linkage mapping of a snp in the porcine madh1 gene to a region of chromosome 8 that contains qtl for...

BRIEF NOTES

Radiation hybrid mapping of three skeletalmuscle genes (CKM, ECH1 and TNNT1) toporcine chromosome 6

R. Davoli*, P. Zambonelli*, L. Fontanesi*,M. Cagnazzo*, D. Bigi*, V. Russo* and D. Milan†

*DIPROVAL, Sezione di Allevamenti Zootecnici, Faculty of

Agriculture, University of Bologna, Via Fratelli Rosselli, 107, Villa

Levi, Coviolo, I-42100, Reggio Emilia, Italy. †Laboratoire de

Genetique Cellulaire, Centre INRA Toulouse, Chemin de Bourde-

Rouge Auzville, BP 27, 31326, Castanet-Tolosan cedex, France

Accepted for publication 31 March 2003

Sources/description: Expressed sequence tags, European Mole-

cular Biology Laboratory (EMBL) accession numbers

AJ301262, AJ301107, and AJ301170, corresponding

respectively to portions of the porcine muscle creatine kinase

(CKM), peroxisomal enoyl coenzyme A hydratase 1 (ECH1),

and skeletal slow troponin T1 (TNNT1) genes were isolated

from an adult porcine skeletal muscle cDNA library1. Polym-

erase chain reaction primers for CKM and ECH1 were designed

in the 3¢-untranslated region to amplify fragments of 207 bp

and 104 bp, respectively. For TNNT1, primers were designed in

the coding sequence, each on a different exon, according to the

organization of the human and mouse TNNT1 gene2,3. Partial

sequencing confirmed that the obtained amplicon of about

490 bp contained portions of exons 8 and 9 and the inter-

vening intron of the porcine TNNT1 gene (EMBL accession

number AJ495809).

Primer sequences:

CKM:

Forward: 5¢-GGGCAAAGGGAGGACCAAG-3¢Reverse: 5¢-GGCGGAGCTCAGGGATAATG-3¢ECH1:

Forward: 5¢-GGAGTGAAGATAAGACAGGA-3¢Reverse: 5¢-CAACCAGAGAGGGAGGACTG-3¢TNNT1:

Forward: 5¢-GCAAGCGCATGGAAAAAGAT-3¢Reverse: 5¢-CGCTCCTTCTCGGTTCTGAA-3¢.

PCR condition: The PCR reactions were performed on a Perkin

Elmer 9600 (Perkin-Elmer, Roche Molecular Systems,

Branchburg, NJ, USA) thermal cycler in 20 ll reaction volume

using 100 lM of each dNTP, 0.5 lM of each primer and 1 U of

AmpliTaq Gold DNA polymerase (Applied Biosystem, Roche

Molecular Systems, Branchburg, NJ, USA) for ECH1 and

TNNT1 or 1 U of Taq polymerase (Roche Diagnostic, Mann-

heim, Germany) for CKM. The reactions contained a MgCl2

concentration of 1.5 mM for ECH1 and TNNT1 and 1.0 mM for

CKM. The DNA samples were denaturated at 95 �C for

5–10 min, then amplified for 35 cycles of 30 s at 95 �C, an

annealing temperature specific for each primer pair was set for

30 s (ECH1, 54 �C; CKM, 65 �C; TNNT1, 57 �C), as well as at

72 �C for 30 s. A final step at 72 �C for 5 min was performed.

Radiation hybrid mapping: Radiation hybrid mapping was per-

formed using INRA-Minnesota 7000 rads radiation hybrid

panel (IMpRH), consisting of 118 hamster-porcine hybrid cell

lines4. Polymerase chain reaction products were separated on

2% agarose gels and stained with ethidium bromide. No PCR

product was obtained from rodent genomic DNA. Vectors of

amplification results were submitted to the IMpRH database

(http://imprh.toulouse.inra.fr)5. The retention frequencies for

the three genes were 23% for CKM, 18% for ECH1 and 26% for

TNNT1. The radiation hybrid map was built using the Car-

thaGene software version 0.5 (www.inra.fr/bia/T/Cartha-

Gene)6 and published marker data7. Two-point analysis

revealed close linkage of CKM, ECH1 and TNNT1 to

microsatellite markers SSC8E02, Sw193 and Sw1129,

respectively at a distance of 19.9, 15.4, 27.2 cR. The corres-

ponding LOD scores were 15.3, 15.9, 13.4, respectively. A

framework map was obtained using BUILDFW command with

the linkage group obtained using a LOD threshold of 6. The

order of the markers was checked with a FLIPS command.

Figure 1 shows the map of the linkage group in which CKM,

ECH1 and TNNT1 were placed.

Comments: All three genes were placed on the linkage group,

where RYR1 maps. This result is in agreement with the data

obtained by Davoli et al.1 who used a somatic cell hybrid panel

to map these genes on porcine chromosome 6q and with

Martins–Wess et al.8 who mapped ECH1 with the IMpRH. The

gene order obtained RYR1/ECH1/CKM/TNNT1 is in agreement

with that reported for human chromosome 19q, homologous to

part of porcine chromosome 6q (http://www.ncbi.nlm.nih.gov/

cR7000 kbp (HSA 19)

0

100

200

300

50

150

250

RYR1ECH1SW193

SW133

CKM

SW782S0220S0333

S0300

TNNT1

3939039705

46209

56077

Figure 1 Radiated hybrid map of a linkage group of porcine chromo-

some 6. The three added genes (ECH1, CKM, and TNNT1) are in bold.

The rightmost column indicate the distances in kb for the genes on

human chromosome 19 as reported in the Homo sapiens Map View,

build 31, November 15, 2002 (http://www.ncbi.nlm.nih.gov/map

view/maps.cgi?org¼hum&chr¼19&MAPS¼gene,ugHs).

� 2003 International Society for Animal Genetics, Animal Genetics, 34, 302–318

mapview/maps.cgi?org¼hum&chr¼19&MAPS¼gene,ugHs).

The distances in kb on human chromosome 19 for the

considered genes are reported in Fig. 1.

Acknowledgements: This work was supported by MIUR ex 40%

and 60% funds and by the EC project GENETPIG. We thank Dr

Martine Yerle who provided the IMpRH and Dr Martin Bouchez

who provided the CarthaGene software.

References1 Davoli R. et al. (2002) Anim Genet 33, 3–18.

2 Barton P. J. et al. (1999) Genomics 57, 102–9.

3 Huang Q.-Q. et al. (1999) Gene 229, 1–10.

4 Yerle M. et al. (1998) Cytogenet Cell Genet 82, 182–8.

5 Milan D. et al. (2000) Bioinformatics 16, 558–9.

6 Schiex T. et al. (2001) Lecture Notes in Computer Science 2149

(First International Workshop on Algorithms in Bioinformatics)

In: Proceedings of WABI 2001. 41–51.

7 Hawken R. J. et al. (1999) Mamm Genome 10, 824–30.

8 Martins-Wess F. et al. (2002) Genomics 80, 416–22.

Correspondence: Roberta Davoli ([email protected])

Identification of a novel lysine-171 allelein the ovine prion protein (PRNP ) gene

X. Guo*, D. M. Kupfer†, G. Q. Fitch*, B. A. Roe†

and U. DeSilva*

*Department of Animal Science, Oklahoma State University,

Stillwater, OK 74078, USA. †Advanced Center for Genome

Technology, Department of Chemistry and Biochemistry, Univer-

sity of Oklahoma, Norman, OK 73019, USA

Accepted for publication 9 April 2003

Scrapie is a fatal neurodegenerative disease of sheep and goats

that belongs to the family of transmissible spongiform encep-

halopathies (TSEs). The causative agent is believed to be a

protease-resistant isoform of sheep prion (PrPsc), which is

derived from an endogenous, protease-sensitive precursor

(PrPc)1. Susceptibility to ovine scrapie is primarily determined

by the infective scrapie strain2,3 and the genotype of the host4.

While polymorphisms at codons 136, 154 and 171 are known

to play a role in scrapie susceptibility, susceptibility to Type C

scrapie prevalent in the USA seems to be determined entirely by

polymorphisms in codon 1713,5. Here we report the identifi-

cation of a previously unreported lysine allele at codon 171 of

the ovine PRNP gene.

Source/description: Approximately 1000 sheep from flocks

across Oklahoma were included in the study. Blood samples

were collected in IsoCode� Stix (Schleicher and Schuell, Dassel,

Germany) DNA isolation devices, shipped to the laboratory,

DNA was isolated and then resuspended in 100 ll of H2O

(following manufacturer’s instructions). Primer sequences for

polymerase chain reaction (PCR) amplification and sequencing

were developed from the ovine PRNP gene (GenBank accession

number X79912) using Primer3 software (http://www.geno

me.wi.mit.edu/genome_software/other/primer3.html).

Primer sequences: (product size 421 bp)

PRNPF: 5�-CAAGCCCAGTAAGCCAAAAA-3�PRNPR: 5�-CACAGGAGGGGAAGAAAAGAG-3�Nested sequencing primer: 5�-CCAGTAAGCCAAAAACCAACA-3�.

Polymerase chain reaction conditions: The PCR was performed in

a 50 ll reaction containing 39.4 ll IsoCode� DNA, 1X PCR

buffer (Applied Biosystems, Foster City, CA, USA) 1.5 mM

MgCl2, 25 pmol of each primer, 200 lM dNTPs and 3 U Taq

DNA Polymerase (Promega, Madison, WI, USA). Cycling

temperature was; one cycle of 3 min at 95 �C, 30 s at 60 �C,

40 s at 72 �C followed by 29 additional cycles of 30 s at

94 �C, 30 s at 60 �C, 40 s at 72 �C and a final extension of

3 min at 72 �C.

Sequencing: The PCR products were treated with shrimp

alkaline phosphatase (1 U ll)1) and Exonuclease III

(10 U ll)1) at a volume equaling 5% of the PCR product and

then incubated at 37 �C for 30 min followed by 80 �C for

10 min. Sequencing was performed in a 8 ll reaction con-

taining 1.67 ll PCR product, 6.5 pmol sequencing primer,

0.5 ll of ET dye terminator mix (Amersham, Piscataway, NJ,

USA) and 1 ll buffer (400 mM Tris, pH 9, 10 mM MgCl2).

Cycling conditions were; 60 cycles of 30 s at 95 �C, 20 s at

50 �C, and 4 min at 60 �C. Sequencing reactions were

cleaned by ethanol precipitation and analysed on an ABI

3700 DNA analyzer (Applied Biosystems, Foster City, CA,

USA). All sequences were base-called and assembled using the

Phred/Phrap/Consed suit of programs6,7,8. A related program,

PolyPhred Version 4 (http://droog.mbt.washington.edu/

PolyPhred.html), was used to identify single nucleotide

polymorphisms in the assembled sequences. The Polyphred

output was ordered and re-arrayed using in-house scripts

polysort and report_polyphred.pl (http://www.genome.ou.edu/

informatics.html).

Polymorphism: Analysis of assembled sequences revealed a C/

A polymorphism at the first nucleotide of codon 171 in eight

animals that introduces a lysine (K) amino acid at codon

171. All eight were heterozygous at codon 171 (Fig. 1). To

confirm that they carry a lysine at codon 171, the amplified

gene fragment was cloned in the pCR2.1 vector using the

TA-cloning� procedure (Invitrogen, Carlsbad, CA, USA).

Several clones from each animal were sequence analysed and

alleles containing K-171 were obtained from each animal

(Fig. 1).

We further developed a PCR–RFLP for convenient identifi-

cation of animals carrying the K-171 allele (Fig. 2). The PRNP

gene fragments (421 bp) amplified using the primers and PCR

conditions described earlier were digested with Sau3A I. Ani-

mals carrying Q, R, or H amino acid at codon 171 produced

overlapping 199 and 197 bp fragments and a 25 bp fragment.

Those with a K-171 allele had a 396 bp fragment and a 25 bp

fragment.

Comments: The eight animals that carry the K allele are from

three unrelated flocks. The breed distributions were; Dor-

per ¼ 1, Barbados Blackbelly ¼ 2, Barbados/St Croix ¼ 2 and

Suffolk crosses ¼ 3. As five of the animals belonged to hair

breeds, we considered the possibility that this mutation arose

in hair breeds. However, we did not find any evidence of


Brief notes 303

hair-sheep in the flock with Suffolk crosses going back several

generations.

There is a concerted effort by the United States Department of

Agriculture–Animal and Plant Health Inspection Service

(USDA-APHIS) to eliminate scrapie from US sheep populations

based on PrP genotyping (http://www.animalagriculture.org/

scrapie/Scrapie.htm). As Type C scrapie is believed to be the

most prevalent form in the US, the main emphasis of geno-

typing has been on codon 171. The presence of a fourth lysine

allele at codon 171 further complicates genotyping for scrapie

resistance. The effect of a lysine at codon 171 on resistance to

scrapie needs to be investigated.

Acknowledgements: This research was supported by Hatch

project no. 2389 of the Oklahoma Agriculture Experiment

Station.

Figure 1 Chromatograms from sequence

corresponding to codon 171. (a) from an

animal with K/R genotype, (b) an animal with

K/Q genotype, (c) K allele from the animal in

panel A after being cloned and re-sequenced

as an individual clone and (d) R allele from the

same animal in panel A after being cloned and

re-sequenced.

Figure 2 A 2.0% agarose gel showing the Sau3A I PCR–RFLP

genotype from ovine PRNP. The genotypes are shown on top (QQ, RR,

KQ, KK). Each sample is run either as uncut (u) or cut (c). M ¼ 100 bp

DNA ladder.


Brief notes304

References1 Prusiner S.B. (1982) Science 216, 136–44.

2 Goldmann W. et al. (1994) J Gen Virol 75, 989–95.

3 O’Rourke K.I. et al. (1997) J Gen Virol 78, 975–78.

4 Clouscard C. et al. (1995) J Gen Virol 76, 2097–101.

5 Westaway D. et al. (1994) Genes Dev 8, 959–69.

6 Ewing B. et al. (1998) Genome Res 8, 175–85.

7 Ewing B. & Green P. (1998) Genome Res 8, 186–94.

8 Gordon D. et al. (1998) Genome Res 8, 195–202.

Correspondence: Udaya DeSilva ([email protected])

Characterization of three single nucleotidepolymorphisms in the porcine BMP15 gene

A. Wang*,†, X. Hu*, N. Li* and C. Wu‡

*State Key Lab for Agrobiotechnology, China Agricultural Univer-

sity, Beijing 100094, China. †Institute of Animal Reproduction,

Guangxi University, Nanning 530005, China. ‡Department of

Animal Genetics and Breeding, China Agricultural University,

Beijing 100094, China.


Source/description: Based on the consensus sequence for

human (GenBank accession no. AJI32405) and sheep (Gen-

Bank: AF236078), bone morphogenetic protein 15 (BMP15)

primer pairs P1, P2 and P3 (Table 1) were designed to obtain

porcine sequence for exon 1 and exon 2. The polymerase

chain reaction (PCR) products were sequenced and analysed

using DNAMAN software package to confirm the authenticity

of the BMP15 sequence. Primer pair P4 (Table 1) was

designed for amplification and sequencing of the intron. The

sequences were assembled by DNAMAN software, and the

porcine BMP15 sequence was deposited in the GenBank

(accession no. AF458070). In addition to primer pairs P1 and

P2, 10 primer pairs covering the promoter, the exon 1, partial

intron and exon 2 were used for subsequent PCR and single

strand conformation polymorphism (SSCP) to identify single

nucleotide polymorphisms (SNPs) in the BMP15 gene. Three

putative SNPs were found in the second exon of the gene.

PCR conditions: The PCR conditions were optimized for each

amplification, to produce single amplicons of the predicted

length. The PCR amplifications were conducted in 25 ll vol-

umes containing 1· PCR buffer, 1.5 mM MgCl2, 200 lM of

each dNTP, 3 pmol of each primer and 1 U of Taq polymerase.

After initial denaturation at 94 �C for 5 min, 35 cycles of

amplifications were performed with denaturation at 94 �C for

30 s, annealing for 30 s at the temperature optimized for each

primer pair (Table 1), extension at 72 �C for 1 min, followed by

a final extension at 72 �C for 7 min and stored at 4 �C. As for

the primer pair P4, the cycling included denaturation at 94 �C

for 40 s, annealing at 55 �C for 1 min and extension at 72 �C

for 5 min.

SSCP analysis: For each amplification fragment, 1 ll of the PCR

product was diluted with 5 ll of the loading buffer. After

heating at 98 �C for 5 min, the mixture was immediately

placed in ice for denaturation and then loaded on a 15%

polyacrylamide gel (acr : bis, 29 : 1) in 1· TBE buffer for 14 h

at 140 V. The gels were silver stained.

Sequence analysis: The porcine BMP15 sequence consisted of

approximately 1185 bp of coding region, 165 bp of the 5¢ UTR

and 4978 bp of the intron. The predicted 394 amino acid

sequence of the porcine BMP15 protein was 87.3% identical

with the sheep BMP15 protein, and 72.9% identical with the

human BMP15 protein.

Polymorphisms: Three putative SNPs were discovered in the

second exon of the gene. The first and third transitions substi-

tuted glutamic acid (E) with glycine (G) at residue 20 and

asparagine (N) with aspartic acid (D) at residue 51 of the

mature peptide, while the second transition resulted in no

Table 1 PCR primers and conditions for amplification.

Symbol Primers (forward/reverse)

Annealing

temperature (�C)

Products

(bp)

P1 CTCTTAGAGAAAGCAACATAGG/CCTGTGTTCCATAAAAAGCACC 53 231

P2 GGTCCTCCTCAGTATTCTTAG/TGCGGTTCTCTCTAGGGTG 55 263

P3 TAGAGCCACTGTGGTTTAC/CTGTTGCTGTCATCTGCATGT 53 802

P4 CTGGAGTTGTACCAGCGTTCAGCC/CACATGAAGCGGAGTCGTAGAAC 55 5.4 k

P5 CTGGAGTTGTACCAGCGTTCAGCC/CCCCTCCAGCACCATATCGTGT 57 151

P6 ACACGATATGGTGCTGGAG/TAACACATCACTCAGTTGCC 54 253

P7 GGCAACTGAGTGATGTGTTAG/AACTCAGCCCTCCTGTACC 57 159

P8 TGGAGAGCGGTTTGTGTTG/CCATGAAAGCTAACGAGAGT 52 190

P9 CCGTGAGGATCTGCTATTG/GTAGTAACACAGTCCACATAG 54 275

P10 CCGCTTCTGTGGTATATGGAG/GTACCATGAGGTTGTAGGTTC 57 188

P11 GGATCGAACCTACAACCTCAT/CTAGGTGAAGTTGATGGCGAT 57 204

P12 GTTCTACGACTCCGCTTCAT/AACCTCAGATGCGATGCT 57 233

P13 GCAGCATCGCATCTGAGGT/GCATGATTGGGGGAATTGAG 57 205

P14 CGGGTACTACACTATGGTCT/CTGTTGCTGTCATCTGCATGT 57 213


Brief notes 305

changes to the amino acid substitution. The positions of the

polymorphic nucleotides are summarized in Table 2. A total of

150 Yorkshire, 110 Landrace and 122 Erhualian pigs were

screened for allele frequencies (Table 2).

Chromosomal location: Radiation hybrid mapping was performed

using the INRA-University of Minnesota porcine radiation hybrid

panel (IMpRH)1. Using the primer pair P11 the BMP15 gene was

located between marker SSC13B11 and SW1044 on the chro-

mosome Xp13 with LOD scores and distances of 11.53, 26 cR

and 8.46, 40 cR, respectively more precisely than in Grapes

et al2.

Acknowledgements: We thank Martine Yerle for use of the

French porcine radiation hybrid panel. This project was funded

by State Key Basic Research Program (G20000161) and The

National High Technology Research and Development Program

of China (2001AA213061).

References1 Milan D. et al. (2000) Bioinformatics 16, 558–9.

2 Grapes L. et al. (2002) Animal Genetics 33, 165–69.

Correspondence: Dr Ning Li ([email protected])

BMPR1B maps to chromosome 8 in swine

A. Wang*,†, X. Hu*, N. Li* and C. Wu‡

*State Key Laboratory for Agrobiotechnology, China Agricultural

University, Beijing 100094, China, †Institute of Animal Reproduc-

tion, Guangxi University, Nanning 530005, China. ‡Department of

Animal Genetics and Breeding, China Agricultural University,

Beijing 100094, China


Source/description: Bone morphogenetic protein receptor 1B

(BMPR1B) is a member of the transforming growth factor-b(TGF-b) receptor family. Mice deficient in BMPR1B exhibit

irregular oestrus cycles and an impaired pseudopregnancy

response1. In addition, a non-conservative substitution in

BMPR1B coding sequence is found to be associated fully with

hyperprolificacy phenotype of Booroola ewes. In vitro, ovarian

granulosa cells from FecBB/FecBB ewes are less responsive than

those from FecB+/FecB+ ewes, to the inhibitory effect on

steroidogenesis of GDF-5 and BMP-4 (natural ligands of

BMPR1B)2,3,4. Thus, BMPR1B is essential for many aspects of

female fertility.

Polymerase chain reaction conditions: The polymerase chain

reaction (PCR) amplifications were carried out for 25 ll of the

solution containing 1· PCR buffer, 1.5 mM MgCl2, 200 lM of

each dNTP, 3 pmol of each primer and 1 unit Taq polymerase.

After initial denaturation at 94 �C for 5 min, 35 cycles of

amplifications were performed with denaturation at 94 �C for

30 s, annealing at 52 �C for 30 s, extension at 72 �C for 1 min,

followed by a final extension at 72 �C for 7 min and then stored

at 4 �C.

PCR primers: According to the cDNA sequence of porcine

BMPR1B gene (GenBank accession no. AY065994) and

genomic DNA sequence of human BMPR1B gene (GenBank

accession no. NT_006397), primers P1 (GAATGCTGGGCG-

CAGAATCCT) and P2 (CAAGTTACCCAAGCGGTTTCT) were

designed, which could amplify a 323-bp fragment of exon 10.

The PCR product obtained was sequenced and analysed using

DNAMAN software package to confirm the authenticity of the

porcine BMPR1B sequence.

Chromosomal location: Radiation hybrid mapping was per-

formed using the INRA-University of Minnesota porcine radi-

ation hybrid panel (IMpRH)5. The results indicated that the

BMPR1B gene is located between marker SW790 and SW61

on porcine chromosome 8q25, with LOD scores and distances

of 17.43, 10 cR and 8.17, 41 cR, respectively.

Comments: The position of the BMPR1B gene lies within the

interval of the QTL, affecting ovulation rate with an additive

effect of 3.07 ovulation6. However, when this research group

included additional animals in a more comprehensive study,

the previously reported QTL for ovulation rate at the telomeric

end of SSC8q was not confirmed7.

Acknowledgements: We thank Martine Yerle for use of the

French porcine radiation hybrid panel. This project was funded

by State Key Basic Research Program (G20000161) and The

National High Technology Research and Development Program

of China (2001AA213061).

References1 Yi S. E. et al. (2001) Proc Natl Acad Sci USA 98, 7994–9.

2 Mulsant P. et al. (2001) Proc Natl Acad Sci USA 98, 5104–9.

3 Souza C. J. et al. (2001) J Endocrinol 169, R1–6.

4 Wilson T. et al. (2001) Biol Reprod 64, 1225–35.


6 Rathje T. A. et al. (1997) J Anim Sci 75, 1486–94.

7 Cassady J. P. et al. (2001) J Anim Sci 79, 623–33.

Correspondence: Dr Ning Li ([email protected])

Table 2 Single nucleotide polymorphisms

(SNPs) in porcine BMP15.No. Type Context1 Location2 Allele frequency

1 A fi G GATGGGCCTGRAAGTAACCAG 6009 A0.86/G0.14

2 C fi T CTTCCACCAABTGGGTTGGGA 6056 C0.98/T0.02

3 A fi G CTATACCCCARACTACTGTAA 6101 A0.99/G0.01

1The letters used for denoting SNPs: R, (G or A); B, (T or C).2The location of SNPs in the sequence of AF458070.


Brief notes306

Radiation hybrid mapping and genomicorganization of canine TBX2 and TBX4

G. Andelfinger*, L. Etter*, M. Dyment*, C. Hitte†,F. Galibert†, E. Kirkness‡ and D. W. Benson*

*Cardiovascular Genetics, Division of Cardiology, Cincinnati

Children’s Hospital, 3333 Burnet Avenue, Cincinnati, OH, 45229,

USA . †UMR 6061 CNRS, Genetique et Developpement, Faculte de

Medecine, 35043 Rennes Cedex, France. ‡The Institute for

Genomic Research, 9712 Medical Center Drive, Rockville, MD

20850, USA


Source/description: Canine tricuspid valve malformation

(CTVM) was recently mapped to canine chromosome 9

(CFA9) between markers C03304 and REN126A151. The

CTVM critical region is homologous to a gene rich region of

human chromosome 17 (HSA17)2. Because of its map loca-

tion on HSA17, T-box 2 (TBX2) is a positional candidate for

CTVM, and previous studies of its role in cardiac development

make TBX2 an interesting biological candidate3. Polymerase

chain reaction (PCR) was used to generate a canine TBX2-

specific probe that spanned from nucleotides 991 to 1538

(Genbank accession number AY192799 table 1) using prim-

ers designed from a TBX2 sequence derived from a canine

genomic sequence database maintained by The Institute for

Genomic Research (TIGR, Rockville, MD, USA). A canine BAC

library (RPCI-81)4 was screened using the TBX2 probe that

had been radiolabelled, and 13 BACs containing TBX2 were

identified. Using primers specific for T-box 4 (TBX4) designed

from a canine genomic database maintained by TIGR, it was

determined that eight of 13 BACs were also positive for TBX4.

A 325 kb BAC contig was constructed, in which canine TBX2

and TBX4 are physically linked within a ~35 kb genomic

region (Fig. 1).

Sequence analysis: Shotgun cloning of BACs was used to obtain

a library of small to medium sized TBX2-containing inserts.

Briefly, BACs were triple-digested (SspI, DraI, EcoRV) and reli-

gated into pBluescript; hybridization on subclones using TBX2

and TBX4 specific probes was then carried out as previously

described4. The genomic organization of canine TBX2 and

TBX4 was determined using alignments with published human

sequence (TBX2: NM_005994 and AC005746; TBX4:

AF188703 and AC005901; Fig. 2). The full-length cDNA of

canine TBX2 (Genbank AH012457) contains an open reading

frame (ORF) of 2109 bp encoding a putative 702 amino acid

protein (Fig. 2, top). Mapping results and sequence data show

that the eight exons of canine TBX4 encompass an ~17 kb

genomic region. The deduced cDNA of canine TBX4 (Genbank

AH012458) consists of an ORF of 1665 bp which encodes a

putative 554 amino acid protein (Fig. 2, bottom).

Canine TBX2 and TBX4 share very high homology with their

human and murine orthologs: canineTBX2 nucleotide se-

quence is highly similar to human (90.8%) and murine

(86.2%) sequences, while similarity of amino acid sequence is

94.9 and 91.7%, respectively. For canine TBX4, respective

nucleotide similarity is 88.8 and 87.2%, and amino acid simi-

larity is 92.3 and 92.8%.

Radiation hybrid mapping: Canine-specific STS for TBX2 and

TBX4 were mapped using the canine-hamster RH panel

RHDF5000.2 5,6. Marker data were integrated into the canine

RH map with TSP/CONCORDE 7,8 using a 2-point LOD score

cutoff of 8.0. TBX2 and TBX4 were co-localized to CFA9. Both

genes were linked to FH2846 and C09.474 with 2-point LOD

scores of 20.68 (distance 9 cR) and 19.7 (distance 11 cR),

respectively. Taken together, radiation hybrid mapping places

TBX2/TBX4 8 Mb telomeric to the CTVM critical interval1.

Radiation hybrid mapping results are consistent with the

results of a PCR screen which places FH2846 on 7 of 13 BACs

in the contig (Fig. 1). These results are also in agreement with

Figure 1 A 325 kb BAC contig encompassing TBX2 and TBX4, BAC-end derived STS and polymorphic repeat markers on CFA9. BAC clones are

drawn to scale. Distances are given in kb. Primer sequences are given in Table 1.


Brief notes 307

the previously described conservation of synteny between

HSA17q and CFA9 which is supported by comparative map-

ping of 20 loci on the current version of the integrated dog

map2. Furthermore, HSA17q is homologous to murine chro-

mosome 11 (http://www.ensembl.org/Homo_sapiens/synteny-

view?chr¼17&species¼Mus_musculus). Based on these

mapping results, TBX2 was excluded as a positional candidate

gene for CTVM.

Figure 2 Genomic organization of the canine

TBX2 and TBX4 genes. Boxes denote exons

with coding sequence (black) and 5¢ and 3¢untranslated regions (open boxes). Numbering

is in accordance with human nomenclature.

Gray boxes: T-box binding domain. Horizontal

hatched boxes: conserved amino-terminal

repressor motifs. AA ¼ amino acid.

Table 1 Canine TBX2 and TBX4 primer

information.

Primer Sequence

Length of

amplicon

(bp)

Nucleotide

positions

GenBank

accession

number

TBX2 BAC/RH F GCTGACGATTGCCGGTATAAGTT 548 991–1538 AY192799

TBX2 BAC/RH R GCAGGACTTCCAAGCCAAGCAGTT

TBX4 RH F TTGCAGAAGTCATGTAAGCCCTCT 863 1–863 AY185175

TBX4 RH R ATAGTCTCCAATCTTGCCTGTCCA

142H21 SP6 F ATAGGCCTATTTAGATTTTCTATT 375 75–449 AY192789

142H21 SP6 R AGGAAGAACAAATGAAATTCAAAC

142H21 T7 F CCAGGTGGGCTGGTCTTTGGGGTC 251 73–323 AY192790

142H21 T7 R GTTCTGGGGACCCTGTGACCCTGG

10J2 SP6 F ATCAACTATTCTCATCAACGTATC 330 15–344 AY192787

10J2 SP6 R ATCCCTATTCCCACTTCTATTTCC

10J2 T7 F AGTACCTCACAGGTAAGCTGTACC 307 30–336 AY192788

10J2 T7 R TGTGTCATCTAATTAGACTGATCG

275K10 SP6 F TTTGTTCAAGTCCGGGAGGC 306 50–405 AY192794

275K10 SP6 R TCCGAGTCACAAGAAGCTTTAATA

275K10 T7 F AGAGAGCACAAGTAGGAGGAGAG 350 43–392 AY192795

275K10 T7 R AGGCTTAAGTTAACTAATGATTCT

147L4 SP6 F GAGTTGGCCAAGACAGAGTGCAAT 288 83–370 AY192791

147L4 SP6 R CAGAAGCCCAGGGAAACTAGAGTG

147L4 T7 F CTATCCATTGAACTGCTGCGTTAG 379 47–425 AY192792

147L4 T7 R GTACTTGGGCTTCTTTGGGTTT

327P20 SP6 F GCCTTTGGCCCAGGGAGACCAAGG 300 46–345 AY192796

327P20 SP6 R GGAACCTCAGGTTCCTTTACTGTG

327P20 T7 F CATGAGCTAGGTACTATTATCTCC 261 36–296 AY192797

327P20 T7 R CTAGATTAATCTTGATGATCTTGC

CIN4 F CTATTCAGTAACCTTGCTGGATTC 329 189–517 AY192786

CIN4 R GGCTCCTTGCAAAGTCTGCTTGTC


Brief notes308

Acknowledgements: The authors are indebted to Yaping Qian

and Bhuvana Sakhtivel for technical assistance. This work was

supported in part by a fellowship grant of the American Heart

Association, Ohio Valley Affiliate (0225191B), to Dr Andelfin-

ger, and by grants from the National Institutes of Health

(HL61006 and HL69712) and the Children’s Heart Foundation

to Dr Benson. C. Hitte and F. Galibert are supported by the

CNRS, France.

References1 Andelfinger G. et al. (2003) J Med Genet 40, 320–24.

2 Breen M. et al. (2001) Genome Res 11, 1784–95.

3 Habets P.E. et al. (2002) Genes Dev 16, 1234–46.

4 Li R. et al. (2001) Genomics 73, 299–315.

5 Vignaux F. et al. (1999) Mamm Genome 10, 888–94.

6 Mellersh C.S. et al. (2000) Mamm Genome 11, 120–30.

7 Agarwala R. et al. (2000) Genome Res 10, 350–64.

8 Hitte C. et al. (2002) J. Hered. 94, 9–13.

Correspondence: D. Woodrow Benson (woody.benson@

cchmc.org)

FISH and RH mapping of the bovine alpha(2)/delta calcium channel subunit gene(CACNA2D1)

J. Buitkamp*, D. Ewald†, J. Masabanda†,M. D. Bishop‡ and R. Fries†

*Institut fur Tierzucht, Bayerische Landesanstalt fur Landwirtschaft,

Poing, Germany. †Lehrstuhl fur Tierzucht, Technische Universitat

Munchen, Freising-Weihenstephan, Germany. ‡Infigen Inc.,

DeForest, WI, USA


Source/description: Twelve BAC clones (RZPD clone names:

BBI_B750O19237Q3, -E16240Q3, -H23190Q3, -C21154Q3,

-J16187Q3, -C07120Q3, -M0613Q3, -M0543Q3, -D1450Q3,

-O19114Q3, -J0822Q3 and -M2161Q3) were isolated using a

murine Cacna2d cDNA (EMBL accession number U73486) as

described.1 Identity of BAC clones was confirmed by subcloning

EcoRI and HindIII fragments into pZEr0TM-2, according to the

instructions of the manufacturer (Invitrogen Corporation, Lei-

den, The Netherlands). Subclones were isolated by colony

hybridization with the 32P-labelled cDNA probe and sequenced

using the FS DyeDeoxy terminator chemistry on a fluorescence-

based automated sequencer (ABI377, PE Applied Biosystems,

Darmstadt, Germany). Sequences of four CACNA2D1 exons

have been identified (accession numbers AJ439530, AJ439531

and AJ439532), showing 91% (exon 6), 96% (exon 19), 86%

(exon 24) and 91% (exon 25) identity with the human CAC-

NA2D1 sequence (accession number AF083817).

Chromosomal location: Two BAC clones (BBI_B750C07120Q3

and -O19114Q3) containing the CACNA2D1 were mapped to

cattle metaphase chromosomes using 50 ng of DNA for fluor-

escent in situ hybridization (FISH), as described.2 Signals were

detected at the same band of chromosome 4 with both

hybridization probes (Fig. 1). The localization of the signal was

determined on the basis of FLpter values assigning CACNA2D1

to BTA 4q18.

Radiation hybrid mapping: The localization of CACNA2D1 was

confirmed and refined by PCR screening of a bovine 5000-cR

radiation hybrid (RH) panel3 (primers: 5¢-ATGCACAATATTT

TTATTCAAGAAAGTC-3¢ and 5¢-GGAATGGAAATACCAGTGG

AAA-3¢ amplifying a 205 bp fragment from accession number

AJ439532). The RH mapping places CACNA2D1 close to

GNAI1 (h ¼ 0.10, LOD ¼ 15.4) and microsatellite MAF70, i.e.

about 10 cM proximal of TGLA116.

Comments: L-type voltage-dependent calcium channels

(CACN) are heteromultimers, composed of various subunits

encoded by different genes and control the flux of extra cel-

lular Ca2+ into the cytoplasm.4 Many mutations in human

and mouse CACN subunit coding genes have been linked to

neuromuscular diseases.5 The alpha (2)/delta calcium channel

subunit gene (CACNA2D1) was mapped to human chromo-

some 7q11.23–q21.16 that shows conserved synteny to part

of bovine chromosomes 29 and 4. Therefore, we considered

CACNA2D1 to be a potential candidate for the weaver con-

dition that has been linked to BTA 4.7 From our study,

CACNA2D1 was confirmed as the candidate based on its

position close to the microsatellite TGLA116 that is linked to

the weaver locus.7

Figure 1 Fluorescence in situ hybridization

(FISH). (A) Partial spread of cattle metaphase

chromosomes before hybridization (arrows

indicate chromosomes BTA 4). (B) The same

metaphases after hybridization with one of the

BACs containing the CACNA2D1 gene as a

probe (DAPI-counterstained).


Brief notes 309

Acknowledgements: We would like to thank T. Angelotti and F.

Hofmann for providing the murine Cacna2d cDNA and Jim

Womack for making available the radiation hybrid panel.

References1 Buitkamp J. et al. (2000) Anim Genet 31, 347–51.

2 Solinas-Toldo S. et al. (1993) Mamm Genome 4, 720–7.

3 Womack J. E. et al. (1997) Mamm Genome 8, 854–6.

4 Hofmann F. et al. (1999) Rev Physiol Biochem Pharmacol 139,

33–87.

5 Doyle J. L. et al. (1998) Trends Genet 14, 92–8.

6 Powers P. A. et al. (1994) Genomics 19, 192–3.

7 Georges M. et al. (1993) Proc Natl Acad Sci USA 90, 1058–

62.

Correspondence: Johannes Buitkamp (Johannes.Buitkamp@

lfl.bayern.de)

Linkage mapping of a SNP in the porcineMADH1 gene to a region of chromosome 8that contains QTL for uterine capacity

J. G. Kim, D. Nonneman, G. A. Rohrer, J. L. Valletand R. K. Christenson

US Department of Agriculture, Agricultural Research Service, US

Meat Animal Research Center, Clay Center, NE, USA


Source/description of primers: Homo sapiens mothers against

decapentaplegic homolog 1 (Drosophila) (MADH1), also repor-

ted as Smad1, belongs to a family of proteins that mediate signal

transduction from TGF-b family ligands, including TGF-b and

bone morphogenetic proteins1. Comparison of porcine and

human genetic maps suggest that MADH1 is located near the

uterine capacity quantitative trait locus (QTL) on chromosome

82. In addition, MADH1 mRNA is expressed in the vascular

endothelial cells of mouse decidua3 and MADH1-mutant mice

die due to the defects in allantois formation4. A cDNA clone

(2077 bp) containing the full coding region of the porcine

MADH1 was isolated (GenBank accession no. AY245888) from

the �Meat Animal Research Center (MARC) 2PIG� expressed

sequence tag (EST) primary library5 by iterative screening and

sequenced. The forward (MADH1 f1) and reverse (MADH1 r1)

primers that were used for PCR amplification to screen the

MARC 2PIG EST library were derived from ovine MADH1

sequence (GenBank accession no. AY035385) and correspon-

ded to bases 560–578 (with one mismatch) and 932–950 (with

two mismatches) of the porcine cDNA sequence (GenBank

accession no. AY245888), respectively. For single nucleotide

polymorphism (SNP) detection, forward (MADH1 f2) and re-

verse (MADH1 r2) primers [bases 1628–1647 and 2046–2026

of the porcine MADH1 cDNA (GenBank accession no.

AY245888), respectively] were designed to amplify a 419-bp

product in the 3¢ untranslated region of the cDNA. This region

was evaluated for SNP in the eight parents (seven F1 sows and

one white composite boar) of the MARC Swine Reference

Population6 by sequencing PCR products amplified from ge-

nomic DNA.

PCR primer sequences and flanking sequence for a single nucleotide

polymorphism: MADH1 f1: CATTCCTCGCTCCCTGGAC

MADH1 r1: AGGAGAGTTGGGGTAACTGCTG

MADH1 f2: AGAATACCACCGCCAGGATG

MADH1 r2: AGATGATTTGTCCCTGGCTTG.

Sequence flanking polymorphism: CATCTGAACT(C/G)ACAAA

GGAGC

MADH1 probe primer: TCAGACCATCTGAACT.

PCR conditions: Polymerase chain reaction reactions were

performed in a 25-ll volume containing 100 ng genomic DNA,

1.5 mM MgCl2, 20 pmol of each primer, 100 lM dNTP and

0.35 U HotstarTM Taq polymerase (Qiagen Inc., Valencia, CA,

USA). Amplification was performed under the following PCR

conditions; 15 min at 94 �C; 45 cycles of 30 s at 94 �C,

annealing for 45 s at 61 �C, 1.5 min at 72 �C and a final

extension of 5 min at 72 �C. Both strands of the amplified

genomic DNA of parents from the MARC Swine Reference

Population6 were sequenced and evaluated for polymor-

phisms7.

Polymorphism and chromosomal location: A C/G single nucleo-

tide polymorphism was detected at position 1842 of the por-

cine MADH1 cDNA (GenBank accession no. AY245888). This

polymorphism was heterozygous in three of the seven F1 sows.

An assay was designed to genotype this polymorphism using

primers MADH1 f2 and r2, primer extension with the MADH1

probe primer and analyte detection on a MALDI-TOF mass

spectrometer8 (Sequenom Inc., San Diego, CA, USA) with

50 ll of PCR product. Polymerase chain reaction conditions

were same as above. This marker generated 38 informative

meioses in the MARC Swine Reference Population. The

MADH1 gene was mapped to chromosome 8 at position

78 cM, which is similar to the marker KS139 on the current

MARC swine chromosome 8 linkage map (http://www.marc.

usda.gov/) using CRI-MAP. The most significant two-point

linkage detected was with KS139 (LOD ¼ 10.24) at 0

recombination. MADH1 maps are within the uterine capacity

QTL on chromosome 82. The human MADH1 gene is located

on chromosome 4q28, which shares homology with swine

chromosome 8.

Acknowledgements: The authors gratefully thank Bree Quigley

for sequencing and Linda Flathman for mass spectrometry.

References1 Huang S. et al. (2000) Gene 258, 43–53.

2 Rohrer G.A. et al. (1999) J Anim Sci 77, 1385–91.

3 Ying Y. et al. (2000) Biol Reprod 63, 1781–6.

Mention of trade names or commercial products in this article is

solely for the purpose of providing specific information and does not

imply recommendation or endorsement by the US Department of

Agriculture.

This article is the material of the US Government and can be pro-

duced by the public at will.


Brief notes310

4 Lechleider L.J. et al. (2001) Dev Biol 240, 157–67.

5 Fahrenkrug S.C. et al. (2002) Mamm Genome 13, 475–8.

6 Rohrer G.A. et al. (1994) Genetics 136, 231–45.

7 Fahrenkrug S.C. et al. (2002) Anim Genet 33, 186–95.

8 Heaton M.P. et al. (2002) Mamm Genome 13, 272–81.

Correspondence: Ronald K Christenson

([email protected])

Linkage mapping of the bovine bonemorphogenetic protein receptor-1B (BMPR1B )to chromosome 6

J. G. Kim, T. P. L. Smith, W. M. Snelling,J. L. Vallet and R. K. Christenson

US Department of Agriculture, Agricultural Research Service, US



Source/description of primers: A mutation in the ovine bone-

morphogenetic protein receptor-1B (BMPR1B) gene is associ-

ated with an increased ovulation rate phenotype in Booroola

Merino sheep1–3. Therefore, BMPR1B is considered as a can-

didate gene for ovulation rate in cattle. A cDNA was obtained

for porcine BMPR1B and the gene was mapped in the porcine

genome4. Comparison of the ovine and porcine BMPR1B cDNA

sequences indicated that they are highly conserved. Therefore,

a pair of primers derived from the porcine BMPR1B cDNA,

which amplified across intron 8 in the pig, were used to amplify

the bovine genomic DNA. The forward (NZ-F1)3 and reverse

(exon9-R1) primers correspond to bases 1041–1064 and

1289–1265 of the porcine BMPR1B cDNA (GenBank accession

no. AF432128), respectively. Agarose gel electrophoresis and

sequencing of the polymerase chain reaction (PCR) amplicons

of bovine genomic DNA indicated that the size of this product

was 1253 bp (GenBank accession no. AY242067).

PCR primer sequences and a flanking sequence for a single nucleotide

polymorphism: BMPR1B NZ-F1: GTCGCTATGGGGAAGTTTGG

ATG

BMPR1B exon9-R1: GGTGGTGGACTTCAGGTAATCATAG

Sequence flanking polymorphism: GTGGTAAAGA(A/G)TCTA

CCTGCC

PCR conditions: Polymerase chain reactions were carried out in

a 25-ll volume containing 100 ng genomic DNA, 1.5 mM

MgCl2, 20 pmol of each primer, 100 lM dNTP and 0.35 U Taq

polymerase. Amplification was performed under the following

PCR conditions: 2 min at 94 �C; 45 cycles of 30 s at 94 �C,

annealing for 1 min at 61 �C, 1 min at 72 �C and a final

extension of 5 min at 72 �C. Both strands of the amplified

genomic DNAs were sequenced and evaluated for polymor-

phisms5 in four bulls from the Meat Animal Research Center

(MARC) Bovine Reference Population6.

Polymorphism and chromosomal location: An A/G single nuc-

leotide polymorphism was detected in intron 8 (GenBank

accession no. AY242067), position 658 from the exon/intron

boundary. This polymorphism was heterozygous in two of the

four bulls from the MARC Bovine Reference Population6. An

assay was designed to genotype this polymorphism using pri-

mer extension with analyte detection on a MALDI-TOF mass

spectrometer (Sequenom Inc., San Diego, CA, USA). This

marker generated 50 informative meioses (40 phases known)

in the MARC Bovine Reference Population. The BMPR1B gene

was mapped to chromosome 6 position 42.4 cM on the current

MARC bovine chromosome 6 linkage map (http://www.mar-

c.usda.gov/) using CRI-MAP near the quantitative trait locus

for milk production7. The most significant two-point linkage

detected was with BMS2508 (LOD ¼ 11.40) at 0.04 recombi-

nation. The BMPR1B gene in human is located on chromo-

some 4q22.3, which shares homology with bovine

chromosome 6.

References1 Mulsant P. et al. (2001) Proc Natl Acad Sci USA 98, 5104–9.

2 Souza C.H.I. et al. (2001) J Endocrinol 169, R1–R6.

3 Wilson T. et al. (2001) Biol Reprod 64, 1225–35.

4 Kim J.G. et al. (2003) Biol Reprod 68, 735–43.

5 Fahrenkrug S.C. et al. (2002) Anim Genet 33, 186–95.

6 Bishop M.D. et al. (1994) Genetics 136, 619–39.

7 Olsen H.G. et al. (2002) J Dairy Sci 85, 3124–30.

Correspondence: R. K. Christenson (christenson@

email.marc.usda.gov)

Mutations in the limbin gene previouslyassociated with dwarfism in Japanese browncattle are not responsible for dwarfism in theAmerican Angus breed

B. P. Mishra and J. M. Reecy

Department of Animal Science, Iowa State University, Ames, IA

50011, USA


Source/description: Bovine chondrodysplastic dwarfism in Jap-

anese brown cattle has been mapped to the distal end of

bovine chromosome 6 by linkage analysis. Disease–specific

mutations in limbin were identified in affected dwarf calves1.

Disproportionate dwarfism has been reported in many cattle

breeds including Dexter, Holstein, Aberdeen Angus, Hereford

and Shorthorn breeds2,3. Dwarfism in American Angus has

not been reported since the 1970�s until recently when

Mention of trade names or commercial products in this article is

solely for the purpose of providing specific information and does not

imply recommendation or endorsement by the US Department of

Agriculture.

This article is the material of the US Government and can be pro-

duced by the public at will.


Brief notes 311

several calves from some sire · dam crosses resulted in

phenotypically dwarf calves. Gross and histo-pathological

examination of these calves indicated evidence for diminished

endochondral ossification and exhibited other gross features

consistent with dwarfism such as the protrusion of the alar

wing of the basisphenoid bone into the cranial cavity,

abnormalities of the ventral vertebral bodies, and curving of

the transverse vertebral processes (Personal communication –

Rowland Cobbold, Washington State University, Pullman,

WA, USA and David Steffen, University of Nebraska, Lincoln,

NE, USA). To begin to investigate the genetic cause of

dwarfism in American Angus cattle, we analyzed the pedi-

gree of affected calves, which included substantial inbreeding.

We genotyped six affected Angus calves from three sire and

five dam matings for the presence of known limbin muta-

tions. In addition, we genotyped two normal unrelated

Angus calves.

Polymerase chain reaction primer sequences: C1356T mutation

Forward primer: TACAGCAGGAGGAGGACCTTGC

Reverse primer: TTAGTTCACTGGAACCCAGCAC

CAInsG mutation

Forward primer: GCCTGCAGAACTCAGGAATGAC

Reverse primer: CGTGAAGATCAAGTGCTCCCAGTG.

Polymerase chain reaction conditions: Oligonucleotide primer

pairs for each mutation were optimized for Polymerase chain

reaction (PCR) amplification by testing over a range of

annealing temperature (53–65 �C). An annealing tempera-

ture of 58 �C was used in subsequent reactions. The PCR

mixture (25 ll) contained 1X reaction buffer[20 mM Tris-HCl,

pH 8.0, 100 mM KCl, 0.1 mM ethylenediaminetetraacetic acid

(EDTA), 1 mM dithiothreitol (DTT), 50% glycerol, 0.5%

Tween 20 and 0.5% Nonidet-P40], 50 ng genomic DNA,

2.5 pmol of each primer, 200 lM each deoxynucleoside trip-

hospahte and one unit Taq DNA polymerase (Promega Cor-

poration, Madison, WI, USA). Amplification was performed in

a MJ Research PTC-200 thermal cycler (MJ Research Inc.,

Watertown, MA, USA) for 32 cycles under the following

reaction conditions: 4 min at 94 �C; 32 cycles of 30 s at

94 �C, 30 s at 58 �C, 30 s at 72 �C; and final extension for

5 min at 72 �C.

Sequencing of PCR fragments: The amplified fragments for both

polymorphisms in the limbin gene were visualized on 1.5%

agarose gel. The amplicon size was estimated to be ~300 and

~250 bp for C1356T and CAInsG, respectively. The PCR

products were purified with Microcon YM-100 centrifugal filter

devices (Millipore Corporation, Bedford, MA, USA) and cycle

sequenced with the forward PCR primers. Sequencing was

performed on an ABI PRISM Model 377 (DNA Sequencing and

Synthesis Facility, Biotechnology Center, Iowa State University,

IA, USA).

Sequence analysis and detection of possible gene mutations: Six

affected calves and two unrelated samples were screened by

PCR for both limbin mutations. The nucleotide sequence around

position 1356 was compared in all affected and normal animals

(Fig. 1). The C to T substitution at position 1356 was not

observed in any Angus animals as reported for limbin mutation

in Japanese Brown cattle1. All animals (both affected and

normal) exhibited the wild-type allele for the C1356T mutation.

In addition, only the wild-type CAInsG sequence at position

2054/2055 was observed. All the animals had CA at position

2054/2055 instead of the reported G for dwarf cattle. Com-

parison of our sequence with the corresponding sequence

in GenBank (accession no. AB083065) revealed complete

similarity of the PCR amplicon regions, indicating limbin gene

homology in the two breeds of cattle. Thus, we detected only

wild-type limbin alleles in dwarf and phenotypically normal

Angus cattle, suggesting that limbin gene mutations associated

with Japanese brown cattle dwarfism are not responsible for

dwarfism in the American Angus breed.

Acknowledgements: The authors thank the Department of

Biotechnology, Ministry of Science and Technology, Govern-

ment of India for the Biotechnology Overseas Associateship

award to Dr B.P. Mishra. In addition, the authors thank Bryce

Schumann, American Angus Association, Saint Joseph, MO

and Dr. Chuck Hines, Ohio State University for their assistance

in DNA collection. This journal paper of the Iowa Agriculture

and Home Economics Experiment Station, Ames, Iowa, Project

No. 3600, was supported by Hatch Act and State of Iowa

funds.

References1 Takeda H. et al. (2002) Proc Natl Acad of Sci 99, 10549–54.

2 Julian L.M. et al. (1959) J Am Vet Med Assoc 135, 104–9.

3 Weaver A.D. (1975) Vet Ann 15, 7–9.

Correspondence: Dr James Reecy ([email protected])

Figure 1 Mutation analysis of genomic DNA sequences of limbin gene.

(a) Reported genomic DNA sequence of C1356T mutation in exon 11

of limbin gene in normal and affected Japanese brown cattle1 (top and

middle) and PCR amplicon sequence of affected American Angus calves

(lower). (b) Genomic sequences in exon 14 of CAInsG mutation in

normal and affected Japanese brown cattle1 (top and middle). The

nucleotide positions 2054/2055 indicated CA to G substitution.

CAInsG–PCR amplicon of affected American Angus calves (lower)

indicated normal allele.


Brief notes312

Linkage mapping of IGF2 on cattlechromosome 29

J. J. Goodall and S. M. Schmutz

Department of Animal and Poultry Science, University of Saskat-

chewan, Saskatoon, Canada S7N 5A8


Source/description: The insulin-like growth factor II gene (IGF2)

has long been thought to be a fetal growth and differentiation

factor in rodents1–4. A post-natal role of IGF2 has also been

suggested in pigs5–7. Primers which amplify exon 2 of cattle

IGF2 were designed. The amplified exon 2 polymerase chain

reaction (PCR) fragment had a SNP (C/T) at nucleotide 150 in

animals from four different breeds: Angus, Charolais, Belgian

Blue and Hereford (GenBank AY237543).

Primer sequences: Forward: CCTCAGCCTCATCCCCTCCTTTGC

Reverse: CTGTGCTCTATTTGCTGTGTTGTCT

Polymerase chain reaction conditions: The PCR reaction of 15 ll

contained 1 ll of DNA template (50–100 ng), 1.5 ll of 10X

PCR buffer (Invitrogen Co., Carlsbad, CA, USA), 0.45 ll of

50 mM MgCl2, 0.3 ll of 10 mM dNTP, 0.1 ll Taq polymerase

(5 U ll)1; Invitrogen), 1 ll of each primer (10 pM ll)1) and

9.6 ll of ddH2O. The reaction began with a 4 min step at

94 �C, followed by 34 cycles of 50 s at 94 �C, 50 s at 64 �C,

and 50 s at 72 �C, and finished with a 4 min step at 72 �C.

Digestion of 8 ll of each PCR product was performed with 1 ll

of BsrI (5 U ll)1) for 3 h at 65 �C.

Polymorphism: The 217 bp fragment contained one inherent

restriction site for BsrI at position 32. The presence of a SNP at

nucleotide 150 added an additional restriction site. After

digestion with BsrI the C allele consisted of 32 and 185 bp

fragments and the T allele consisted of 32, 67 and 118 bp

fragments. Alleles were resolved on a 3% agarose gel. The T

allele occurred with a frequency of 0.17 in the 24 purebred

cattle of our parental generation.

Chromosomal location: Linkage mapping was done using the

Canadian Beef Reference Herd (http://skyway.usask.ca/~schmutz/herd.html) of 17 full-sib cattle families from five sires

and 13 dams (Angus, Belgian Blue, Charolais, Hereford, Lim-

ousin, Simmental). IGF2 was mapped to the telomeric end of

cattle chromosome 29, 0 cM from ILSTS081 (LOD ¼ 6.62). The

most likely map order generated by CRI-MAP was BMC8012 –

ILSTS015 – Tyrosinase – BMC3224 – BMS764 – BMC1206 –

ILSTSO81 – IGF2.

Comment: IGF2 has been mapped to human chromosome

11p15.58,9, horse chromosome 12q1310, sheep chromo-

some 21q21-qter11, mouse chromosome 712, and pig chro-

mosome 2p1.75,6. Our data are consistent with this

comparative mapping data as well as our previous in situ

hybridization mapping of IGF2 to the distal end of bovine

chromosome 2913. These areas are being intensively studied

because of the presence of a cluster of imprinted genes and their

implication in human disease. It should also be noted that a

second SNP (A/G) in IGF2 intron 8 (GenBank AY237544) was

also identified.

Acknowledgements: We thank everyone who helped raise and

fund the Canadian Beef Reference Herd Families (Canadian

Cattlemen’s Association, the Alberta Cattle Commission and the

Natural Science and Engineering Research Council-Industry

Orientated Research Program).

References1 Rotwein P. & Hall L.J. (1990) DNA Cell Biol 9, 725–35.

2 Giannoukakis N et al. (1993) Nat Genet 4, 98–101.

3 Honegger A. & Humel R.E. (1986) J Biol Chem 261, 569–

75.

4 De Chiara T.M. et al. (1990) Nature 345, 78–82.

5 Jeon J.T. et al. (1999) Nat Genet 21, 157–8.

6 Nezer C. et al. (1999) Nat Genet 21, 155–6.

7 Amarger V. et al. (2002) Mamm Genome 13, 388–98.

8 Henry I. et al. (1985) Cytogenet Cell Genet 40, 648–9.

9 Morton C. et al. (1985) Cytogenet Cell Genet 40, 703.

10 Raudsepp T. et al. (1997) Mamm Genome 8, 569–72.

11 Ansari H.A. et al. (1994) Genomics 24, 451–5.

12 Zemel S. et al. (1992) Nat Genet 2, 61–5.

13 Schmutz S.M. et al. (1996) Mamm Genome 7, 473.

Correspondence: S. Schmutz ([email protected])

Linkage and radiation hybrid mappingof the porcine PIK3R1 gene to chromosome 16

S. Cepica* and G. A. Rohrer†

*Institute of Animal Physiology and Genetics, Academy of Sciences

of the Czech Republic, Libechov, Czech Republic. †USDA ARS, US


Accepted for publication 19 May 2003

Source and description: A fragment of the porcine PIK3R1

[phosphatidylinositol 3-kinase, regulatory subunit, polypeptide

1 (p85 alpha)] gene, encompassing parts of exons 10 and 13,

and intervening introns and exons was amplified using a pair of

primers designed from cDNA sequence of the human gene

(XM_043865), aligned with human genomic DNA sequence

(AC016564) to determine exon–intron boundaries of the gene.

To verify the identity, 1650 bp amplicon was terminally

sequenced and the data obtained was deposited in the EMBL

nucleotide database under accession numbers AJ555826 and

AJ555827. The sequences were compared with sequences in

NCBI databases using BLAST. The sequences AJ555826 and

AJ555827 matched exons 11 and 13 of the human sequence

AC016564 with identity of 88% (142 of 161 nucleotides) and

89% (86 of 96 nucleotides), respectively.

Primer sequences: Forward: 5¢-AAG GCA ATG AGA AAG AAA

TAC AA -3¢, Reverse: 5¢-TCT CCC GGA CAA GAA AAG TG -3¢.

PCR conditions: The polymerase chain reaction (PCR) was

performed in 25 ll reactions using 50 ng porcine genomic

DNA, 1· PCR buffer [50 mM Tris–HCl, pH 9.3, 15 mM

(NH4)2SO4, 0.1% Tween], 0.2 lM each primer, 200 lM each


Brief notes 313

dNTP, 1.5 mM MgCl2, 2% DMSO and 0.625 U LA polymerase

(Top-Bio, Prague, Czech Republic). After an initial 95 �C

denaturation step (2 min) the PCR was carried out at 95 �C

(45 s), 53 �C (45 s) and 68 �C (90 s, the last extension 7 min)

for 30 cycles. To verify the identity, the amplimer was ter-

minally sequenced using Thermo SequenceTM CyTM5 Dye ter-

minator Kit (Amersham Biosciences, AP Czech, Prague).

Digestion of 5–10 ll of each PCR product was performed with

5 U of MvaI (prototype EcoRII, Fermentas, Lithuania) at 37 �C

overnight.

Polymorphism/Mendelian inheritance/allele frequencies: Biallelic

polymorphism was detected with MvaI (Fig. 1). MvaI cuts

the amplimer into five or six fragments. Allele A, in which the

restriction site is absent, is characterized by the presence of the

longest fragment approximately 490 bp long, whereas for allele

B which possesses the polymorphic restriction site, this frag-

ment is cut to yield a fragment of about 370 bp, overlapping

with the second longest fragment and fragment of about

120 bp. Mendelian inheritance was confirmed in the USDA-

MARC backcross pedigree.1 Allele frequencies in unrelated

animals of eight pig breeds are given in Table 1.

Linkage mapping: Two-point linkage analysis identified the most

significant linkage of PIK3R1 with SW1341 and SW382

(h ¼ 0.00, LOD ¼ 4.82). Multi-point linkage analysis was

performed in the USDA-MARC backcross pedigree using CRI-

MAP software package, version 2.4.2 On the basis of

18 informative meioses, the PIK3R1 marker was localized on

the USDA-MARC linkage map3 to SSC16 position 40.1

Kosambi cM at the same location as SW81, SW382, SW1090

and SW1341.

Radiation hybrid mapping: Radiation hybrid (RH) mapping was

performed with the use of the INRA – University of Minnesota,

porcine Radiation Hybrid panel.4 Two-point analysis performed

on IMpRH Server at http://imprh.toulouse.inra.fr5 showed the

most significant linkage to SW1341 (LOD ¼ 5.73, 56 cR) and

together with this marker forms a new linkage group on the

first porcine RH map6 (Fig. 2).

Comments: Phosphatidylinositol 3-kinase (PI3-kinase) is the

major pathway for the metabolic effects of insulin and other

growth factors. This enzyme plays an important role in the

stimulation of glucose transport, glycogen synthesis and lipoly-

sis. The PI3-kinases are heterodimeric enzymes composed of a

regulatory subunit (p85) and a catalytic subunit (p110a or

p110b). Regulatory subunits of PI3-kinases exist in several

Table 1 Allele frequencies in eight breeds of pig for the PIK3R1 gene

Mva I polymorphism.

Breed n

Allele

A B

Landrace 12 0.25 0.75

Large White 14 0.07 0.93

Czech meat pig 15 0.20 0.80

Black Pied Prestice 7 0.21 0.79

Meishan 7 0.36 0.64

Pietrain 6 0.00 1.00

Hampshire 6 0.00 1.00

Duroc 2 0.00 1.00

Figure 2 Radiation hybrid map of porcine chromosome 166 showing

position of PIK3R1 gene.

Figure 1 Agarose gel (2.5%) showing genotypes in porcine PIK3R1

gene after digestion of the amplicon with MvaI. The genotypes (AA, AB

and BB) are shown at the top of each lane. M, GeneRulerTM 100 bp

DNA Ladder Plus (Fermentas, Vilnius, Lithuania); PCR, undigested PCR

product.


Brief notes314

isoforms derived from the p85a gene, including two short forms

p50a and p55a/AS53, as well as subunits encoded by the p85band P55PIK/p55c genes.7 In human beings the PIK3R1 gene

was mapped to 5q13.8 FISH assigned porcine microsatellite

SW81, sharing the same position on USDA-MARC 2 linkage

map as PIK3R1, to SSC16q21.9 Mapping of PIK3R1 to SSC16

is in agreement with comparative mapping data.10 For its

physiological role the PIK3R1 gene could be considered as

a candidate gene for fat traits and food intake, as the PI3-

kinase, regulatory subunit, polypeptide 1 (p85 alpha) is essential

for adipocyte differentiation7 and neuronal PI3-kinase is

important for the effect of leptin on food intake,11 respectively.

However, so far no QTLs for these traits have been detected on

SSC16.12

Acknowledgements: The authors would like to thank Mrs

Marketa Hancova for her excellent technical assistance and Dr

Martine Yerle (INRA, Castanet-Tolosan, France) for providing

the IMpRH panel.

References1 Rohrer G.A. et al. (1994) Genetics 136, 231–45.

2 Green P. et al. (1990) Documentation for CRI-MAP, Version

2.4. Washington University School of Medicine, St Louis,

MO, USA.

3 Rohrer G.A. et al. (1996) Genome Res 6, 371–91.

4 Yerle M. et al. (1998) Cytogenet Cell Genet 82, 182–8.


6 Hawken R.J. et al. (1999) Mamm Genome 10, 824–30.

7 Almid K. et al. (2002) Proc Natl Acad Sci USA 99, 2124–8.

8 Cannizzaro L.A. et al. (1991) Cancer Res 51, 3818–20.

9 Robic A. et al. (1996) Mamm Genome 7, 438–45.

10 Goureau A. et al. (1996) Genomics 36, 252–62.

11 Niswender K.D. et al. (2001) Nature 413, 794–5.

12 Bidanel J.P. & Rothschild M. (2002) Pig News and

Information 23, 39N–54N.

Correspondence: S. Cepica ([email protected])

Thirty-one polymorphic microsatellite markersfor genetic mapping in rainbow trout(Oncorhynchus mykiss)

A. Ozaki, S.-K. Khoo, T. Sakamotoand N. Okamoto

Department of Aquatic Biosciences, Tokyo University of Fisheries,

Minato, Tokyo, Japan

Accepted for publication 5 June 2003

Source/description: Microsatellites were isolated from genomic

library of size-selected (150–400 bp) Sau3AI restriction frag-

ments from the RTG-2 cell line. The DNA was inserted in

pBluescriptSK, digested with BamHI and transformed into

Table 1 Rainbow trout microsatellite primer information. The primer sequences, type and length of repeat, Tm (PCR annealing temperature) of the

primers, length of PCR products, chromosomal location, heterozygosity, polymorphism information content (PIC) and DDBJ accession number.

Locus name Primer sequence (5¢–3¢)Repeat

array* Tm (�C)

Length of

PCR products*

Chromosomal

location Heterozygosity PIC

Accession

number

OmyOGT1TUF F: GTCTGATTGACGCATGCG (CA)38 55 199 V 0.87 0.86 AB087584

R: GATCACAAATGGAATTCACCA

OmyOGT5TUF F: CTCACAGCTTCGTGGAAACA (CA)17 55 189 Fi, Fii 0.69 0.65 AB087585

R: CTAACCCTCCCATTGTCCCT

OmyRGT1TUF F: AGTTTTGATTGAACGGGGC (CA)30 55 177 5 0.76 0.75 AB087586

R: CAGGGGACGCCACCTATAC

OmyRGT2TUF F: ATAATGTGTCCCCAGGCAAG (CA)13 55 150 H 0.65 0.63 AB087587

R: GAGGATGCGTCTTTGCATCT

OmyRGT3TUF F: CGTCAGTCTGCTTCACCGTA (CA)11 55 143 Fi 0.64 0.62 AB087588

R: GCTCATGTGTGTGCCTGC

OmyRGT4TUF F: GGAACACTGAGAATTCCTCCC (CA)19 55 123 Oi 0.71 0.69 AB087589

R: TCGCTCAGCCACTACAAGTG

OmyRGT9TUF F: GGTCCTTCTCCTCTCCGC (CA)10 55 150 Q 0.64 0.62 AB087590

R: TGCTCCCAGTTCAATCAGC

OmyRGT12TUF F: TGAAGACGTTGTGGCTCCTA (CA)12 58 143 K, U 0.65 0.63 AB087591

R: CAAAGCACCTGGCCTGTAAT

OmyRGT13TUF F: GTACTCCAGCTCCTCCCTCC (CA)12 58 119 15 0.69 0.65 AB087592

R: ACACCCCACTTTCTCTCCCT

OmyRGT14TUF F: CCTGGCTCTGTTACCTGTCTG (CA)19 58 126 N 0.71 0.69 AB087593

R: ATCAATAAACCGCAAATGGG

OmyRGT17TUF F: GGTCAGTGGCCATTCAGATT (CA)27 58 151 R 0.76 0.75 AB087594

R: ACCAGCTCCTCCCTTGTTCT

OmyRGT19TUF F: TCGGATCTCCGATTGGTAAG (CA)25 58 238 2 0.76 0.74 AB087595

R: AGGACCTGCATGAAATGGAG


Brief notes 315

competent Escherichia coli cell (DH5a). The partial genomic

library was screened with a c-32P end-labelled (CA)10 oligo-

nucleotide probe. The sequence was obtained from an ABI 310

genetic analyzer (Perkin Elmer, Tokyo, Japan). The polymerase

chain reaction (PCR) primers flanking the dinucleotide repeats

were described.

PCR condition and genotyping: The PCR was performed in a 25 ll

reaction volume containing 0.5 lM of unlabelled forward primer

and 0.05 lM of reverse primer labelled with (c33P) adenosine

triphosphate using T4 polynucleotide kinase, plus 0.4 mM of

each dNTP, 10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2,

0.1 lg ml)1 bovine serum albumin (BSA), 0.625 U Taq DNA

polymerase (Takara, Tokyo, Japan) and 50 ng template DNA. A

specific annealing temperature was used for each microsatellite

marker. The PCR program consisted of an initial denaturation at

95 �C for 2 min, followed by 35 cycles consisting of 1 min at the

annealing temperature, 1 min at 72 �C, 30 s at 95 �C and a

final extension of 3 min at 72 �C. Amplicons were denatured by

adding an equal volume (25 ll) of formamide buffer (98%

formamide, 10 mM ethylene diamine tetra acetate, pH 8.0,

0.05% bromo-phenol blue and 0.05% xylene cyanol) and

heating at 95 �C for 10 min. Three ll of each sample were

loaded on a 6% polyacrylamide gel to obtain individual geno-

types. Allele sizes were determined using a M13 standard

sequencing ladder. The gel was dried and used to expose a Fuji

Image Plate Bas 1000 (Fujifilm, Tokyo, Japan) overnight.

Table 1 (Continued)

Locus name Primer sequence (5¢–3¢)Repeat

array* Tm (�C)

Length of

PCR products*

Chromosomal

location Heterozygosity PIC

Accession

number

OmyRGT21TUF F: CCCTGAACCAGATGGCAC (CA)39 58 147 8 0.87 0.86 AB087596

R: TCATTAGCTGGGATTCCGAC

OmyRGT24TUF F: CCCCTCTGCTTCAACTGTTT (CA)37 58 150 M 0.88 0.85 AB087597

R: ATCCCCCTTGAGTAATGTCTTG

OmyRGT26TUF F: TGTGAGGGGAGAAGGAGAGA (CA)36 58 138 B 0.87 0.85 AB087598

R: GTTAGCACCCCTGTAACGGA

OmyRGT28TUF F: CACCGTGAGAGGACACATTG (CA)19 58 132 18 0.71 0.69 AB087599

R: CCACTTGCCATGTAGACCCT

OmyRGT30TUF F: GATCCGTGTGAGTGATGTGG (CA)11 58 132 Oi 0.67 0.65 AB087600

R: GAATGAGTTGCAAGCAGGC

OmyRGT31TUF F: TCTATGGAAGGTTCTGTTTGCA (CA)34 58 235 15 0.88 0.87 AB087601

R: TTCCCCAACCCTCTCCTC

OmyRGT32TUF F: CACTCATTGGCTGGACTGTG (CA)18 58 185 N 0.71 0.69 AB087602

R: AAGCTGTGACAAGTGCAGTCA

OmyRGT33TUF F: TTCATAGTGACCACAATGCTCC (CA)36 58 140 Oi 0.87 0.85 AB087603

R: CCCATGCCTCCTTTCACTTA

OmyRGT35TUF F: GTAGCGCAGAGGAACTGGAC (CA)17 58 158 2 0.71 0.68 AB087604

R: GATCCAAGCCTCAAAGAGCA

OmyRGT36TUF F: ATCATCAAGAGTCCATCAGAGC (CA)44 58 193 G 0.86 0.85 AB087605

R: GGTCTGGTGCCATTCTGG

OmyRGT38TUF F: ACCCCCATCCCTCTAAACC (CA)15 58 134 Oi 0.71 0.69 AB087606

R: CCTGAAACAGCTTGCCTTTC

OmyRGT39TUF F: TAAGCGCATGACTGAACAGG (CA)12 58 112 E 0.67 0.64 AB087607

R: TATGTGACCCCGACCAAATT

OmyRGT40TUF F: GCAGATAAGGCACCAACCAT (CA)9 58 128 Oi, Oii 0.64 0.59 AB087608

R: TATGCTTAGAGCCCCCTGTG

OmyRGT42TUF F: TTCGTTACCCTAGCTTAGCACC (CA)46 58 151 Oi, Oii 0.88 0.86 AB087609

R: TCACACACTTCCATCTTACTGG

OmyRGT43TUF F: TTACTGTGCATCCTACAGGCC (CA)81 58 230 D 0.87 0.85 AB087610

R: CATTGCTCATTCATCCCTGA

OmyRGT44TUF F: GAGGGTTGGAGTACACAGAAGG (CA)11 58 138 C 0.67 0.65 AB087611

R: ATGTGGGGACATATTAACTGGC

OmyRGT46TUF F: TCAGAAATCCAGCCAAAACC (CA)10 58 125 N 0.69 0.67 AB087612

R: GACGCAAAGAGAGTTCAGTGG

OmyRGT51TUF F: TCCACTCAGTCAGTCTCTCTGC (CA)23 58 142 N 0.71 0.68 AB087613

R: TTGCATCATAGCAGCTCTGG

OmyRGT52TUF F: GCAGCCTTTCACCAGCTC (CA)33 58 245 R 0.87 0.85 AB087614

R: GTCAGTGGGCATGATGGAC

*The sequences of repeat arrays and lengths of PCR products are from the original sequenced clone.


Brief notes316

Mendelian inheritance: Co-dominant Mendelian inheritance of

alleles was confirmed in farmed reference rainbow trout fam-

ilies.1,2

Polymorphism: Polymorphism was studied in 17 unrelated

rainbow trout obtained from five Japanese hatcheries. Infor-

mation regarding the designated markers is shown in Table 1.

Chromosomal location: These markers have been assigned to the

reference rainbow trout genome map by linkage analysis.1,2

Acknowledgments: This study was partially supported by grants-

in-research fellowships of the Japan Society for the Promotion

of Science for Young Scientists, and Aid for Scientific research

from the Ministry of Education, Science, Sports and Culture of

Japan (No. 11460088), the Japanese Fisheries Agency and

JSPS-RFTF 97L00902.

References1 Sakamoto et al. (2000) Genetics 155, 1331–45.

2 Ozaki et al. (2001) Mol Genet Genomics 265, 23–31.

Correspondence: Nobuaki Okamoto (nokamoto@tokyo-u-fish.

ac.jp)

Linkage mapping of the porcine hairless gene(HR ) to chromosome 14

A. Fernandez*, L. Silio*, J. L. Noguera†,A. Sanchez‡ and C. Ovilo*

*Departamento de Mejora Genetica Animal, SGIT-INIA 28040,

Madrid, Spain. †Area de Produccio Animal Centre, UdL-IRTA

25198, Lleida, Spain. ‡Unitat de Genetica i Millora, Facultat de

Veterinaria, Universitat Autonoma de Barcelona, 08193 Bellaterra,

Barcelona, Spain

Accepted for publication 12 June 2003

Source/description: The hairless gene (HR) codes for a protein,

which is a transcriptional corepressor for thyroid hormone

receptors.1 Mutations in the human and mouse HR are

involved in complete or partial absence of hair.2,3,4 The human

HR spans over 14 kb on chromosome 8p12 and is organized

into 19 exons.5 The objective of the present study was the

linkage mapping of the porcine homologue of the HR.

Samples: Skin samples were collected from two pigs showing

hairlessness (Guadyerbas Iberian pigs) and two pigs with hair

(Landrace pigs). Total RNA was purified with the Tri Reagent

(Sigma-Aldrich Chemie, Madrid, Spain) from 100 mg of tissue.

The reverse transcriptase (RT) was performed with Superscript

II (Invitrogen, Life Technologies, Barcelona, Spain) and random

hexamers, following the suppliers� instructions.

Primer sequences: FW1: 5¢-CCAGCTCTGGGCAGCCTATGGTG-3¢RW1: 5¢-CTGCTTGGAACACAGCCCAGTCC-3¢FW2: 5¢-ACCAACATCCTGGACAGCATTAT-3¢RW2: 5¢-GACCAGGGAAGTCACCTCCACAC-3¢

PEX17F: 5¢-CCCGGCTGGGGCAGGAAACTTG-3¢PEX17R: 5¢-GGGAGCCCCGGCAGGCACCAG-3¢.

Sequencing: Two cDNA fragments were amplified with primers

(FW1–RW1 and FW2–RW2), designed from conserved regions

of human, mouse and rat HR sequences (GenBank accession

numbers NM_005144, NM_021877 and NM_024364,

respectively), covering exons 11–15 and 14–19. The polym-

erase chain reactions (PCR) were performed in 25 ll volumes

containing 2 ll of cDNA, standard PCR buffer [75 mM Tris-

HCl pH 9.0, 50 mM KCl, 20 mM (NH4)2SO4], 2 mM MgCl2,

200 lM dNTPs, 0.5 lM of each primer and 0.5 U Tth polym-

erase (Biotools, Madrid, Spain). Amplification conditions were

94 �C for 3 min, followed by 40 cycles of 94 �C (45 s), 62 �C

(45 s) and 72 �C (45 s), with a final extension step of 7 min at

72 �C. The PCR reactions were performed on a PTC-100

thermocycler (MJ Research, Watertown, MA, USA). The RT-

PCR products of 575 and 663 bp were sequenced in both

directions with the Dye Terminator Cycle Sequencing in an

ABI 310 automatic sequencer (PE Applied Biosystems, War-

rington, UK). The two sequences obtained were assembled into

one sequence of 1027 bp (GenBank accession number

AY279972), which had 88, 83 and 82% sequence similarity

to the human, mouse and rat HR sequences, respectively. This

porcine sequence potentially encodes a protein fragment of

342 amino acids, which shows 83, 80 and 79% sequence

similarity to the human, mouse and rat HR sequences,

respectively.

Polymorphism/PCR–RFLP: The porcine HR cDNA sequence

reported here allowed the identification of one single nucleotide

polymorphism at position 864. This SNP creates a polymorphic

PstI restriction site. The primers PEX17F and PEX17R were

designed for the PCR–restriction fragment length polymorph-

ism (RFLP) genotyping of this SNP on genomic DNA samples.

The primers amplify a 154 bp fragment in exon 17. The PCR

reactions were performed with the same PCR conditions as

described previously, but containing 60 ng of genomic DNA

and at an annealing temperature of 64 �C. Amplification

products (10 ll) were digested with 2 U of PstI in 20 ll vol-

umes and the genotypes were determined analyzing the diges-

tion products in 3% agarose gels (allele A: 154 bp, allele G: 114

100 pb

200 pb

50 pb

300 pb400 pb500 pb

154 pb

114 pb

40 pb

1 2 3 4 5 6 7 8

AA AA AG AG GG GG

Figure 1 Agarose gel (3%) showing different genotypes of the

PCR–RFLP PstI within the porcine hairless gene. Lane 1, 50 bp ladder

marker; lane 8, PCR product; lanes 2–6, examples of different

genotypes.


Brief notes 317

and 40 bp) (Fig. 1). This polymorphism was genotyped in an

Iberian · Landrace pedigree including 33 F0, 70 F1 and 369 F2

animals. Codominant Mendelian inheritance was observed in

F2 families from this intercross.

Linkage mapping: A linkage map was constructed using geno-

types for the PstI PCR–RFLP and the microsatellite information

available for the Iberian · Landrace intercross. Data were

analyzed with Twopoint and Build options of the CRI-MAP6

software version 2.4. The HR locus showed linkage with

microsatellite Sw857 at 13.3 cM (LOD score 51.22) on SSC14,

with the most likely location at 0 cM (Fig. 2).

Comments: Hairless animals are found in some varieties of

Iberian and Creole pigs.8,9 Nevertheless, few studies have

analyzed the implication of different genes on this trait. In this

study we report on a gene, hairless, whose possible implication

in porcine hairlessness should be investigated further. The

mapping of HR to porcine chromosome 14 agrees with the

human-porcine comparative mapping, as conservation of

synteny between HSA8 and SSC14 has been reported previ-

ously.

Acknowledgements: We are grateful to D. Milan for providing

the GEMMA. Microsatellite primers were kindly provided by

M. Rothschild and the US National Genome program NRSP-8.

The Guadyerbas boar was a gift from the SIA �El Deheson del

Encinar� (Toledo, Spain) and the experimental crosses were

performed in the Nova Genetica facilities (Lleida, Spain). This

project was granted by the Spanish Science and Technology

Ministry (RTA01-051).

References1 Potter G. B. et al. (2001) Genes Dev 15, 2687–701.

2 Ahmad W. et al. (1998) Science 279, 720–4.

3 Ahmad W. et al. (1999) J Invest Derm 113, 281–3.

4 Cichon S. et al. (1998) Hum Mol Genet 7, 1671–9.

5 Ahmad W. et al. (1999) Genomics 56, 141–8.

6 Green P. et al. (1990) http://biobase.dk.Embnetut/Crimap.


8 Toro M. A. et al. (2000) Conserv Biol 14, 1843–51.

9 Lemus-Flores C. et al. (2001) J Anim Sci 79, 3021–6.

Correspondence: Ana Fernandez ([email protected])

0 .0 cM HR

128.1 cM Sw2515

Sw1125

Sw857

Sw210

S0007

Sw1557

13.3 cM

32.3 cM

56.1 cM

69.7 cM

106.7 cM

SSC 14

Figure 2 Linkage map obtained for SSC14.


Brief notes318

linkage mapping of a snp in the porcine madh1 gene to a region of chromosome 8 that contains qtl for...

Documents