops species grown in the region and possible public opposition to

transgenic food crops means that this is possibly not the path to follow (although this

does not mean that we should not investigate this further once transformation

protocols become available). In light of this, it is probable that the most useful

outcome of the work presented here will be the use of the infectious clones in

screening new legume varieties for conventional virus resistance. A glasshouse-based

screening system, complementing the conventional field-based virus resistance

screening, would greatly speed up the identification and introduction of new resistant

varieties.

178

Chapter 8

References

Ahmad, M. and Harwood, R. F. 1973. Studies on a whitefly-transmitted yellow

mosaic of urdbean (Phaseolus mungo). Plant Disease Reporter 57: 800–802.

Allen, E., Xie, Z., Gustafson, A. M. and Carrington, J. C. 2005. microRNA-directed

phasing during trans-acting siRNA biogenesis in plants. Cell 121: 207–21.

Amin, I., Mansoor, S., Iram, S., Khan, M. A., Hussain, M., Zafar, Y., Bull, S. E.,

Briddon, R. W. and Markham, P. G. 2002. Association of a monopartite

begomovirus producing subgenomic DNA and a distinct DNA β on Croton

bonplandianus showing yellow vein symptoms in Pakistan. Plant Disease 86:

444.

Argüello-Astorga, G. R., Guevara-González, L. R., Herrera-Estrella, L. R. and

Rivera-Bustamante, R. F. 1994. Geminivirus replication origins have a group-

specific organization of iterative elements: a model for replication. Virology

203: 90–100.

Argüello-Astorga, G. R. and Ruiz-Medrano, R. 2001. An iteron-related domain is

associated to motif 1 in the replication proteins of geminiviruses: identification

of potential interacting amino acid-base pairs by a comparartive approach.

Archives of Virology 146: 1465–1485.

Argüello-Astorga, G., Lopez-Ochoa, L., Kong, L. J., Orozco, B. M., Settlage, S. B.

and Hanley-Bowdoin, L. 2004. A novel motif in geminivirus replication

proteins interacts with the plant retinoblastoma-related protein. Journal of

Virology 78: 4817–4826.

Atapattu, S. S. and Kodituwakku, D. C. 2009. Agriculture in South Asia and its

implications on downstream health and sustainability: A review. Agricultural

Water Management 96: 361–373.

Atzmon, G., van Oss, H. and Czosnek, H. 1998. PCR-amplification of Tomato yellow

leaf curl virus (TYLCV) DNA from squashes of plants and whitefly vectors:

application to the study of TYLCV acquisition and transmission. European

Journal of Plant Pathology 104: 189–194.

Azzam, O., Frazer, J., de la Rosa, D., Beaver, J. S., Ahlquist, P. and Maxwell, D. P.

1994. Whitefly transmission and efficient ssDNA accumulation of bean

179

golden mosaic geminivirus requires functional coat protein. Virology 204:

289–296.

Bailey, L. H. 1970. Manual of cultivated plants. (Rev.) MacMillan, New York. pp.

1116.

Balaji, V., Vanitharani, R., Karthikeyan, A. S., Anbalagan, S. and Veluthambi, K.

2004. Infectivity analysis of two variable DNA B components of Mungbean

yellow mosaic virus-Vigna in Vigna mungo and Vigna radiata. Journal of

Biosciences 29: 297–308.

Baliji, S., Black, M. C., French, R., Stenger, D. C. and Sunter, G. 2004. Spinach curly

top virus: a newly described Curtovirus species from southwest Texas with

incongruent gene phylogenies. Phytopathology 94: 772–779.

Bartel, D. P. 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell

116: 281–297.

Baulcombe, D. 2004. RNA silencing in Plants. Nature 431: 356–363.

Behjatnia, S. A. A., Dry, I. B. and Rezaian, M. A. 1998. Identification of the

replication-associated protein binding domain within the intergenic region of

tomato leaf curl geminivirus. Nucleic Acids Research. 26: 925–931.

Bevan, M. 1984. Binary Agrobacterium vectors for plant transformation. Nucleic

Acids Research 12: 8711–8721.

Bisaro, D. M., Hamilton, W. D. O., Coutts, R. H. A. and Buck, K. W. 1982.

Molecular cloning and characterisation of the two components of tomato

golden mosaic virus. Nucleic Acids Research 10: 4913–4922.

Bisaro, D. 1996. Geminivirus DNA replication. In "DNA replication in eukaryotic

cells", pp. 833–854. Cold Spring Harbor Laboratory press.

Bisaro, D. M. 2006. Silencing suppression by geminivirus proteins. Virology 344:

158–168.

Blanco, L., Bernard, A., Lazaro, J. M., Martin, G., Garmendia, C. and Salas, M. 1989.

Highly efficient DNA synthesis by the phage phi29 DNA polymerase.

Symmetrical mode of DNA replication. Journal of Biological Chemistry 264:

8935–8940.

Blawid, R., Van, D. T. and Maiss, E. 2008. Transreplication of a Tomato yellow leaf

curl Thailand virus DNA-B and replication of a DNAß component by Tomato

180

leaf curl Vietnam virus and Tomato yellow leaf curl Vietnam virus. Virus

Research 136: 107–117.

Bock, K. R., Guthrie, E. J. and Woods, R. D. 1974. Purification of Maize streak virus

and its relationship to viruses associated with streak diseases of sugarcane and

Panicum maximum. Annals of Applied Biology 77: 289–296.

Bos, L. 1981. Hundred years of Koch's Postulates and the history of etiology in plant

virus research. European Journal of Plant Pathology 87: 91–110.

Böttcher, B., Unseld, S., Ceulemans, H., Russell, R. B. and Jeske, H. 2004. Geminate

structures of African cassava mosaic virus. Journal of Virology 78: 6758–765.

Boulton, M. I., Steinkellner, H., Donson, J., Markham, P. G., King, D. I. and Davies,

J. W. 1989. Mutational analysis of the virion-sense genes of Maize streak

virus. Journal of General Virology 70: 2309–2323.

Boulton, M. I. and Markham, P. G. 1986. The use of squash-blotting to detect plant

pathogens in insect vectors. In "Developments and applications in virus

testing" (R. A. C. Jones, and L. Torrance, Eds.), pp. 55–69. Association of

Applied Biologists.

Boulton, M. I., King, D. I., Donson, J. and Davies, J. W. 1991. Point substitutions in a

promotor-like region and the V1 gene affect the host range and symptoms of

maize streak virus. Virology 183: 114–121.

Boulton, M. I. 2002. Functions and interactions of mastrevirus gene products.

Physiological and Molecular Plant Pathology 60: 243–255.

Brennecke, J., Stark, A., Russell, R. B. and Cohen, S. M. 2005. Principles of

microRNA-target recognition. PLoS Biology 3: E85.

Brewer, B. 1988. When polymerases collide: replication and transcriptional

organization of the E. coli chromosome. Cell 53: 679–686.

Briddon, R. W., Watts, J., Markham, P. G. and Stanley, J. 1989. The coat protein of

beet curly top virus is essential for infectivity. Virology 172: 628–633.

Briddon, R. W., Pinner, M. S., Stanley, J. and Markham, P. G. 1990. Geminivirus coat

protein replacement alters insect specificity. Virology 177: 85–94.

Briddon, R. W., Bedford, I. D., Tsai, J. H. and Markham, P. G. 1996. Analysis of the

nucleotide sequence of the treehopper-transmitted geminivirus, tomato

psueudo-curly top virus, suggests a recombinant origin. Virology 219: 387–

394.

181

Briddon, R. W., Stenger, D. C., Bedford, I. D., Stanley, J., Izadpanah, K. and

Markham, P. G. 1998. Comparison of a Beet curly top virus isolate originating

from the Old World with those from the New World. European Journal of

Plant Pathology 104: 77–84.

Briddon, R. W., Mansoor, S., Bedford, I. D., Pinner, M. S., Saunders, K., Stanley, J.,

Zafar, Y., Malik, K. A. and Markham, P. G. 2001a. Identification of DNA

components required for induction of cotton leaf curl disease. Virology 285:

234–243.

Briddon, R. W. and Markham, P. G. 2001b. Complementation of bipartite

begomovirus movement functions by topocuviruses and curtoviruses. Archives

of Virology 146: 1811–1819.

Briddon, R. W., Bull, S. E., Mansoor, S., Amin, I. and Markham, P. G. 2002.

Universal primers for the PCR-mediated amplification of DNA-β; a molecule

associated with some monopartite begomoviruses. Molecular Biotechnology.

18: 1–4.

Briddon, R. W., Bull, S. E., Amin, I., Idris, A. M., Mansoor, S., Bedford, I. D.,

Dhawan, P., Rishi, N., Siwatch, S. S., Abdel-Salam, A. M., Brown, J. K.,

Zafar, Y. and Markham, P. G. 2003. Diversity of DNA β: a satellite molecule

associated with some monopartite begomoviruses. Virology 312: 106–121.

Briddon, R. W., Bull, S. E., Amin, I., Mansoor, S., Bedford, I. D., Rishi, N., Siwatch,

S. S., Zafar, M. Y., Abdel-Salam, A. M. and Markham, P. G. 2004. Diversity

of DNA 1; a satellite-like molecule associated with monopartite begomovirus-

DNA β complexes. Virology 324: 462–474.

Briddon, R.W. and Stanley, J. 2006. Sub-viral agents associated with plant single-

stranded DNA viruses. Virology 344: 198–210.

Briddon, R., Brown, J., Moriones, E., Stanley, J., Zerbini, M., Zhou, X. and Fauquet,

C. 2008. Recommendations for the classification and nomenclature of the

DNA-β satellites of begomoviruses. Archives of Virology 153: 763–781.

Briddon, R. W., Basavaprabhu, P., Basavaraj, B., Nawaz-ul-Rehman, M. S. and

Fauquet, C. M. 2009. Distinct evolutionary histories of the DNA-A and DNA-

B components of bipartite begomoviruses. Manuscript in preparation.

Brough, C. L., Hayes, R. J., Morgan, A. J., Coutts, R. H. A. and Buck, K. W. 1988.

Effects of mutagenesis in vitro on the ability of cloned Tomato golden mosaic

182

virus DNA to infect Nicotiana benthamiana plants. Journal of General

Virology 69: 503–514.

Brough, C. L., Gardiner, W. E., Inamdar, N., Zhang, X. Y., Ehrlich, M. and Bisaro, D.

M. 1992. DNA methylation inhibits propagation of Tomato golden mosaic

virus DNA in transfected protoplasts. Plant Molecular Biology 18: 703–712.

Brown, J. K., Idris, A. M., Torres-Jerez, I., Banks, G. K. and Wyatt, S. D. 2001. The

core region of the coat protein gene is highly useful for establishing the

provisional identification and classification of begomoviruses. Archives of

Virology 146: 1581–1598.

Brown, J. K. and Czosnek, H. 2002. Whitefly transmission of plant virues. In R. T.

Plumb and J. A. Callow (Eds), Advances in Botanical Research. New York:

Academic Press, pp. 65–100.

Brunetti, A., Tavazza, R., Noris, E., Lucioli, A., Accotto, G. P. and Tavazza, M. 2001.

Transgenically expressed T-Rep of Tomato yellow leaf curl Sardinia virus acts

as a trans-dominant-negative mutant, inhibiting viral transcrition and

replication. Journal of Virology 75: 10573–10581.

Buchmann, R. C., Asad, S., Wolf, J. N., Mohannath, G. and Bisaro, D. M. 2009.

Geminivirus AL2 and L2 proteins suppress transcriptional gene silencing and

cause genome-wide reductions in cytosine methylation. The Journal of

Virology 83: 5005–5013.

Bull, S. E., Tsai, W. S., Briddon, R. W., Markham, P. G., Stanley, J. and Green, S. K.

2004. Diversity of begomovirus DNA β satellites of non-malvaceous plants in

east and south-east Asia. Archives of Virology 149: 1193–1200.

Bull, S. E., Briddon, R. W., Sserubombwe, W. S., Ngugi, K., Markham, P. G. and

Stanley, J. 2007. Infectivity, pseudorecombination and mutagenesis of Kenyan

cassava mosaic begomoviruses. Journal of General Virology 88: 1624–1633.

Campos-Olivas, R., Louis, J. M., Clerot, D., Gronenborn, B. and Gronenborn, A. M.

2002. The structure of a replication initiation protein unites diverse aspects of

nucleic acid metabolism Proceedings of National Academy of Science, USA.

99: 10310–10315.

Capoor, S. P. and Varma, P. M. 1948. Yellow mosaic of Phaseolus lunatus. Current

Science 17: 152–153.

183

Capoor, S. P. and Varma, P. M. 1950. New virus disease of Dolichos lablab. Current

Science 19: 242–249.

Castillo, A. G., Collinet, D., Deret, S., Kashoggi, A. and Bejarano, E. R. 2003. Dual

interaction of plant PCNA with geminivirus replication accessory protein

(REn) and viral replication protein (Rep). Virology 312: 381–394.

Castillo, A. G., Kong L. J., Hanley-Bowdoin, L. and Bejarano, E. R. 2004. Interaction

between a geminivirus replication protein and the plant sumoylation system.

Journal of Virology 78: 2758–2769.

Chakraborty, S., Pandel, P. K., Banerjee, M. K., Kalloo, G. and Fauquet, C. M. 2003.

Tomato leaf curl Gujarat virus, a new begomovirus species causing a severe

leaf curl disease of tomato in Varanasi, India. Virology 93: 1485–1495.

Chatchawankanphanich, O. and Maxwell, D. P. 2002. Tomato leaf curl Karnataka

virus from Bangalore, India, appears to be a recombinant begomovirus.

Phytopathology 92: 637–645.

Chatterji, A., Chatterji, U., Beachy, R. N. and Fauquet, C. M. 2000. Sequence

parameters that determine specificity of binding of the replication associated

protein to its cognate site in two strains of Tomato leaf curl virus-New Delhi.

Virology 273: 341–350.

Chatterji, A., Beachy, R. N. and Fauquet, C. M. 2001. Expression of the

oligomerization domain of the replication-associated protein (Rep) of Tomato

leaf curl New Delhi virus interferes with DNA accumulation of heterologous

geminiviruses. Journal of Biological Chemistry 276: 25631–25638.

Chattopadhyay, B., Singh, A., Yadav, T., Fauquet, C., Sarin, N. and Chakraborty, S.

2008. Infectivity of the cloned components of a begomovirus: DNA beta

complex causing chilli leaf curl disease in India. Archives of Virology 153:

533–539.

Choudhury, N. R., Malik, P. S., Singh, D. K., Islam, M. N., Kaliappan, K. and

Mukherjee, S. K. 2006. The oligomeric Rep protein of Mungbean yellow

mosaic India virus (MYMIV) is a likely replicative helicase. Nucleic Acids

Research 34: 6362–6377.

Chung, B. N., Canto, T. and Palukaitis, P. 2007. Stability of recombinant plant viruses

containing genes of unrelated plant viruses. Journal of General Virology 88:

1347–1355.

184

Cohen, S. and Nitzany, F. E. 1966. Transmission and host range of the Tomato yellow

leaf curl virus. Phytopathology 56: 1127–1131.

Cohen, S., Duffus, J. E., Larsen, R. C., Liu, H. Y. and Flock, R. A. 1983. Purification,

serology, and vector relationships of squash leaf curl virus, a whitefly-

transmitted geminivirus. Phytopathology 73: 1669–1673.

Collin, S., Fernandezlobato, M., Gooding, P. S., Mullineaux, P. M. and Fenoll, C.

1996. The two non-structural proteins from Wheat dwarf virus involved in

viral gene expression and replication are retinoblastoma-binding proteins.

Virology 219: 324–329.

Cui, X. F., Xie, Y. and Zhou, X. P. 2004a. Molecular characterization of DNA β

molecules associated with Tobacco leaf curl Yunnan virus. Journal of

Phytopathology. 152: 647–650.

Cui, X., Tao, X., Xie, Y., Fauquet, C. M. and Zhou, X. 2004b. A DNA β associated

with Tomato yellow leaf curl China virus is required for symptom induction.

Journal of Virology 78: 13966–13974.

Cui, X., Li, G., Wang, D., Hu, D. and Zhou, X. 2005. A begomovirus DNA β-

encoded protein binds DNA, functions as a suppressor of RNA silencing, and

targets the cell nucleus. Journal of Virology 79: 10764–10775.

Czosnek, H. and Laterrot, H. 1997. A world wide survey of Tomato yellow leaf curl

viruses. Archive of Virology 142: 1391–1406.

Czosnek, H., Ghanim, M., Morin, S., Rubinstein, G., Fridman, V. and Zeidan, M.

2001. Whiteflies; vectors, and victims of geminiviruses. Advances in Virus

Research 57: 291–322.

Czosnek, H., Ghanim, M. and Ghanim, M. 2002. The circulative pathway of

begomoviruses in the whitefly vector Bemisia tabaci — insights from studies

with Tomato yellow leaf curl virus. Annals Applied Biology 140: 215–231.

Dalmay, T., Hamilton, A. Rudd, S. Angell, S. and Baulcombe. D. C. 2000. An RNA-

dependent RNA polymerase gene in Arabidopsis is required for

posttranscriptional gene silencing mediated by a transgene but not by a virus.

Cell 101: 543–553.

Dalmay, T., Horsefield, R. Braunstein, T. H. and Baulcombe, D. C. 2001. SDE3

encodes an RNA helicase required for post-transcriptional gene silencing in

Arabidopsis. EMBO Journal 20: 2069–2077.

185

Dangl, J. L., Dietrich, R. A. and Richberg, M. H. 1996. Death don’t have no mercy:

Cell death programs in plant–microbe interactions. Plant Cell 8: 1793–1807.

Dean, F. B., Nelson, J. R., Giesler, T. L. and Lasken, R. S. 2001. Rapid amplification

of plasmid and phage DNA using phi29 DNA polymerase and multiply-

primed rolling circle amplification. Genome Research 11: 1095–1099.

De Candolle, A. 1886. Origin of cultivated plants. Hafner Publishing Company., New

York, N. Y. (Reprint of 2nd ed. 1959).

Desbiez, C., David, C., Mettouchi, A., Laufs, J. and Gronenborn, B. 1995. Rep

protein of tomato yellow leaf curl geminivirus has an ATPase activity required

for viral DNA replication. Proceedings of National Academy of Science, USA

92: 5640–5644.

Dickinson, V. J., Halder, J. and Woolston, C. J. 1996. The product of Maize streak

virus ORF V1 is associated with secondary plasmodesmata and is first

detected with the onset of viral lesions. Virology 220: 51–59.

Ding, S. W., Li, H., Lu, R., Li, F. and Li, W. X. 2004. RNA silencing: a conserved

antiviral immunity of plants and animals. Virus Research 102: 109–115.

Dixon, R. and Kahn, D. 2004. Genetic regulation of biological nitrogen fixation.

Nature Reviews Microbiology 2: 621–631.

Dong, X., van Wezel, R., Stanley, J. and Hong, Y. 2003. Functional characterization

of the nuclear localization signal for a suppressor of posttranscriptional gene

silencing. Journal of Virology 77: 7026–7033.

Donson, J., Morris-Krsinich, B. A. M., Mullineaux, P. M., Boulton, M. I. and Davies,

J. W. 1984. A putative primer for second-strand synthesis of Maize streak

virus is virion-associated. EMBO Journal 3: 3069–3073.

Doyle, J. J. and Doyle, J. L. 1990. Isolation of plant DNA from fresh tissue. Focus 12:

13–15.

Dry, I., Krake, L. R., Rigden, J. E. and Rezaian, M. A. 1997. A novel subviral agent

associated with a geminivirus: the first report of a DNA satellite. Proceeding

of National Academy of Science USA 94: 7088–7093.

Duan, Y. P., Powell, C. A. Purcifull, D. E. Broglio, P. and Hiebert, E. 1997.

Phenotypic variation in transgenic tobacco expressing mutated geminivirus

movement/pathogenicity (BC1) proteins. Molecular Plant-Microbe

Interactions. 10: 1065–1074.

186

Eagle, P. A., Orozco, B. M. and Hanley-Bowdoin, L. 1994. A DNA sequence

required for geminivirus replication also mediates transcriptional regulation.

Plant Cell 6: 1157–1170.

Egelkrout, E. M., Mariconti, L., Settlage, S. B., Cella, R., Robertson, D and Hanley-

Bowdoin, S. 2002. Two E2F elements regulate the proliferating cell nuclear

antigen promoter differently during leaf development. Plant Cell 14: 3225–

3236.

Elmer, J. S., Brand, L., Sunter, G., Gardiner, W. E., Bisaro, D. M. and Rogers, S. G.

1988. Genetic analysis of the tomato golden mosaic virus. The product of the

AL1 coding sequence is required for replication. Nucleic Acids Research 16:

7043–7060.

Esteban, J. A., Salas, M. and Blanco, L. 1993. Fidelity of phi 29 DNA polymerase.

Comparison between protein-primed initiation and DNA polymerization.

Journal of Biological Chemistry 268: 2719–2726.

Etessami, P., Callis, R., Ellwood, S. and Stanley, J. 1988. Delimitation of essential

genes of Cassava latent virus DNA 2. Nucleic Acids Research. 16: 4811–

4829.

Etessami, P., Saunders, K., Watts, J. and Stanley, J. 1991. Mutational analysis of

complementary-sense genes of African cassava mosaic virus DNA A. Journal

of General Virology 72: 1005–1012.

Evans, D and Jeske, H. 1993. DNA-B facilitates, but is not essential for, the spread of

Abutilon mosaic virus in agroinoculated Nicotiana benthamiana. Virology

194: 752–757.

Fagoaga, C., Lόpez, C., de Mendoza, A., Moreno, P., Navarro, L., Flores, R. and

Peńa, L. 2006. Post-Transcriptional Gene Silencing of the p23 Silencing

Suppressor of Citrus tristeza virus Confers Resistance to the Virus in

Transgenic Mexican Lime. Plant Molecular Biology 60: 153.

Faivre-Rampant, O., Gilroy, E. M., Hrubikova, K., Hein, I., Millam, S., Loake, G. J.,

Birch, P., Taylor, M. and Lacomme, C. 2004. Potato Virus X-induced gene

silencing in leaves and tubers of potato. Plant Physiology 134: 1308–1316.

Fauquet, C. M., Bisaro, D. M., Briddon, R. W., Brown, J. K., Harrison, B. D.,

Rybicki, E. P., Stenger, D. C. and Stanley, J. 2003. Revision of taxonomic

187

criteria for species demarcation in the family Geminiviridae, and an updated

list of begomovirus species. Archives of Virology 148: 405–421.

Fauquet, C., Briddon, R., Brown, J., Moriones, E., Stanley, J., Zerbini, M. and Zhou,

X. 2008. Geminivirus strain demarcation and nomenclature. Archives of

Virology 153: 783–821.

Ferreira, P. T. O., Lemos, T. O., Nagata, T. and Inoue-Nagata, A. K. 2008. One-step

cloning approach for construction of agroinfectious begomovirus clones.

Journal of Virological Methods 147: 351–354.

Fire, A. and Xu, S. Q. 1995. Rolling replication of short DNA circles. Proceeding of

National Academy of Science USA 92: 4641–4645.

Flor, H. H. 1971. Current status of the gene-for-gene concept. Annual Review of

Phytopathology 9: 275–296.

Fofana, I. B., Sangare, A., Collier, R., Taylor, C. and Fauquet, C. M. 2004. A

geminivirus-induced gene silencing system for gene function validation in

cassava. Plant Molecular Biology 56: 613–624.

Fontes, E. P. B., Luckow, V. A. and Hanley-Bowdoin, L. 1992. A geminivirus

replication protein is a sequence-specific DNA binding protein. Plant Cell 4:

597–608.

Fontes, E. P. B., Eagle, P. A., Sipe, P. S., Luckow, V. A. and Hanley Bowdoin, L.

1994. Interaction between a geminivirus replication protein and origin DNA is

essential for viral replication. Journal of Biological Chemistry 269: 8459–465.

Fox, J. E., Gulledge, J., Engelhaupt, E., Burow, M. E. and McLachlan, J. A. 2007.

Pesticides reduce symbiotic efficiency of nitrogen-fixing rhizobia and host

plants. Proceeding of National Academy of Science USA 104: 10282–10287.

Frischmuth, T., Roberts, S., von Arnim, A. and Stanley, J. 1993. Specificity of

bipartite geminivirus movement proteins. Virology 196: 666–673.

Frischmuth, T. and Stanley, J. 1993. Strategies for the control of geminivirus diseases.

Virology 4: 329–337.

Frischmuth, T. and Stanley, J. 1994. Beet curly top virus symptom amelioration in

Nicotiana benthamiana transformed with a naturally occurring viral

subgenomic DNA. Virology 200: 826–830.

Frischmuth, T., Engel, M., Lauster, S. and Jeske, H. 1997. Nucleotide sequence

evidence for the occurrence of three distinct whitefly-transmitted, Sida-

188

infecting bipartite geminiviruses in Central America. Journal of General

Virology 78: 2675–2682.

Frischmuth, T. and Stanley, J. 1998. Recombination between viral DNA and the

transgenic coat protein gene of African cassava mosaic geminivirus. Journal

of General Virology 79: 1265–1271.

Frischmuth, S., Kleinow, T., Aberle, H. J., Wege, C., Hülser, D. and Jeske, H. 2004.

Yeast two-hybrid systems confirm the membrane-association and

oligomerization of BC1 but do not detect an interaction of the movement

proteins BC1 and BV1 of Abutilon mosaic geminivirus. Archives of Virology

149: 2349–2364.

Frischmuth, S., Wege, C., Hülser, D. and Jeske, H. 2007. The movement protein BC1

promotes redirection of the nuclear shuttle protein BV1 of Abutilon mosaic

geminivirus to the plasma membrane in fission yeast. Protoplasma 230: 117–

23.

García-Arenal, F., Fraile, A. and Malpica, J. M. 2001. Variability and genetic

structure of plant virus populations. Annual Reviews of Phytopathology 39:

157–186.

Gardiner, W. E., Sunter, G., Brand, L., Elmer, J. S., Rogers, S. G. and Bisaro, D. M.

1988. Genetic analysis of tomato golden mosaic virus: the coat protein is not

required for systemic spread or symptom development. EMBO Journal 7:

899–904.

Garmendia, C., Bernad, A., Esteban, J. A., Blanco, L. and Salas, M. 1992. The

bacteriophage phi29 DNA polymerase, a proofreading enzyme. Journal of

Biological Chemistry 267: 2594–2599.

Garrido-Ramirez, E. R., Sudarshana, M. R., Lucas, W. J. and Gilbertson, R. L. 2000.

Bean dwarf mosaic virus BV1 protein is a determinant of the hypersensitive

response and avirulence in Phaseolus vulgaris. Molecular Plant-Microbe

Interactions 13: 1184–1194.

Gennadius, P. 1889. Disease of tobacco plantations in the Trikonia. The aleurodid of

tobacco. Ellenike Georgia 5:1–3.

Ghanim, M., Morin, S. and Czosnek, H. 2001. Rate of Tomato yellow leaf curl virus

translocation in the circulative transmission pathway of its vector, the whitefly

Bemisia tabaci. Phytopathology 91: 188–196.

189

Gibbs, M. J. and Weiller, G. F. 1999. Evidence that a plant virus switched hosts to

infect a vertebrate and then recombined with a vertebrate-infecting virus.

Proceeding of National Academy of Science USA 96: 8022–8027.

Gilbertson, R. L., Sudarshana, M., Jiang, H., Rojas, M. R. and Lucas, W. J. 2003.

Limitations on geminivirus genome size imposed by plasmodesmata and

virus-encoded movement protein: Insights into DNA Trafficking. Plant Cell

15: 2578–2591.

Girish, K. R. and Usha, R. 2005. Molecular characterization of two soybean-infecting

begomoviruses from India and evidence for recombination among legume-

infecting begomoviruses from South-East Asia. Virus Research 108: 167–

176.

Goodman, R. M. 1977a. Single-stranded DNA genome in a whitefly-transmitted plant

virus. Virology 83: 171–179.

Goodman, R. M., 1977b. Infectious DNA from a whitefly-transmitted virus of

Phaseolus vulgaris. Nature 266: 54–55.

Goodman, R. N. and Novacky, A. J. 1994. The hypersensitive reaction in plants to

pathogens. A resistance phenomenon. St Paul, MN, USA: APS Press.

Gopal, P., Pravin Kumar, P., Sinilal, B., Jose, J., Kasin Yadunandam, A. and Usha, R.

2007. Differential roles of C4 and βC1 in mediating suppression of post-

transcriptional gene silencing: evidence for transactivation by the C2 of

Bhendi yellow vein mosaic virus, a monopartite begomovirus. Virus Research

123: 9–18.

Greathead, A. H. 1986. Host plants. In: Bemisia tabaci – A Literature Survey. Ed. by

Cock, M. J. W. Ascot: FAO and CAB International Institute of Biological

Control. p 17–25.

Grimsley, N., Hohn, T., Davies, J. W., Hohn, B. 1987. Agrobacterium-mediated

delivery of infectious Maize streak virus into maize plants. Nature 325: 177–

179.

Grimson, A., Farh, K. K., Johnston, W. K., Garrett-Engele, P., Lim, L. P. and Bartel,

D. P. 2007. MicroRNA targeting specificity in mammals: determinants beyond

seed pairing. Molecular Cell 27: 91–105.

190

Gröning, B. R., Abouzid, A. and Jeske, H. 1987. Single-stranded DNA from Abutilon

mosaic virus is present in the plastids of infected Abutilon sellovianum.

Proceeding of National Academy of Science USA 84: 8996–9000.

Guerineau, F., Lucy, A. and Mullineaux, P. 1992. Effect of two consensus sequences

preceding the translation initiator codon on gene expression in plant

protoplasts. Plant Molecular Biology 18: 815–818.

Guerra-Peraza, O., Kirk, D., Seltzer, V., Veluthambi, K., Schmit, A. C., Hohn, T. and

Herzog, E. 2005. Coat proteins of Rice tungro bacilliform virus and Mungbean

yellow mosaic virus contain multiple nuclear-localization signals and interact

with importin alpha. Journal of General Virology 86: 1815–1826.

Ha, C., Coombs, S., Revill, P., Harding, R., Vu, M. and Dale, J. 2006. Corchorus

yellow vein virus, a New World geminivirus from the Old World. Journal of

General Virology 87: 997–1003.

Ha, C., Coombs, S., Revill, P., Harding, R., Vu, M. and Dale, J. A. 2008. Molecular

characterization of begomoviruses and DNA satellites from Vietnam:

additional evidence that the New World geminiviruses were present in the Old

World prior to continental separation. Journal of General Virology 89: 312–

326.

Haasnoot, P. C. J., Cupac, D. and Berkhout, B. 2003. Inhibition of virus replication by

RNA interference. Journal of Biomedical Science 10: 607–616.

Haber, S., Ikegami, M., Bajet, N. B. and Goodman, R. M. 1981. Evidence for a

divided genome in bean golden mosaic virus, a geminivirus. Nature 289: 324–

326.

Haley, A., Zhan, X. C., Richardson, K., Head, K. and Morris, B. 1992. Regulation of

the activities of African cassava mosaic virus promoters by the AC1, AC2 and

AC3 gene products. Virology 188: 905–909.

Hameed, S. and Robinson, D. J. 2004. Begomoviruses from mungbeans in Pakistan:

epitope profiles, DNA A sequences and phylogenetic relationships. Archives

of Virology 149: 809–819.

Hamilton, W. D. O., Bisaro, D. M. and Buck, K. W. 1982. Identification of novel

DNA forms in Tomato golden mosaic virus infected tissue. Evidence for a two

component viral genome. Nucleic Acids Research 10: 4901–4912.

191

Hamilton, A., Voinnet, O., Chappell, L. and Baulcombe, D. 2002. Two classes of

short interfering RNA in RNA silencing. EMBO Journal 21: 4671–4679.

Hanley-Bowdoin, L., Elmer, J. S. and Rogers, S. G. 1990. Expression of functional

replication protein from Tomato golden mosaic virus in transgenic tobacco

plants. Proceedings of the National Academy of Sciences USA 87: 1446–1450.

Hanley-Bowdoin, L., Settlage, S. B., Orozco, B. M., Nagar, S. and Robertson, D.

1999. Geminiviruses: models for plant DNA replication, transcription, and cell

cycle regulation. Critical Reviews in Plant Sciences 18: 71–106.

Hanley-Bowdoin, L., Settlage, S. B. and Robertson, D. 2004. Reprogramming plant

gene expression: a prerequisite to geminivirus DNA replication. Molecular

Plant Pathology 5: 149–156.

Hao, L., Wang, H., Sunter, G. and Bisaro, D. M. 2003. Geminivirus AL2 and L2

proteins interact with and inactivate SNF1 kinase. Plant Cell 15: 1034–1048.

Harrison, B. D., Barker, H., Bock, K. R., Guthrie, E. J., Meredith, G. and Atkinson,

M. 1977. Plant viruses with circular single-stranded DNA. Nature 270: 760–

762.

Harrison, B. D. and Robinson, D. J. 1999. Natural genomic and antigenic variation in

whitefly-transmitted geminiviruses (begomoviruses). Annual Review of

Phytopathology 37: 369–398.

Harrison, B. D., Swanson, M. M. and Fargette, D. 2002. Begomovirus coat protein:

serology, variation and functions. Physiol Mol Plant Pathol 60: 257–271.

Hartitz, M. D., Sunter G. and Bisaro, D. M. 1999. The geminivirus transactivator

(TrAP) is a single-stranded DNA and zinc-binding phosphoprotein with an

acidic activation domain. Virology 263: 1–14.

Havelda, Z., Hornyik, C., Crescenzi, A. and Burgyàn, J. 2003. In situ characterization

of Cymbidium ringspot tombusvirus infection-induced posttranscriptional gene

silencing in Nicotiana benthamiana. Journal of Virology 77: 6082–6086.

Hefferon, K. L., Kipp, P. and Moon, Y. S. 2004. Expression and purification of

heterologous proteins in plant tissue using a geminivirus vector system.

Journal of Molecular Microbiology and Biotechnology 7: 109–114.

Hehnle, S., Wege, C. and Jeske, H. 2004. Interaction of DNA with the movement

proteins of geminiviruses revisited. Journal of Virology 78: 7698–7706.

192

Herr, A. J., Jensen, M. B., Dalmay, T. and Baulcombe, D. C. 2005. RNA polymerase

IV directs silencing of endogenous DNA. Science 308:118–120.

Heyraud-Nitschke, F., Shumacher, S., Laufs, J., Schaefer, S., Schell, J. and

Gronenborn, B. 1995. Determination of the origin cleavage and joining

domain of geminivirus Rep proteins. Nucleic Acids Research 23: 910–916.

Himber, C., Dunoyer, P., Moissiard, G., Ritzenthaler, C. and Voinnet, O. 2003.

Transitivity-dependent and -independent cell-to-cell movement of RNA

silencing. EMBO Journal 22: 4523–4533.

Höhnle, M., Höfer, P., Bedford, I. D., Briddon, R. W., Markham, P. G. and

Frischmuth, T. 2001. Exchange of three amino acids in the coat protein results

in efficient whitefly transmission of a nontransmissible Abutilon mosaic virus

isolate. Virology 290: 164–171.

Honda, Y., Iwaki, M., Saito, Y., Thonmeearkom, P., Kittisak, K. and Deema, N. 1983.

Mechanical transmission, purification and some properties of whitefly borne

Mung bean yellow mosaic virus in Thailand. Plant Disease 67: 801–804.

Hong, Y. and Stanley, J. 1995. Regulation of African cassava mosaic virus

complementary-sense gene expression by N-terminal sequences of the

replication-associated protein AC1. Journal of General Virology 76: 2415–

2422.

Hong, J. and Stanley, J. 1996. Virus resistance in Nicotiana benthamiana conferred

by African cassava mosaic virus replication-associated protein (AC1)

transgene. Molecular Plant-Microbe Interactions 4: 219–225.

Hong, Y., Saunders, K. and Stanley, J. 1997. Transactivation of dianthin transgene

expression by African cassava mosaic virus AC2. Virology 228: 383–37.

Hoogstraten, R. A., Hanson, S. F. and Maxwell, D. P. 1996. Mutational analysis of

the putative nicking motif in the replication-associated protein (AC1) of bean

golden mosaic geminivirus. Molecular Plant-Microbe Interactions 9: 594–

599.

Hormuzdi, S. G. and Bisaro, D. M. 1993. Genetic analysis of beet curly top virus:

evidence for three virion sense genes involved in movement and regulation of

single- and double-stranded DNA levels. Virology 193: 900–909.

Hou, Y. M., Sanders, R., Ursin, V. M. and Gilbertson, R. L. 2000. Transgenic plants

expressing geminivirus movement proteins: abnormal phenotypes and delayed

193

infection by Tomato mottle virus in transgenic tomatoes expressing the Bean

dwarf mosaic virus BV1 or BC1 proteins. Molecular Plant-Microbe

Interactions 13: 297–308.

Howarth, A. J. and Vandemark, G. J. 1989. Phylogeny of geminiviruses. Journal of

General Virology 70: 2717–2727.

Howell, S. H. 1984. Physical structure and genetic organisation of the genome of

Maize streak virus (Kenyan isolate). Nucleic Acids Research 12: 7359–7375.

Hur, J., Kenneth, J. B., Lee, S. and Keith, R. D. 2007. Transcriptional activator

elements for Curtovirus C1 expression reside in the 3′ coding region of ORF

C1. Molecules and Cells 23: 80–87.

Husain, M. A. and Trehan, K. N. 1933. Observations on the life-history, bionomics

and control of white-fly of cotton (Bemisia gossypiperda M. and L.). Indian

Journal of Agricultural Science 3: 701–753.

Hussain, M., Qazi, J., Mansoor, S., Iram, S., Bashir, M. and Zafar, Y. 2004. First

report of Mungbean yellow mosaic India virus on mungbean in Pakistan. New

Disease Reports [http://www.bspp.org.uk/ndr/] Volume 9.

Hussain, M., Mansoor, S., Iram, S., Fatima, A. N. and Zafar, Y. 2005. The nuclear

shuttle protein of Tomato leaf curl New Delhi virus is a pathogenicity

determinant. Journal of Virology 79: 4434–4439.

Hussain, M., Mansoor, S., Iram, S., Zafar, Y and Briddon, R. W. 2007. The

hypersensitive response to Tomato leaf curl New Delhi virus nuclear shuttle

protein is inhibited by transcriptional activator protein. Molecular Plant-

Microbe Interactions 20: 1581–1588.

Idris, A. M. and Brown, J. K. 2004. Cotton leaf crumple virus is a distinct Western

Hemisphere begomovirus species with complex evolutionary relationships

indicative of recombination and reassortment. Phytopathology 94: 1068–1074.

Ingham, D. J., Pascal. E. and Lazarowitz, S. G. 1995. Both bipartite geminivirus

movement proteins define viral host range, but only BL1 determines viral

pathogenicity. Virology 207: 191–204.

Innis, M. A., Gelfand, D. H. and Sninsky, J. J. 1990. PCR protocols. Academic Press,

San Diego.

Inoue-Nagata, A. K., Albuquerque, L. C., Rocha, W. B. and Nagata, T .2004. A

simple method for cloning the complete begomovirus genome using the

194

bacteriophage φ29 DNA polymerase. Journal of Virologcal Methods 116:

209–211.

Inouye, T. and Osaki, T. 1980. The first record in the literature of the possible plant

virus disease that appeared in Manyoshu, a Japanese classic anthology, as far

back as the time of the 8th century. Annual report of Phtopathological Society

of Japan 46: 49–50.

Jacob, S. S., Vanitharani, R., Karthikeyan, A. S., Chinchore, Y., Thillaichidambaram,

P. and Veluthambi, K. 2003. Mungbean yellow mosaic virus-Vi agroinfection

by codelivery of DNA A and DNA B from one Agrobacterium strain. Plant

Disease 87: 247–251.

Jacquemond, M., Teycheney, P. Y., Carrĕre, I., Navas-Castillo, J. and Tepfer, M.

2001. Resistance phenotypes of transgenic tobacco plants expressing different

cucumber mosaic virus (CMV) coat protein genes. Molecular Breeding 8: 85.

Jeske, H., Lutgemeier, M. and Preiss, W. 2001. DNA forms indicate rolling circle and

recombination-dependent replication of Abutilon mosaic virus. EMBO Journal

20: 6158–6167.

Jeske, H. 2009. Geminiviruses. In "The Still Elusive Human Pathogens" (E.-M. de

Villiers, and H. Zur Hausen, Eds.). Springer Verlag, Berlin Heidelberg.

Jiang, T. and Zhou, X. P. 2004. First report of Malvastrum yellow vein virus infecting

Ageratum conyzoides. Plant Pathology 53: 799.

Jiang, T. and Zhou, X. 2005. Molecular characterization of a distinct begomovirus

species and its associated satellite DNA isolated from Malvastrum

coromandelianum in China. Virus Genes 31: 43– 48.

Jin, M., Li, C., Shi, Y., Ryabov, E., Huang, J., Wu, Z., Fan, Z. and Hong, Y. 2008. A

single amino acid change in a geminiviral Rep protein differentiates between

triggering a plant defence response and initiating viral DNA replication.

Journal of General Virology 89: 2636–2641.

John, P., Sivalingam, P., Haq, Q., Kumar, N., Mishra, A., Briddon, R. and Malathi, V.

2008. Cowpea golden mosaic disease in Gujarat is caused by a Mungbean

yellow mosaic India virus isolate with a DNA B variant. Archives of Virology

153: 1359–1365.

195

Jordan, C., Shen, W., Hanley-Bowdoin, L. and Robertson, D. 2007. Geminivirus-

induced gene silencing of the tobacco retinoblastoma-related gene results in

cell death and altered development. Plant Molecular Biology 65: 163–175.

Jose, J. and Usha, R., 2003. Bhendi yellow vein mosaic disease in India is caused by

association of a DNA β satellite with a begomovirus. Virology 305: 310–317.

Jupin, I., De Kouchkovsky, F., Jouanneau, F. and Gronenborn, B. 1994. Movement of

tomato yellow leaf curl geminivirus (TYLCV): Involvement of the protein

encoded by ORF C4. Virology 204: 82–90.

Kapitonov, V. V. and Jurka, J. 2001. Rolling-circle transposons in eukaryotes.

Proceedings of the National Academy of Sciences USA 98: 8714–8719.

Karthikeyan, A. S., Vanitharani, R., Balaji, V., Anuradha, S., Thillaichidambaram, P.,

Shivaprasad, P. V., Parameswari, C., Balamani, V., Saminathan, M. and

Veluthambi, K. 2004. Analysis of an isolate of Mungbean yellow mosaic virus

(MYMV) with a highly variable DNA B component. Archive of Virology 149:

1643–1652.

Khan, A., Idris, A., Al-Saady, N., Al-Mahruki, M., Al-Subhi, A. and Brown, J. 2008.

A divergent isolate of Tomato yellow leaf curl virus from Oman with an

associated DNAβ satellite: an evolutionary link between Asian and the Middle

Eastern virus–satellite complexes. Virus Genes 36: 169–176.

Kikuno, R., Toh, H., Hayashida, H. and Miyata, T. 1984. Sequence similarity between

putative gene products of geminiviral DNAs. Nature 308: 562–562.

Kim, C. H. and Palukaitis, P. 1997. The plant defense response to Cucumber mosaic

virus in cowpea is elicited by the viral polymerase gene and affects virus

accumulation in single cells. EMBO Journal 16: 4060–4068

Kirthi, N. and Savithri, H. S. 2003. A conserved zinc finger motif in the coat protein

of Tomato leaf curl Bangalore virus is responsible for binding to ssDNA.

Archives of Virology 148: 2369–2380.

Kittelmann, K., Rau, P., Gronenborn, B. and Jeske, H. 2009. Plant geminivirus Rep

protein induces re-replication in fission yeast. Journal of Virology (in press).

Kjemtrup, S., Sampson, K. S., Peele C. G., Nguyen, L. V., Conkling, M. A.,

Thompson, W. F. and Robertson, D. 1998. Gene silencing from plant DNA

carried by a geminivirus. Plant Journal 14: 91–100.

196

Klahre, U., Crete, P., Leuenberger, S. A., Iglesias, V. A. and Meins, F. 2002. High

molecular weight RNAs and small interfering RNAs induce systemic

posttranscriptional gene silencing in plants. Proceedings of the National

Academy of Sciences USA 99: 11981–11986.

Klinkenberg, A., Ellwood, S. and Stanley, J. 1989. Fate of African cassava mosaic

virus coat protein deletion mutants after agroinoculation. Journal of General

Virology 70: 1837–1844.

Klute, K. A., Nadler, S. A. and Stenger, D. C. 1996. Horseradish curly top is a distinct

subgroup II geminivirus species with Rep and C4 genes derived from a

subgroup III ancestor. Journal of General Virology 77: 1369–1378.

Kolar, S. and Lodge, D. M. 2001. Progress in invasion biology: predicting invaders.

Trends in Ecology and Evolution 16: 199–204.

Kong, L. J., Orozco, B. M., Roe, J. L., Nagar, S., Ou, S., Feiler, H. S., Durfee, T.,

Miller, A. B., Gruissem, W., Robertson, D. and Hanley-Bowdoin, L. 2000. A

geminivirus replication protein interacts with the retinoblastoma protein

through a novel domain to determine symptoms and tissue specificity of

infection in plants. EMBO Journal 19: 3485–3495.

Kong, L. and Hanley-Bowdoin, L. 2002. A geminivirus replication protein interacts

with a protein kinase and a motor protein that display different expression

patterns during plant development and infection. Plant Cell 14: 1817–1832.

Koonin, E. V. and Ilyina, T. V. 1992. Geminivirus replication proteins are related to

prokaryotic plasmid rolling circle DNA replication initiator proteins. Journal

of General Virology 73: 2763–2766.

Kornberg, A. and Baker, T. A. 1992. DNA replication. W.H. Freeman and Company,

San Francisco.

Krek, A., Grün, D., Poy, M. N., Wolf, R., Rosenberg, L., Epstein, E. J.,

MacMenamin, P., da Piedade, I., Gunsalus, K. C., Stoffel, M. and Rajewsky,

N. 2005. Combinatorial microRNA target predictions. Nature Genetics 37:

495–500.

Kunik, T., Salomon, R., Zamir, D., Navot, N., Zeidan, M., Michelson, I., Gafni, Y.

and Czosnek, H. 1994. Transgenic tomato plants expressing the Tomato

yellow leaf curl virus capsid protein are resistant to the virus. Biotechnology

12: 500–504.

197

Kunik, T., Palanichelvam, K., Czosnek, H., Citovsky, V. and Gafni, Y. 1998. Nuclear

import of the capsid protein of Tomato yellow leaf curl virus (TYLCV) in

plant and insect cells. Plant Journal 13: 393–399.

Kunik, T., Mizrachy, L., Citovsky, V. and Gafni, Y. 1999. Characterization of a

tomato karyopherin α that interacts with the Tomato yellow leaf curl virus

(TYLCV) capsid protein. Journal of Experimental Biology 50: 731–732.

Lacomme, C. and Chapman, S. 2008. Use of Potato virus X (PVX) -based vector for

gene expression and virus-induced gene silencing (VIGS). Current Protocols

in Microbiology 8: 161.1.1–161.1.13.

Lai, J., Chen, H., Teng, K., Zhao, Q., Zhang, Z., Li, Y., Liang, L., Xia, R., Wu, Y.,

Guo, H. and Xie, Q. 2009. RKP, a RING finger E3 ligase induced by BSCTV

C4 protein, affects geminivirus infection by regulation of plant cell cycle.

Plant Journal 57: 905–917.

Lamb, C. and Dixon, R. A. 1997. The oxidative burst in plant disease resistance.

Annual Review of Plant Physiology and Plant Molecular Biology 48: 251–275

Latham, J. R., Saunders, K., Pinner, M. S. and Stanley, J. 1997. Induction of plant cell

division by Beet curly top virus gene C4. Plant Journal 11: 1273–1283.

Laufs, J., Traut, W., Heyraud, F., Matzeit, V., Rogers, S. G., Schell, J., and

Gronenborn, B. 1995a. In vitro cleavage and joining at the viral origin of

replication by the replication initiator protein of Tomato yellow leaf curl virus.

Proceedings of the National Academy of Sciences USA 92: 3879–3883.

Laufs, J., Schumacher, S., Geisler, N., Jupin, I., Gronenborn, B., 1995b. Identification

of the nicking tyrosine of geminivirus Rep protein. FEBS Letters. 377: 258–

262.

Laufs, J., Jupin, I., David, C., Schumacher, S., Heyraud-Nitschke, F. and Gronenborn,

B. 1995c. Geminivirus replication: genetic and biochemical characterization of

Rep protein function, a review. Biochimie 77: 765–773.

Lazarowitz, S. G., Wu, L. C., Rogers, S. G. and Elmer, J. S. 1992. Sequence-specific

interaction with the viral AL1 protein identifies a geminivirus DNA

replication origin. Plant Cell 4: 799–809.

Lefeuvre, P., Lett, J. M., Reynaud, B., Martin, D. P. 2007a. Avoidance of protein fold

disruption in natural virus recombinants. PLoS Pathogens 3: e181.

198

Lefeuvre, P., Martin, D. P., Hoareau, M., Naze, F., Delatte, H., Thierry, M., Varsani,

A., Becker, N., Reynaud, B., Lett, J. M. 2007b. Begomovirus 'melting pot' in

the south-west Indian Ocean islands: molecular diversity and evolution

through recombination. Journal of General Virology 88: 3458–68.

Leung, A. K. and Sharp, P. A. 2007. microRNAs: a safeguard against turmoil? Cell

130: 581–585.

Lewis, B. P., Shih, I. H., Jones-Rhoades, M. W., Bartel, D. P. and Burge, C. B. 2003.

Prediction of mammalian microRNA targets. Cell 115: 787–798.

Li, Z. H., Xie, Y. and Zhou, X. P. 2005. Tobacco curly shoot virus DNAβ is not

necessary for infection but intensifies symptoms in a host-dependent manner.

Phytopathology 95: 902–908.

Lindbo, J. A., Silva-Rosales, L., Proebsting, W. M. and Dougherty, W. G. 1993.

lnduction of a highly specific antiviral state in transgenic plants: implications

for regulation of gene expression and virus resistance. Plant Cell 5: 1749–

1759.

Liu, D., Daubendiek, S. L., Zillman, M. A., Ryan, K. and Kool, E. T. 1996. Rolling

circle DNA synthesis: Small circular oligonucleotides as efficient templates

for DNA polymerases. Journal of the American Chemical Society 118: 1587–

1594.

Liu, H., Boulton, M. I. and Davies, J. W. 1997. Maize streak virus coat protein binds

single- and double-stranded DNA in vitro. Journal of General Virology 78:

1265–1270.

Liu, H., Boulton, M. I., Thomas, C. L., Prior, D. A., Oparka, K. J. and Davies, J. W.

1999. Maize streak virus coat protein is karyophyllic and facilitates nuclear

transport of viral DNA. Molecular Plant-Microbe Interactions 12: 894–900.

Lizardi, P. M., Huang, X., Zhu, Z., Bray-Ward, P., Thomas, D. C. and Ward, D. C.

1998. Mutation detection and single-molecule counting using isothermal

rolling-circle amplification. Nature Genetics 19: 225–232.

Lotrakul, P., Valverde, R. A., Clark, C. A. and Hurtt, S. 2002. Sweet potato leaf curl

virus and related geminiviruses in sweetpotato. Acta Horticultrae 583: 135–

141.

Lu, R., Malcuit, I., Moffett, P., Ruiz, M. T., Peart, J., Wu, A. J., Rathjen, J. P.,

Bendahmane, A., Day, L. and Baulcombe, D. C. 2003. High throughput virus-

199

induced gene silencing implicates heat shock protein 90 in plant disease

resistance. EMBO Journal 22: 5690–5699.

Lucioli, A., Noris, E., Brunetti, A., Tavazza, R., Ruzza, V., Castillo, A. G., Bejarano,

E. R., Accotto, G. P. and Tavazza, M. 2003. Tomato yellow leaf curl Sardinia

virus Rep-derived resistance to homologous and heterologous geminiviruses

occurs by different mechanisms and is overcome if virus-mediated transgene

silencing is activated. Journal of Virology 77: 6785–6798.

Luque, A., Sanz-Burgos, A. P., Ramirez-Parra, E., Castellano, M. M. and Gutiérrez,

C. 2002. Interaction of geminivirus Rep protein with replication factor C and

its potential role during geminivirus DNA replication. Virology 302: 83–94.

Luria, S. E., Darnell, J. E. J., Baltimore, D. and Cambell, A. 1978. In general

virology, pp. 1–7 John Willey and sons.

Lyttle, D. J. and Guy, P. L. 2004. First record of geminiviruses in New Zealand:

Abutilon mosaic virus and Honeysuckle yellow vein virus. Australian Plant

Pathology 33: 321–322.

Malathi, V. G., Surendranath, B., Naghma, A. and Roy, A. 2005. Adaptation to new

hosts shown by the cloned components of Mungbean yellow mosaic India

virus causing cowpea golden mosaic in northern India. Canadian Journal of

Plant Pathology 27: 439–447.

Mandal, B., Varma, A. and Malathi, V. G. 1997. Systemic infection of Vigna mungo

using the cloned DNAs of the blackgram isolate of Mungbean yellow mosaic

geminivirus through agroinoculation and transmission of the progeny virus by

whiteflies. Journal of Phytopathology 145: 505–510.

Mansour, A. and Al-Musa, A. 1992. Tomato yellow leaf curl virus: host range and

virus vector relationships. Plant Pathology 42: 122–125.

Mansoor, S., Khan, S. H., Bashir, A., Saeed, M., Zafar, Y., Malik, K. A., Briddon, R.

W., Stanley, J. and Markham, P. G. 1999. Identification of a novel circular

single-stranded DNA associated with cotton leaf curl disease in Pakistan.

Virology 259: 190–199.

Mansoor, S., Amin, I., Hussain, M., Zafar, Y., Bull, S., Briddon, R. W. and Markham,

P. G. 2001. Association of a disease complex involving a begomovirus, DNA

1 and a distinct DNA beta with leaf curl disease of okra in Pakistan. Plant

Disease 85: 922.

200

Mansoor, S., Briddon, R. W., Bull, S. E., Bedford, I. D., Bashir, A., Hussain, M.,

Zafar, M.Y., Malik, K. A., Fauquet, C. and Markham, P. G. 2003. Cotton leaf

curl disease is associated with multiple monopartite begomoviruses supported

by single DNA β. Archives of Virology 148: 1969–1986.

Mariano, A. C., Andrade, M. O., Santos, A. A., Carolino, S. M. B., Oliveira, M. L.,

Baracat-Pereira, M. C., Brommonshenkel, S. H. and Fontes, E. P. B. 2004.

Identification of a novel receptor-like protein kinase that interacts with a

geminivirus nuclear shuttle protein. Virology 318: 24–31.

Martin, D. P. and Rybicki, E. P. 2000. RDP: detection of recombination amongst

aligned sequences. Bioinformatics 16: 562–563.

Maruthi, M. N., Rekha, A. R., Govindappa, M. R., Colvin, J. and Muniyappa, V.

2005. A distinct begomovirus causes Indian dolichos yellow mosaic disease.

New Diseas Report. [http://www.bspp.org.uk/ndr/] Volume 11.

Maruthi, M. N., Manjunatha, B., Rekha, A. R., Govindappa, M. R., Colvin, J. and

Muniyappa, V. 2006. Dolichos yellow mosaic virus belongs to a distinct

lineage of Old World begomoviruses; its biological and molecular properties.

Annals of Applied Biology 149: 187–195.

Matthews, R. E. F. 1979. Classification and nomenclature of viruses. Third Report of

the International Committee on Taxonomy of Viruses. Intervirology 12:132–

296.

Mayo, M. A., Leibowitz, M. J., Palukaitis, P., Scholthof, K. B. G., Simon, A. E.,

Stanley, J. and Taliansky, M. 2005. Satellites. In: Fauquet, C. M., Mayo, M.

A., Maniloff, J., Desselberger, U., Ball, L.A. (Eds.), VIIIth Report of the

International Committee on Taxonomy of Viruses. Virus Taxonomy,

Elsevier/Academic Press, London, pp. 1163–1169.

McGarry, R. C., Barron, Y. D., Carvalho, M. F., Hill, J. E., Gold, D., Cheung, E.,

Kraus, W. L. and Lazarowitz, S. G. 2003. A novel Arabidopsis

acetyltransferase interacts with the geminivirus movement protein NSP. Plant

Cell 15: 1605–1618.

Mehta, P., Wyman, J. A., Nakhla, M. K. and Maxwell, D. P. 1994. Polymerase chain

reaction detection of viruliferous Bemisia tabaci (Homoptera:Aleyrodidae)

with two tomato-infecting geminiviruses. Journal of Economic Entomology

87: 1285–1290.

201

Méndez-Lozano, J., Quintero-Zamora, E., Barbosa-Jasso, M. P., Leyva-López, N. E.,

Garzón-Tiznado, A. and Argüello-Astorga, G. R. 2006. A begomovirus

associated with leaf curling and chlorosis of soybean in Sinaloa, Mexico is

related to Pepper golden mosaic virus. Plant Disease 90: 109.

Michalakis, Y., Roze, D. 2004. Epistasis in RNA viruses. Science 306: 1492–1493.

Modernell, M. G., Granito, M., Paolini, M. and Olaizola, C. 2008. Use of cowpea

(Vigna sinensis) as a chicken complement in an infant formula. Archive of

Latinoam Nutrition 58:292–298.

Moffatt, B. A., Stevens, Y. Y., Allen, M. S., Snider, J. D., Periera, L. A., Todorova,

M. I., Summers, P. S., Weretilnyk, E. A., Martin-Caffrey, L. and Wagner C.

2002. Adenosine kinase deficiency is associated with developmental

abnormalities and reduced transmethylation. Plant Physiology 128: 812–821.

Mohr, J. J., Clark, R., Sun, S., Androphy, E. J., MacPherson, P. and Botchan, M. R.

1990. Targeting the E1 replication protein to the papillomavirus origin of

replication by complex formation with E2 transactivation. Science 250:1694–

1699.

Monci, F., Sanchez-Campos, S., Navas-Castillo, J. and Moriones, E. 2002. A natural

recombinant between the geminiviruses Tomato yellow leaf curl Sardinia

virus and Tomato yellow leaf curl virus exhibits a novel pathogenic phenotype

and is becoming prevalent in Spanish populations. Virology 303: 317–326.

Monsalve-Fonnegra, Z., Argüello-Astorga, G. and Rivera-Bustamante, R. 2001.

Geminivirus replication and gene expression. In "Plant viruses as molecular

pathogens" (J. A. Khan, and J. Dijstra, Eds.), pp. 257-277. The Haworth Press,

New York.

Mor, T. S., Moon, Y. S., Palmer, K. E. and Mason, H. S. 2003. Geminivirus vectors

for high-level expression of foreign proteins in plant cells. Biotechnology and

Bioengineering 81: 430–437.

Morel, J. B. and J. L. Dangl. 1997. The hypersensitive response and the induction of

cell death in plants. Cell Death and Differentiation 4: 1318–1328.

Morinaga, T., Ikegami, M. and Miura, K. I. 1993. The nucleotide sequence and

genome structure of mungbean yellow mosaic geminivirus. Microbiology and

Immunology 37: 471–476.

202

Morozov, S., Fedorkin, O., Juttner, G., Schiemann, J., Baulcombe, D. and Atabekov,

J. 1997. Complementation of a Potato virus X mutant mediated by

bombardment of plant tissues with cloned viral movement protein genes.

Journal General Virology 78: 2077–2083.

Mourrain, P., Beclin, C., Elmayan, T., Feuerbach, F., Godon, C., Morel, J. B., Jouette,

D., Lacombe, A. M., Nikic, S., Picault, N., Remoue, K., Sanial, M., Vo, T. A.

and Vaucheret, H. 2000. Arabidopsis SGS2 and SGS3 genes are required for

post-transcriptional gene silencing and natural virus resistance. Cell 101: 533–

542.

Moya, A., Holmes, E. C., González-Candelas, F. 2004. The population genetics and

evolutionary epidemiology of RNA viruses. Nature Revies Microbiology 2:

279–288.

Muangsan, N., Beclin, C., Vaucheret, H., Robertson, D. 2004. Geminivirus VIGS of

endogenous genes requires SGS2/SDE1 and SGS3 and defines a new branch

in the genetic pathway for silencing in plants. Plant Journal 38: 1004–1014.

Mueller, E., Gilbert, J. E., Davenport, G., Brigneti, G. and Baulcombe, D. C. 1995.

Homology-dependent resistance: Transgenic virus resistance in plants related

to homology-dependent gene silencing. Plant Journal 7: 1001–1013.

Mullineaux, P. M., Donson, J., Morris-Krsinich, B. A. M., Boulton, M. I. and Davies,

J. W. 1984. The nucleotide sequence of Maize streak virus DNA. EMBO

Journal. 3: 3063–3068.

Mumford, D. L. 1974. Purification of curly top virus. Phytopathology 64: 136–139.

Muniyappa, V., Rajeshwari, R., Bharathan, N., Reddy, D. V. R. and Nolt, B. L. 1987.

Isolation and characterization of a geminivirus causing yellow mosaic disease

of horsegram (Macrotyloma uniflorum [Lam.] Verdc.). Journal of

Phytopathogy 119: 81–87.

Murphy, F. A., Fauquet, C. M., Bishop, D. H. L., Ghabrial, S. A., Jarvis, A. W.,

Martelli, G. P., Mayo, M. A. and Summers, M. D. 1995. Virus Taxonomy:

Sixth Report of the International Committee on Taxonomy of Viruses.

Wien, New York: Springer-Verlag. pp 585.

Nagar, S., Pedersen, T. J., Carrick, K. M., Hanley-Bowdoin, L. and Robertson, D.

1995. A geminivirus induces expression of a host DNA synthesis protein in

terminally differentiated plant cells. Plant Cell 7: 705–719.

203

Nair, N. G., Nene, Y. L. and Naresh, J. S. 1974. Reaction of certain urdbean varieties

to yellow mosaic virus of mungbean. Indian Phytopathology 27: 256–257.

Nariani, T. K. 1960. Yellow mosaic of mung (Phaseolus aureus L.). Indian

Phytopatholgy 13: 24–29.

Navot, N., Zeidan, M., Pichersky, E., Zamir, D. and Czosnek, H. 1992. Use of

polymerase chain reaction to amplify tomato yellow leaf curl virus DNA from

infected plants and viruliferous whiteflies. Phytopathology 82: 1199–1202.

Nene, Y. L. 1973. Viral disease of some warm weather pulse crops in India. Plant

Disease Reporter 57: 463–467.

Noris, E., Jupin, I., Accotto, G. P. and Gronenborn, B. 1996. DNA-binding activity of

the C2 protein of tomato yellow leaf curl geminivirus. Virology 217: 607–612.

Noueiry, A. O., Lucas, W. J. and Gilbertson, R. L. 1994. Two proteins of a plant

DNA virus coordinate nuclear and plasmodesmal transport. Cell 76: 925–932.

Onodera, Y., Haag, J. R., Ream, T., Nunes, P. C., Pontes, O. and Pikaard, C. S. 2005.

Plant nuclear RNA polymerase IV mediates siRNA and DNA-methylation

dependent heterochromtin formation. Cell 120: 613–622.

Orozco, B. M. and Hanley-Bowdoin, L. 1996. A DNA structure is required for

geminivirus replication origin function. Journal of Virology 70: 148–158.

Orozco B. M., Miller, A. B., Settlage, S. B. and Hanley-Bowdoin, L. 1997. Functional

domains of a geminivirus replication protein. Journal of Biological Chemistry

272: 9840–9846.

Orozco, B. M. and Hanley-Bowdoin, L. 1998. Conserved sequence and structural

motifs contribute to the DNA binding and cleavage activities of a geminivirus

replication protein. Journal of Biological Chemistry 273: 24448–24456.

Orozco, B. M., Gladfelter, H. J., Settlage, S. B., Eagle, P. A., Gentry, R. N. and

Hanley-Bowdoin, L. 1998. Multiple cis elements contribute to geminivirus

origin function. Virology, 242: 346–356.

Padidam, M., Beachy, R. N. and Fauquet, C. M. 1995. Classification and

identification of geminiviruses using sequence comparisons. Journal of

General Virology 76: 249–263.

Padidam, M., Beachy, R. N. and Fauquet C. M. 1996. The role of AV2 ("precoat")

and coat protein in viral replication and movement in tomato leaf curl

geminivirus. Virology 224: 390–404.

204

Padidam, M., Sawyer, S. and Fauquet, C. M. 1999. Possible emergence of new

geminiviruses by frequent recombination. Virology 265: 218–225.

Page, R. D. M. 1996. TREEVIEW: An application to display phylogenetic trees on

personal computers. Computer Applications in the Biosciences 12: 357–358.

Palanichelvam, K., Kunik, T., Citovsky, V. and Gafni, Y. 1998. The capsid protein of

Tomato yellow leaf curl virus binds cooperatively to single-stranded DNA.

Journal of General Virology 79: 2829–2833.

Pascal, E., Goodlove, P. E., Wu, L. C. and Lazarowitz, S. G. 1993. Transgenic

tobacco plants expressing the geminivirus BL1 protein exhibit symptoms of

viral disease. Plant Cell 5: 795–807.

Pascal, E., Sanderfoot, A. A., Ward, B. M., Medville, R., Turgeon, R., Lazarowitz, S.

G. 1994. The geminivirus BR1 movement protein binds single-stranded DNA

and localizes to the cell nucleus. Plant Cell 6: 995–1006.

Paximadis, M., Idris, A. M., Torres-Jerez, I., Villarreal, A., Rey, M. E. and Brown, J.

K. 1999. Characterization of tobacco geminiviruses in the Old and New

World. Archive of Virology 144: 703–717.

Peele, C., Jordan, C. V., Muangsan, N., Turnage, M., Egelkrout, E., Eagle, P., Hanley-

Bowdoin, L. and Robertson, D. 2001. Silencing of a meristematic gene using

geminivirus-derived vectors. Plant Journal 27: 357–366.

Peragine, A., Yoshikawa, M., Wu, G., Albrecht, H. L. and Poethig, R. S. 2004. SGS3

and SGS2/SDE1/RDR6 are required for juvenile development and the

production of trans-acting siRNAs in Arabidopsis. Genes and Development

18: 2368–2379.

Piroux, N., Saunders, K., Page, A. and Stanley, J. 2007. Geminivirus pathogenicity

protein C4 interacts with Arabidopsis thaliana shaggy-related protein kinase

AtSKη, a component of the brassinosteroid signalling pathway. Virology 362:

428–440.

Pita, J. S., Fondong, V. N., Sangre, A., Otim-Nape, G. W., Ogwal, S. and Fauquet, C.

M. 2001. Recombination, pseudorecombination and synergism of

geminiviruses are determinant keys to the epidemic of severe cassava mosaic

disease in Uganda. Journal General Virology 82: 655–665.

Pollard, D. G. 1955. Feeding habits of the cotton whitefly, Bemisia tabaci Genn.

(Homoptera:Aleyrodidae). Annals of Applied Biology 43: 664–671.

205

Polston, J. E., Al-Musa, A., Perring, T. M. and Dodds, J. A. 1990. Association of the

nucleic acid of squash leaf curl geminivirus with the whitefly Bemisia tabaci.

Phytopathology 80: 850–856.

Polston, J. E., McGovern, R. J. and Brown, L. G. 1999. Introduction of Tomato yellow

leaf curl virus in Florida and implications for the spread of this and other

geminiviruses of tomato. Plant Disease 83: 984–988.

Pooggin, M., Shivaprasad, P. V., Veluthambi, K. and Hohn, T. 2003. RNAi targeting

of DNA virus in plants. Nature Biotechnology 21: 131–132.

Pooma, W. and Petty, I. T. D. 1996. Tomato golden mosaic virus open reading frame

AL4 is genetically distinct from its C4 analogue in monopartite geminiviruses.

Journal of General Virology 77: 1947–1951.

Pooma, W., Gillette, W. K., Jeffrey, J. L. and Petty, I. T. D. 1996. Host and viral

factors determine the disspensability of coat protein for bipartite geminivirus

systemic movement. Virology 218: 264–268.

Porebski S. and Bailey L. G. 1997. Modification of a CTAB DNA extraction protocol

for plants containing high polysaccharide and polyphenol components. Plant

Molecular Biology Reporter 15: 8–15.

Poulter, R. T, Goodwin, T. J and Butler, M. I. 2003. Vertebrate helentrons and other

novel Helitrons. Gene 313: 201–212.

Preiss, W. and Jeske, H. 2003. Multitasking in replication is common among

geminiviruses. Journal of Virology 77: 2972–2980.

Priyadarshini, P. C. and Savithri, H. S. 2009. Kinetics of interaction of Cotton Leaf

Curl Kokhran Virus-Dabawali (CLCuKV-Dab) coat protein and its mutants

with ssDNA. Virology 386: 427–437.

Qazi, J., Mansoor, S., Amin, I., Awan, M. Y., Briddon, R. W. and Zafar, Y. 2006.

First report of Mungbean yellow mosaic India virus on mothbean in Pakistan.

New Disease Reports [http://www.bspp.org.uk/ndr/] Volume 13.

Qazi, J., Ilyas, M., Mansoor, S. and Briddon, .R. W. 2007a. Legume yellow mosaic

viruses genetically isolated begomoviruses. Pathogen Profile, Molecular Plant

Pathology 8: 343–348.

Qazi, J., Amin, I., Mansoor, S., Iqbal, M. J. and Briddon, R. W. 2007b. Contribution

of the satellite encoded gene βC1 to cotton leaf curl disease symptoms. Virus

Research 128: 135.

206

Qu, F. and Morris, T. J. 2002. Efficient infection of Nicotiana benthamiana by

Tomato bushy stunt virus is facilitated by the coat protein and maintained by

p19 through suppression of gene silencing. Molecular Plant-Microbe

Interaction 15: 193–202.

Qu, F., Ren, T. and Morris, T. J. 2003. The coat protein of Turnip crinkle virus

suppresses posttranscriptional gene silencing at an early initiation step.

Journal of Virology 77: 511–522.

Qu, F., Ye, X., Hou, G., Sato, S., Clemente, T. E. and Morris, T. J. 2005. RDR6 has a

broad-spectrum but temperature-dependent antiviral defense role in Nicotiana

benthamiana. Journal of Virology 79: 15209–15217.

Raghavan, V., Malik, P. S., Choudhury, N. R. and Mukherjee, S. K. 2004. The DNA-

A component of a plant geminivirus (Indian mung bean yellow mosaic virus)

replicates in budding yeast cells. Journal of Virology 78: 2405–2413.

Raj, S. K., Khan, M. S. and Singh, R. 2005. Natural occurrence of a begomovirus on

pigeonpea in India. New Disease Reports [http://www.bspp.org.uk/ndr/]

Volume 11.

Raj, S. K., Khan, M. S., Snehi, S. K., Srivastava, S. and Singh, H. B. 2006a. First

report of Tomato leaf curl Karnatka virus infecting soybean in India. New

Disease Reports [http://www.bspp.org.uk/ndr/] Volume 13.

Raj, S. K., Khan, M. S., Snehi, S. K., Srivastava, S. and Singh, H. B. 2006b. A

Yellow Mosaic Disease of Soybean in Northern India is caused by Cotton leaf

curl Kokhran virus. Plant Disease 90: 975.

Rector, A., Tachezy, R. and van Ranst, M. 2004. A sequence-independent strategy for

detection and cloning of circular DNA virus genomes by using multiply

primed rolling-circle amplification. Journal of Virology 78: 4993–

4998.Reddy, R. V., Colvin, J., Muniyappa, V. and Seal, S. 2005. Diversity and

distribution of begomoviruses infecting tomato in India. Archives of Virology

150: 845–867.

Reddy, R. V., Achenjangb, F., Feltona, C., Etarocka, M. T., Anangfaca, M., Nugenta,

P. and Fondong, V. N. 2008. Role of a geminivirus AV2 protein putative

protein kinase C motif on subcellular localization and pathogenicity. Virus

Research 135: 115–124.

207

Rhee, Y., Gurel, F., Gafni, Y., Dingwall, C. and Citovsky, V. 2000. A genetic system

for detection of protein nuclear import and export. Nature Biotechnology 18:

433–437.

Rigden, J. E., Dry, I. B., Mullineaux, P. M. and Rezaian, M. A. 1993. Mutagenesis of

the virion-sense open reading frames of Tomato leaf curl virus. Virology 193:

1001–1005.

Rigden, J. E., Krake, L. R., Rezaian, M. A. and Dry, I. B. 1994. ORF C4 of tomato

leaf curl geminivirus is a determinant of symptom severity. Virology, 204:

847–850.

Rigden, J. E., Dry, I. B., Krake, L. R. and Rezaian, M. A. 1996. Plant virus DNA

replication processes in Agrobacterium: insight into the origins of

geminiviruses? Proceedings of National Academy of Sciences USA 93: 10280–

10284.

Roberts, S. and Stanley, J. 1994. Lethal mutations within the conserved stem-loop of

African cassava mosaic virus DNA are rapidly corrected by genomic

recombination. Journal of General Virology 75: 3203–3209.

Roggero, P., Ciuffo, M., Benvenuto, E. and Franconi, R. 2001. The expression of a

single-chain Fv antibody fragment in different plant hosts and tissues by using

Potato virus X as a vector. Protein Expression and Purification 22: 70–74.

Rojas, M. R., Noueiry, A. O., Lucas, W. J. and Gilbertson, R. L. 1998. Bean dwarf

mosaic geminivirus movement proteins recognize DNA in a form- and

sizespecific manner. Cell 95: 105–113.

Rojas, M. R., Jiang, H., Salati, R., Xoconostle-Cazares, B., Sudarshana, M. R., Lucas,

W. J. and Gilbertson, R. L. 2001. Functional analysis of proteins involved in

movement of the monopartite begomovirus, Tomato yellow leaf curl virus.

Virology 291: 110–125.

Rojas, M. R., Hagen, C., Lucas, W. J. and Gilbertson, R. L. 2005. Exploiting chinks

in the plant's armor: Evolution and emergence of geminiviruses. Annual

Review of Phytopathology 43: 361–394.

Roossinck, M. J. 1997. Mechanisms of plant virus evolution. Annual Review of

Phytopathology 35: 191–209.

Roth, B. M., Pruss, G. J. and Vance V. B. 2004. Plant viral suppressors of RNA

silencing. Virus Research 102: 97–108.

208

Rothenstein, D., Krenz, B., Selchow, O. and Jeske, H. 2007. Tissue and cell tropism

of Indian cassava mosaic virus (ICMV) and its AV2 (precoat) gene product.

Virology 359: 137–145.

Rouhibakhsh, A. and Malathi, V.G. 2005. Severe leaf curl disease of cowpea–A new

disease of cowpea in northern India caused by Mungbean yellow mosaic India

virus and a satellite DNA β. Plant Pathology 54: 259.

Ruiz-Medrano, R., Guevara-González, R. G., Argüello-Astorga, G. R., Monsalve-

Fonnegra, Z., Herrera-Estrella, L. R. and Rivera-Bustamante, R. F. 1999.

Identification of a sequence element involved in AC2-mediated transactivation

of the pepper huasteco virus coat protein gene. Virology 253: 162–169.

Rybicki, E. P. 1994. A phylogenetic and evolutionary justification for three genera of

Geminiviridae. Archives of Virology 139: 49–77.

Saeed, M, Behjatnia, S. A. A., Mansoor, S., Zafar, Y., Hasnain, S. and Rezaian, M. A.

2005. A single complementary-sense transcript of a geminiviral DNA β

satellite is determinant of pathogenicity. Mol Plant Microbe Interact 18: 7–14.

Saeed, M., Zafar, Y., Randles, J. W. and Rezaian, M. A. 2007. A monopartite

begomovirus-associated DNA betasatellite substitutes for the DNA B of a

bipartite begomovirus to permit systemic infection. Journal of General

Virology 88: 2881–2889.

Sambrook, J., Fritsch, E. F. and Maniatis, T. 1989. Molecular cloning: A laboratory

manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Samretwanich, K., Kittipakorn, K., Chiemsombat, P. and Ikegami, M. 2001.

Complete nucleotide sequence and genome organization of Soybean crinkle

leaf virus. Journal of Phytopathology 149: 333–336.

Sanderfoot, A. A. and Lazarowitz, S. G. 1995. Cooperation in viral movement: the

geminivirus BL1 movement protein interacts with BR1 and redirects it from

the nucleus to the periphery. Plant Cell 7: 1185–1194.

Sanderfoot, A. A., Ingham, D. J. and Lazarowitz, S. C. 1996. A viral movement

protein as a nuclear shuttle. Plant Physiology 11: 22–33.

Sanz, A. I., Fraile, A., García-Arenal, F., Zhou, X., Robinson, D. J., Khalid, S., Butt,

T. and Harrison, B. D. 2000. Multiple infection, recombination and genome

relationships among begomovirus isolates found in cotton and other plants in

Pakistan. Journal of General Virology 81: 1839–1849.

209

Saunders, K., Lucy, A. and Stanley, J. 1991. DNA forms of the geminivirus African

cassava mosaic virus consistent with a rolling circle mechanism of replication.

Nucleic Acids Research 19: 2325–2330.

Saunders, K., Lucy, A. and Stanley, J. 1992. RNA-primed complementary-sense

DNA synthesis of the geminivirus African cassava mosaic virus. Nucleic

Acids Research 20: 6311– 6315.

Saunders, K. and Stanley, J. 1999. A nanovirus-like DNA component associated with

yellow vein disease of Ageratum conyzoides: evidence for interfamilial

recombination between plant DNA viruses. Virology 264: 142–152.

Saunders, K., Bedford, I. D., Briddon, R. W, Markham, P. G, Wong, S. M., Stanley, J.

2000. A novel virus complex causes Ageratum yellow vein disease.

Proceedings of the National Academy of Sciences USA 97: 6890–6895.

Saunders, K., Bedford, I. D. and Stanley, J. 2001. Pathogenicity of a natural

recombinant associated with Ageratum yellow vein disease: implications for

geminivirus evolution and disease aetiology. Virology 282: 38–47.

Saunders, K., Salim, N., Mali, V. R., Malathi, V. G., Briddon, R. W., Markham, P. G.,

Stanley, J. 2002. Characterisation of Sri Lankan cassava mosaic virus and

Indian cassava mosaic virus: evidence for acquisition of a DNA B component

by a monopartite begomovirus. Virology 293: 63–74.

Saunders, K., Bedford, I. D., Yahara, T. and Stanley, J. 2003. The earliest recorded

plant virus disease. Nature 422: 831.

Saunders, K., Norman, A., Gucciardo, S. and Stanley, J. 2004. The DNA β satellite

component associated with Ageratum yellow vein disease encodes an essential

pathogenicity protein (βC1). Virology 324: 37–47.

Saxena, S., Hallan, V., Singh, B. P. and Sane, P. V. 1998. Nucleotide sequence and

intergeminiviral homologies of the DNA-A of papaya leaf curl geminivirus

from India. Biochemistry and Molecular Biology International 45: 101–113.

Scheel, D. 1998. Resistance response physiology and signal transduction. Current

Opinion in Plant Biology 1: 305–310.

Schnippenkoetter, W. H., Martin, D. P., Willment, J. A. and Rybicki, E. P. 2001.

Forced recombination between distinct strains of Maize streak virus. Journal

of General Virology 82: 3081–3090.

210

Scholthof, H. B., Scholthof, K. B. G. and Jackson, A. O. 1995. Identification of

Tomato Bushy Stunt Virus host-specific symptom determinants by expression

of individual genes from a Potato virus X vector. The Plant Cell 7: 1157–

1172.

Schrag, S. J. and Wiener, P. 1995. Emerging infectious disease: what are the relative

roles of ecology and evolution? Trends in Ecology and Evolution 10: 319–324.

Seemanpillai, M., Dry, I., Randles J. and Rezaian A. 2003. Transcriptional silencing

of geminiviral promoter-driven transgenes following homologous virus

infection. Molecular Plant-Microbe Interaction 16: 429–438.

Segers, G. C., Zhang, X., Deng, F., Sun, Q. and Nuss, D. L. 2007. Evidence that RNA

silencing functions as an antiviral defense mechanism in fungi. Proceedings of

the National Academy of Sciences USA 104: 12902–12906.

Selth, L. A., Randles, J. W. and Rezaian, M. A. 2004. Host responses to transient

expression of individual genes encoded by Tomato leaf curl virus. Molecular

Plant-Microbe Interactions 17: 27–33.

Selth, L. A., Dogra, S. C., Rasheed, M. S., Healy, H., Randles, J. W. and Rezaian, M.

A. 2005. A NAC domain protein interacts with Tomato leaf curl virus

replication accessory protein and enhances viral replication. Plant Cell 17:

311–325.

Sera, T. and Uranga, C. 2002. Rational design of artificial zinc-finger proteins using a

nondegenerate recognition code table. Biochemistry 41: 7074–7081.

Sera, T. 2005. Inhibition of virus DNA replication by artificial zinc finger proteins.

Journal of Virology 79: 2614–2619.

Settlage, S. B., Miller, B. and Hanley-Bowdoin, L. 1996. Interactions between

geminivirus replication proteins. Journal of Virology 70: 6790–6795.

Settlage, S. B., See, R. G. and Hanley-Bowdoin, L. 2005. Geminivirus C3 protein:

replication enhancement and protein interactions. Journal of Virology 79:

9885–9895.

Shih, S. L., Tsai, W. S., Green, S. K., Khalid, S., Ahmad, I., Rezaian, M. A. and

Smith, J. 2003. Molecular characterization of tomato and chilli leaf curl

begomoviruses from Pakistan. Plant Disease 87: 200.

Shirasu, K. and Schulze-Lefert, P. 2000. Regulators of cell death in disease resistance.

Plant Molecular Biology 44: 371–385.

211

Shivaprasad, P. V., Akbergenov, R., Trinks, D., Rajeswaran, R., Veluthambi, K.,

Hohn, T. and Pooggin, M. 2005. Promoters, transcripts, and regulatory

proteins of Mungbean yellow mosaic geminivirus. Journal of Virology 79:

8149–8163.

Shivaprasad, P., Thillaichidambaram, P., Balaji, V. and Veluthambi, K. 2006.

Expression of full-length and truncated Rep genes from Mungbean yellow

mosaic virus-Vigna inhibits viral replication in transgenic tobacco. Virus

Genes 33: 365–374.

Sijen, T., Wellink, J., Hendriks, J., Verver, J. and Van Kammen, A. 1995. Replication

of cowpea mosaic virus RNAl or RNA2 is specifically blocked in transgenic

Nicotiana benthamiana plants expressing the full-length replicase or

movement protein genes. Molecular Plant-Microbe Interactions 8: 340–347.

Singh, H. B., Joshi, B. S. and Thomas, T. A. 1970. The Phaseolus group. P.

Kachroo and M. Arif (eds.). Pulse crops of India. Indian Council of

Agricultural Research, New Delhi pp. 136–164.

Smartt, J. 1990. Pulses of the classical world, p. 190-198. In: R.J. Summerfield and

E.H. Ellis (eds.). Grain legumes: evaluation and genetic resources. Cambridge

University Press, Cambridge.

Smith, D. R. and Maxwell, D. P. 1994. Requirement of the common region of DNA-B

and the BL1 open reading frame of bean golden mosaic geminivirus for

infection of Phaseolus vulgaris. Phytopathology 84: 133–138.

Soto, M. J., Chen, L. F., Seo, Y. S., and Gilbertson, R. L. 2005. Identification of

regions of the Beet mild curly top virus (family Geminiviridae) capsid protein

involved in systemic infection, virion formation and leafhopper transmission.

Virology 341: 257–270.

Sserubombwe, W. S., Briddon, R. W., Baguma, Y. K., Ssemakula, G. N., Bull, S. E.,

Bua, A., Alicai, T., Omongo, C., Otim-Nape, G. W. and Stanley, J. 2008.

Diversity of begomoviruses associated with mosaic disease of cultivated

cassava (Manihot esculenta, Crantz) and its wild relative (Manihot glaziovii,

Müll. Arg.) in Uganda. Journal of General Virology 89: 1759–1769.

Stanley, J. 1983. Infectivity of the cloned geminivirus genome requires sequences

from both DNAs. Nature 305: 643– 645.

212

Stanley, J. and Gay, M. R. 1983. Nucleotide sequence of Cassava latent virus DNA.

Nature 301: 260–262.

Stanley, J. and Townsend, R. 1985. Characterization of DNA forms associated with

Cassava latent virus infection. Nucleic Acids Research 13: 2189–2205.

Stanley, J., Markham, P. G., Callis, R. J. and Pinner, M. S. 1986a. The nucleotide

sequence of an infectious clone of the geminivirus Beet curly top virus. EMBO

Journal 5:1761–1767.

Stanley, J. and Townsend, R. 1986b. Infectious mutants of Cassava latent virus

generated in vivo from intact recombinant DNA clones containing single

copies of the genome. Nucleic Acids Research 14: 5981–5998.

Stanley, J., Frischmuth, T. and Ellwood, S. 1990. Defective viral DNA ameliorates

symptoms of geminiviruses infection in transgenic plants. Proceedings of

National Academy of Sciences USA 87: 6291–6295.

Stanley, J. and Latham, J. R. 1992. A symptom variant of beet curly top geminivirus

produced by mutation of open reading frame C4. Virology 190: 506–509.

Stanley, J., Latham, J. R., Pinner, M. S., Bedford, I. and Markham, P. G. 1992.

Mutational analysis of the monopartite geminivirus Beet curly top virus.

Virology 191: 396–405.

Stanley, J., Bisaro, D. M., Briddon, R. W., Brown, J. K., Fauquet, C. M., Harrison, B.

D., Rybicki, E. P. and Stenger, D. C. 2005. Geminiviridae. Virus Taxonomy.

VIIIth Report of the International Committee on Taxonomy of Viruses, pp.

301–326. Edited by C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger

and L. A. Ball. London: Elsevier/ Academic Press.

Stenger, D. C., Duffus, J. E. and Villalon, B. 1990. Biological properties of a

geminivirus isolated from peppers. Phytopathology 80: 704–709.

Stenger, D. C., Revington, G. N., Stevenson, M. C. and Bisaro, D. M. 1991.

Replication release of geminivirus genomes from tandemly repeated copies:

evidence for rolling-circle replication of a plant viral DNA. Proceedings of

National Academy of Sciences USA 88: 8029–8033.

Stenger, D. C. 1994a. Complete nucleotide sequence of the hypervirulent CFH strain

of Beet curly top virus. Molecular Plant-Microbe Interaction 7: 154–157.

213

Stenger, D. C. 1994b. Strain-specific mobilisation and amplification of a transgenic

defective-interfering DNA of the geminivirus Beet curly top virus. Virology

203: 397–402.

Stenger, D. C. and Ostrow, K. M. 1996. Genetic complexity of a Beet curly top virus

population used to assess sugar beet cultivar response to infection.

Phytopathology 86: 929–933.

Sudarshana, M. R., Wang, H. L., Lucas, W. J. and Gilbertson, R. L. 1998. Dynamics

of bean dwarf mosaic geminivirus cell-to-cell and long-distance movement in

Phaseolus vulgaris revealed, using the green fluorescent protein. Molecular

Plant-Microbe Interactions 11: 277–291.

Sunter, G., Hartitz, M. D., Hormuzdi, S. G., Brough, C. L. and Bisaro, D. M. 1990.

Genetic analysis of Tomato golden mosaic virus: ORF AL2 is required for

coat protein accumulation while ORF AL3 is necessary for efficient DNA

replication. Virology 179: 69–77.

Sunter, G. and Bisaro, D. M. 1992. Transactivation of geminivirus AR1 and BR1

gene expression by the viral AL2 gene product occurs at the level of

transcription. Plant Cell 4: 1321–1331.

Sunter, G., Hartitz, M. D. and Bisaro, D. M. 1993. Tomato golden mosaic virus

leftward gene expression: Autoregulation of geminivirus replication protein.

Virology 195: 275–280.

Sunter, G., Stenger, D. C. and Bisaro, D. M. 1994. Heterologous complementation by

geminivirus AL2 and AL3 genes. Virology 203: 203–210.

Sunter, G. and Bisaro, D. M. 1997. Regulation of a geminivirus coat protein promoter

by AL2 protein (TrAP): evidence for activation and derepression mechanisms.

Virology 232: 269–280.

Sunter, G., Sunter, J. L. and. Bisaro, D. M. 2001. Plants expressing Tomato golden

mosaic virus AL2 or Beet curly top virus L2 transgenes show enhanced

susceptibility to infection by DNA and RNA viruses. Virology 285: 59–70.

Sunter, G. and Bisaro, D. M. 2003. Identification of a minimal sequence required for

activation of the Tomato golden mosaic virus coat protein promoter in

protoplasts. Virology 305: 452–462.

Surendranath, B., Usharani, K. S., Nagma, A., Victoria, A. K. and Malathi, V. G.

2005. Absence of interaction of genomic components and complementation

214

between Mungbean yellow mosaic India virus isolates in cowpea. Archives of

Virology 150: 1833-1844.

Tahir, M., Haider, M. S., Iqbal, J. and Briddon, R. W.

2009. Association of a distinct

begomovirus and a betasatellite with leaf curl symptoms in Pedilanthus

tithymaloides. Journal of Phytopathology 157: 188–193.

Tan, P. H. N., Wong, S. M., Wu, M., Bedford, I. D., Saunders, K. and Stanley, J.

1995. Genome organization of Ageratum yellow vein virus, a monopartite

whitefly-transmitted geminivirus isolated from a common weed. Journal of

General Virology 76: 2915–2922.

Tao, X. and Zhou, X. 2004. A modified viral satellite DNA that suppresses gene

expression in plants. Plant Journal 38: 850–860.

Tao, X. and Zhou, X. 2008. Pathogenicity of a naturally occurring recombinant DNA

satellite associated with Tomato yellow leaf curl China virus. Journal of

General Virology 89: 306–311.

Tenllado, F., Gania-Luque, I., Serra, M. T., and Diaz-Ruir, J. R. 1995. Nicotiana

bentbamiana plants transformed with the 54-kDa region of the Pepper mild

mottle tobamovirus replicase gene exhibit two types of resistance responses

against viral infection. Virology 211: 170–183.

Tenllado, F., Gemia-Luque, I., Serra, M. T. and Dia-Ruir, J. R. 1996. Resistance to

Pepper mild mottle tobamovirus conferred by the 54-kDa gene sequence in

transgenic plants does not require expression of the wild-type 54-kDa protein.

Virology 219: 330–335.

Thomas, C. L., Leh, V., Lederer, C. and Maule, A. J. 2003. Turnip crinkle virus coat

protein mediates suppression of RNA silencing in Nicotiana benthamiana.

Virology 306: 33–41.

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. and Higgins, D. G.

1997. The Clustal_X windows interface; flexible strategies for multiple

sequence alignment aided by quality analysis tools. Nucleic Acids Research

25: 4876–4882.

Thongmeearkom, P., Honda, Y., Saito, Y. and Syamananda, R. 1981. Nuclear

ultrastructural changes and aggregates of virus-particles in mungbean cells

infected with mungbean yellow mosaic disease. Phytopathology 71: 41–44.

215

Timmermans, M. C. P., Das, O. P. and Messing, J. 1994. Geminiviruses and their uses

as extrachromosomal replicons. Annual Review of Plant Physiology and Plant

Molecular Biology 45: 79–112.

Townsend, R., Watts, J. and Stanley, J. 1986. Synthesis of viral DNA forms in

Nicotiana plumbaginifolia protoplasts inoculated with Cassava latent virus

(CLV); evidence for the independent replication of one component of the CLV

genome. Nucleic Acids Research 14: 1253–1265.

Trinks, D., Rajeswaran, R., Shivaprasad, P. V., Akbergenov, R., Oakeley, E. J.,

Veluthambi, K., Hohn, T. and Pooggin, M. 2005. Suppression of RNA

silencing by a geminivirus nuclear protein, AC2, correlates with

transactivation of host genes. Journal of Virology 79: 2517–2527.

Turnage, M. A., Muangsan, N., Peele, C. G. and Robertson, D. 2002. Geminivirus

based vectors for gene silencing in Arabidopsis. Plant Journal 30: 107–114.

Unseld, S., Höhnle, M., Ringel, M. and Frischmuth, T. 2001. Subcellular targeting of

the coat protein of African cassava mosaic geminivirus. Virology 286: 373–

383.

Usharani, K. S., Surendranath, B., Haq, Q. M. R. and Malathi, V. G. 2004. Yellow

mosaic virus infecting soybean in northern India is distinct from the species

infecting soybean in southern and western India. Current Science 86: 845–

850.

Usharani, K. S., Surendranath, B., Haq, Q. M. R. and Malathi, V. G. 2005. Infectivity

analysis of a soybean isolate of Mungbean yellow mosaic India virus by

agroinoculation. Journal of General Plant Pathology 71: 230.

Vaistij, F. E., Jones, L. and Baulcombe, D. C. 2002. Spreading of RNA targeting and

DNA methylation in RNA silencing requires transcription of the target gene

and a putative RNA-dependent RNA polymerase. Plant Cell 14: 857–867.

Vance, V. B., and Vaucheret, H. 2001. RNA silencing in plants: defense and counter

defense. Science 292: 2277–2280.

Vanitharani, R., Chellappan, P., Pita, J. S. and Fauquet, C. 2004. Differential roles of

AC2 and AC4 of cassava geminiviruses in mediating synergism and

suppression of posttranscriptional gene silencing. Journal of Virology 78:

9487–9498.

216

Vanitharani, R., Chellappan, P. and Fauquet, C. M. 2005. Geminiviruses and RNA

silencing. Trends in Plant Science 10: 144–151.

van Regenmortel, H. V., Bishop, D. H. L., Fauquet, C. M., Mayo, M. A., Maniloff, J.

and Calisher, C. H. 1997. Guidelines to the demarcation of virus species.

Archives of virology 142: 1505–15018.

van Wezel, R., Liu, H., Tien, P., Stanely, J. and Hong, Y. 2001. Gene C2 of the

monopartite geminivirus tomato yellow leaf curl virus-China encodes a

pathogenicity determinant that is localized in the nucleus. Molecular Plant-

Microbe Interactions 14: 1125–1128.

van Wezel, R., Dong, X., Liu, H., Tien, P., Stanley, J. and Hong, Y. 2002a. Mutation

of three cysteine residues in Tomato yellow leaf curl virus-China C2 protein

causes dysfunction in pathogenesis and posttranscriptional genesilencing

suppression. Molecular Plant-Microbe Interactions 15: 203–208.

van Wezel, R., Dong, X., Blake, P., Stanley, J. and Hong, Y. 2002b. Differential roles

of geminivirus Rep and AC4 (C4) in the induction of necrosis in Nicotiana

benthamiana. Molecular Plant Pathology 3: 461–471.

van Wezel, R., Liu, H., Wu, Z., Stanley, J. and Hong, Y. 2003. Contribution of the

zinc finger to zinc and DNA binding by a suppressor of posttranscriptional

gene silencing. Journal of Virology 77: 696–700.

Vasudeva, R. S. 1942. A mosaic disease of cowpea in India. Indian Journal of

Science 12: 281–283.

Vaucheret, H., Vazquez, F., Crete, P. and Bartel, D. P. 2004. The action of

ARGONAUTE1 in the miRNA pathway and its regulation by the miRNA

pathway are crucial for plant development. Genes and Development 18: 1187–

1197.

Vavilov, N. I. 1951. The origin, variation, immunity, and breeding of cultivated

plants. (translation by K. S. Chester). Chronicle Botany 13: 1–364.

Vazquez, F., Vaucheret, H., Rajagopalan, R., Lepers, C., Gasciolli, V., Mallory, A.

C., Hilbert, J. L., Bartel, D. P. and Crete, P. 2004. Endogenous trans-acting

siRNAs regulate the accumulation of Arabidopsis mRNAs. Molecular Cell 16:

69–79.

217

Voinnet, O., Pinto, Y. M. and Baulcombe, D. C. 1999. Suppression of gene silencing:

a general strategy used by diverse DNA and RNA viruses of plants.

Proceedings of National Academy of Science USA. 96: 14147–14152.

Voinnet, O., Lederer, C. and Baulcombe, D. 2000. A viral movement protein prevents

spread of the gene silencing signal in Nicotiana benthamiana. Cell 103:157–

167.

Voinnet, O. 2001. RNA silencing as a plant immune system against viruses. Trends in

Genetics 17: 449–459.

Voinnet, O. 2005. Induction and suppression of RNA silencing: insights from viral

infections. Nature Reviwes Genetics 6: 206–220.

von Arnim, A. and Stanley, J. 1992a. Determinants of Tomato golden mosaic virus

symptom development located on DNA B. Virology 186: 286–293.

von Arnim, A. and Stanley, J. 1992b. Inhibition of African cassava mosaic virus

systemic infection by a movement protein from the related geminivirus

Tomato golden mosaic virus. Virology 187: 555–564.

Wang, H., Hao, L., Shung, C. Y., Sunter, G. and Bisaro, D. M. 2003. Adenosine

kinase is inactivated by geminivirus AL2 and L2 proteins. Plant Cell 15:

3020–3032.

Wang, H., Buckley, K. J., Yang, X., Buchmann, R. C. and Bisaro, D. M. 2005.

Adenosine kinase inhibition and suppression of RNA silencing by geminivirus

AL2 and L2 proteins. Journal of Virology 79: 7410–7418.

Wang, L. Z. 1985. Origin and diffusion of soybean. Soybean Science 4: 1–7

Wartig, L., Kheyr-Pour, A., Noris, E., De Kouchkovsky, F., Jouanneau, F.,

Gronenborn, B. and Jupin, I. 1997. Genetic analysis of the monopartite tomato

yellow leaf curl geminivirus: roles of V1, V2, and C2 ORFs in viral

pathogenesis. Virology 228: 132–140.

Waterhouse, P. M., Wang, M. B. and Lough, T. 2001. Gene silencing as an adaptive

defence against viruses. Nature 411: 834–842.

Were, H. K., Takeshita, M., Furuya, N. and Takanami, Y. 2005a. Molecular

characterization of a new begomovirus infecting honeysuckle in Kobe, Japan.

Journal of Faculty of Agriculture, Kyushu University 50: 61–71.

218

Were, H. K., Takeshita, M., Furuya, N. and Takanami, Y. 2005b. Molecular

characterization of a new begomovirus infecting honeysuckle in Sapporo,

Japan. Journal of Faculty of Agriculture, Kyushu University 50: 73–81.

Williams, L., Carles, C. C., Osmont, K. S. and Fletcher, J. C. 2005. A novel approach

identifies an endogenous trans-acting siRNA that targets the Arabidopsis

ARF2, ARF3/ETT and ARF4 genes. Proceedings of the National Academy of

Sciences USA 102: 9703–9708.

Wright, E. A., Heckel, T., Groenendijk, J., Davies, J. W. and Boulton, M. I. 1997.

Splicing features in maize streak virus virion- and complementary-sense gene

expression. Plant Journal 12: 1285–1297.

Wu, P. J. and Zhou, X. P. 2005. Interaction between a nanovirus-like component and

the tobacco curly shoot virus/satellite complex. Acta Biochimica Biophysica

Sinica 37: 25–31.

Xie, Z., Johansen, L. K., Gustafson, A. M., Kasschau, K. D., Lellis, A. D., Zilberman,

D., Jacobsen, S. E. and Carrington, J. C. 2004. Genetic and functional

diversification of small RNA pathways in plants. PLoS Biology 2: E104.

Xiong, Q., Guo, X. J., Che, H. Y. and Zhou, X. P. 2005. Molecular characterization of

a distinct Begomovirus and its associated satellite DNA molecule infecting

Sida acuta in China. Journal of Phytopathology 153: 264–268.

Yadav, R. K., Shukla, R. K., Chattopadhyay, D. 2009. Soybean cultivar resistant to

Mungbean yellow mosaic India virus infection induces viral RNA degradation

earlier than the susceptible cultivar. Virus Research (in press).

Yang, Y., Sherwood, T. A., Patte, C. P., Hiebert, E. and Polston, J. E. 2004a. Use of

Tomato yellow leaf curl virus (TYLCV) Rep gene sequences to engineer

TYLCV resistance in tomato. Phytopathology, 94: 490–496.

Yang, S. J., Carter, S. A., Cole, A. B., Cheng, N. H. and Nelson, R. S. 2004b. A

natural variant of a host RNA-dependent RNA polymerase is associated with

increased susceptibility to viruses by Nicotiana benthamiana. Proceedings of

the National Academy of Sciences USA 101: 6297–6302.

Yang, X., Baliji, S., Buchmann, R. C., Wang, H., Lindbo, J. A., Sunter, G. and Bisaro,

D. M. 2007. Functional modulation of the geminivirus AL2 transcription

factor and silencing suppressor by self-interaction. Journal of Virology 81:

11972–11981.

219

Yu, B., Yang, Z., Li, J., Minakhina, S., Yang, M., Padgett, R. W., Steward, R. and

Chen, X. 2005. Methylation as a crucial step in plant microRNA biogenesis.

Science 307: 932–935.

Zhang, H. S. and Dean, D. C. 2001. Rb-mediated chromatin structure regulation and

transcriptional repression. Oncogene 20: 3134–3138.

Zhang, W., Olson, N. H., Baker, T. S., Faulkner, L., Agbandje-McKenna, M.,

Boulton, M. I., Davies, J. W. and McKenna, R. 2001. Structure of the Maize

streak virus geminate particle. Virology 279: 471– 477.

Zhang, S. C., Ghosh, R. and Jeske, H. 2002. Subcellular targeting domains of

Abutilon mosaic geminivirus movement protein BC1. Archives of Virology

147: 2349–2363.

Zhang, P., Fütterer, J., Frey, P., Potrykus, I., Puonti-Kaerlas, J. and Gruissem, W.

2003. Engineering virus-induced ACMV resistance by mimicking a

hypersensitive reaction in transgenic cassava plants. In: I.K. Vasil (Ed.) Plant

Biotechnology 2002 and Beyond, Kluwer Academic Publishers, Dordrecht,

Netherlands, pp. 143–146.

Zhou, X., Liu, Y., Calvert, L., Munoz, C., Otim-Nape, G. W., Robinson, D. J. and

Harrison, B. D. 1997. Evidence that DNA A of a geminivirus associated with

severe cassava mosaic disease in Uganda has arisen by interspecific

recombination. Journal of General Virology 78: 2101–2111.

Zhou, X., Xie, Y., Tao, X., Zhang, Z., Li, Z. and Fauquet, C. M. 2003a.

Characterization of DNA β associated with begomoviruses in China and

evidence for co-evolution with their cognate viral DNA-A. Journal of General

Virology 84: 237–247.

Zhou, X., Xie, Y., Peng, Y. and Zhang, Z. 2003b. Malvastrum yellow vein virus, a

new Begomovirus species associated with satellite DNA molecule. Chinese

Science Bulletin 48: 2205–2209.

Zhukovsky, P. M. 1950. Cultivated plants and their wild relatives (translation by P. S.

Hudson, 1962). Commonwealth Agricultural Bureau, Farnham Royal,

England pp. 107.

Zilberman, D., Cao, X. and Jacobsen, S. E. 2003. ARGONAUTE4 control of locus-

specific siRNA accumulation and DNA and histone methylation. Science 299:

716–719.

220

Zrachya, A., Glick, E., Levy, Y., Arazi, T., Citovsky, V. and Gafni, Y. 2006.

Suppressor of RNA silencing encoded by Tomato yellow leaf curl virus -

Israel. Virology 358: 159–165.