Lignocellulose Saccharification and Direct Fermentation to Ethanol: An Engineered Saccharomyces cerevisiae Co-displaying active Cellulases/Domains

Chandrasekhar. BanothChandrasekhar. BanothBSR-RFSMS-JRF

Dept. of Microbiology, Osmania University, Hyderabad-500 007, India.

WHY BIOETHANOL??

Can be produced from several different plant biomass

Oxygenated fuel that contains 35% oxygen

Higher octane number

Broader flammability limits

The net CO2 emission of burning a biofuel like ethanol is zero

CURRENT STATUS OF BIOETHANOL

The world's top ethanol producers in 2014 were 1.The United States with 52.6 billion liters2.Brazil with 21.1 billion liters,

Both countries accounting together for 87.1% of world production

Brazil has the largest and most successful bio-fuel programs in the world, involving production of ethanol fuel from sugar cane.

The United States produces Corn ethanol and consumes more than any other country in the world

To reduce environmental pollution, Government of India have been examining supply of ethanol-doped-petrol in the country 

Both pilot projects and R & D studies have been successful and established blending of ethanol up to 5% with petrol and usage of ethanol-doped-petrol in vehicles

By 2017, the GOI mandates replacing 20 percent of petroleum-based motor fuel with biofuels

The country lacks mature technologies for ethanol production from lignocellulosic biomass

Though biomass itself is cheap, the cost of its processing is relatively higher.

BIOETHANOL IN INDIA

YEAST AS A FERMENTATIVE ORGANISM

An ideal organism for the production of ethanol

Ferment both pentoses and hexoses

Has the capability to survive at high temperatures

Withstand against fermenting inhibitors

Should have high ethanol yield within a shorter periods

Can cope up with high ethanol concentration.

Cellulases are responsible for the hydrolysis of the β-1,4 glucosidic bonds in cellulose.

Members of the glycoside hydrolase families of enzymes, which hydrolyze oligosaccharides and/or polysaccharides .

Enzymatic hydrolysis is one of the most expensive processing steps in cellulosic biofuel production

To hydrolyze cellulose into soluble sugars, multiple enzymatic activities are required.

Cellulases

Native enzymes are not well suited for industrial applications Protein engineered enzymes are well studied for industrial applications because

Increase the efficiency of enzyme-catalyzed reactions

Eliminate the need for cofactor in enzymatic reaction

Change substrate binding site to increase specificity

Change the thermal tolerance

Change the pH stability

Increase proteins resistance to proteases (purification)

Signal sequences - secretion

rare codon changes

Reactivity in non aqueous solvents

Alter allosteric regulation

Engineering cellulases

Worldwide quantities of rice straw available and theoretical ethanol yield. (Kim and Dale (2004).

Country Rice straw availability Theoretical ethanol yield

  (Million MT) (Billion liters)

Africa 20.93 8.83

Asia 667.59 281.72

Europe 3.92 1.65

North America 10.95 4.62

Central America 2.77 1.17

South America 23.51 9.92

I. Collection of Cellulases sequences and identification of functional key domains a. Evaluation based analysis b. Structure Based analysis. c. Muteins development and Ramchandran Plot analaysis

II. Screening and selection of potent thermotolerant yeasts. Samples were collected across the India during mid-summer (April-May2009). a. Selection of potent thermotolerant yeasts: Growth at 41°C to 50°C by gradually increasing 1°C. b. Characterization: Biochemical characterization-- Sugar fermentation: Genetic Characterization:

18 S r-RNA gene sequencing and Phylogenic analysis. c. Ethanol fermentation

I. Cloning of Cellulases in E. Coli and Site directed Mutagenesis Cloning of wild cellulases into E Coli and S. cerevisiae for extra cellular expression Bacillus subtilis –Endocellulose Trichoderma reesei ---Cellobiohydrolase and Aspergillus niger ---Beta glucosidase

Objectives of the study

Vectors: For Bacterial expression pET34, for yeast expression pRS316 GU.

Secretary tags: Alpha factor of yeast and ompR of E. coli

Genomic DNA isolation from B.subtilis, T reesei and A niger.

PCR of endocellulase from B. subtilis, cellulobiohydrolyase from T. reesei and betaglucosidase from A. niger

PCR clean up.

Plasmid isolation.

Restriction Digestion of Plasmid and PCR product and gel elution.

Ligation of gene and signal peptide in E Coli and Yeast.

Induction of Gal promoter in Yeast and Lac promoter in E coli.

Evaluation of activities of extra cellular cellulases.

Site directed mutagenesis:

Protein Engineering: Alteration of amino acids based on sequence phylogeny and structural analysis.

Docking Studies: Docking of celluloses with engineered cellulases.

Selection of Engineered sequences:

Codon Optimization: DNA 2.0 tool for codon optimization. Codons were assigned as per usage frequency.

15% below frequency codons were ignored.

As wild sequences showed very little activity and many points were identified for mutagenesis, instead of conventional site directed mutagenesis, engineered synthetic genes were designed (Mr. Gene Inc., Germany).

IV. Sub-cloning of active catalytic cellulases with and without substrate binding domain. Protein Engineering: CBD was added and removed. Docking Studies: Docking for efficient CBD binding. Selection of Engineered sequences. Codon Optimization for Cloning and expression in yeast

V. Cloning of engineered cellulases in yeast for surface display a. Cloning of cellulases after 2-aggluttin gene in yeast surface displaying pCTOCP vector.. b. Expression of cellulases in recombinant yeasts and confirmation of surface expression of

cellulases: c. Stability studies of recombinant surface displaying yeasts d. Enzymatic hydrolysis of selected Cellulosic materials at 40 0C e. Enzymatic hydrolysis with increased cellulase surface displaying yeast concentration to reduce

process duration. f. Estimation of Pretreated and Cellulases treated rice straw composition and ethanol produced in

simultaneous saccharification and fermentation at 450C.

1. Thermotolerant yeasts isolated were identified by 18S rRNA sequencing.

• These sequences were published in NCBI Database with the following accession No.• KR136204 Sacchoromyces cervisiae• HQ659553 Pichia nakasei• HQ659557 Kyluveri maxianus•  KP998094 Sacchoromyces cervisiae• HM009313 Sporobolomyces Dimmenae• KM873330 Sacchoromyces cervisiae• HQ659566 Zygosaccharomyces bailii• HM009316 Sacchoromyces cervisiae•  KP998095 Pichia jaronii kudriavzevii• HM009318 Wickerhamoryces edophicus• KR028986 Sacchoromyces cerevisiae

1. Chandrasekhar B and Bhima B: Cellulose as Sole Substrate for Bio Ethanol Production: Development of Structural Molecular Model of Endoglucanase III from Trichoderma Reesei Using Bioinformatic Tools. Int J Pharm Sci Res 2015; 6(3): 1132-36

2. A paper entitled “Evolution of biodiversity of thermotolerant yeasts isolated across the India” is being prepared for communication to journal of Applied and Environmental Microbiology.

3. After depositing the cellulase surface displaying yeasts in IMTECH, Indian and PCT patents will be filed

4. After patents filing research work will be published in high impact factor journal.

Publications/Patents/Technology and Product

Detailed work reportDetailed work reportCollection of Cellulases sequences and analysis to identify functional key domains

Retrieving of protein and gene sequences of cellulases:

I. Domains conservation evolution & Muteins selection:

Master template genes: Cel AAA34213, CBHIIAAA72922 and BglI Q9P8F4

II. Structure based analysis:

Development of PDB structures and evolution for stable and higher active cellulases.

Homology modeling: Devlopment of PDB structures using MODELLOR9.V1.

Ram chandran plot analysis

– Cel Wild sequence: AAA34213 core: 88.9% allow: 9.4% Disall: 1.1% Gen: 0.6%

– Altered Sequence1: AAA34213M2 core: 90% allow: 8.3% Disall: 0.6% Gen: 1.1%

– CBH Wild sequence: AAA72922 Core: 90.2%allow: 9.5%disallow: 0%gen: 0.3%

– Altered Sequence1: AAA72922 M4 Core: 90.4% allow: 9.6% disallow:0% gen:0%

– Bgl Wild sequence: Q9P8F4 Core: 86.6% allow:9.9% disallow:1.12% gen:2.4%

– Altered Sequence1: Q9P8F4M5 Core: 87.1% allow: 10% disallow:0.8% gen:2.1%

PROTEIN ENGINEERING FOR THREE ENZYMES

Engineering profile of Endoglucanase III: 

– A mutant replacement of N with T at 321 position (N321T) exhibited an optimal activity at pH 5.4.

– The N321E changed enzyme’s optimal activity to pH 4.0 and increase in the activity.

– N321H mutated enzyme was active over a broader pH range.

– Replacement of four aspartates within the active site centre of endoglucanase with alanine and Glutamine results increase in the substrate binding.

Engineering profile of Cellobiohydrolase

– CBH was designed with and without CBD.

– Replacement of Alanine of 224 with Histidine and Glutamic acid of 217 with Aspartic acid was found to give more thermostable enzyme.

Engineering profile of Betaglucosidase:

– G replaced with aromatic aas as like F,W,Y, at 294 showed higher activities for substrate recognition than the parent strain. The hydrolytic activities are increased.

– Enzyme engineering was performed to link the cbd of CBHII to BGL.

– cbhCBD-BGL exhibited the highest rate of hydrolysis, Approximately four fold higher than native enzyme. CBD-CBD-BGL exhibited two fold higher than native enzyme.

Docking Studies:Wild Mutant

Ecell

CBH II

Bgl

CODON OPTIMIZATION

– DNA 2.0 software for maximum expression of cellulase.

– Codon optimization was carried out at above 15% threshold and as per the codon usage frequency of standard Saccharomyces table.

Genes selected for synthesis

– A.Cellobiohydrolase without CBD;

– B.Cellobiohydrolase

– C. Endocellulase without CBD;

– D. Endocellulase

– E. Beta Glucosidase ;

– F. Beta Glucosidase without CBH

– G. Cellobiohydrolase with additional CBD;

– H. Endocellulase with additional CBD

II. ISOLATION, SCREENING AND SELECTION OF POTENT THERMOTOLERANT YEASTS

Sample: Samples were collected across the India during mid summer (April-May2012) to isolate thermotolerant yeast

Isolation methods: Thermotolerant yeast isolation from the collected sample was done by two different strategies.

Method 1: In this method all the samples were suspended equally (0.1 gram each) in YEPD broth media. It is called as enriched sample. To this Ampicillin was added to avoid bacterial growth. Next day 100ul of Enriched Culture was spread in to YEPDA media plates.

Method 1: In this method 1 g of soil sample is suspended in 10 ml of water to make a diluted suspension. From this suspension 100 ul of sample was taken and spreaded onto the YPD agar media (with amp.) plates

These plates were incubated at 30 °C for overnight. From these plates, yeast colonies were isolated and sub cultured on YEPD plates.

Selection of potent thermotolerant yeasts

The isolated colonies were inoculated on YEPD plates and incubated at different temperatures ranging from 41°c to 50°c by gradual increase in temperature to 1°C.

Finally, Thermotolerant yeasts growing at 49 °C were isolated.

Characterization:One hundred and ten yeast isolates were characterized by growth morphology on solid and liquid YEPD media, microscopic, biochemical and genetic characteristics.

Growth on solid and liquid YEPED media

Isolated pure cultures were streaked on YEPDA and incubated at 28 °C for 2 days and the colony morphology was noted.

Isolated yeasts were also inoculated into YEPD broth, incubated at 28 °C/150 RPM for 24 hrs and further 24 hrs in constant position.

Nature of yeast growth (flocculation, suspended growth, top and bottom growth) was noted.

RESULTSIn the present study, 110 yeasts were isolated from 250 samples based on their growth at 40 oC.

After obtaining, they were incubated at temperatures from 40 oC to 50 oC and were isolated (Table).

Table. No of yeasts isolated based on the growth temperature

Temperature No. of Yeasts40° C 30

41° C 15

42° C 12

43° C 10

44° C 10

45° C 10

46° C 8

47° C 8

48° C 6

49° C 1

50° C 0

Biochemical characterization (Sugar fermentation)

Sl.No Samples Control Glucose Maltose Ribulose Fructose Xylose Cellobiose Inositol

1 S.C 0 0.405 0.145 0 0.12 0 0 0

2 CB7 0 0.981 0.680 0.573 0.895 0.035 0.617 0.635

3 OBC9 0 0.489 0.420 0 0 0.143 0.236 0.275

4 CB4 0 0.580 0.283 0.053 0.505 0.124 0.197 0.123

5 OBS2 0 0.463 0.273 0.80 0.340 0 0.195 0.111

6 CB11 0 0.512 0.253 0.177 0.480 0.365 0.090 0.301

7 OBC14 0 0.503 0.245 0 0.571 0 0.05 0.276

8 CB5 0 0.509 0.279 0.145 0.650 0.150 0.112 0.230

9 CB8 0 0.293 0.323 0 0.350 0.131 0.178 0.139

10 CB10 0 0.396 0.283 0.113 0.453 0.123 0.178 0.139

11 OBC15 0 0.470 0.243 0.71 0.452 0 0.177 0.220

12 SRPT5 0 0.425 0.097 0.153 0.549 0.87 0.182 0

Molecular Based Characterization:

Genomic DNA Isolation was carried out By phenol chloroform method

18S rRNA was amplified with yeast specific primers and the amplicons were sent to Bioserve pvt. ltd for 18s r RNA sequencing.

Forward primer: GTTAGATCCCAGGCGTAGAACAGRiverse primer: CAATCTCGGGTCCGCATCTTGTC

35 cycles

Initial Denaturation 940C 1min

Denaturatrion 940C 30s Annealing 610C 30s Extension 720C 2 min

Final Externsion 720C for 10,min

Results:OBS2, OBC9, OBC14 and OBC51samples are confirmed as a Saccharomyces based on the morphological, biochemical and 18 S r RNAsequencing analyses.

S.No. Gene bank Accession No. Name1 KR136204 Sacchoromyces cervisiae

2 KP998094 Sacchoromyces cervisiae

3 KR136204 Sacchoromyces cervisiae

4 KM873330  Sacchoromyces cervisiae

These 11 sequences were deposited in NCBI public database.

Ethanol fermentation:

Sl.

No

Samples 15% Glucose 7.5g/50ml LOS

Ethanol Fermentation efficiency

20% Glucose 10.5/50ml

Ethanol Fermentation efficiency

25% Glucose 12.5g/50ml

Ethanol Fermentation efficiency

%

1 S.C 329mg 2.18g 59.5 314mg 3.2g 60.66 321mg 4.8g 77.12

2 CB7 127mg 2.5g 66.35 30mg 3.7g 69.15 121mg 5.1g 80.68

3 OBC9 312mg 3.29g 90 308mg 4.8g 92.16 334mg 5.8g 93.2

4 OBS2 12mg 3.32g 87 0 4.65g 86.66 95mg 5.7g 90

5 CB11 163mg 2.32g 61 0 4.2g 78.27 154mg 5.4g 85.5

6 CB14 271mg 2.18g 58 30mg 4.1g 76.6 14mg 5.7g 89.3

7 OBC14 333mg 3.4g 93 309mg 4.72g 91.45 54mg 6.0g 94

8 CB5 25mg 3.4g 89 0 3.8g 70.82 0 5..9g 92.3

9 CB8 0 3.1g 80 9mg 3.2g 59.69 0 4.8g 75.14

10 CB10 96mg 2.45g 64.7 0 3.4g 63.36 0 5.4g 84.5

11 OBC15 30mg 3.45g 90.38 0 4.5g 83.8 0 6..35g 77.8

12 SRPT5 283mg 2.12g 56.75 300mg 0 0 300mg 5.2g 83.41

Scanning electron Microscopy images for OBC14, OBC 15, and OBC9 Strains at 6000X magnification and 10um bar

OBC14 480C

OBC15 490C

OBC9480C

Scanning electron Microscopy images for OBC14, OBC 15, and OBC9 Strains at 2500X magnification and 10um Bar and measurement of cell in micrometers

OBC14 3.26-3.96um

OBC15 1.94-4.83um

OBC9 2.03-3.67um

III. Cloning of Cellulases in E.Coli and Site directed Mutagenesis

• Cloning of the wild cellulases in E Coli and S. cerevisiae for extracellular expression.

• Vectors For Bacteria pET34, For yeast pRS316 GU

• Signal sequences - alpha factor of yeast and ompR of E. coli

• Genomic DNA isolation from B. subtillis, T. reesei and A. niger.

• PCR of cel endocellulase gene from B. subtillis, Cellobiohydrolase II from T. reesi and bgl betaglucosidase from A. niger.

• PCR clean up.

• Plasmid isolation

• Restriction Digestion of Plasmid and PCR product.

• Ligation of gene and signal peptide in E Coli and Yeast.

• Induction of Gal promoter in Yeast and Lac promoter in E coli.

• Evaluation of activities of extra cellular cellulases.

Cloned endocellulase from B.subtillis, CBH II from T. reesei and bgl betaglucosidase from A. niger in both E Coli and S.cerevacea for extra cellular expression.

The endocellulase in E Coli (2IU CMCase/ml) and cellobiohydrolase CBHII in S.cerevacea (1IU FPAse/ml) were obtained. Betaglucosidase activity was not found in either Ecoli or Yeast.

Results:

IV. Sub-cloning of active catalytic cellulase with and without substrate binding domain

Engineering profile of Endoglucanase III: 

• A mutant replacement of N with T at 321 position (N321T) exhibited an optimal activity at pH 5.4 .

• The N321E changed enzyme’s optimal activity to pH 4.0 and increase in the activity.

• N321H mutated enzyme was active over a broader pH range.

• Replacement of four aspartates within the active site centre of endoglucanase with alanine and Glutamine results increase in the substrate binding.

Engineering profile of Cellobiohydrolase

• CBH was designed with and without CBD.

• Replacement of Alanine of 224 with Histidine and Glutamic acid of 217 with Aspartic acid was found to give more thermostable enzyme.

Engineering profile of Betaglucosidase:

• G replaced with aromatic aas as like F,W,Y, at 294 showed higher activities for substrate recognition than the parent strain. The hydrolytic activities are increased.

• Enzyme engineering was performed to link the cbd of CBHII to BGL.

• cbhCBD-BGL exhibited the highest rate of hydrolysis, Approximately four fold higher than native enzyme. CBD-CBD-BGL exhibited two fold higher than native enzyme.

VI. Cloning of engineered cellulases in yeasts for surface display

• After engineering studies 2 mutants for 3 cellulases each were synthesized (Mr Gene, Germany).

• Synthetic genes were provided in standard plasmid which is further sub-cloned in surface display vector having Gal promoter.

• Plasmid: Surface display plasmid was developed in our laboratory earlier (pCTO CP) was used in these studies. 2-Agglutinin gene 120bp N terminal was amplified and kept after GAL promoter with EcoR I site. After half agglutinin ( Gly 4, Ser)3 linker was kept and followed by MCS for cloning of desired genes.

A: Cellobiohydrolase without CBD. 1 Kbps.B.Cellobiohydrolase 1.35 Kbps.C. Endocellulase without CBD 1.1 KbpsD. Endocellulase 1.23 KbpsE. Beta Glucosidase 2.65 Kbps.F. Beta Glucosidase without CBH 2.3 KbpsG. Cellobiohydrolase with additional CBD 1.7 kb.H. Endocellulase with additional CBD 1.4 Kbps.I. Vector: pCTOCP 6.5Kbp

Restriction Digestion and Elution: digested using NheI and BamHI

Ligation:

Transformation in E coli:

Screening for recombinant clones:

Yeast Surface Display Cloning Studies Gels:A: Cellobiohydrolase without CBD. 1 Kbps.B.Cellobiohydrolase 1.35 Kbps.C. Endocellulase without CBD 1.1 KbpsD. Endocellulase 1.23 KbpsE. Beta Glucosidase 2.65 Kbps.F. Beta Glucosidase without CBH 2.3 KbpsG. Cellobiohydrolase with additional CBD 1.7 Kbps.H. Endocellulase with additional CBD 1.4 Kbps.

Gene transformation into yeast by electroporation

• Auxotrophic S.cerevisiae EYB100 and Thermotolerant S. cerevisiae OBC14 strains were selected for electrotranformation.

• Electroporation was carried out at 1.6 Volts for 9s.

• The EYB100 transformation samples were plated on Tryptophan- selective medium (YNB minimal medium without Tryptophan) and incubated for 3 days at 30 oC.

• The OBC14 transformed samples were plated on Tryptophan- selective medium (YNB minimal medium with Cellulose/CMC/cellulobiose replacing glucose) and incubated for 3 days at 42 oC.

• Recombinant yeasts were selected by their growth on selective medium.

Surface display of cellulases and their activity

• Five EYB100 recombinants from selective medium were grown in 100 ml YNB selective medium (1% yeast nitrogen base, 2% Ammonium sulphate, 1% glucose and 2% Galactose) without tryptophan for 48 hrs.

• Five thermotolerant OBC14 recombinant yeasts were grown in 100ml YEPDG medium (1% yeast extract, 2% peptone, 1% Glucose and 1% Galactose) for 24 hrs at 40 oC. Then the culture was further induced with sterile 2ml of 10% galactose solution and grown for 24 hours more.

• After harvesting the yeast cells from medium, supernatant, washed whole cells, lysed cells and isolated membrane were used for cellulase activity.

• FPase and CMCase assays were performed due to lack of specific substrates for individual enzyme assays.

• Intact EBY100 & OBC14 high density cells assayed at above 50 oC showed 10 IU FPase/ml

• Cellulase activity was not found in supernatant and also there was no DNS activity when entire OBC14 cells used at 50 oC and below temperatures.

• There is no DNS reaction in intact live OBC14 cells at 50 oC and below temperatures because of immediate up taking of glucose after cellulase activity by live cells.

• Cellulase activity was found in membrane and also in heat killed intact cells. But the activity is very less (1-2 IU FPase/ml)

• Based on activity, one recombinant each for Endocellulase, Cellobiohydrolase and Betaglucosidase were selected from EBY100 and OBC14 transformants.

• Swollen cellulose, crystalline cellulose, pretreated ( 2% acid treated and 0.2M NaOH treated ) rice straw and Watt man No 1 paper pieces were suspended in 50 mM Sodium acetate buffer at 2 % substrate concentrations.

• After sterilization at 10 lbs for 20 minutes 15% w/v of inoculum (mixture cell suspension of three recombinant yeasts) was added and incubated at 45 oC & 150 rpm for 72 hrs

• Samples were collected and used for estimation of sugars by DNS method and ethanol produced by HPLC.

Hydrolysis of Wattman No.1 paper using cellulases surface displaying YeastsA: Control and 48hrs digested at 45oC B: Control,12 and 24hrs digested at 50oC.

Hydrolysis of crystalline cellulose and Whatmann No.1 paper using cellulose Surface displaying Yeasts. A: 48hrs digested crystalline cellulose and Whatmann No.1 paper at 45oC with control

Hydrolysis of CMC and swollen cellulose using cellulases surface displaying Yeasts. A: Control, 24 and 48hrs digested CMC at 45oC with endocellulase surface displaying yeast.

B: Control and 24 hrs digested swollen cellulose at 45oC with three yeasts mixture.

A B

Hydrolysis of crystalline cellulose using cellulases surface displaying yeasts.(10ml) A:Control & 48hrs digested crystalline cellulose at 45oC with yeasts after shaking.

B: 48hrs digested crystalline cellulose at 45oC with yeasts & Control after 1hr standing.

Hydrolysis of crystalline cellulose using cellulases surface displaying yeasts.(50ml) A:Control & 48hrs digested crystalline cellulose at 45 oC with yeasts after shaking.

B: 48hrs digested crystalline cellulose at 45oC with yeasts & Control after 1hr standing.

Expression of cellulase by recombinant yeasts and confirmation of surface expression of cellulases

– Transformed thermotolerant OBC14 and EBY100 yeasts were inoculated in YEPDG medium and incubated at 30 0C for 48 hrs.

– Cells were harvested by centrifugation and washed with saline.

– Half of the cells were treated with 10 mM DTT and remaining half were treated with 100 mM β Marcapto Ethanol in 0.1M phosphate buffer at 70 0C for 4 hrs.

– From DTT/MTOH treated cells, half of the cells were lysed with sonication.

– Different samples (1. Fermented supernatant 2. Intact cells 3.Supernatant after DTT/MTOH treatment 4. Washed cells after DTT/MTOH treatment and 5. DTT/MTOH treated, washed and lysed sample) were used for enzyme assays, utilization/degradation of selective substrate, protein estimation and detection by SDS PAGE.

Results

No cellulase activities were found in the supernatant of culture broth, in DTT/ β Mercaptoethanol treated cells and DTT/ β Mercaptoethanol treated and lysed fraction.

It was also found that these samples were not able to utilize/degrade selected celluloses.

Intact cells and supernatant after DTT/ β Mercaptoethanol treatment showed cellulase activities.

Intact cells showed less activity at 45oC than it’s potential of celluolosic material degradation, may be due to immediate uptake of Glucose by yeast.

High enzyme activity (10.0 IU/ml) was found with high density cells at 55 oC.

Supernatant of DTT/ β Mercaptoethanol treated samples showed protein expression and was detected by SDS PAGE, but activity was minimum due to denaturation of disulfide bonds of cellulases and leading to

inactivation.As there is no cellulase activity in supernatant and inside the cells, It confirms the proteins are anchoring

and expressed on cell surface.

10 mM DTT and 100 mM of β Mercaptoethanol concentration is required to remove the cell bound cellulases, which is also reducing/destroying activity of cellulases on the yeast membrane with agglutinin

proteins indicating strong attachment of cellulases in the membrane.

Stability studies of recombinant surface displaying yeasts

•Two recombinant yeasts from each clone were inoculated in YNB selective medium with substrates (Endocellulase- CMC, cellobiohydrolase-swollen cellulose , β- Glucosidase- cellobiose). •EYB 100 strains were inoculated in YEPC (0.5% Yeast extract, 1% peptone, 0.5% glucose, 1% galactose, 2% swollen cellulose) and OBC14 strains were inoculated in YEPG media and incubated at 40 0C for one week.• Another cycle is performed by similar media with 100 ul previous inoculum.•Likewise, five cycles were repeated. •Finally presence of plasmid, enzyme and substrate hydrolysis was observed.

Results•Selected recombinant strains of EYB100 yeast were found to be stable for surface display of cellulases and utilization of selective cellulosic materials for studied period. •In thermotolerant yeast about 25% cells lost plasmids after 5 cycles.•Hence it is advised to transform the genes again into OBC14 thermotolerant yeasts and prepare 100 glycerol stocks from fresh positive transformants.

• Jhonsson et al 1989; Identification of Carbohydrate binding domain.• Maccoren et al 1993; Cellulase active site determination. • Kataeva et al 1999; Identified domains,Cloning of thermostable Cellulobiose domain.• Lindera et al 1999; pH stable domain engineering.• Frangos et al 1999; Domain with cellulase and hemicellulase activity• Schulein 2000; Protein engineering of cellulases• Liu et al 2001; Active site and Linker engineering.• Wang et al 2005; pH stable domain engineering• Violot et al 2005: Low temperature active cellulase.• Sandgren et al 2005; Domain thermo stability and substrate binding.• Zhang et al 2006; Review on Cellulase protein engineering.• Voutilainen et al 2007; Thermostable domain engineering.• Wang et al 2008; Thermostable bacillus domain engineering.• Qin et al 2008; Domain with high activity in alkaline conditions.• Zhou et al 2008;.Identification and purification of different domains.• Murai et al 1999;Surface expression of - Glucosidase and Carboxymethylcellulase• Shaomin Yan et al 2013; Secretory pathway of cellulase.• Jiefang Honget al 2014; Development of a cellulolytic Saccharomyces cerevisiae strain

with enhanced cellobiohydrolase activity

• Alexander V et al 2011; Alternatives to Trichoderma reesei in biofuel production

References