localization of monoterpenoid indole alkaloid (mia ... of monoterpenoid indole alkaloid (mia)...
TRANSCRIPT
Localization of monoterpenoid indole alkaloid (MIA) biosynthesis by in situ hybridization (ISH)
By
Elizabeth Edmunds, Hons. B.Sc.
A Thesis
Submitted to the Department of Biotechnology
In partial fulfillment of the requirements
For the degree of
Masters of Science
August, 2012
Brock University
St. Catha rines, Ontario
©Elizabeth Edmunds, 2012
ii
Acknowledgments
First and foremost I would like to thank Dr. Vincenzo Deluca for the opportunity to work
in his laboratory under his mentorship. I have appreciated the helpful insight that has guided
me through the course of this project. I have gained a valuable experience being able to learn
from such an established and knowledgeable researcher.
Secondly, I would like to thank my committee members Dr. Jeffrey Atkinson and Dr.
Heather Gordon for their support and advice and their time to serve on my advisory committee.
Thirdly, I would like to thank my colleagues and co-workers for their patience and
helpful advice throughout my project. Particular mention must be given to Dr. Carlone's lab for
their assistance and insight into in situ hybridization techniques.
Finally, I would like to express my sincerest gratitude and appreciation towards my
family and friends for their support. I would not be where I am today without the support and
love from my mother and father, as well as Craig Easton.
iii
Abstract
Monoterpenoid indole alkaloids (MIA) are among the largest and most complex group
of nitrogen containing secondary metabolites that are characteristic of the Apocynaceae plant
family including the most notable Catharanthus roseus. These compounds have demonstrated
activity as successful drugs for treating various cancers, neurological disorders and
cardiovascular conditions. Due to the low yields of these compounds and high pharmacological
value, their biosynthesis is a major topic of study. Previous work highlighting the leaf epidermis
and leaf surface as a highly active area in MIA biosynthesis and MIA accumulation has made the
epidermis a major focus of this thesis. This thesis provides an in-depth analysis of the valuable
technique of RNA in situ hybridization (ISH) and demonstrates the application of the technique
to analyze the location of the biosynthetic steps involved in the production of MIAs.
The work presented in this thesis demonstrates that most of the MIAs of Eurasian Vinca
minor, African Tabernaemontana e/egans and five Amsonia species, including North American
Amsonia hubrichitii and Mediterranean A. orienta/is, accumulate in leaf wax exudates, while the
rest of the leaf is almost devoid of alkaloids. Biochemical studies on Vinca minor displayed high
tryptophan decarboxylase (TOe) enzyme activity and protein expression in the leaf epidermis
compared to whole leaves. ISH studies aimed at localizing TOe and strictosidine synthase
suggest the upper and lower epidermis of V. minor and T. e/egans as probable significant
production sites for MIAs that will accumulate on the leaf surface, however the results don't
eliminate the possibility of the involvement of other cell types.
The monoterpenoid precursor to all MIAs, secologanin, is produced through the MEP
pathway occurring in two cell types, the IPAP cells (Gl0H) and epidermal cells (LAMT and SLS).
iv
The work presented in this thesis, localizes a novel enzymatic step, UDPG-7-deoxyloganetic acid
glucosyltransferase (UGT8) to the IPAP cells of Catharanthus longifolius. These results enable
the suggestion that all steps from Gl0H up to and including UGT8 occur in the IPAP cells of the
leaf, making the IPAP cells the main site for the majority of secologanin biosynthesis. It also
makes the IPAP cells a likely cell type to begin searching for the gene of the uncharacterized
steps between Gl0H and UGT8. It also narrows the compound to be transported from the IPAP
cells to either 7-deoxyloganic acid or loganic acid, which aids in the identification of the
transportation mechanism.
Table of Contents
Acknowledgements
Abstract
Table of Contents
List of Figures
Chapter 1. Literature Review
1.1 In situ hybridization
1.2
1.1.1 The power of localization
1.1.2 Localization with the technique of in situ hybridization
1.1.3 Applications of in situ hybridization
1.1.4 Isotopic and non-isotopic systems for performing ISH
1.1.5 Detection of the DIG label
1.1.6 Probe choice and synthesis
1.1.7 Tissue and slide preparation
Alkaloid producing Apocynaceae family
Page
ii
iii
v
ix
2
4
5
6
8
9
13
1.2.1 Secondary metabolism 17
1.2.2 Catharanthus raseus and Catharanthus longifolius taxonomy 18
and origin
1.2.3 Vinca minor taxonomy and origin 19
1.2.4 Tabernaemontana elegans taxonomy and origin 21
1.2.5 Pharmacological value of monoterpenoid indole alkaloids 22
1.3 Previous work on Catharanthus raseus
1.3.1 DNA in situ hybridization on Catharanthus roseus 25
v
Table of Contents
1.4
Chapter 2.
2.1
2.2
2.3
2.4
1.3.2 Monoterpenoid indole alkaloid biosynthetic pathway
1.3.3 Shikimate pathway
1.3.4 2-C-methyl-D-erythritoI4-phosphate (MEP) pathway
Concluding remarks
Epidermome enriched biosynthesis of monoterpenoid indole
alkaloids and secretion to the plant surface may be common
in the Aocynaceae family of plants.
Abstract
Introduction
Materials and Methods
2.3.1 Plant material and alkaloid extraction
2.3.2 Alkaloid analysis
2.3.3 Isolation and Identification of vincadifformine from
Amsonia hubrichtii
2.3.4 Crude protein preparation and enzyme assays
2.3.5 Construction and sequence analysis of cDNA libraries
2.3.6 Real-time quantitative PCR
2.3.7 Molecular cloning and functional characterization
2.3.8 Tissue fixation and embedding
2.3.9 In situ hybridization
Results
2.4.1 Five Amsonia species accumulate their MIAs exclusively
in their leaf surface.
Page
27
31
36
41
44
45
49
50
51
52
52
53
54
55
55
56
vi
vii
Table of Contents Page
2.4.2 Vinca minor accumulates plumeran- and eburnan- type 58
MIAs on the leaf and stem surfaces.
2.4.3 MIA biosynthetic enzymes are preferentially expressed 60
in young developing leaves in V. minor.
2.4.4 Tabernaemontana elegans accumulates the majority of 62
MIAs on the leaf surfaces.
2.4.S MIA biosynthesis is regulated differently in 63
Tabernaemontana elegans compared to Vinca minor or
Catharanthus rase us.
2.4.6 Biochemical and in situ hybridization localizes TOC and 65 STR gene expression close to the upper and lower leaf epidermis of T. elegans and V. minor
2.S Discussion 68
2.6 Acknowledgements 72
Chapter 3. UDPG-7-deoxyloganetic acid glycosyltransferase
3.1 Abstract 74
3.2 Introduction 75
3.3 Materials and Methods
3.3.1 In situ hybridization 80
3.3.2 Whole leaf and Epidermal Protein Extraction 81
3.3.3 Tryptophan decarboxylase activity assay 82
3.3.4 Western Immunoblots 83
Table of Contents
3.4 Results
3.4.1 Preferential expression of CrUGT8 in plant organs and
leaf cells
3.4.2 ISH to detect CrUGT8 in young leaves of Catharanthus
roseus
3.4.3 The cell-specific organization of MIA biosynthesis in
Catharanthus roseus and in Catharonthus longifolius.
3.4.4 ISH to detect CrUGT8 in young leaves of Catharonthus
longifolius
3.5 Discussion
3.6 Acknowl edgement
References
Appendix I : Chapter 2 Supplemental Figures
Page
87
89
91
92
92
97
98
106
viii
ix
List of Figures
Figures Title Page
Chapter 1
1.1 Model of NBT/BCIP immunological detection of 10 digoxigenin (DIG) labeled ssRNA probes.
1.2 Monoterpenoid indole alkaloid producing plants. 20
1.3 Pharmacologically valuable indole-indoline dimeric alkaloids. 24
1.4 Application of DNA ISH for the cytogenetic analyses of C. roseus 26
on mitotic spreads prepared from root tip cells.
1.5 Biosynthesis of monoterpenoid indole alkaloids. 28
1.6 Examples ofthe typical biosynthetic MIAs of biosynthesis of 30 V. minor, A. hubrichtii, C. roseus and T. elegans from the central strictosidine pathway.
1.7 Previous RNA ISH work on longitudinal sections to localize the 32 MIA biosynthetic steps of tdc, strl, d4h and dat mRNA in developing leaves.
1.8 Spatial separation of the distribution of catharanthine and 35 vindoline on the surface of and within the third leaf of Catharonthus species.
1.9 Summary of previous work on the localization of gene 38 expression of the biosynthetic pathway for monoterpenoid indole alkaloids in C.roseus aerial organs.
1.10 The biosynthetic steps in the production of the iridoid 39 secologanin from geraniol.
Chapter 2
2.1 The biosynthetic of typical V. minor, A. hubrichtii, 46 C. roseus and T. elegans MIAs from the central strictosidine pathway.
x
List of Figures
Figures Title Page
2.2 Amsonia hubrichtii secretes vincadifformine into 57 leaf surface.
2.3 Vinca minor secretes most MIAs into leaf surface. 59
2.4 Tabernaemontana elegans secretes MIAs into leaf 61 surface except for some dimers.
2.5 Functional verification of Vinca minor and Tabernaemontana 64 elegans recombinant TDCs and STRs expressed in E. coli.
2.6 Biochemical and in situ localization of tdc and str mRNA 66 in young developing leaves of Tabernanamonta elegans and Vinca minor.
2.7 Model for the biosynthesis and secretion of MIAs in leaves 69 of the Apocynaceae.
Chapter 3
3.1 Preferential expression of CrUGT8 in Catharanthus roseus 84
leaves with highest activity in first leaf pair.
3.2 CrUGT8 mRNA not detectable in young developing leaves of 86 Catharanthus roseus
3.3 Catharanthus longifolius demonstrates similar cellular 88
organization of the MIA biosynthetic steps, TDC and D4H, as
Catharanthus roseus.
3.4 Localization of ugt8 mRNA in young developing leaves of 90 Catharanthus longifolius to the IPAP cells.
3.5 Spatial model of iridoid biosynthesis and translocation in 93
Catharanthus leaves.
Appendix
51 Comparative TLC analysis of leaf surface extracts from 107
Amsonia orientalis, ciliata, tabernaemontana var. salicifolia,
hubrichtii and jonsii
List of Figures
Figures
52
53
54
Title Page
Protein sequence alignment of Camptotheca acuminata 108
(CaTDC1, AAB39708.1; CaTDC2, AB39709.1), Ophiorrhiza
pumila (OpTDC, BAC41515.1), Catharanthus raseus (CrTDC;
AAA33109.1), Rauvolfia verticillata (RvTDC, ABP96805.1), Vinca minor (VmTDC, JN644945), Tabernamontana elegans
(TeTDC, JN644946).
Protein sequence alignment of Ophiorrhiza japonica (OjSTR, 109
ACF21007.1), Ophiorrhiza pumila (OpuSTR, BAB47180.1), Catharanthus roseus (CrSTR, CAA43936.1), Rauvolfia serpentina
(RsSTR, CAA68725.1) Vinca minor (VmSTR, JN644947), and Tabernaemontana elegans (TeSTR, JN644948).
In situ localization of str mRNA in young developing leaves of 110
xi
Chapter 1
Literature Review
Elizabeth Edmunds
1
2
1. Literature Review
Elizabeth Edmunds
1.1 In situ hybridization
1.1.1 The power of localization
With the revelation of a novel gene comes many questions one must address with
respect to who carries and/or expresses this gene, what is the gene's function, when does the
gene get expressed, why does this gene exist, how has it evolved, and where does the gene
function in order to characterize and fully understand the discovery. Among the many methods
employed to provide answers to these questions, techniques that localize gene expression to
particular organs, tissues or cell-types during growth and development are very powerful tools
for determining the role of biochemical specialization in the biosynthesis of particular
metabolites. This capability to localize where genes are expressed in an organism has been
used to probe how species have evolved certain metabolic pathways, whether they occur in
different sexes or what stage of growth and development might be involved. More specifically,
knowledge about cell-type specific pathway expression can probe if the process evolved to
fulfill particular biological roles required for the fitness of the species. Research along these
lines provides valuable insight into understanding the final questions of why and how certain
genes and/or transcripts behave in a certain way and aid in understanding the relevance of
their biological function. The value of localization studies has been illustrated in various
applications such as genome mapping, developmental studies, hormone analysis and even
natural product biosynthesis (Wilcox, 1993; Wilkinson, 1995). Most notably, the strength of
localization processes to research is clearly evident in pathology where localization of disease
genes and transcripts are important diagnostics and can differentiate between different stages
of a particular disease (Farquharson and McNicol, 1997).
3
Researchers utilize complementary approaches by employing a variety of research
techniques from molecular biology, biochemistry, chemistry, and more to detect genes,
transcripts, protein products and metabolites. This includes such molecular biology techniques
as Northern and Southern blots that detect the presence or absence of targeted RNA or DNA,
respectively, in samples prepared from different species, organs, tissues or cell types and the
quantity of particular RNA or DNA targets are determined by real time-polymerase chain
reaction (Wilcox, 1993; Wilkinson, 1995). Biochemical analyses utilize various techniques
including RNase protection, which can identify individual RNA molecules in a heterogeneous
RNA sample, or enzyme assays to determine the activities of particular proteins extracted from
specific tissue (Wilkinson, 1995). All of these techniques, and more, enable researchers to
detect DNA, RNA, and/or particular proteins from extracted tissues. However, these techniques
do not reveal the distribution profile or transcripts or biochemical pathways within specific cell
types, nor do they provide information about the intra- and intercellular organization of
metabolic pathways within an organism (Angerer and Angerer 1991; Wilcox, 1993; Wilkinson,
1995). As previously mentioned, the ability to visualize the location of gene expression
patterns is valuable for the analysis of gene function, as well as its spatial identity and its role in
differentiation and/or physiological stimulation of cells (Wilkinson, 1995). To meet these
information demands, researchers opt to utilize the technique of in situ hybridization, which
has become an invaluable tool in many areas of research.
1.1.2 Localization with the technique of in situ hybridization
In situ hybridization (ISH) was first described in 1969, and since then has been
4
reinvented numerous times (Gall and Pardue, 1969; Gill and Jiang, 1994; John et al. 1969).
Several alternative methods have been developed that allow researchers a variety of options
when it comes to system selection, tissue preparation, probe synthesis, and immunological
detection. Regardless of the methods chosen, ISH uses labelled complementary DNA (cDNA) or
RNA probes, to hybridize to DNA or RNA within a histological section, termed in situ or in some
cases, the whole tissue is probed if it is small enough (Angerer and Angerer, 1991; Gill and
Jiang, 1994;Kadkol et al. 1999; Wilcox, 1993). In spite of years of extensive use of in situ
hybridization in many laboratories, it still remains as one of the most difficult, unpredictable,
and demanding molecular biology techniques. The difficulties encountered may be due to the
mixed skill set required in molecular biology and histology that are rarely found in one
individual or even in one laboratory. Not only does ISH require a unique skill set, it can also be
quite tedious since numerous individual steps need to be empirically optimized before the
analysis can proceed. Regardless of these challenges, there is a significant need for researchers
to utilize this ISH technique to spatially localize the distribution of DNA and mRNA expression of
candidate genes found through the use of large scale screening technologies.
1.1.3 Applications of in situ hybridization
The use of ISH in research streams, such as, biology, pathology, medical diagnosis and
plant breeding, has been applied to studies of chromosome structure, chromosome evolution,
gene mapping, gene expression, localization of viral sequences, localization of oncogenes and
to diagnostics (McNicol and Farquharson, 1997; Wilcox, 1993). However, a major limitation of
the ISH technique is the potential for non-specific hybridization to other similar genes, rather
than the gene of interest. This may occur when the target gene is a member of a large gene
family such as the cytochrome P450s (CYPsL where several very similar genes could be
5
detected by ISH, thus producing false-positive results. There are a large number of diverse CYPs
found ubiquitously in plants, often making it difficult to determine the exact cell type where an
individual CYP is expressed due to the fact of shared sequence motifs. For this reason, other
techniques must be employed to localize CYPs or members of other large gene families.
ISH is most commonly associated with the localization of RNA transcripts within
prepared tissues. This technique can also be applied to localizing genes or DNA sequences. This
tool is regularly utilized in the field of cytogenetics, which focuses on the structure and
organization of genes on chromosomes (Guimaraes, et al. 2012; Weiss, et al. 1999). One of the
major studies in cytogenetics is karyotyping, which refers to a phenotypic analysis of the
metaphase chromosomes. This analysis can provide information on the number of
chromosome5, chromosome length, position of centromeres, banding patterns, differences
between sex chromosomes and other physical characteristics (Guimaraes, et al. 2012; Schrock,
1996; Speicher, 1996; Weiss, et al. 1999). To develop a detailed karyotype, researchers employ
different DNA/chromatin staining techniques, as well as DNA in situ hybridization, through the
use of fluorescent in situ hybridization (FISH) (Weiss et 01. 1999). FISH utilizes fluorescently
labelled DNA probes to determine the presence or absence, as well as the location of DNA
sequences on specific chromosomes (Durrant et 01., 1995; Swinger and Tucker, 1996).
Karyotyping is an instrumental tool that enables researchers to help decipher linkage groups
and map gene locations on chromosomes amongst the overwhelming surplus of genomic
information being generated in research today (Guimaraes, et 01. 2012).
1.1.4 Isotopic and non-isotopic systems for performing ISH
6
In situ hybridization can be performed using either isotopic or nonisotopic systems that
differ by the labelling method chosen for probe detection. Each system has its own strengths
and weaknesses that must be weighed against the desired research goals. The isotopic system
utilizes the radioisotopes 35S, 3H, and 32p to label nucleic acids in the probe (Kadkol et 01.1999;
McNicol and Farquharson, 1997). The isotopic system was the original labelling process to be
developed for ISH work and, still to this day, researchers feel it is the most sensitive method
available and produces results with the highest resolution (Kadkol et 01. 1999; Wilcox 1993)
compared to other methods. While labelled samples are easily visualized by autoradiography
on X-ray film in complete darkness, the exposure time is quite variable and it can take several
weeks and even months before useful results may be obtained (Kadkol et 01. 1999). The choice
of radioisotopes can be used to reduce exposure times at the expense of resolution quality. For
those researchers requiring a short exposure time with no concern for resolution, 32p can be
utilized, however those requiring high resolution with no regard for exposure time,3H in more
appropriate. Most researchers show a strong preference for using 35S, which demonstrates a
fine balance between the resolution quality and the exposure time (Durrant et 01. 1995).
Overall, isotopic systems have a major disadvantage due to the short half-life of the probe
labels and the long exposure times; samples tend to require repeated labelling and
unfortunately generate large variability that affects the reproducibility of the results from one
experiment to the next (Kadkol et 01. 1999; McNicol and Farquharson 1997; Wilcox 1993).
Despite these issues, isotopic systems are generally favoured in situations requiring the
quantification of the target via grain counting, or for the detection of low copy number
sequences (Gorham et 01. 1996; Kadkol et 01. 1999; Miller et 01. 1993).
The disadvantages of isotopic systems together with the requirements for proper
certification to use radioisotopes have prompted efforts to develop alternative systems for
performing ISH. The first nonisotopic system using biotin (vitamin B7) as a label moiety
(Naoumov et 01. 1988; Bloch et 01. 1993) showed high sensitivity (Wilcox 1993) but it suffered
from high background readings due to the presence of endogenous levels of the vitamin in
tissue samples. This encouraged the development of alternative low background nonisotopic
systems using digoxigenin, FITC (Fluorescein isothiocyanate), dinitrophenyl and alkaline
phosphatase. For the purpose of this review, the nonisotopic system using a digoxigenin label
moiety will be discussed. Digoxigenin (DIG) is a steroidal compound found exclusively in
Digitalis purpurea, Digitalis orientalis and Digitalis lanata, which are common garden variety
foxgloves (McCreery 1997). The aglycone of DIG, known as digoxin, is an important heart drug
7
that is commonly utilized in the treatment of various conditions. The benefits of this 'cardiac
glycoside' to treat heart conditions are tempered by the toxicity of foxgloves to humans and
animals that may consume the plant. Even in small doses, digoxin can cause nausea, vomiting,
headaches, dilated pupils, convulsions and can result in a fatal outcome for affected young
children (Daniel 2006).
DIG molecules are covalently linked to nucleotides such as deoxyuridine triphosphate
(dUTP) and are incorporated during the synthesis of nucleic acids to produced DIG-labelled
probes (Cox et 01. 1984). The DIG-labelled nucleotides are incorporated either internally by in
vitro transcription (RNA), polymerase chain reaction (PCR) (DNA) or by end-labelling (Kadkol et
01. 1999). The DIG-labelled probes are then used for specific hybridization to complementary
nucleic acid moieties and the DIG component can then be easily detected using antibodies
raised against this hapten (anti-DIG antibodies)(Wilkinson 1995). The DIG labels demonstrate a
very long half-life and results that are very reproducible.
1.1.5 Detection of the DIG label.
8
The anti-DIG antibodies will react with the DIG components of the hybridization and the
degree of binding is visualized by conjugating the DIG antibody to a visible or fluorescent dye or
to an enzyme. The choice of the visualization system chosen for ISH will depend greatly on the
label moiety and the desired level of sensitivity. The most common detection systems include
biotin-peroxidase, antidigoxigenin-alkaline phosphatase, and anti-fluorescein isothiocyanate
9
{FITC)-alkaline phosphatase (Kadkol et 01. 1999) coupled to the anti-DIG antibody. This review
will focus on the antidigoxigenin-alkaline phosphatase system (Figure 1.1) that hydrolyses
phosphate groups of several different substrates. The binding of antidigoxigenin-alkaline
phosphatase complex to the DIG molecules is visualized with the 5-bromo-4-chloro-3'
indolyphosphate (BCIP) and nitro-blue tetrazolium (NBT) redox system (Kadkol et 01. 1999). At
first, BCIP is oxidized by the alkaline phosphatase through the removal of the phosphate group,
where NBT is reduced to diformazan. The resulting reaction products generate a water
insoluble precipitate that can vary in colour depending on the sample, including the reddish
brown precipitate shown in the present thesis (McNicol and Farquharson 1997). Once the
target RNA or DNA is visualized by this redox system, the samples can be preserved with
gelatinized glycerin. Typically, the application of gelatinized glycerin (50% glycerol, 7% gelatin,
1% phenol) to the slides requires one to three days at 45°C to dry. This preservation technique
ensures the sample results remain stable for at least one year and enables researchers to
develop catalogues of hybridized slides to repeatedly analyze the results as more information
becomes available to them.
1.1.6 Probe choice and synthesis
Whether the detection method is isotopic or non isotopic, researchers have another very
important choice to make, as to which probe to synthesize. The probe may be double-stranded
DNA (dsDNA), single-stranded RNA (ssRNA), or oligonucleotides. These probes offer different
A
c
D
{:::E~:~~:~~:)
~
B
(1\1;) .-~ ...
I.~~;'~.I ". ~',
(AI') (AP 1 11llil1 .. ./
f~~i:\ir/ (Ar '; I ~'['! lAP ~ ,lJIl,!.J (,~p) (,\p)
i"f('I ' l :~I~.i ~'f(;- ~' ITJfl'IC; .... ~ AU AU
."' " - ~' -@ ~) ;~) (@ (§) (@ [~
AUGCGUCAUGCUAGCUAGAGCUAU I I I I I I I I I I I I I I I I I I I I I I I I U ACGCAG !fACq A II C (1 A 11(' lie (i A I1A
EiJ Qr:'.s.')
~
10
Figure 1.1 Model of NBT/BCIP immunological dectection of digoxigenin (DIG) labeled ssRNA probes. (A)
Displays the DIG labeled ssRNA probe hybridizing to the targeted RNA. (B) Demonstrates the DIG moiety of the
fully hybridized probe being detected by DIG antibodies (DIG AB) that are conjugated to an alkaline
phosphatase (AP) enzyme. (C) Demonstrate the application of NBT and BClP as substrates for the alkaline
phosphatase. (D) Displays the redox reaction that occurs with NBT and BCIP through the alkaline phosphatase
to ultimately yield a colour precipitant (Part D adapted from Invitrogen).
11
advantages and disadvantages for use that must be weighed against research goals (Kadkol et
01. 1999; McNicol and Farquharson 1997; Wilcox 1993). Double-stranded DNA probes are
generated through cloning and amplification of specific sequences of DNA or cDNA (McNicol
and Farquharson 1997). DsDNA probes are easily labeled with isotopic or nonisotopic methods
through the use of nick translation, PCR or random primer techniques (Feinberg and Vogelstein
1984; Rigby and Dieckmann 1977). DsDNA probes are very stable and tend to have a very high
specific activity, due to increased length of the probe, which also increases detection sensitivity
due to the presence of more label moieties. Despite such benefits, dsDNA probes require
denaturation to produce single-stranded DNA (ssDNA), as the antisense strand is the only
strand available to bind to the mRNA (Kadkol et 01. 1999). However this process tends to
generate free sense strands that have the ability to re-anneal to the antisense strands of the
probes. This reduces the hybridization efficiency, as the number of antisense probes available
to hybridize to the target RNA or DNA is limited (McNicol and Farquharson 1997; Wilcox 1993).
In some cases, researchers utilize PCR to generate single-stranded DNA probes, which
eliminates the need to denature the probe prior to use (McNicol and Farquharson 1997).
Some researchers lean towards the use of single stranded RNA probes (ssRNA),
otherwise known as riboprobes. SsRNA probes are very easily produced through in vitro
transcription, which transcribes RNA from template DNA via an RNA polymerase while
incorporating labelled nucleotides (Cox et 01.1984; Kadkol et 01. 1999). Similar to dsDNA
probes, ssRNA probes have very high specific activity due to their increase in probe length
(Kadkol et 01. 1999). One of the major advantages over dsDNA probes is that ssRNA probes
12
generate RNA-RNA hybrids that are much more stable than their DNA-DNA or DNA-RNA
counterparts. The strength of this hybridization allows for much more stringent washes after
hybridization to help decrease background noise (Kadkol et al. 1999; McNicol and Farquharson
1997). Another benefit of ssRNA versus dsDNA is that the whole ssRNA probe is used, allowing
more label to be introduced into the hybridization process (Kadkol et al. 1999). Despite all the
benefits of ssRNA probes, they still come with certain disadvantages. Unlike dsDNA, ssRNA
probes are susceptible to degradation by RNase activity, and special precautions must be taken
to prevent RNase contamination (Kadkol et al. 1999; McNicol and Farquharson 1997). SsRNA
probes are also characterized as being "sticky" in comparison to dsDNA, which can be
considered a great quality for the hybridization process, however when the probe is too sticky it
can have the tendency to increase background noise through nonspecific binding (McNicol and
Farquharson 1997).
The final possible choice for probe synthesis is synthetic oligodeoxynucleotides. These
probes are usually only 15-30 bases long and are easily generated through an automated
synthesizer (McNicol and Farquharson 1997). These probes are either labelled on the 3' end
with labelled deoxyuridine triphosphate (dUTP) via terminal deoxynucleotide transferase or on
the 5' end through the attachment of a reporter molecule (Kadkol et al. 1999; McNicol and
Farquharson 1997). While there is no difference between the sensitivity of these labels,
researchers can label both the 3' and 5' ends of the probe or use a cocktail of oligonucleotide
probes to increase the sensitivity to levels comparable to when using a longer probe.(8ardin et
al. 1993). The short length of these probes (15-30 bases) enables better tissue penetration but
13
may also cause nonspecific binding and production of weak hybrids that may be disrupted and
displaced during post-hybridization washes to produce false-negative results (Kadkol et al.
1999; McNicol and Farquharson 1997). Researchers may also utilize an oligoribonucleotide
probe, which is quite similar to that of ssRNA probes, only shorter in length, and similar to
synthetic deoxynucleotide probes in their accessibility to the target RNA or DNA. An added
benefit of using oligoriboprobes is that similar to ssRNA probes they generate a strong RNA
RNA hybrid. Unfortunately they run into the same issue as ssRNA probes, in which they are
very susceptible to degradation through RNases and thus their use requires additional
precautions (McNicol and Farquharson 1997).
For the purpose of this review, we focused our research around the use of ssRNA probes
since the benefits, such as ease of synthesis, high specific activity, high sensitivity, and strong
RNA-RNA hybrids, outweighed the negatives of susceptibility to RNases and the possibility of
increased background noise.
1.1.7 Tissue and slide preparation
As previously mentioned, ISH combines molecular biology and histological techniques to
obtain insights about the cells involved in biosynthesis. The process of tissue preparation
requires histological skills, and is definitely one of the most gruelling and technical aspects of
ISH. Tissue preparation requires numerous sequential steps including dissection, fixation,
dehydration, embedding, and sectioning.
14
The dissection process involves the selection of appropriate tissues to attain the
research goals. The tissue characteristics to consider are the species to be studied, the choice
of developmental stage and organ to be analyzed and the size of the tissue to be processed.
These choices are guided by biochemical analyses to specify which organs or developmental
growth stages best express the pathway to be studied and to provide guidance in the selection
of tissue best suited for ISH. Once the tissue has been selected, it may require further dissection
into smaller fragments in order to allow for proper fixation, dehydration and embedding and
for eventual histological sectioning. In addition, certain tissues may have other hindering
chemical characteristics such as waxy surfaces that need to be removed without destroying
tissue morphology in order to permit downstream procedures.
The fixation process involves maximizing the retention of intact transcript target
sequences as well as preserving the natural morphology of the tissue. While numerous cross
linking fixatives have been employed (Singer et 01. 1986; Weiss and Chen 1991), formaldehyde
fixative has been preferred since it unmasks the nucleic acids to reveal the target sequences of
RNA or DNA more rapidly than glutaraldehyde (Brigati et 01. 1983; Hofler et 01. 1986; McNicol
and Farquharson 1997). Zenker's, Carnoy's and Boulin's fixatives can also be utilized but these
will retain less of the target RNA sequences, which will result in reduced signal intensity (Nuovo
1991; Urieli-Shoval et 01. 1992). In all cases, researchers must find a balance between under
and over-fixation to resolve any issues with hybridization. Since over-fixation causes a decrease
in signal intensity due to the loss of access to the targeted sequence, a prolonged unmasking
treatment may be able to counteract this. Under-fixation can also cause a decrease in signal
15
intensity due to targeted RNA sequence degradation by RNases (Kadkol et al. 1999). One
alternative to the process of fixation is to utilize unfixed fresh frozen tissues but at the sacrifice
of morphology retention and in certain delicate tissues this method is not even an option
(McNicol and Farquharson 1997). For the purpose of this review, our research utilized the
favoured formaldehyde fixative, FAA (formalin-acetic acid-alcohol). However, regardless of the
fixative used, for our purpose of targeting RNA sequences, the fixation process must be
performed rapidly and immediately after tissue dissection in order to minimize possible
degradation by RNases (Hofler et al.1986; Pringle et al. 1989). Once the tissue is fixed, it must
go through a series of dehydration steps that clears the tissue and removes all background that
may interfere with the hybridization itself. For the purpose of this review this step was to clear
the leaf material of chlorophyll. The use of fully cleared tissue greatly increases the clarity of
the hybridization signal. There are different solutions one could utilize to dehydrate tissue, all
of which contain an alcohol, such as methanol, ethanol and tert-butanol. The process involves
using a graduated series of solutions with increasing alcohol content. The slow gradual increase
in alcohol allows the tissue to slowly dehydrate, ensuring the retention of tissue morphology
and structure.
Once the tissue is fixed and fully cleared, it must then be prepared for sectioning by
embedding it in paraffin wax, plastic, or by freezing the sections. The chosen embedding
method will depend on the structural characteristics required to perform the experiment:
either uniformly hard with plastic or frozen sections, or uniformly soft with paraffin embedded
sections (Alers et al. 1999; Cao and Beckstead 1989; Hoffman and Le 2004; Wilcox 1993).
16
Frozen sections embedded in water soluble glycols and resins found in Optimal Cutting
Temperature {O.C.T.)-tissue freezing medium, can cause difficulties in histological evaluations
due to the lack of morphological preservation, whereas the alternative hard state embedding
technique, plastic embedding, provides sections with high quality cell morphology.
Unfortunately this technique is quite cumbersome and not well-suited for use in DNA or RNA
ISH (Alers et al. 1999; Cao and Beckstead 1989). For these reasons, our review focuses on the
use of paraffin embedded sections. This technique requires the gradual incorporation of
melted paraffin wax into the final alcohol series from the dehydration process. With several
washes, one will continue to incorporate more melted paraffin and less alcohol until the tissue
is submerged in nothing but melted paraffin. At this stage, the paraffin and tissues are cast
into molds, with care taken for optimum orientation of tissues in order to obtain longitudinal,
cross- or other histological sections. Usually tissue orientation must be maintained manually
until the paraffin begins to solidify. This is one of the most difficult steps of tissue preparation,
since the previous tissue processing steps have rendered the tissue very fragile and can result in
the breakage and loss oftissue. Once the mold has been cast, many histological sections can be
produced and the mold can be kept for a long period oftime for eventual analysis. The paraffin
embedding method is readily paired with formalin fixatives and is commonly utilized in RNA ISH I
work (Kadkol et al. 1999; Wilcox 1993).
Once the tissue is fixed, dehydrated, and embedded, it can then be sectioned onto
slides for the hybridization procedure. This may not be as easy as it seems as one of the major
causes of loss of samples during the ISH protocol is when the tissue sections fall off the slide
17
during any of the numerous sequential washes. This is most commonly caused by lack of
adherence (Maddox and jenkins 1987; McNicol and Farquharson 1997; Wilcox 1993). To better
adhere the tissue sections the slides can be pretreated with different slide coatings such as
poly-L-Iysine that assists in tissue morphology retention or 3-aminopropyltriethoxysilane (APES)
dissolved in acetone, that is particularly good for plastic or paraffin embedded sections
(McNicol and Farquharson 1997). For this reason our research focused on the use of APES as a
slide coating treatment for paraffin embedded sections. This coating treatment works by
binding the -OH groups of the glass slide surface with a silane containing an amino group. This
newly available amino group enables the glass slide surface to bind to proteins, DNA, other
molecules, and provides increased adherence for paraffin embedded sections (Maddox and
jenkins 1987).
1.2 Alkaloid producing Apocynaceae family
1.2.1 Secondary metabolism
Plants have continued to evolve over millions of years and in the process have become
increasingly complex as they have adapted to occupy virtually every habitat on the planet. This
plasticity and opportunistic behaviour is in part due to the dynamic range of metabolic activities
of plants and their ability to produce a wide variety of compounds that are used for storage
(such as carbohydrates, fats and proteins), defense (such as biologically active natural
products), communication (such as hormones) and a range of other roles. While more than
100,000 of these structurally diverse compounds have been chemically described, many more
remain to be discovered (Gang, 2005). Plant pathways have been divided into primary and
18
secondary metabolism. Primary metabolism is common amongst all plants as it is required for
survival. It is involved in the production of essential compounds, such as amino acids and
mevalonate, that fulfill the basic needs of life for normal growth, development and
reproduction (Daniel 2006). The compounds produced through primary metabolism are the
building blocks for secondary metabolism. Unlike primary metabolism, secondary metabolism is
not required to sustain life and may vary greatly from one plant family to another. Secondary
metabolism produces compounds such as alkaloids, terpenoids and phenolics. It is believed
that secondary metabolites function to defend plants against herbivory and in interspecies
defence. In the case of human uses, plants are essential sources of aromas, flavours, medicines
and/or recreational drugs (Firn 2010; Taiz and Zeiger 2006).
For the purpose of this review, we will focus on a specific type of indole alkaloid, the
monoterpenoid indole alkaloids (MIA). MIAs are a class of isoprenoid indole alkaloids derived
from the amino acid tryptophan and two isoprene units, which form a ten carbon
monoterpenoid. MIA compounds are generally produced specifically in plants of the
Apocynaceae, Loganiaceae and Rubiaceae family (Daniel 2006; Firn 2010). For the purpose of
this review, we will focus on plants of the Apocynaceae family.
1.2.2 Catharanthus rose us and Catharanthus longifolius taxonomy and origin
Catharanthus roseus, commonly referred to as Madagascar periwinkle, is one of eight
species found within the Catharanthus genus. Other species include C. pusillus (Murray) G.
19
Don, C. trichophyllus (Bak.) Pichon, C. scitulus (Pichon) Pichon, C. ovalis Markr., C. coriaceus
Markgr., C. Iynceus (Bojer ed A.DC.) Pichon, and C. longifolius (Pichon) Pichon. As the common
name suggests, the majority of the genus Catharanthus are known to originate from
Madagascar, with the exception of Catharanthus pusi/lus that originates from India (van der
Heijden et al. 2004). It is an herbaceous perennial plant, with oval, ovate and oblong, glossy
green leaves, and flowers that can range from white to dark pink. It can reach an average
height of 1 m with leaves ranging from 2-9 cm in length and 1-4 cm in width. Over the years,
over 110 indole alkaloids have been documented in C. raseus extracts. It has even been noted
to produce up to 20 indole-indoline dimeric alkaloids with some of these demonstrating activity
as hypotensive, sedative, tranquilizer, and oncolytic agents (van der Heijden et al. 2004). Due
to their classification within the Catharanthus genus, Catharanthus longifolius and
Catharanthus roseus have very similar characteristics. Major differences include longer and
narrower leaves of C. longifolius resulting in more of a lanceolate shape (Figure1.2D) and less
branching than for C. roseus, which generates a less than full appearance (Figure 1.2B).
1.2.3 Vinca minor taxonomy and origin
Vinca minor, otherwise known as Lesser periwinkle, is one of six species within the Vinca
genus. V. minor first originated in Eurasia but now is widely cultivated around the world. Vinca
minor is a fast growing, common garden variety perennial ground cover (Farananika et al. 2011)
(Figure1.2A). This species has slender trailing stems that can reach up to 2 meters in length,
that are able to root down from 20-70 cm above the ground. The leaves of this species occur in
20
o
••• Figure 1.2 Monoterpenoid indole alkaloid producing plants (A) Vinca minor, (8) Catharanthus /ongi/olius,and
(C) Tabernaemontana e/egans. (0) Leaf pairs of different developmental stages from first (left) leaf pair to
fourth (right) leaf pair (only one leaf of each stage shown) of MIA producing plants. Scale bar denotes 2.5 em.
21
opposite pairs with a lanceolate to ovate shape ranging from 1-9 cm long and 0.Scm-6cm wide
during development (Figure 1.2D)(Ortho, 2003). V. minor is widely soughtas a flowering
ornamental evergreen because it is easy to cultivate and its invasive nature will smother most
weeds. V. minor has also been cultivated for medicinal use, as it has shown activity in
enhancing brain metabolism, treating circulatory diseases, and treating cardiovascular disorders
and more recently treating high blood pressure (Farananika et 01. 2011). Studies on V. minor
have discovered the presence of at least 50 MIAs such as vincamine and vincadifformine
(Farananika et 01. 2011).
1.2.4 Tabernaemontana e/egans taxonomy and origin
Tabernaemontana elegans, otherwise known as Toad tree, is one species of
approximately 110 species belonging to the Tabernaemontana genus (Figure 1.2C}. The
species belonging to the Tabernaemontana genus are commonly referred to as Milkwood, due
to the presence of a large amount of milky latex in the leaves (Figure 1.2C inset). T. elegans is
indigenous to tropical east Africa, South Africa and Swaziland. T. elegans is considered an
unarmed shrub or a small tropical tree that can reach heights up to 15 meters tall (Neuwinger
2000). The leaves of this species grow in opposite pairs, are dark glossy green in colour and
tend to be very leathery. In comparison to the previously mentioned species, C. roseus, C.
longifolius, and V. minor, the size of the leaves of T. elegans are very large. The leaves can vary
over development from as small as 3cm to as large as 25 cm long (Figure 1.2D). T. elegans has
been cultivated for years for its use in traditional medicine, as a means for treating cancer,
pulmonary disease, heart disease, and tuberculosis. Researchers have discovered and
characterized over 66 different MIAs in T. elegans, such as vobasine and conophylline
(Pratchayasakul et 01.2008).
1.2.6 Pharmacological value of monoterpenoid indole alkaloids.
22
MIAs are a very diverse class of compounds both in structure and function, with over
130 known compounds (van der Heijden et 01. 2004) being produced in plants all over the
world. Even though there are a large number of MIAs documented, only a small portion of
them have characterized functions. Catharanthus roseus has been cultivated for many years for
use in traditional Chinese medicine and as an ornamental plant. Traditional Chinese medicine
utilizes C. roseus as a treatment for numerous diseases such as diabetes, malaria and Hodgkin's
disease (van der Heijden et 01. 2004). Traditional medicine is rooted in long-standing traditions
that have been passed on for hundreds of years by word-of-mouth. The knowledge passed
along pertains to the proper preparation of the plant and the spiritual ceremonial aspects of
the treatment without regard for the compounds responsible for the medicinal activity. The
identification and isolation of these compounds has begun to occupy the pharmaceutical
industries' priorities as they playa big role in providing and/or inspiring drug candidates for the
treatment of diabetes, cancer, anxiety and more.
c.roseus produces some of the most well-documented MIA compounds. C. roseus produces
both an antihypertensive (ajamalicine) and a sedative (serpentine), but most noted are the
23
oncolytic compounds vinblastine and vincristine used in chemotherapy treatments for a range
of human cancers, by preventing cell division (Roepke et al. 2010), shown in Figure 1.3. These
compounds a,re three of the twenty indole-indoline dimeric alkaloids found in C. roseus and are
extracted from the aerial organs (van der Heijden et al. 2004). Originally, researchers
attempted to synthesize these compounds in vitro, however due to the overwhelming
complexity total chemical synthesis is not economical. Essentially, the plant itself still remains
as the only commercial source for these compounds or precursors for partial synthesis (Loyola
Vargas et al. 2007). In recent years there has been a major shift in people's habits toward
favouring earth-friendly natural products and away from items with a lot of preservatives or
synthetic elements. With this shift the pharmaceutical companies saw a golden opportunity
with the plant-based pharmaceuticals found in C. roseus. Unfortunately, the total yield
(approximately 0.0005% of dry weight) of these highly desired compounds is not large enough
to make this process economically and commercially plausible (Loyola-Vargas et al. 2007). To
begin to understand why the yield is so low and possibly how to increase the yield, researchers
began to explore Catharonthus roseus, the MIA biosynthetic pathway and breeding programs
(Dutta et al. 2004).
24
+
Catharanthine Vindoline
Vincristine Vinblastine
Figure 1.3 Pharmacologically valuable Indole-indoline dimeric alkaloids. Vincristine and Vinblastine are dimers
that consist of catharanthine and vindoline compounds.
25
1.3 Previous work on Catharanthus roseus
1.3.1 DNA in situ hybridization on Catharanthus rose us
As noted in section 1.1, DNA ISH techniques can be applied to various species to analyze
their chromosomes. Despite all of the research over the past years on Catharanthus roseus,
due to the pharmaceutical applications of its MIAs, very little is known about its cytogenetics
and genome size. This would be very valuable information to aid in development of physical
maps for breeding programs, to aim at developing varieties of C. roseus with higher levels of
dimeric MIAs (Dutta et al. 2004). This information is crucial to determine the ancestry of the
MIA pathway and facilitate MIA genetics and genomic research. Up until 2012, the
chromosome number, 2n=16, was the only data known regarding C. roseus chromosomes,
without regard for the morphological description of the chromosomes (Ge and Li 1989).
As Figure 1.4 displays, researchers began to develop the C. roseus karyotype and the
resulting ideogram, through staining chromosomes with actinomycin D and 4',6-diamidino-2-
phenylindole (AD/DAPI), for a clear morphological distinction of all chromosomes in metaphase
and prometaphase (Guimaraes et al. 2012). Actinomycin D is a nonfluorescent compound that
binds to the GC-rich regions of dsDNA, whereas DAPI is a blue fluorescent compound that binds
to the AT-rich clusters. They were able to confirm 2n= 16 chromosomes and demonstrate that
of these 16 chromosomes there were two metacentric, four sub-telocentric and two telocentric
chromosome pairs. They were able to show that most chromosomes are highly asymmetrical
26
A B ... C
~ . : . y '4 • • • p
.. .. of • . ' J
'r
. ~. ....... ,
/ ..- '.
• - Centromere ~ - ConSl flCl lon
_ - l3and ~ · NOR
Figure 1.4 Application of DNA ISH for the cytogenetic analyses of C. roseus on mitotic spreads prepared from root tip cells. (A-C) Mitotic spreads of C. roseus stained with silver nitrate. (A) Prophase. (B) Prometaphase. (C) Prometaphase with NORs restricted to a single chromosome pair. (D) Fluorescent staining of prometaphase with AD and DAPI. (E) C-banding and staining of prometaphase with PI and DAPI; NORs in red. (F) Fluorescence in situ hybridization of rDNA of metaphase with the use of a biotin-14-dATP labelled pTa71 probe and detected with fluorescein-avidin D. Chromosomes were counterstained with DAPI and NORs were highlighted in green. Arrow indicates chromosome 8. (G) Catharanthus roseus karyotype. Chromosomes are aligned by the centromeric region. (H) Ideogram of C. roseus chromosomes; small arm of chromosome 8 is represented by a dashed line since it is usually not visible. Scale bars : 5 mm (Guimaraes et 01.2012).
27
with centromere indexes that fall below 25% and that chromosome 8 and 3 have constrictions
in their long arms (Guimaraes et al. 2012). The AD/DAPI staining was helpful in identifying
heterochromatin regions (stronger fluorescence) and demonstrating they account for
approximately 20% of the length of the chromosome complement. Heterochromatin is
regularly associated with nucleolar organizing regions (NORs). NOR is the chromosomal region
around which the nucleolus forms and contains several copies of ribosomal RNA genes. To
confidently localize the NOR, silver nitrate staining, which preferentially binds to the NOR,
confirmed the presence of a single nucleolus at interphase and prophase nuclei. In
prometaphase, silver nitrate highlighted a pair of regions located on the short arm of
chromosome 6 (Guimaraes et al. 2012). To follow up, researchers utilized C-banding, which
stains constitutive heterochromatin, in conjunction with propidium iodide (PI)/DAPI staining,
and demonstrated a high affinity of PI to NORs with red, whereas other chromosomal regions
bind with high affinity either PI (red) or DAPI (blue) (Andras et al. 2000). The result of this
staining highlighted two red regions on chromosome 6. These results were corroborated
through the use of FISH to localize ribosomal DNA (rONA) with an 185-5.85-265 (pTa71) probe
from wheat, resulting in the hybridization to the same regions on chromosome 6. This
demonstrated the presence of a single 185-5.85-265 locus (Guimaraes et al. 2012).
1.3.2 Monoterpenoid indole alkaloid biosynthetic pathway
Several research groups have been working diligently on piecing together the whole MIA
biosynthesis pathway, from initial substrate to each individual possible product (Burlat et 0/.
28
¥~~ Geraniol
! Cyp76B6 HO~O~:: ~O~ LAMT ~"~ ------.. to! -0,< __ .~H ------.. H 0 -0,<_. OH
o DipH ":poole 0 CHpH
()::::Jr.:,COOH H,c5\~
HO OH
10-Hydroxygeramo l
! H,c5\~
OHe CHO
10-0xogeramol
~Ol' Hp1~
copt, 16-Melhoxy1abersomne
I ~CH'
H,co~:, 16- Melhoxy-2.3-dlhydro-
3 -hydroxytabersonJine
! NMT
~CH' HPl~~
H,c He cops
DesacetoxYVlndollne
H,co~CH' H.lC He CO,cH,
Deacetylvlndollne
! DAT
H
7 · Deoxylogamc aCid Loganlc acid Logam" L-Tryptophan
~ /! Cyp72A1
Hc-C' -O~"" 1 ! TDC
- HOos8OH 7.Deoxyloganellc acid
160MT ~ .....-- H "'-""'~
HO N H copt,
16-Hydroxylabersonine
H,coa~b ~H 7 -Deoxyloganin
~NH CH,
H H H OH
H,co 0
Stnctosldlne aglycoside
! ,. i , I T16H
~~ . . - ---~ co,cH, H.ptJaC aiD
Tabersonine Oehydrogeissoschlzine ! ............... , ~;~~
00",..,
lochnenclne
~ ... ".0
• CH,
~ H ~OH co",..,
Hbrhammericlne
~ • CH,
N H H OH
H copt,
6 ,7 -Dehydromlnovincinine
! MAT
~ ! CH,
~ H H ~ 00"""
6 .7 -Dehydroechitovenine
!
~' H~
H o __ o~_. ~ + ~c 0 CHaOH O:::0NH'
H
Secologanin Tryptamine
! STR
SGD - ~HCH' ~H H':~
0_0 ,<_ OH
ty::.o,c 0 CHpH
Strictosid ine
Polyneundine aldehyde
~" -VH
Vomllenlne
! VR
~~ 1,2-Dlhydrovomilenine
~E O::::BN-";Oll
IlH~ Norajmaline
~H
N N H H
ep,-VehoSlmlne
! VS
cQ§:~ NH_~
Vlnonne
~" Acety lnoraJmaline
! ANAMT
~OCO,C:, OH
I H CH,
Acetylajmaline
~ I = ai,
Hp;l ~ H OCHJOt, +
HloC HO CO~H:I
Vlndoline
1 PER
HO
~ H,c HO
Vinblastine
RG Ajmahne
~ocopt' HO
N o~ N t1 -0,<_ OH
CH,OH
Raucaffricine
29
Figure 1.5 Biosynthesis of the monoterpenoid indole alkaloids. Enzymes for which corresponding cDNAs have been isolated are shown in red. The key branch-point intermediate dehydrogeissoschizine is highlighted in yellow. Abbreviations: 160MT, 16-hydroxytabersonine-16-0-methyltransferase; AAE, acetylajmalan esterase; ANAMT, acetylnorajmalan methyltransferase; Cyp71D12, tabersonine 16-hydroxylase; Cyp72Al, secologanin synthase; Cyp76B6, geranioll0-hydroxylase; D4H, desacetoxyvindoline 4-hydroxylase; DAT, deacetylvindoline 4-0-acetyltransferase; DHVR, dihydrovomilenine reductase; lAMT, loganic acid methyltransferase; MAT, minovincinine acetyltransferase; NAMT, norajmalan methyltransferase; NMT, N-methyltransferase; PER, peroxidase; PNAE, polyneuridine aldehyde esterase; SBE, sarpagan bridge enzyme; SGD, strictosidine b-Dglucosidase; STR, strictosidine synthase; TDC, tryptophan decarboxylase; VH, vinorine hydroxylase; VR, vomilenine reductase; VS, vinorine synthase. Although not shown in the figure, NADPH cytochrome c reductase (CPR) is involved in the Cyp-catalyzed reactions. (Facchini and Deluca 2008).
2004 and Murata et 01.2008). There has been great success in cloning a number of the
biosynthetic steps (Figure 1.5), as well as the cellular localization of several of these steps. As
shown in Figure 1.5, this pathway is not only extremely long but also very complex, involving
more than 30 enzymatic steps (Facchini and Deluca 2008). MIAs are the products of a
condensation reaction between the terminal end products of the Shikimate pathway
(tryptamine) and the plastidic 2-C-methyl-D-erythritol 4- phosphate (MEP) pathway
(secologanin) (Burlat et 01.2004; Murata et 01. 2008), as shown in Figure 1.6. The condensation
reaction between the nitrogen containing tryptamine and the monoterpenoid secologanin is a
very important process in the production ofthe essential central intermediate, strictosidine.
This compound is the starting branch point for the biosynthesis of all MIAs (approximately 3000
alkaloids). For the purpose of this review, we will focus our attention on the biosynthetic steps
up to and including the production of strictosidine.
MEP pathway
+
~, geraniol
~ G10H 10-hydroxygeraniol
+ + Loganic acid
~ LAMT
,42'"' HOGle
loganin
'" Vincamine (V. minor)
I~ (~J/ ~.
COaCH,
Vincadifformine
~ SLS
~CHl
~: secologanin
, 'I
(A hubrichtii, V. minor)
OH
./
N I H
/ /
CH, COOCH,
Vinblastine (C.roseus)
OH
Indole pathway
+ + ~
COOH
I I H NH, .0 N
H tryptophan
~ TDC
CcnH' ~ tryptamine
H
Vobasine (T. e/egans)
OH COOCH ,
Conophylline (T. elegans)
30
Figure 1.6. Examples of the typical biosynthetic MIAs of V. minor, A. hubrichtii, C. roseus and T. elegans from
the central strictosidine pathway. The individual pathways contributing to the production of strictosidine are
the focus of this review. These individual pathways are highlighted; Indole pathway (red) and MEP pathway
(blue). The post-strictosidine steps for each pathway have not been characterized.
31
1.3.3 Shikimate pathway
The Shikimate pathway is commonly found in plants, microorganisms and in some
animals. The Shikimate pathway utilizes products of primary metabolism, erythrose-4-
phosphate and phosphoenolpyruvic acid (PEP), to produce the aromatic amino acids
tryptophan, tyrosine, and phenylalanine. These aromatic amino acids are commonly utilized as
substrates in the production for various secondary metabolites, including Iignins, flavonoids,
certain cyanogenic glycosides and alkaloids (Taiz and Zeiger 2006). Studies have demonstrated
tryptophan's involvement in the production of MIAs as the substrate for the enzyme
tryptophan decarboxylase (TDC). TDC converts tryptophan into the indole precursor tryptamine
for use in the production of the central intermediate strictosidine. The TDC gene has been
successfully cloned in numerous well-documented MIA-producing plants, including C. roseus
(Deluca et al. 1989). TDC is a cytosolic soluble enzymatic dimer (molecular weight 115kDA)
comprised of two 54kDA monomeric subunits (Deluca et al. 1986; Noe et al. 1984). It was
originally suspected to be the rate-limiting step of the MIA biosynthetic pathway, as this step is
a transition point between primary and secondary metabolism. Despite the fact that this was
eventually disproven, the suspicion fueled an increase in research oriented around C. roseus
which produced a wealth of information, including the cellular organization of key enzymatic
steps, including that of TDC (Burlat et al. 2004 and Kutchan 2005).
32
ue
a.1 W· "''ff" .~.\ I~ .1
1'\"" ~ ... "'!!f
) '. ~ -... ~
~ 'j \ ' ~ • !d . ~ ~
A' Ie C
. - -"'- '- ."'" ....,....
01
Figure 1.7 Previous RNA ISH work on longitudinal sections to localize the MIA biosynthetic steps of tdc, strl,
d4h and dat mRNA in developing leaves. Parraffin-embedded, longitudinal sections of lS-mm long leaves were
probed with digoxigenin labelled transcripts. Immunological detection of probes through anti-digoxigenin
alkaline phosphatase conjugate and BCIP/NBT. Abbreviations: Ie, lower epidermis; ue, upper epidermis. Solid
arrowheads show laticifer cells; open arrowheads point to idioblast cells. (A) Sections were hybridized with
antisense RNA for tdc. (B) Sections were hybridized with antisense RNA for strl. (C) Sections were hybridized
with antisense RNA for d4h. (0) Sections were hybridized with antisense RNA for dat (Adapted from St-Pierre
et al. 1999).
33
The application of ISH to the MIA biosynthetic pathway demonstrated that the cellular
organization is as equally complex as the numerous enzymatic steps themselves (Burlat et al.
2004 and Kutchan 2005). These studies utilized the technique of RNA ISH, by employing DIG
labelled ssRNA probes to localize the transcripts of enzymatic steps at the start of the MIA
pathway, tryptophan decarboxylase (TDCL strictosidine synthase (STRL and strictosidine ~-d
glucosidase (SGDL as well as enzymatic steps near the terminal end of the MIA pathway,
desacetoxyvindoline 4-hydroxylase (D4H) and deacetylvindoline-4-0-acetyltransferase (DAT) in
Catharanthus roseus (Figure 1.7). Following the production of tryptamine via TDC, strictosidine
synthase (STR) is the enzyme responsible for the condensation reaction between the indole,
tryptamine, and the monoterpenoid, secologanin, to produce the central intermediate,
strictosidine. Strictosidine ~-D-glucosidase (SGD) then converts strictosidine to strictosidine
aglycone. Each enzymatic step from tryptamine to strictosidine-aglycone (TDC, STR and SGD)
was localized to the upper and lower epidermis of young leaves in C. roseus (Deluca and St
Pierre 2000; Guirimand et 01. 2010; St-Pierre et 01. 1999). The downstream product of these
reactions, desacetoxyvindoline, is converted to deacetylvindoline and then to vindoline via the
terminal enzymatic reactions D4H and DAT, respectively. The localization of these terminal
steps differ from the initial TDC, STR, and SGD steps, as they were found to be localized within
the specialized idioblasts found in both the palisade and spongy mesophylliayers, and within
the lacticifers found at the interface between the palisade and spongy mesophyll (De luca and
St-Pierre 2000; St-Pierre et 01. 1999). These results demonstrated that the MIA biosynthetic
pathway performs enzymatic steps in both the epidermis as well as the internal cells of the leaf.
34
One can conclude that there is considerable movement of substrates and products throughout
the pathway to various cell types of C. roseus leaves, however, since then, little work has been
done to localize the remaining enzymatic steps. With all this movement of MIA precursors
between cell types, questions began to arise as to where the resulting MIAs accumulate.
To satisfy this question, focus shifted to localizing the monomeric components,
catharanthine and vindoline (Figure 1.3), of C. roseus's highly sought-after natural anticancer
drugs. Despite the low biological yield of the dimeric compounds, vinblastine and vincristine, in
C. rose us, chemists have developed semisynthetic derivatives via the monomeric precursors
isolated from C. roseus. Due to previous localization work, it was suggested that these
compounds should be found either on the surface or within young developing leaves of C.
roseus (Murata et al. 2008). Sequential extractions of chloroform and methanol were
performed to determine their location (Roepke et al. 2010). Chloroform dipping is a technique
known to remove surface waxes and other hydrophobic surface chemicals. With the surface
extracts removed, the leaves were subjected to a methanol extraction that would remove the
internal compounds of the leaf (Samuels et al. 2008). The extractions were analyzed via UPLC
(DEFINE) and the results displayed that 100% of the catharanthine produced in the young
leaves is secreted to the surface, whereas only 3.8% of vindoline is secreted. The remaining
vindoline was found in the methanol extraction, demonstrating that it accumulates largely
within the young leaves of C. roseus. As displayed in Figure 1.8, similar activity was
demonstrated within a total of 11, C. roseus (L.) G. Don cultivars, Catharanthus species and
hybrids, that demonstrated 100% leaf surface accumulation of catharanthine and internal
A
1600
• Catharan1tt[ne D VlnoollB!!
c: o ~ '~ l
.... 600 :I i Ie .....
en 200 ~
o
1 2 4 5 6 7 S 9 10 11
1 2 3 4 5 ti 7 8 9 1et 11
catnaranltlus vanetylSpeCIQS
Figure 1.8 Spatial separation of the distribution of catharanthine and vindoline on the surface of and within the third leaf of C. roseus (L.) G. Don cv. Little Delicata (1), c. roseus Pacifica Peach (2), Catharanthus longifolius (Pichon) Pichon (3), Catharanthus ovalis (4), Catharanthus trichophyllus (Baker) Pichon (5), plus C. rose us hybrids (tolerant to the fungal pathogen P. nicotianiae var. Parasitical Cora Deep Lavender (6), Cora White (7), Cora Lavender (8), Cora Violet (9), Cora Apricot (10), and Cora Burgundy (11). The experiment for each variety/species was performed in triplicate (Roepke et al. 2010).
35
36
accumulation of vindoline (Roepke et a/. 2010). With the spatial separation of vindoline and
cathranthine, together with the specific localization of the terminal steps in vindoline
biosynthesis, DAT and D4H, to the idioblasts and lacticifers, provides an explanation for the low
accumulation of dimers due to the differential sequestration of the monomeric compounds.
The secretion of certain alkaloids has been demonstrated as a common trait amongst the
Catharanthus genus (Roepke et al. 2010); it would be ideal to broaden the search and
determine if this secretion activity is specific to the Catharanthus genus or if it is a characteristic
of all alkaloid producing plants(approximately 20% of plant species).
1.3.4 2-C-methyl-D-erythritol 4- phosphate (MEP) pathway
As nmed earlier, the MIA central intermediate is produced through the condensation of
an indole (tryptamine) and the monoterpenoid (secologanin). Monoterpenoids are iridoids that
are a specific class of monoterpenes. They get this classification due to the presence of a
glucose moiety and a highly oxygenated pentacyclic ring which is only found within more
complex structures during late steps of biosynthesis .. For the purpose of this review,
secologanin does not contain this pentacyclic ring as it is a simple monoterpenoid generated in
early steps of biosynthesis. The synthesis of secologanin begins with the production of a
monoterpene through the 2-C-methyl-D-erythritol 4- phosphate (MEP) pathway, otherwise
known as the non-mevalonate pathway (Rodriguez-Concepcion and Boronat 2002).
Monoterpenes belong to the class of compounds called terpenes, which are a ubiquitous class
of secondary metabolites found throughout the plant kingdom. They are found in all plants, as
37
they are essential to normal growth and development due to the roles they play in forming the
side chain of chlorophyll and components in hormones like cytokinins, abscisic acid and
gibberellins (Taiz and Zeiger 2006). They are derived from C5 isoprene units condensed into
various multiples, monoterpenes (Cl0), sesquiterpenes (C15), diterpenes (C20), triterpenes
(C30), tetraterpenes (C40) and polyterpenes (C5x). To produce terpenes, plants have evolved
two pathways, the mevalonic acid (MVA) pathway, which produces sesquiterpenes and
triterpenes, and the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway, which produces
monoterpenes, diterpenes, and triterpenes (Rodriguez-Concepcion and Boronat 2002; Taiz and
Zeiger 2006). For the purpose of this review, we will focus on the MEP pathway as it produces
the desired monoterpene products for the production of secologanin.
The plastidic specific MEP pathway was originally discovered in the mid 1990's (Rohmer
1999). The pathway is initiated by the condensation of glyceraldehyde 3-phosphate and
pyruvate by l-deoxy-D-xylulose 5-phosphate synthase (DXS) to produce l-deoxy-D-xylulose 5-
phosphate (DXP). l-Deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) then reduces and
isomerizes the DXP intermediate to generate 2-C-methyl-D-erythritol-4-phosphate (MEP). MEP
undergoes numerous enzymatic steps that result in the condensation with cytidine-5-
triphosphate (CTP) and phosphorylation by adenosine triphosphate (ATP) to form 2-
diphosphocytidyl-2C-methyl-D-erythritol-2-phosphate. The cytidine nucleotide is then removed
from this product via 2-C-methyl-D-erythritol 2, 4-cyclodiphosphate synthase (MECS) to form 2-
C-methyl-D-erythritol-2, 4-cyclodiphosphate (MEC). MEC undergoes numerous enzymatic steps
which essentially dehydrate and reduce it into isopentyl-pyrophosphate, otherwise known as
I [)XS
~~ I MECS
l G10H
hlio!llJaI ph!!ll!m pm~-"n':h:Jrnii
38
Figure 1.9 Summary of previous work on the localization of gene expression of the biosynthetic
pathway for monoterpenoid indole alkaloids in C. rose us aerial organs. Three MEP pathway
genes DX5 (l-deoxy-D-xylulose 5-phosphate synthase), DXR (l-deoxy-D-xylulose 5-phosphate
reductoisomerase) and MEC5 {2-C-methyl-D-erythritoI2,4-cyclodiphosphate synthase}, as well
as G10H (geraniol-10-hydroxylase), are expressed in internal phloem parenchyma (IPAP). The
localized intermediate genes 5L5 (secologanin synthase), TDC (tryptophan decarboxylase) and
5TR {strictosidine synthase} are then express in epidermis. Late genes D4H (desacetoxyvindoJine
4-hydroxylase) and DAT (deacetyl-vindoline 4-0-acetyltransferase) are expressed in specialised
laticifer (closed arrowheads) and idioblast (open arrowheads) cells {Kutchan 200S}.
~_/.: geraniol p) Gl0H! HO
! CHO
iridotrial
COOH
7-deoxyloganetic acid s:=¢ -----------i COOCH, OH 7-deoXYIOganetin~
Glucosylation h~ OH
COOH
7-deoxyloganic acid s=¢ 1 OGle
GI ucosylation
COOH
loganic acid HO-s:=¢ OGle
COOCH3
7-deO~IOganin s:=¢ I OGle
l ~-----------~~OCH3
loganin HO-s:=¢ SLS 1 OGle
CHOCOOCH3
~IC
LAMT
secologanin
Figure 1.10. The biosynthetic steps in the production ofthe iridoid secologanin from geraniol. Enzymes for
which corresponding molecular clones have been isolated are shown in black, bold, capitals. Abbreviations:
G10H, geraniol-la-hydroxylase; LAMT, loganic acid methyltransferase; SLS, secologanin synthase.
39
IPP (Oudin et 01. 2007). Through the use of the previously described technique of RNA in situ
hybridization, transcripts of these characterized steps of the MEP pathway, DXS, DXR, MECS,
were localized to the internal phloem associated parenchyma (IPAP) cells, as demonstrated in
Figure 1.9 (Kutchan 2005). These results suggest that the terpene precursor for monoterpene
indole alkaloids is preferentially synthesized in the plastids of IPAP cells.
40
The product of the MEP pathway, IPP, undergoes numerous uncharacterized enzymatic
steps to form the substrate for the initial committed step of iridoid biosynthesis, geraniol.
Figure 1.10 demonstrates the biosynthetic pathway from geraniol to secologanin, which begins
with geraniol being oxidized by geraniol 10- hydroxylase (Gl0H) to generate 10-
hydroxygeraniol. This metabolite is then oxidized and cyclized to produce iridotrial. This
cyclized product is the first metabolite to demonstrate the five member ring structure found in
majority of iridoids (Jensen and Schripsema 2002). Iridotrial is further oxidized to 7-
deoxyloganetic acid. From 7-deoxyloganetic acid, there are two proposed branches that
ultimately produce loganin, as displayed in Figure 1.10. One pathway involves the methylation
of 7-deoxyloganetic acid to 7-deoxyloganetin, which is then glucosylated to form 7-
deoxyloganin and finally hydroxylated to produce loganin. The alternative branching pathway
starts off with glucosylating 7-deoxyloganetic acid into 7-deoxyloganic acid, which is then
hydroxylated to loganic acid, and finally methylated by loganic acid methyltransferase (LAMT)
to generate loganin. Loganin is finally converted into secologanin via secologanin synthase,
which oxidizes the pentacyclic ring (Oudin et 01. 2007). From geraniol to loganin, only three
enzymatic steps, Gl0H, LAMT, and SLS, have genes cloned and characterized for the reactions
41
(Burlat et 01. 2004). The valuable technique of RNA in situ hybridization was employed to
localize the transcripts ofthese three steps. The results demonstrated that similar to the
preceding enzymatic steps ofthe MEP pathway, DXS, DXR, and MECS, the first step in iridoid
biosynthesis, GlOH, is preferentially expressed in the internal phloem associated parenchyma
(IPAP) cells. The terminal steps in secologanin synthesis, LAMT and SLS, were both localized to
the upper and lower leaf epidermis of C. roseus (Murata et 01. 2008; Oudin et 01. 2007). The
results here demonstrate the initial step of iridoid biosynthesis converges with the MEP
pathway in the IPAP cells, whereas the terminal steps converge with the Shikimate pathway in
the upper and lower epidermis (Figure 1.9). There are numerous enzymatic steps that have yet
to be characterized, genes cloned and transcripts localized. Overall, one can suggest that at
some point along this pathway there is a transport mechanism either shuttling the metabolites
from the IPAP cells to the epidermis, or to intermediate cell types whose involvement has yet to
be discovered.
1.4 Concluding Remarks
As discussed in this review, there is a significant place within plant secondary
metabolism field for the application of ISH. More specifically, the application of DNA ISH to
help with the development of breeding programs aimed at generating a Cothoronthus roseus
cultivar with an increased production of commercially important MIAs. The application of RNA ,
ISH can be utilized to compliment biochemical analysis, in revealing the location of enzymatic
steps in the MIA biosynthetic pathway and the MEP pathway. The work mentioned above
42
points to the leaf epidermis ofthe Catharanthus species as being an important site of MIA
synthesis and secretion. The use of DIG-labelled ssRNA probes is valuable in determining if
other alkaloid producing plant species, such as Tabernamontana elegans and Vinca minor,
utilize the young leaf epidermis as a site of early enzymatic steps, TDC and STR, as well as a site
for shuttling alkaloids to the leaf surface for accumulation. Due to the varying strength of ISH
results, it is best to corroborate ISH work with biochemical analyses. The same technique can
be utilized to determine if the intermediate steps of secologanin synthesis occur in the IPAP
cells of Catharanthus species similar to earlier enzymatic steps such as Gl0H, or if it occurs in
the epidermis similar to terminal enzymatic steps such as LAMT and SLS, or even if it occurs in
an entirely differentcell type. The resolution of this question can help guide research to specific
cell types when looking for those remaining unknown intermediate enzymatic steps and
essentially aid in elucidating the full iridoid biosynthetic pathway.
43
Chapter 2.
Epidermome enriched biosynthesis of monoterpenoid indole alkaloids and secretion to the plant surface may be common in the Apocynaceae family of plants.
This manuscript was submitted to New Phytologist
Contribution: The work pertaining to the TDC assays and the immunoblots that utilized the
carborundum abrasion protein extraction protocol, as well as the in situ hybridizations, were
performed by Elizabeth Edmunds.
Epidermome enriched biosynthesis and of monoterpenoid indole alkaloids and secretion to
the plant surface may be common in the Apocynaceae family of plants.
Sayaka Masada-Atsumi, Dylan Levac, Elizabeth Edmunds, Kyung-Hee Kim, Vincenzo De Luca
Department of Biological Sciences, Brock University, 500 Glenridge Avenue, St Catharines,
Ontario, L2S 3Al, Canada
2.1 Abstract
44
Monoterpenoid indole alkaloids (MIA) are among the largest and most complex group
of nitrogen containing secondary metabolites that are characteristic of the Apocynaceae,
Loganiaceae, and Rubiaceae plant families. This complexity has been the source of useful drugs
for treating various cancers, neurological disorders and cardiovascular conditions. The
preferential expression of MIA pathways in the leaf epidermis of Catharanthus roseus and the
exclusive accumulation of catharanthine in leaf wax exudates of 4 different species of
Catharanthus, suggested that secretion of MIAs might be a more widespread phenomena, than
previously anticipated. This study shows most of the MIAs of Eurasian Vinca minor, African
Tabernaemontana elegans and 5 Amsonia species, including North American Amsonia
hubrichitii and Mediterranean A. orientalis, accumulate in leaf wax exudates, while the rest of
the leaf is almost devoid of alkaloids. Biochemical studies with Vinca minor show that
tryptophan decarboxylase (TDC) enzyme activity and protein occurs preferentially in epidermis
enriched leaf extracts compared to whole leaves. In situ hybridization studies to localize TDC
45
and strictosidine synthase suggest that the upper and lower epidermis of V. minor and T.
elegans could be important sites of MIA biosynthesis for alkaloids that subsequently
accumulate on the plant surface} but the results do not eliminate other associated cell types in
the leaves that might be involved. These observations suggest that biosynthesis of MIAs in
epidermal or closely related cells are responsible for MIA biosynthesis and their secretion to
plant surfaces may have evolved as a common feature in MIA-producing members of the
Apocynaceae.
2.2 Introduction
The monoterpenoid indole alkaloids (MIAs) make up one of the most structurally and
pharmacologically diverse classes of plant secondary metabolites} including the most prominent
anti-cancer drugs vinblastine from Catharanthus roseus and camptothecin from Camptotheca
acuminata} the anti-hypertensive agent reserpine and the anti-arrhythmia agent ajmaline from
Rauwolfia serpentina} and the anti-malarial drug quinine from Cinchona officinalis and related
species. In spite of their pharmacological and therapeutic value} plants remain the only
commercial source for these low yield compounds since their chemical complexity makes total
synthesis uneconomical. Therefore} with over 2000 known structures} their pharmacological
and economical importance has motivated the characterization of the MIA pathways involved}
together with investigations of the specialized cells and organs participating in their
biosynthesis (reviewed by Facchini and De Luca} 2008).
MEP pathway
+
~" geraniol
~ G10H 10-hydroxygeraniol
+ + Loganic acid
~ LAMT
" ,---tJ;~"' ~I:
Vincamine (V. minor)
I~ C-f?/ lX)V'"'' H '
COOCH,
Vincadifformine
loganin
~ SLS
~CHl
ut'2 secologanin
I
(A. hubrichtii, V. minor)
/ /
N . I H j CH, COaCH,
Vinblastine (C.roseus)
OH
H, CO
Indole pathway
+ + ():0
COOH
I I H' NH:,
.& ~ tryptophan
~ TOe
()i0'H. ~N) r: . H
tryptamine
I COaCH,
H
Vobasine (T. e/egans)
o
OH COOCH,
Conophylline (T. e/egans)
46
Figure 2.1: The biosynthetic of typical V. minor, A. hubrichtii, C. roseus and T. elegans MIAs from the central strictosidine pathway. The post-strictosidine steps for each pathway have not been characterized.
47
MIAs originate from the assembly of the shikimate and non-mevalonate pathways that
supply the indole precursor tryptamine and monoterpene-secoiridoid precursor secologanin,
respectively (Figure 2.1). Tryptophan decarboxylase (TDC; EC 17 4.1.1.28) converts tryptophan
to tryptamine, while secologanin is derived from the plastidic 2-C-methyl-D-erythritoI4-
phosphate (MEP) pathway via multiple steps that have partially been characterized at the
molecular level. Strictosidine synthase (STR; 20 EC 4.3.3.2) catalyzes the condensation of
tryptamine with secologanin to form strictosidine, the common precursor for thousands of
Corynanthe, Iboga and Aspidosperma MIAs. The metabolites typically found in Catharanthus
rase us, Vinca minor, Amsonia hubrichtii and Tabernamontana elegans are representative
examples of MIAs derived from strictosidine (Figure 2.1). The highly regulated expression of
MIA biosynthesis in Catharanthus raseus by development-, environment-, 1 organ- and 2 cell
specific controls have been well documented (De Luca, 2011; Facchini and De Luca, 2008,
Guirimand et 01.,2010; Guirimand et 01., 2011). All known genes involved in the MEP pathway
as well as geraniol10-hydroxylase (G10H; CYP76B6; EC 5 1.14.14.1) (Burlat et 01.,2004;
Courdavault et 01., 2005; Mahroug et 01.,2007; Oudin et 01.,2007) were shown to be
preferentially expressed in internal phloem-associated parenchyma (IPAP) cells in C. roseus
leaves, while secologanin synthase (SLS; CYP71A1; EC 1.3.3.9) and loganic acid
methyltransferase (LAMT; EC 2.1.1.50) encoding the 2 terminal steps in secologanin
biosynthesis, TDC, STR and strictosidine ~-glucosidase (SGD; EC 3.2.1.105) were expressed
exclusively in leaf epidermal cells (St-Pierre et 01., 1999; Irmler et 01., 2000; Murata and De
Luca, 2005, Murata et 01., 2008). The leaf epidermis also preferentially expresses tabersonine
16-hydroxylase and 16-hydroxytabersonine 16-0-methyltransferase (Murata and De Luca,
2005) while the terminal steps in vindoline biosynthesis are expressed in leaf mesophyll
idioblasts and laticifers (St-Pierre et al., 1999). This highly specialized nature of C. roseus leaf
epidermis in young leaves led to the term 'epidermome' (Murata et aI., 2008), coined for the
apparent organization ofthis cell type for simultaneous biosynthesis of several different small
molecules, many of which are secreted to the leaf surface.
48
Most recently, the need for complex development-, environment-, organ-, and cell
specific regulation of MIA biosynthesis was partially explained by the discovery that
catharanthine and vindoline accumulated in different locations in Catharanthus leaves (Roepke
et al., 2010). Although the entire production of catharanthine and vindoline occurs in young
developing leaves, catharanthine accumulated in leaf wax exudates of leaves, while vindoline is
found within leaf cells of 4 separate species of Catharanthus (c. rose us, C. longifolius, C. ovalis
and C. trichophy/lus). The spatial separation of these two MIAs provided a biological
explanation for the low level production of dimeric anticancer drugs found in the plant that
result in their high cost of commercial production. The ability of catharanthine to inhibit the
growth offungal zoospores at physiological concentrations found on the surface of
Catharonthus leaves, as well as its insect toxicity, provide an additional biological role for its
secretion. This spatial separation also raised the possibility that dimer formation might be
triggered by herbivory that would mix catharanthine and vindoline to form toxic vinblastine or
related dimers within the intestinal tract of the herbivore. The involvement of the nucleus in
the subcellular organization of strictosidine biosynthesis in Catharanthus was also proposed to
provide a mechanism for the release 9f reactive strictosidine breakdown products that might
be involved in defense against insect herbivores (Guirimand et al., 2010; Guirimand et al.,
49
2011). Other studies in Camptotheca acuminata used indirect fluorescence detection to suggest
that camptothecin accumulated in glandular trichomes on the abaxial side of the leaf mid-rib
and in epidermal cells surrounding them, as well as in spongy parenchyma idioblasts adjacent
to the abaxial epidermis (Valletta et al., 2010).
The discovery of catharanthine on the leaf surfaces offour separate Catharanthus
species suggests that many more plant species may actually secrete alkaloids for defensive
reasons as well as for other functions that remain to be discovered in Nature. MIAs are found
mainly in plant families of the Apocynaceae, Loganiaceae and Rubiaceae. Botanically, these
three are closely related families in which the Apocynaceae and Rubiaceae have emerged from
the Loganiaceae. Since a large variety of MIAs have been extensively characterized in the
Apocynaceae plant family, three species from widely different geographic regions (Vinca minor
from Eurasia; Tabernaemontana elegans from Africa; Amsonia hubrichitii from North America),
were selected to test the hypothesis that they might secrete MIAs to their respective leaf
surfaces. The present study demonstrates that all 3 species commonly secret various MIAs to
the leaf surface, and that the leaf epidermis or closely related cells are responsible for MIA
biosynthesis.
2.3 Materials and Methods
2.3.1 Plant material and alkaloid extraction
Catharanthus raseus, Vinca minor, and Tabernaemontana elegans plants were grown in
a greenhouse under a 16/8 h day photoperiod at 30 DC. Fresh leaves and other tissues of
Amsonia hubrichtii, A. tabernaemontana, A. jonesii, A. ciliata and A. orientalis were harvested in
50
the Niagara Parks Botanical Garden or from the Montreal Botanical Gardens. The surface
extracts were obtained by dipping each plant tissue in 3-5 mL chloroform at room temperature
for 30 min to 1 hr. The surface stripped materials were then air dried and dipped in 3-5 mL
methanol at room temperature for 1 hr to collect alkaloids accumulated within the internal
cells. These chloroform and methanol extracts were evaporated by vacuum centrifugation using
a SPD SpeedVac (Thermo Savant). The dry samples were resuspended in 500 ~L (chloroform
extracts) or 1-3 mL (methanol extracts) of methanol and filtered through 0.22 ~m PALL filter
(VWR) before UPLC-MS analysis.
2.3.2 Alkaloid analysis
Thin-layer chromatography (TLC) was performed on Polygram Sil G/UV254 (Macherey
Nagel and Co.) developed with ethyl acetate/methanol, 90:10 vivo Silica gel plates were
visualized under UV light or after treating with CAS (1 % eerie ammonium sulfate in 85%
phosphoric acid) spray reagent. An ACQUITY UPLC system (Waters) equipped with a Single
Quadrupole Detector (SQD) mass detector and a photo diode array (PDA) was used for alkaloid
analysis. The analytes were separated using an ACQUITY UPLC BEH C18 column (1.0 x 50 mm
Ld., 1.7~m, Waters). UPLC-MS analysis was carried out with the same condition as described
previously (Roepke et 01., 2010). Chromatographic peaks were identified by the diode array
profiles and mass of each compound.
51
2.3.3 Isolation and identification of vincadifformine from Amsonia hubrichtii
A chloroform extract was obtained from 768 g of young Amsonia hubrichtii leaves and
stems by immersion in chloroform (4 L) over a 3 hr period at room temperature with periodic
shaking. After the solvent was evaporated in vacuo, the residue was suspended in 200 mL of
water:methanol (80:20), acidified to pH 2 with 10% H2S04 and subsequently washed several
times with ethyl acetate. The resultant aqueous phase was then basified to pH 12 with 10 N
NaOH and subsequently washed several times with ethyl acetate. The ethyl acetate phase was
separated from the aqueous phase and evaporated in vacuo, yielding 1.6 g of total alkaloids.
800 mg ofthe residue was subjected to silica gel column chromatography with isocratic elution
of chloroform:methanol (9:1) and the first yellow colored fractions were collected. 12 mL ofthe
colored fractions was evaporated using a SPD SpeedVac (Thermo Savant), yielding 180 mg of
hydrophobic alkaloids that contained approximately 60% vincadifformine. The residue was
subjected to preparative TLC (TLC Silica gel 60 F254, EMD) with hexane:ethyl acetate (8:2) as
the eluent. The bands which developed at Rf 0.49 were scraped and eluted with methanol. The
removal of the methanol produced approximately 10 mg of a white crystal powder. The NMR
spectrum of this powder was identical to that of a reference sample of vincadifformine (Kalaus
et 01., 1993). lH nuclear magnetic resonance (NMR) spectra were measured on a Bruker Avance
AV 600 Digital NMR spectrometer (Bruker) with a 14.1 Tesla Ultrashield Plus magnet. lH NMR
spectra (in CDCh, 600 MHz) {5 (ppm): 0.58 (3H, m; C2o-CH 2CH3), 3.2 (3H, s, COOCH 3), 6.8-7.3 (4H,
m; aromatic H), 8.9 (lH, br s; indole NH).
52
2.3.4 Crude protein preparation and enzyme assays
Leaf epidermis-enriched and whole leaf extracts protein extracts were prepared as
described previously (Murata and De Luca, 2005; Levac et al" 2008) with minor modifications
for each plant organ. The protein concentration was determined using a protein assay kit (Bio
Rad). TDC assays were performed in 200 ~L reaction mixture containing buffer (100 mM Tris
HCI, pH 8.01 14 mM 2-mercaptoethanolL 5 ~L of crude protein extract, lmM pyridoxal
phosphate and 6.25 ~M (0.06 ~Ci) [3_14C] L-tryptophan (Moravek). After incubation at 30 DC for
1 hr, the reaction was terminated by adding 30 ~L of 10 N NaOH. The products were extracted
with 500 ~L of ethyl acetate, then 50 ~L of ethyl acetate extracts were mixed into 5 mL of
SCINTISAFE cocktail (Fischer Scientific) and radioactivity was detected using a Beckman LS 6500
scintillation counter.
2.3.5 Construction and sequence analysis of cDNA libraries
V. minor and T. elegans EST libraries were established as described previously (REFBMC
paper). Total RNAs were extracted from young V. minor leaves and roots and T. elegans leaves
using Trizol (Invitrogen) according to the manufacturer's instruction. Double strand cDNA
libraries were prepared with the optimized protocols and sequenced on a Roche 454 GS-FLX
Titanium platform (Roche) and an Iliumina Genome Analyzer IIX platform (I\lumina) at McGill
University and Genome Quebec Innovation Centre. After assembling and annotating with the
optimized software programs, sequences were archived in the MAGPIE software
package(http://magpie.ucalgary.ca/magpie/) at University of Calgary. Reverse transcription was
performed using AMV Reverse Transcriptase (Promega) according to the manufacturer's
instruction and obtained cDNAs for following experiments.
2.3.6 Real-time quantitative peR
S3
The TOC and STR mRNA transcripts were quantified by real-time quantitative PCR using
iTaq SYBR Green Supermix with ROX (Bio-Rad) according to the manufacturer's instruction. The
real-time quantitative PCR was performed in triplicate with a 25 ~L reaction mixture containing
150 nM of each primer, 12.5 ~L iTaq SYBR Green Supermix with ROX and 1 ~L (80 ng) of cDNA
under the following conditions: 95 DC for 3 min, then 40 cycles of 95 DC for 10 sec, 55 DC for 15
sec and 72 DC for 30 sec. Primer concentrations, annealing temperatures, and cycle numbers
were optimized for each primer pair as follows: VmTOC-RT-F 5'-, VmTOC-RT-R 5'-, VmSTR-RT-F
5'- , VmSTR-RT-R 5'-, VmACT-RT-F 5'-, VmACT-RT-R 5'- , TeTOC-RT-F
5'-GATIGTGATGGATIGGTTTGCTC-3', TeTOC-RT-R
5'-TIGACTCGCTGGTGGTGTIC-3', TeSTR-RT-F
5' -CCCTCCACCAAAGAAACAACA-3', TeSTR-RT-R
5'-CAAGAACTCGGCCACAAGAAC-3', TeUBQ-RT-F
5'-TCTIACTGGCAAGACCATCACA-3', TeUBQ-RT-R
5'-TGCCAGCGAAAATCAACC-3'. The expression levels of each target gene were analyzed with
the Bio-Rad CFX Manager Software (Bio-Rad), and normalized to the housekeeping gene using
the 2-MCt method (Livak and Schmittgen, 2001).
S4
2.3.7 Molecular cloning and functional characterization
Full length ORFs for TOC and STR were amplified using gene specific primers as follows:
VmTOC-ORF-F 5'- VmTOC-ORF-R 5'-, VmSTR-ORF-F 5'-, VmSTR-ORF-R 5'-, TeTOC-ORF-F 5'
GAAAATGGGCAGCATIGATI-3' , TeTOC-ORF-R 5'-GCTCACTICAGGCTICCTIG-3' , TeSTR-ORF-F
5'-CAGTCTGAACATGGCAAACTC-3' , TeSTR-ORF-R 5'-CAATATGTCCGTCCATGACTCT-3'. PCR
products were cloned into the pGEM-T easy vector (Promega) and were sequenced to verify
their identities. Inserts were then mobilized to the pET 30b vector (Novagen) by digestion with
appropriate restriction enzymes and transformed into E. coli (DE3) pLysS cells. Transformed
cells were cultivated at 37 DC until an 00600 of 0.6 and incubated at 25 DC overnight. After
harvesting recombinant cells and obtaining the soluble proteins, enzyme assays for TDC and
STR were performed as described previously (De Luca, 1993). The identity of strictosidine
produced in the STR assay was confirmed by converting it to strictosamide (strictosidine lactam)
with 10 N NaOH. UPLC-MS analysis was carried out with the same equipment and column for
alkaloid analysis. The solvent systems for enzyme assay containing A (methanol:acetonitrile: 5
mM ammonium aetate (6:14:80}) and B [methanol: acetonitrile: 5 mM ammonium aetate
(25:65:10)] formed with the following linear gradient at 0.3 mL/min in between the time points:
0.2 min 1% B, 1.0 min 12% B, 2.5 min 35% B, 2.8 min 50% B, 3.2 min 35% B, 3.8 min 30% B, 4.1
min 12% B, 5.0 min 1% B. The mass spectrometer was operated with an ESI ion source of
positive ionization mode. A capillary voltage of 3.0 kV, cone voltage of 30 V, cone gas flow of 2
L/hr, desolvation gas flow of 650 L/hr, desolvation temperature of 350DC, and a source
temperature of 150DC were applied. Conversion of tryptophan to tryptamine was verified by
the diodearray profile, mass (mlz 161) and retention time (0.96 min) compared to authentic
standard. Production of strictosamide from tryptamine and secologanin was verified by the
diode array profile, mass (m/z 499) and monitoring the tryptamine reduction.
2.3.8 Tissue fixation and embedding
55
The first pair of leaves from V. minor and T. elegans were fixed in FAA (50% ethanol, 5%
acetic acid, and 5% formaldehyde), dehydrated through an ethanol and tert-butanol series and
then embedded in Paraplast Xtra (Fisher Scientific) as described previously (St-Pierre et al.,
1999; Murata and De Luca, 2005). The embedded samples were sectioned into 10 ~m thick
slices using a rotary microtome (Reichert Jung) and sections were carefully spread onto slides
previously treated with 2% (v/v) 3-aminopropyltriethoxysilane (AES; Sigma) in acetone,
incubated for 24 hr at 400( and stored at 4°( until use. Serial sections were deparaffinized by
two incubations of 15 min each in xylene before rehydration in an ethanol gradient series up to
diethylpyrocarbonate-treated water.
2.3.9 In situ hybrizidation
The in situ RNA hybridization was performed as described previously (St-Pierre et al.,
1999) with some modifications. Full-length of VmTDC, TeTDC, VmSTR and TeSTR in the pGEM-T
easy vector (Promega) were used for the synthesis of sense and antisense digoxigenin-Iabeled
RNA probes using DIG RNA Labeling Kit (SP6/T7, Roche) according to the manufacturer's
instructions. The RNA probes were submitted to partial alkaline hydrolysis for 20 min at 60°C.
After prehybridization, hybridization of the digoxigenin-Iabeled RNA probes and washing, the
slides were stained with alkaline phosphatase-conjugated antidigoxigenin antibodies (Roche).
For color development, the conjugates were visualized by incubation for 3 hr (V. minor) and 5
hr (T. elegans) in 5-bromo-4-chloro-3'-indolylphosphate (BClP) and nitro blue tetrazolium
chloride (NBT).
2.4 Results
2.4.1 Five Amsonia species accumulate their MIAs exclusively in their leaf surface.
56
The genus Amsonla (bluestars) contains 22 species, with the majority found in a wide
range of habitats throughout North America, except for A. orientalis (native to Mediterranean)
and A. e/liptica (native to Eastern Asia). Like other Apocynaceae plants, several MIAs have been
isolated from A. elliptica and A. tabernaemontana in the past several decades (Aimi et al.,
1978). Leaves from Amsonia orientalis, A. ciliata, A. tabernaemontana, A. hubrichtii, A. i/lustris
and A. jonesii were harvested and dipped in chloroform to obtain leaf surface waxes and other
chemicals. When the chloroform soluble fractions were separated by thin layer
chromatography (TLC) and visualized with Ceric Ammonium Sulphate spray reagent (Figure 51),
Amsonia ciliata, A. tabernaemontana, A. hubrichtii, A. il/ustris and A. jonesii showed identical
simple patterns of 2 MIAs that were tentatively identified as strictamine (blue spot, Rf 0.04)
and vincadifformine (blue spot, Rf 0.65) by UPLC MS. In contrast 3 spots (Rf 0.04,0.11 and 0.20)
were detected in A. orientalis extracts and the major compound was tentatively identified as
isoeburnamine (orange spot, Rf 0.20) (Liu et al., 1991). These preliminary results clearly showed
that all Amsonia species irrespective of their geographic origin appear to secrete their MIAs
onto the leaf surface. More detailed studies were performed with Amsonia hubrichtii by
A
E
~ « Q) :>
vincadirrormine ~
RT = 6.41 min ,I
I ~ a;
a: )l,d':'c", ~ ""~_"JL __ _ 2 3 4 5 6 7 8 9 10
Retention time (min)
B
226 CIlJ en ! i 'I 297 /\ 327 <: ,l,! (.J \
~ 1 \ i \\' El i \ I &! \/ \
:, ••. ,....--, nm 250 350 450
100 339
o ' mlz 200 400 600
% of vincadifformine on chroloform extracts
% of vincadifformine on methanol extracts
Flowers 1 st stage leaves 2nd stage leaves 3rd stage leaves 4th stage leaves stems
99.3 ± 0.93 100 100 100 100 100
0.66 ± 0.93 o o o o o
57
Figure 2.2: Amsonia hubrichtii secretes vincadifformine into leaf surface. (A) UPLC-MS chromatogram of the chloroform extracts from 2nd stage leaves. The major peak was tentatively identified by their absorption and mass spectra as vincadifformine (RT = 6.41 min, m/z = 339) and by lH-NMR (Kalaus et al. 1993). (B) Distribution of vincadifformine content in different A. hubrichtii organs. Chromatographic peak areas of vincadifformine on the surface of flowers, leaves of different ages and stems were measured by UPLC-MS. The experiment for each organ was performed in quintuplicate.
58
collecting leaves (from 4 separate stages of growth: the youngest leaves at stage 1 to oldest
leaves at stage 4), stems and flowers that were extracted with chloroform to harvest leaf
surface MIAs and chloroform stripped plant parts were then extracted for MIAs as described in
experimental procedures. UPLC-MS analysis identified vincadifformine (Figure 2.3, 1), based on
its mass (339 m/z) and its absorption spectrum (Figure 2.2A) as the major MIA occurring on the
surfaces of flowers, stage 1 to 4 leaves and stems, while the methanol extracts contained
virtually no MIAs (Figure 2.2B). Vincadifformine was purified and identified by 13C H-NMR
analysis as described in experimental procedures. These results suggest that the biosynthesis of
MIAs in Amsonia species from different geographic origins takes place in or near the epidermis
of different above ground plant organs and that secretion of MIAs is the default pathway that
leads to the exclusive accumulation of vincadifformine on the surface of plant organs (Figure
2.2) together with waxes and other surface molecules such as triterpenes (Roepke et 01., 2010).
2.4.2 Vinca minor accumulates plumeran- and eburnan-type MIAs on the leaf and stem
surfaces.
Vinca minor L. (lesser periwinkle) is a popular fast-growing ground cover that is distributed
throughout middle and southern Europe to the Caucasus. This herb has been known to humans
for thousands of years for its properties in the treatment of circulatory disorders and to
stimulate brain metabolism. More recently it has been studied extensively for its potential use
to treat high blood pressure. Vinca minor is closely related to Catharanthus roseus and
phytochemical studies have identified more than 50 MIAs, including vincamine and
vincadifformine (Farananika et 01., 2011) in this species. Metabolites extracted by chloroform
S9
A 1 I B
" of 1.1IA 011 " of MIA on 3 ,5 CHCI \ Cxl ' <1cls r, cOH cxlmcl~;
I 4 V,nC;Jm,nc 2 98 94 1 06
« I
Mlnov,nclntnc (3) 9943 0 57 a> Lochncna nc (<\ ) 96.42 3 58 ~ ro '111IC;\(:, llO'11I nc (1) } 8924 ¢i Ermlcclllc (1')
10 76 0::
Erv,n,dllllnc (5) 98 16 1 84 Vlllc..'ITl,noretnc (6) 9927 0 73
-- R
2 1 3
~' I 3 Il , (~ . a Ii H ) C~t
r 4 R, Rl ~ R. ) • ti 0' 7.0 -.:::: I H (v 1 fl· Ft.,. R};:I J1
.1 ~ 4 1\ h f ~ ~ ;{ 1 "
R !aOCtf l Rl~ k H ~ H 5 fl , 'r RJ It R]"O a> COOCH ~ ro \1 r 6 059/ ¢i
0:: , , , t I I " \ .: . . . II COCC
•. j I A
""-C .. COOCH
2 3 4 5 6 7 8 2 6
Retention time (min)
C 0 20 Ide sIr
1 G 1 B
lP2 1 J , 5
~' 5 , 2 ' : "0 , z E '0 .e
~ ~10 o B • ;! 08 u 06
06 « l em !i O~
O ~ n 02 02 D 0 .J 00 = [] = 00 CJ III , LP7 IP3 fH LPI LP2 LP3 RT lPl LP2 lP3 RT
Figure 2.3: Vinca minor secretes most MIAs into leaf surface. (A) UPLC-MS chromatogram of chloroform extracts from 1st pair of leaves at 330 nm (upper panel) and 280 nm (lower panel). The major peaks were tentatively identified by their absorption and mass spectra as vincamine (2, RT = 3.32 min, m/z = 355), minovincinine (3, RT = 4.47 min, m/z = 355), lochnericine (4, RT = 5.12, m/z = 353), vincadifformine (I, RT = 6.38 min, m/z = 339), ervinidinine (5, RT = 6.43, m/z = 353) and vincaminoreine (6, RT = 6.91, m/z = 355). (B) The % of each MIA found on the surface in Vinca minor 1st leaf pairs. This was estimated by measuring UPLC chromatographic peak areas of each MIA on the leaf surface compared to those ofthe methanol extract of whole leaves after stripping their surfaces with chloroform. (C) Distribution of TDC activity in Vinca minor in leaves of different ages (LP1 to LP3) and roots (RT). Assays containing crude extracts were incubated for 1 hr in the presence of [3_14C] L-tryptophan and processed as described in materials and methods. Each point represents the mean of three biological replicate assays ± SD. (D) Real-time PCR quantification of TDC and STR in leaf pairs 1, 2 and 3 and in roots of Vinca minor. ~-actin was used as a reference for the quantitative RT-PCR. Each data point represents the mean of triplicate measurements ± SD.
60
dipping of leaf pairs 1 to 3 (Figure 2.3) and stems showed almost identical MIA metabolite
profiles that included vincamine (2), minovincinine (3), lochnericine (4), vincadifformine (1),
ervinceine (1'), ervinidinine (5) and vincaminoreine (6) as predicted by their UV absorbance and
UPLC MS profiles (Figure 2.3A) (Malikov and Yunusov, 1977). The majority (89 to over 99 %) of
the plumeran- and eburnan-type MIAs of V. minor appeared to be secreted to the leaf surface
(Figure 2.3B) and only low levels of a few MIAs were detected in methanol extracts.
2.4.3 MIA biosynthetic enzymes are preferentially expressed in young developing leaves in
V. minor.
5ince MIA biosynthesis is highly regulated during plant growth and development in
Catharanthus roseus (Murata and De Luca, 2005; Levac et al., 2008; Murata et al., 2008), this
was investigated in V. minor by measuring TOC enzyme activity together with TOC and STR gene
expression profiles in leaves of different ages. Analyses of TOC enzyme activity showed that
while the youngest leaves (Figure 2.3C, Leaf Pair 1) were most active, leaf pair 2 was only 22 %
as active and leaf pair 3 displayed no TOC activity. A V. minor E5T library prepared from mRNA
extracted from leaf pair 1 was submitted to large scale 454 sequencing and the complete
sequences of VmTOC and VmSTR were obtained by homology searches using Catharanthus
genes as queries (Figure 52 and 53). Real time peR analysis showed that VmTOC and VmSTR
gene expression was strictly limited to leaf pair 1 when compared to the results obtained in leaf
pairs 2 and 3 (Figure 2.30). Analysis of roots suggested that while VmSTR expression in roots
was similar to the levels found in leaf pair 1, expression of VmTOC was inSignificant and this
A CHCI3 e)(tracts (a ) LP1 ,8
I
II 10
9 • --' .... ..-. ... (b ) LP2
8 « ! '" ~ iii LP ' LP! c; 11 a:: 7 10
'\." 9 . 13 -(cl LP3 ,
8
7 - 9 10 11
I I 13
2 3 4 5 G 7 8 Retention time (m in)
c 0 2~ • S
,ft ;>0 • • "?
s I ' 0 ,5 E .=
, 0
>- ' 0 0 8
" 0 0 6
~ c .
0 O~
U 00 lP1 1.f'7 l P3
« C!> ~ iii QJ a::
tP'
9 , 0
MeOH extracts (d) LP2
B
, 2
7 ., \ 15
1_-3 4 5 G 7 8
Retention t ime (rmn) 9 , 0
of nlCt.lbor h~ In CHCI J (! )(tr.J c:: tc;
I\p;>.tr l. ne (7 ) 7729 ± 20 28
Vob .I$,nc (8 ) 99 7 3 = 0 .: 7
T;thf>rnaemontnnlnc (9 ) 9j Of) !': 9 20
/\I.,unmmlhno N {ot ) o x t!c ( 10 ) 97 16 !. 123
Dcoxyvoblus"", ( 11 ) 1110
Conoph ylltno ( 12) 2·: 78 = 1-1 b 9
unknow n ( 13) 3039! 9 ~ 8
C or.ophylltd ,ne (14 ) 1 -1 6 ! 1 83
un lo.. nO\'. n ( 15) ..; 41 ! 368
19 I t.tc s fT
, 6
•• , ~ 10
U 06
06
O.
O~
00 u 0 0 o o LP l L P:' LPl LP' LPZ LP3
61
Figure 2.4: Tabernaemontana elegans secretes MIAs into leaf surface except for some dimers.
(A) UPLC-MS chromatogram of the extracts from leaves of different ages. Chloroform extracts
of leaf pairs 1 (a), 2 (b), 3(c) and methanol extract of leaf pair 2 (d). The major peaks were
tentatively identified by their known absorption and mass spectra as apparicine (7, RT = 3.06
min, m/z = 265), vobasine (8, RT = 3.71 min, m/z = 353), tabernaemontanine (9, RT = 4.14, m/z = 355), akuammiline N (4}-oxide (10, RT = 4.57 min, m/z = 411), anhydrovobtusine (II, RT =
5.31, m/z = 702), conophylline (12, RT = 5.54, m/z = 796), unknown (13, RT = 6.10, m/z = 837),
conophyllidine (14, RT = 6.42, m/z = 780) and unknown (IS, RT = 8.61 min, m/z = 793). (8) The
% of each MIA found on the surface of 2nd T. elegans leaf pairs. This was estimated by
measuring UPLC chromatographic peak areas of each MIA on the leaf surface compared to
those of the methanol extract of whole leaves after stripping their surfaces with chloroform.
The experiment represents data obtained from 3 biological replicates. (C) Distribution of TDC
activity in T. elegans leaves of different ages (LP1 to LP3). Assays containing crude extracts were incubated for 10 minute in the presence of [3_14C] L-tryptophan and processed as described in
materials and methods. Each data point represents the mean of three separate assays ± SD. (0)
Real-time PCR quantification of TDC and STR in leaf pairs 1, 2 and 3 of T. elegans. Ubiquitin was
used as a reference for the quantitative RT-PCR. Each data point represents the mean of
triplicate measurements ± SD.
62
profile was consistent with the lack of MIAs occurring in the roots (Figure 2.3B). These results
clearly suggest that as in C. roseus, MIA biosynthesis takes place in early stages of leaf
development in V. minor and that the majority of MIAs being produced are secreted to the leaf
surface as leaf expansion and maturation is completed.
2.4.4 Tabernaemontana elegans accumulates the majority of MIAs on the leaf surfaces.
Tabernaemontana elegans (milkwood) is a small tree that grows up to 15 m tall,
originating in tropical east Africa, South Africa and Swaziland that has been used in traditional
medicine for treating heart disease, cancer, pulmonary disease and tuberculosis (Neuwinger,
2000). Phytochemical analyses ofthis traditional medicinal plant have characterized at least 66
MIAs (Pratchayasakul et al., 2008) that include a number of monomers and several dimers
(Figure 2.1). In contrast to V. minor (Figure 2.3C) and C. rose us that produce rather small leaves,
T. elegans leaves are much larger (Figure 2.4Aa, inset). Leaf pairs 1, 2 and 3 harvested from 4
month-old T. elegans plants were dipped in chloroform and stripped leaves were extracted in
methanol to harvest MIAs. The surface of leaf pair 1 contained vobasine (8),tabernaemontanine
(9) and akuammiline-N-(4)-oxide (10) (Figure 4Aa, B), while leaf pairs 2 (Figure 2.4Ab) and 3
(Figure 2.4Ac) showed more complex MIA profiles containing apparicine (7) and
deoxyvobtusine (11). While extracts from chloroform stripped leaves contained most of MIAs 7,
8,9, 10 and 11, the dimeric MIAs conophylline (12) and conophyllidine (14) were found inside
these leaves (Figure 2.4Ad) (Majumder et aI., 1974; Beek et al., 1984; Kam et al., 1993). Ibogan
type alkaloids, such as tabernaemontanine (9), dregamine and pericyclivine, were also
63
identified from the root surface extracts (data not shown) (Majumder et 01., 1974).
Interestingly, more than 90% of the vobasine (8), tabernaemontanine (9), akuammiline-N-(4)
oxide (10) and deoxyvobtusine (11) were detected from chloroform extracts, while only 25% of
the conophylline (12) and 1.5% of conophyllidine (14) were extracted from chloroform (Figure
2.4B). These results indicate that formation of some dimers in T. elegans may restrict secretion
of the dimer to the leaf surface as already described for C. roseus (Roepke et 01. 2010). The
expanded MIA profile of older leaves suggest that MIA biosynthesis in T. elegans may take place
over a broader range of leaf developmental stages than those of V. minor (Figure 2.3C) or C.
roseus (De Luca, 2011; Facchini and De Luca, 2008).
2.4.S MIA biosynthesis is regulated differently in Tabernaemontana elegans compared to
Vinca minor or Catharanthus roseus.
Analyses of TDC enzyme activity showed that older leaves (leaf pairs 2 and 3) were quite
active (Figure 2.4C) compared leaf pair 1. Unlike V. minor, the TeTDC activities gradually
decreased from 21.4 to 8.9 to 3.1 pmol/Ilg in leaf pairs 1, 2 and 3, respectively (Figure 2.4C),
while TeTDC expression was quite stable (Figure 2.4Dtdc) and TeSTR expression gradually
decreased with leaf age (Figure 2.4Dstr).This is of particular relevance given the slow rate of
development and expansion of T. elegans leaves that reach up to 20 cm in length (Figure 2.4A,
inset) compared to those of V. minor (2 cm) (Figure 2.3C, inset) or C. roseus (4 cm). A T. elegans
EST library prepared from mRNA extracted from leaf pair 1 was submitted to large scale 454
sequencing and the complete sequences of TeTDC and TeSTR were obtained by homology
A (a) Trl'Jltamine
i\ I \ I \
RT = 0.96 min
I ' 1tr._ - "
! Ii \\ (\ J ; I i ,. , ! i
~ ~ (c r .... , - . J . - j ..... - -_ .• - .... -
.!!! : . ) i \ \ & ' , '\\ }f : i\ 1\ .'
i-. _ .... _ .. .1 \1 \ .. ..--"': '- ..... J .,' \ .... ~ .. . (d) II
II il 1\
f, j t ,'\! :
-!_\:._\.~. - - --- --0.5 1.0 1.5 2.0
Retontion time (min)
B 100
(al ; i
A. '"' !' I l il\ /11 0 !:I~l ll' l (; i. I .' 200 -100
l .l II' I \ . , Ii _ , J '-~'-- . _ _ _
:'1 1; ! . 'lll! .1." . L U mt:l 600 !lOO
(b) II j 1\ f!
j JUUi'L-__ _ (e) ~
,t Ii II ' II I!
.r \ II i .... . ~~. !. ______ _ 123 4 5
Retention time (min)
64
Figure 2.5: Functional verification of Vinca minor and Tabernaemontana e/egans recombinant TOCs and STRs expressed in E. coli. (A) E. coli cell-free extracts expressing recombinant TeTOC
(b) and VmTOC (c) converted tryptophan to tryptamine (RT; 0.96 min) compared to those expressing empty vector (d). Chromatography of tryptamine standard is in panel (a). (B) E. coli
cell-free extracts expressing TeSTR (a) and VmSTR (b) convert tryptamine and secologanin to the strictosidine by-product strictosamide (RT = 2.33 mini m/z = 499) compared with those expressing empty vector (c).
searches using Catharanthus genes as queries (Figure 52 and 53). Real time PCR analysis
showed that TeTDC and TeSTR gene expression (Figure 2.40) was well correlated with the
expanded TOC enzyme activity (Figure 2.4C) and MIA profiles (Figure 2.4Aa-d, B) that were
observed with leaf age and confirm that MIA biosynthesis is regulated differently in T. elegans
compared to V. minor or C. raseus.
65
In order to prove the biochemical functions of TeTDC, VmTDC, TeSTR and VmSTR, their
corresponding ORFs of were cloned and expressed in E. cali. Recombinant TeTOC (Figure 2.5Ab)
and VmTOC (Figure 2.5Ac) enzymes converted tryptophan (Rt, 0.64 min) into tryptamine (Rt,
0.96 min) compared to bacterial extracts expressing the empty vector (Figure 2.5Ad).
Recombinant Te5TR (Figure 2.5Ba) and Vm5TR (Figure 2.5Bb) enzymes converted secologanin
(Rt, 1.46 min) and tryptamine (Rt, 0.92 min) into strictosamide (Rt, 2.33 min) compared to
bacterial extracts expressing the empty vector (Figure 2.5Bc).
2.4.6 Biochemical and in situ hybridization localizes TDC and STR gene expression close to
the upper and lower leaf epidermis of T. elegans and V. minor
The large scale secretion of MIAs to the surfaces of Amsonia species, T. elegans and V.
minor strongly suggest that the MIA pathways in these species are expressed in epidermal or
associated cells, as shown previously in C. roseus where in situ hybridization studies showed
that CrTDC and CrSTR genes are preferentially expressed in epidermal cells of young growing
leaves, stems and flower buds (5t-Pierre et 01., 1999). Whole and epidermis enriched 1st leaf
pairs of V. minor were extracted and assayed for TOC activity (Figure 2.6A). The specific activity
of TOC was 5-fold greater within leaf epidermis-enriched extracts compared with whole leaves
Vinca minor A
>. .:: 3 E 30 ;0 u ..... 'lie u .-;S 20 .- 0 u "-III Q. Q.Cl
(/) -u=== 10 Q 0 .... E
Q.
Whole leaf
-55 Kda
Leaf epidermis
Tabernamontana e/egans
66
E
Figure 2.6: Biochemical and in situ localization of tdc mRNA in young developing leaves of Tabernanamonta elegans and Vinca minor. (A) Leaf epidermis-enriched and whole leaf extracts of Vinca minor were assayed for TOC enzyme activity and for TOC antigen abundance (inset) within each preparation. Paraffin-embedded serial longitudinal 10 Sm sections were made from 2-3 cm long leaves of T. elegans and 6-10 mm long leaves of V. minor. The slides containing V. minor (B, C) and T.elegans (0, E) sections were hybridized with antisense (B, D) and control sense (C, E) digoxigenin-Iabeled TOC transcripts.
and these results were corroborated when extracts were submitted to 505 PAGE,
electrophoretic transfer to PVOF membranes and immunoblot against TOC antibodies (Figure
2.6A, inset).
67
Very young leaves (leaf pair 1) of T. elegans and V. minar were prepared for in situ RNA
hybridization studies to localize transcripts of VmTDC and VmSTR genes. In situ RNA
hybridization of V. minar longitudinal sections using VmTDC antisense probes suggest that
palisade mesophyll cells as well as those from the upper and lower leaf epidermis preferentially
express TOC (Figure 2.6B)' since no hybridization signal was observed with VmTDC sense probes
(Figure 2.6C). The VmSTR antisense probes hybridized with varying intensity to several leaf cell
types including the palisade and spongy mesophyll as well as the upper and lower leaf
epidermis (Figure 54A), while sense probes did not (Figure 54B). In situ RNA hybridization of
longitudinal sections using TeTDC antisense probes (Figure 2.60) localized TDCtranscripts to
the upper and lower leaf epidermis when compared to sections treated with TeTDC sense
probes (Figure 2.6E) that produce no signals. The TeSTR antisense probes (Figure 54C) hybridize
with palisade mesophyll cells together with those of upper and lower leaf epidermis, while
TeSTR sense probe did not (Figure 540). Together (Figures 2.6A-E &Figure 54) these results
suggest that the upper and lower epidermis of V. minar and T. elegans could be important sites
of MIA biosynthesis for alkaloids that subsequently accumulate on the plant surface, but the
results do not eliminate other cell types in the leaves that might be involved.
68
2.5 Discussion
The Apocynaceae family is one of the largest angiosperm families being composed of
over 5000 species found mainly in tropical and subtropical areas around the world. Many
species from this family grow as small or large forest trees or as climbing vines attached to
trees, shrubs or other physical structures. This adaptability combined with their capacity to
biosynthesize many different biologically active secondary metabolites has allowed members of
this family to occupy a range of habitats that has contributed to their biodiversity and
ecological success. The Apocynaceae also differ from other families in their order (Gentianales)
since they accumulate latex in specialized cells known as laticifers, where MIAs, cardiac
glycosides and various other secondary metabolites are assumed to accumulate. The MIA
biosynthetic enzymes preferentially expressed in C. roseus leaf epidermis encoded by LAMT,
SLS, TOC, STR, SGO, T16H and 160MT (De Luca, 2011; Facchini and De Luca 2008), the exclusive
accumulation of catharanthine as exudates on the surface of the plant (Roepke et aI., 2010) has
raised the possibility that specialized epidermal biosynthesis and secretion of MIAs to the
surface may be quite common among the MIA producing members of the Apocynaceae.
Specialized cells for MIA biosynthesis coupled by surface secretion has also been suggested for
camptothecin biosynthesis in glandular trichomes, the surrounding epidermal cells and
adjacent spongy parenchyma idioblasts (Valletta et al., 2010). The present study has expanded
this investigation to Vinca minor from Eurasia, Tabernaemontana elegans from Africa and
several Amsonia species mostly from North America to suggest that the biosynthesis of MIAs in
<Surface>
\ ' )..: --J
r.alhamnlhlne
tlyp:qJhan 1'" ,, ) ___ . .... ncadiffcrmine -+ oNln:clno
I TOC tX~l..J ~ vol.oluson"
.. . SIt< , _ • .,. .. AJ -..... &' ... ,. ........... ) .. tr;'lltamllle y strF s.dne - --. .:: J,,,"., --_..... '" J.. ~ ! . __
~ \ ta!>orsonino (. ., J ....... / '')' ) .1. I '"' 1 -.. ......~..... ' sccolo~an in A-. '" - , • T16H :.' ~"'. • ..... ~ J.- L ."
f ~ :~ ;. 16-hyd'o~ytabersDl1 in8 lochnerlcine '" I·-i ....
SLS /0 " Y • j , ,,, t, I.AMT rl I I 160MT • "",,1"5"""""
.. -' '''' NMT ' G·hyuroxylochnericinc
t 1 c~l~orunlhlno • <Epidermis>
• '110HGO !! 0411 ~ 1 <Mesophyll> G~ OM :
geraniol t
~'PAP> LS"-'r t . ""'~O') e:eX ~.' X ,) -.' H ,t tl .~ ~, ,,, ) .' ~c tt ;t. u'" ;?":( .
!1tf."1 \:Otx;ttl 11.":..., c<.;o :.!t l
""Ih~ranth'.no dC~!, 16-hydroxytaborsonlno laberhanlno 16-hydrnxytor.llnericlne -~ U I v,n rlnO I . II j
:....----,+--'. + ,n, \ + .(1 \ V/ COOC" 9V/<~''''
vlI1blasbne
'~'? II .. ... ..; ::, 11 0 i:UUClh =: -fJ
~t.H .. It I
conophyakJlne r;) uJnophylrrne f
'", 55:'(, "OV---C(~UH MIL-if ~n I j to:~"'~)""i(Y
"""{'l ' C(A:CH, ~o;.u I"" ... ":\}'-.Hl
69
Figure 2.7: Model for the biosynthesis and secretion of MIAs in leaves of the Apocynaceae. The leaf epidermis may to be the site of MIA assembly in the Apocynaceae since several Catharanthus and Amsonia species as well as those of V. minor, and T. e/egans secrete and accumulate their MIAs (catharanthine, vincadifformine, ervinceine, lochnericine and vobtusine) on the plant surface. However some MIAs (, vindoline, vinblastine, conophyllidine and conophylline) occur mostly within the leaves and are assembled by processes that remain to be described. In C. roseus, IPAP cells whose are responsible for the formation of 10-hydroxygeraniol as suggested by the preferential expression of G10H (geraniol-10-hydroxylase) and 10HGO (10-hydroxygeraniol-oxidoreductase) in this cell type. An uncharacterized intermediate is transported from the IPAP cells to the leaf epidermis the last 2 steps (LAMT; loganic acid O-methyltransferase and SLS; secologanin synthase) in secologanin biosynthesis are preferentially expressed, as are Toe (tryptophan decarboxylase), STR (strictosidine synthase), T16H {taberson ine-16-hyd roxylase L 160MT (16-hyd roxytaberson ine-16-0-methyltransferase) and possibly NMT (16-methoxy-2,3-dihydrotabersonine-N-methyl-transferase). Since the last 2 steps in vindoline biosynthesis (04H desacetylvindoline-4-hydroxylase and OAT deacetylvindoline- 4-0-acetyltransferase) have been localized to specialized mesophyl idioblasts and laticifers, transport of a late vindoline pathway intermediate from the leaf epidermis must take place. The dotted arrows indicate uncharacterized reactions in different plant species. The wide arrows indicate the putative transportation of MIAs from the epidermis to the leaf surface or to leaf mesophyll.
70
epidermal cells and their secretion to plant surfaces may have evolved as a common feature in
MIA-producing members of the Apocynaceae.
Initial qualitative studies using simple TLC combined with CA5 spray reagent (Figure 51)
demonstrated that the leaf surfaces of Amsonia orienta/is, A. ciliata, A. tabernaemontana, A.
hubrichtii, A. iIIustris and A. jonesii accumulate the majority of the MIAs that they produce,
while the leaves that contain laticifers exude large amounts of latex upon wounding that is
virtually devoid of MIAs. The results obtained with these 5 species suggest that the 22 known
Amsonia species probably secrete their MIAs to the plant surface. This is corroborated by the
detailed and more quantitative studies that were performed on Amsonia hubrichtii plant
material from various stages of growth and development that demonstrates its major MIA,
vincadifformine, is virtually all secreted to the plant surface (Figure 2.1A, B). These studies
clearly suggest that the plant epidermis of Amsonia species may be specialized for MIA
biosynthesis and secretion.
Remarkably, the plant surface of V. minor accumulated virtually all of the MIAs
produced with the profiles from leaf pairs 2 and 3 being virtually identical to the profiles shown
in Figure 2.3A, B for leaf pair 1. Enzymatic analyses ofTOC together with the expression profiles
of VmTDC and VmSTR genes suggested that young leaves are most active in MIA biosynthesis
(leaf pair 1, Figure 2.3C and 0) and that leaf epidermal cells (Figure 2.6 and Figure 54) may be
primary, but not exclusive sites for expression of these pathways.
T. e/egans secretes MIAs of increasing complexity on the leaf surface when comparing
the profiles from leaf pairs 1 to 3 (Figure 2.4Aa,b,c,d; B). In contrast to the results obtained with
V. minor, TeTOC enzyme activity, as well as TeTDC and TeSTR gene expression decreased
71
gradually with leaf age (Figure 2.4C, D). In situ hybridization studies also suggested that leaf
epidermial cells (Figure 2.6B and C) are preferred sites of MIA gene expression. These
observations validate the use of simple chloroform dipping to identify MIAs that accumulate on
the surface of leaves/stems and that the exclusive accumulation of catharanthine in the leaf
wax exudates in four separate Catharanthus species (c. roseus, C. longi!olius, C. ovolis, and C.
trichophy/lus) (Roepke et 01., 2010) is not an isolated case.
T. elegons also accumulates the dimeric MIAs including conophylline (12) and
conophyllidine (14) within the leaves (Figure 2.4Ad), while deoxyvobtusine (11) was only found
on the leaf surface (Figure 2.4Ac). The biosynthesis of conophylline (12) would require the
formation of 16-hydroxytabersonine and taberhanine precursors, while conophyllidine (14)
would be derived from taberhanine and 16-hydroxylochnericine. The biosynthesis of each
precursor involves various oxidations and in the case of taberhanine 2 separate O-methylations.
The mechanisms of dimer formation as well as those that allow some dimers to accumulate in
the leaf or on the surface in T. elegans remain to be determined. The directional transport
mechanisms of MIAs are obscure, but 16-hydroxylation might be a key step for the
transportation of plumeran-type alkaloids from epidermis to mesophyll cells. Together these
results provide strong evidence that members of MIA producing Apocynaceae have evolved
specialized MIA biosynthesis within the leaf epidermis coupled to secretory mechanisms that
allow preferential surface accumulation of MIAs (Figure 2.7).
72
2.6 Acknowledgments
This work was supported by Genome Canada, the Ontario Centers of Excellence and by
a Discovery Grant from the Natural Sciences and Engineering Research Council of Canada to V.
D. L. We are very grateful to Stephane M. Bailleul and Anais Rinfret-Pilon from the Montreal
Botanical Gardens and Lorne Fast from Niagara Parks Botanical Gardens for providing
assistance and access to different Amsonia species in their collections.
73
Chapter 3.
Cellular localization of the newly discovered UDP-glycosyltransferase S (UGTS) enzymatic step
in Iridoid biosynthesis.
Contribution: The work pertaining to the TDC enzyme assays, immunoblots and in situ
hybridization of CrUGTB in both Catharanthus raseus and Catharanthus longifolius was
performed by Elizabeth Edmunds
74
Cellular localization of the newly discovered UDP-glycosyltransferase 8 (UGT8) enzymatic step
in Iridoid biosynthesis.
Elizabeth Edmunds, Sayaka Masada Atsumi, and Vincenzo De Luca
3.1 Abstract
Iridoids are a specific group of secondary metabolites that define a class of
monoterpenes possessing a highly oxygenated pentacyclic ring associated to a glucose moiety.
Iridoids are characteristic metabolites of a wide variety of plants and have been detected in
certain insect species. Certain plants also use iridoids together with tryptamine in the
biosynthesis of monoterpenoid indole alkaloids (MIA). MIAs are among the most complex
group of nitrogen containing secondary metabolites and many are used for treating various
cancers, neurological disorders and cardiovascular conditions. The preferential expression of
10-hydroxygeraniol biosynthesis in biochemically specialized leaf internal phloem parenchyma
(IPAP) cells and the last 2 steps in secologanin biosynthesis in the leaf epidermis of
Catharanthus raseus suggests an unknown iridoid intermediate must be transported between
the 2 cell types in order to allow for the assembly of secologanin. The present study uses the
technique of in situ hybridization to localize 7-deoxyloganetic acid glucosyltransferase (UGT8)
to IPAP cells in Catharanthus /angi/a/ius. Biochemical studies with Catharanthus raseus and
Catharanthus /angi/a/ius show that tryptophan decarboxylase (TOC) enzyme activity and
protein occurs preferentially in epidermis enriched leaf extracts compared to whole leaves,
whereas desacetaxyvinda/ine 4-hydraxy/ase (04H) protein is preferentially expressed in the
whole leaves compared to epidermal extracts. Overall we demonstrated that C. /angi/a/ius and
75
C. roseus share similar organization of the biosynthesis of iridoids, which can suggest similar
traits for all Catharonthus species. These observations suggest that in the biosynthesis of the
iridoid involved in MIA production, secologanin, the steps preceding UGT8 are likely to be
localized to IPAP cells and that deoxyloganic or loganic acid are likely to be transported to the
epidermis for conversion to secologanin by loganic acid methyltransferase (LAMT) and
secologanin synthase. The similarities between iridoid and MIA biological function as anti
herbivores and the use of iridoids to produce MIAs, point towards a plausible route of evolution
of MIAs from iridoids.
3.2 Introduction
Iridoids are a specific class of monoterpenes composed of a highly oxygenated
pentacyclic ring bound to a glucose moiety that occur in a wide variety of plants and in some
specialized insect species. Iridoids have been associated with loading the apoplast to generate
osmotic potential within the phloem of plants (Voitsekhovskaja et 01. 2006). Additionally, some
iridoids have powerful antifeeding and anti-microbial properties that have been attributed to
their bitterness and ability to crosslink proteins (Konno et 01./ 1999). Lastly, a small subset of
iridoids is involved in the biosynthesis of the pharmacologically valuable monoterpenoid indole
alkaloids (MIAs). The most notable pharmaceutical MIAs are used as anti-cancer,
antihypertensive, anti-arrhythmia, or antimalarial treatments (Thomas 1961).
The anti-feedant properties of iridoids have been exploited by both plants and animals.
A very well-studied anti-feedant iridoid is the monoterpene iridoid glucoside common to the
76
tribe Antirrhineae of the family Scrophulariaceae, antirrhinoside (Beninger et al. 2008). These
studies showed that 39% of the carbon being transported in the phloem is antirrhinoside and
48% is sucrose and when fed 14C02 in the presence of light 15% was converted photosynthate
into phloem-mobile antirrhinoside. (Beninger, et al. (2007).The study suggested that the
presence of antirrhinoside in the phloem could deter sap-sucking insects from phloem feeding.
Remarkably, antirrhinoside levels in young leaves, flowers and buds can account for up to 20%
of the plant dry weight (Beninger et al. 2007). However, not all insects find iridoids to be a
deterrent. Some Lepidoptera (butterfly) lay their eggs on the leaves of iridoid producing plants
in order to protect their eggs from predators who are deterred from consuming the eggs by the
presence of iridoids in the leaves (Penuelas et al. 2006). Iridoids have been shown to
differentially affect the growth of generalist insects where reduced (Lymantria dispar L.) and
increased (Trichoplusia hObner) growth rates were observed with feeding. (Beninger et al.
2008). In other cases, some insects, such as Chrysomelina, are capable of storing iridoids
harvested from plants that they consume or they can biosynthesize their own iridoids (Burse et
al. 2007). Each of these examples show how certain insects have adapted to the presence of
iridoids in plants and suggest that similar iridoid biosynthesis pathways in plants and insects
may have appeared through convergent evolution as a result of natural selection.
Plants have evolved two pathways to produce the large variety of terpenes known to
accumulate. The mevalonic acid (MVA) pathway localized to the cytosol of plant cells generates
5 carbon isoprene units for the biosynthesis of sesquiterpenes (CiS) and triterpenes (C30),
while the methylerythritol4-phosphate (MEP) pathway localized to plastids generates 5 carbon
isoprene units for the biosynthesis of monoterpenes (Cl0), diterpenes (C20), and triterpenes
(C30) (Rodriguez-Concepcion and Boronat 2002; Taiz and Zeiger 2006).
77
While much is known about the diversity of iridoids found in plants, the biochemistry and
molecular biology of iridoid biosynthesis remains poorly characterized with regard to the genes
involved as well as the localization of each step. In the case of MIA biosynthesis 4 out of 11
enzymatic steps have the likely genes involved in the biosynthesis of secologanin from geraniol
characterized. The biosynthesis of secologanin begins with the production of the
monoterpene, geraniol, through the MEP to generate C5 isoprenoids. The monoterpene,
geraniol is derived from the condensation of two C5 isoprenoid units via the enzyme geraniol
synthase.
The plastidic specific MEP pathway (Figure 1.9), which is involved in the production of
secologanin, is initiated with the condensation of glyceraldehyde 3-phosphate and pyruvate by
1-deoxy-D-xylulose 5-phosphate synthase (DXS) to produce 1-deoxy-D-xylulose 5-phosphate
(DXP). 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR) then reduces and isomerizes
the DXP intermediate to generate 2-C-methyl-D-erythritol-4-phosphate (MEP). MEP undergoes
numerous enzymatic steps that results in the condensation with cytidine-5-0-triphosphate
(CTP) and phosphorylation by adenosine triphosphate (ATP) to form 2-diphosphocytidyl-2C
methyl-D- erythritol-2-phosphate. The cytidine nucleotide is then removed from this product
via 2-C-methyl-D-erythritol 2, 4-cyclodiphosphate synthase (MECS) to form 2-C-methyl-D
erythritol-2, 4-cyclodiphosphate (MEC). MEC undergoes numerous enzymatic steps which
essentially dehydrate and reduce it into isopentyl-pyrophosphate, otherwise known as IPP.
78
Through the use of RNA in situ hybridization researchers were able to localize the transcripts of
these characterized steps ofthe MEP pathway, DXS, DXR, MECS, to the internal phloem
associated parenchyma (I PAP) cells, as demonstrated in Figure 1.9 (Oudin et al. 2007). These
results suggest that the terpene precursor for monoterpenoid indole alkaloids is preferentially
synthesized in the plastids of IPAP cells.
The product of the MEP pathway, IPP, undergoes numerous uncharacterized enzymatic
steps to form the substrate for the initial committed step of iridoid biosynthesis, geraniol.
Figure 1.10 demonstrates the biosynthetic pathway from geraniol to secologanin, which is
initiated with geraniol being oxidized by geraniol 10- hydroxylase (GI0H) to generate 10-
hydroxygeraniol. This metabolite is then oxidized and cyclized to produce the characteristic 5-
member ring with the synthesis of the metabolite iridotrial (Jensen and Schripsema 2002).
Iridotrial is further oxidized to 7-deoxyloganetic acid. From 7-deoxyloganetic acid, there are
two proposed branches that ultimately produce loganin, as displayed in Figure 1.10. One
pathway involves the methylation of 7-deoxyloganetic acid to 7-deoxyloganetin, which is then
glucosylated to form 7-deoxyloganin and finally hydroxylated to produce loganin. The
alternative branching pathway starts off with glucosylating 7-deoxyloganetic acid into 7-
deoxyloganic acid, which is then hydroxylated to loganic acid, and finally methylated by loganic
acid methyltransferase (LAMT) to generate loganin. Loganin is finally converted into
secologanin via secologanin synthase, which oxidizes the 5-member ring (Oudin et al. 2007).
Out of all the enzymatic steps from geraniol to secologanin, only three genes, GI0H, LAMT, and
SLS, have been cloned and functionally characterized. Researchers have utilized these clones to
79
employ the valuable technique of RNA in situ hybridization to localize the transcripts of these
three steps (Burlat et al. 2004 and (Kutchan 2005).) (Figure 1.9). They were able to show that
the first step in iridoid biosynthesis, G10H, is preferentially expressed in the internal phloem
associated parenchyma (IPAP) cells, similarly to the preceding enzymatic steps, as previously
mentioned, of the MEP pathway, DXS, DXR, and MECS. The terminal steps in secologanin
synthesis, LAMT and SLS, were both localized to the upper and lower leaf epidermis of C. roseus
(Oudin et al. 2007). The previous research demonstrates the initial steps of iridoid biosynthesis
are found within the IPAP cells whereas the terminal steps show preference within the
epidermis where the products of the MEP pathway converge with the products of the shikimate
pathway as summarized in Figure 1.9. There are numerous intermediate enzymatic steps that
have yet to be characterized, genes cloned and transcripts localized. Overall, one can suggest,
that at some point along this pathway, there is a transport mechanism that must be involved in
shuttling an iridoid metabolite from the IPAP cells to the epidermis, or to intermediate cell
types involved that have yet to be discovered for completion of intermediate biosynthesis.
The work presented in this study focuses on the recent discovery and cloning ofthe
glucosyltransferase that transforms 7-deoxyloganetic acid to 7-deoxyloganic acid, UDP
glycosyltransferase 8 (UGT8) from Catharanthus roseus (Asada et al. 2011). UGT8 is the first
intermediate step between GlOH and LAMT to be discovered and cloned, which enables
researchers to suggest that this is the favoured branching pathway for the synthesis of loganin.
Since the initial steps of iridoid synthesis takes place in the IPAP cells and the terminal steps
take place in the leaf epidermis, UGT8 makes a great candidate to determine the localization of
the uncharacterized intermediate steps. This present study demonstrates that the UGT8 is
located in the IPAP cells in Catharanthus species and can suggest that all enzymatic steps
between G10H and UGT8 are also localized in the IPAP cells.
3.3 Materials and Methods
3.3.1 In situ hybridization
80
The in situ RNA hybridization was performed basically as described previously (St
Pierre et al. 1999) with some modifications. The first pair of leaves from C. langifalius were
fixed in FAA (50% ethanol, 5% acetic acid, and 5% formaldehyde), dehydrated through an
ethanol and tert-butanol series and then embedded in Paraplast Xtra (Fisher Scientific, ON,
Canada). The embedded samples were sectioned into 10 11m thickness by using a rotary
microtome (Reichert Jung). The sections were carefully spread onto the slides treated with 2%
(v/v) 3-aminopropyltriethoxysilane (AES; Sigma Aldrich, Toronto, ON, Canada) in acetone,
incubated for 24 hours at 40D C and stored at 4D C until use. Serial sections were deparaffinized
by two incubations of 15 min each in xylene before rehydration in an ethanol gradient series up
to diethylpyrocarbonate-treated water.
Full-length of CrUGT8 in the pGEM-T easy vector (Promega, Fisher Scientific, ON,
Canada) were used for the synthesis of sense and antisense digoxigenin-Iabeled RNA probes
using DIG RNA Labeling Kit (SP6/T7, Roche Applied Science, ON, Canada) according to the
manufacturer's instructions. The RNA probes were submitted to partial alkaline hydrolysis for
20 min at 60°(, After prehybridization, hybridization of the digoxigenin-Iabeled RNA probes
and washing, the slides were stained with alkaline phosphatase-conjugated antidigoxigenin
antibodies (Anti-DIG-AP, FAB fragments from sheep, Roche Applied Science, ON, Canada).
3.3.2 Whole Leaf and Epidermal Protein Extraction
81
Young plant tissues were collected from Vinca minor, Catharanthus roseus and
Catharonthus longifolius by harvesting the first leaf pair and kept on ice. Whole leaves (1 g)
were placed in a mortar and pestle previously cooled with liquid nitrogen. After adding more
liquid nitrogen leaves were pulverized into a fine powder for 5 minutes and after thawing at
room temperature for 10 minutes, they were extracted in 30 ml of cold extraction buffer
(100mM TrisHCI, 5mM MgClz, 14mM ~-mercaptoethanol, pH 8.0). Samples were centrifuged in
a 21000R Thermo IEC centrifuge (Fisher Scientific, ON, Canada) at 10000 rpm for 10 minutes at
4D C to harvest the supernatant fraction. Leaf epidermis enriched protein extracts were
produced by placing 1 g of leaves in a 50 mL conical Falcon tube containing 1:1 w/w fresh
weight leaves to carborundum and 1:12 w/v fresh weight leaves to extraction buffer (100mM
TrisHCI, 5mM MgClz, 14mM B-mercaptoethanol, pH 8.0). The 50 mL tubes were continuously
manually shaken for 5 minutes, preventing the carborundum from settling on the bottom of the
tube. The tubes were cooled on ice for 5 minutes and the shaking procedure repeated before
the leaves were removed. The tubes containing leaf epidermis enriched extracts were
centrifuged (21000R Thermo IEC, Fisher Scientific, ON, Canada) at 4D C for 10 minutes at 10000
rpm to remove residual carborundum and the supernatant was harvested by filtering through
PS filter paper (Fisher Scientific, ON, Canada).
The whole leaf and epidermis enriched protein extracts were transferred to SOml
beakers containing a magnetic stir bar and were placed in an ice bath. Extracts were treated
with ammonium sulfate (O% to 70% saturation) and stirred for an hour to allow for
equilibration. The protein precipitates were harvested by centrifugation at 10,000 rpm for 30
minutes at 4°C (21000R Thermo IEC, Fisher Scientific, ON, Canada). The protein pellet was
resuspended in 2.S ml of extraction buffer (100mM TrisHCI, SmM MgCb, 14mM B
mercaptoethanol, pH 8.0) and desalted by Sephadex G2S PD10 gel filtration (Sigma Aldrich,
Toronto, ON, Canada). The concentration of protein in desalted extracts was determined by
Bio-Rad Protein assay (Bio-Rad, Hercules, CA, USA).
3.3.3 TDC Enzyme Assay
82
TDC enzyme assays contained 200 III of the desalted extract, 10 III of 10mM pyridoxal
phosphate, and 10 III of 0.06 IlCi/3 III (Specific activity S3IlCi/mmol) l-[side chain-3 14 C]
tryptophan (Perkin Elmer, ON, Canada) in a l.S ml microcentrifuge tube. Negative control
reactions were supplemented with 200 III extraction buffer rather than desalted protein
extracts. In all cases, the enzyme reaction mixtures were mixed for 30 seconds and were
subsequently centrifuged for 30 seconds in a microcentrifuge at SOOO rpm to ensure full
incorporation of all the components. After a 10 min incubation at 30°C, enzyme reactions were
83
stopped with 50 III of 2N NaOH, and radioactive tryptamine was separated from unreacted
tryptophan by adding EtOAc (500 Ill), mixing vigorously for 0.5 min and separating the phases
by centrifugation (Micromax Thermo IEC, Fisher Scientific, ON, Canada) for 5 minutes at 10000
rpm. The organic layer was transferred (450 Ill), into 1.5 ml tubes, dried in a SPD Speed Vac
(Thermo Savant, Holbrook, New York) for 15-20 minutes and reaction product was resuspended
in 5 III of 20mM tryptamine. After application to a Silica gel G thin layer chromatography plate
(TlC; Fisher Scientific, ON, Canada), reaction products were separated by chromatography in
Petroleum ether: Diethylamine: Acetone (7:2:1). The reaction product, tryptamine (Rf 0.7), was
easily observed under UV light (254nm) and bands were harvested into individual scintillation
vials along with 5 ml of scintillation fluid (ScintiSafe Econo 2, Fisher Scientific, ON, Canada) and
counted by liquid scintillation counting (Beckman Coulter, Mississauga, ON, Canada)
3.3.4 Western Immunoblots
The protein samples were diluted to equalize the protein concentrations. 100 III of
protein sample and 100 III of 2X sodium dodecyl sulfate (SDS) buffer containing ~
mercaptoethanol (7:1 v/v) were mixed. We utilized a 12% resolving gel and 4% stacking gel to
run an SDS-Page gel using a Bio-Rad Electrotrophoresis system (Hercules, CA, USA). The
polyacrylamide gel was placed in transfer buffer (3g Tris, 14.4g glycine, 200 ml MeOH, for II
aqueous solution) for 15 minutes on a shaker. Meanwhile, a PVDF transfer membrane (Thermo
Scientific, Fisher Scientific, ON, Canada) was cut to a size just slightly larger than that of the
sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel. The PVDF
84
A UGT8 "0 .... 1.50 ra
00 Qj Qj J:-f- (,) Qj
(!) 'i: -
T ::J c 0 "0 Qj i 1.00 - c 1 o .- 0 .... c .... Qj 0 CIl > ._.-:;:CIlE
0.50 ra CIl .... - Qj Qj Qj .... "O
0::: a.._ >< a. 0 .03 Qj Qj
0.00 Epidermis Whole Leaf
B SLS
"Oiij 15.00 12f8 Qj Qj
(/)J:-..J .~ Qj 1 (/),='0 "OQjJ: 10.00 'Oc3: ..... - 0 Qjc .... > 0 CIl :;: 'en 'E 5.00 .!!:!CIl .... Qj Qj Qj 0::: .... "0 a.._
><a. Qj Qj 0.00
Epidermis Whole Leaf
C LAMT "Oiij 6 .00
f-QjQj :aEJ:- 4. :;,3 ~.g~ ..Jc~ 4 .00 "OQjj - C o .- 0 .... c .... Qj 0 CIl > ._.-
2.00 .- CIl E 'iU CIl .... 1 -QjQj Qj .... "O T 0::: a.._
l ...
J ><a. Qj Qj 0 .00
Epidermis Whole Leaf
Figure 3.1: Preferential expression of CrUGTs within Catharanthus roseus leaves with highest activity
in first leaf pair. Relative expression of (A) CrUGT8, (B) LAMT and (C) SLS transcripts in whole leaf versus
leaf epidermal cells obtained by carborundum abrasion treatment analysis by quantitative RT-PCR. The
data points represent triplicate measurements ± SD.
8S
membrane was activated by placing it in MeOH for 5 seconds and rinsing it in ddH 20. The
membrane was equilibrated in transfer buffer on a shaker for 15 minutes. The electrotransfer
was then set up, from the bottom up, with three layers of transfer buffer soaked filter paper,
the equilibrated PVDF membrane, the transfer buffer treated SDS-PAGE gel, and finally, three
more layers of transfer buffer soaked filter paper. The electrotransfer was ran for one hour at
25V 100mA. Once the electrotransfer was completed, the PVDF membrane was cut to fit into a
50 ml tube and to separate the individual samples for separate immunoblot experiments .. The
PVDF membranes were rinsed with 5 mL of PBS for 10 minutes on a rotary at room
temperature. The PVDF membranes were blocked with 5 mL of PBS with 5% skim milk for one
hour on a rotary room temperature. After blocking, the PVDF membranes were rinsed three
times with 5 ml of PBST {PBS-Tween} for 10 minutes on a rotary at room temperature. The
PVDF membranes were then incubated with 5 ml of PBST with 5% skim milk and 5 III of r
antibody {1:1000L one TDC and the other D4H {only for C. roseus and C. longifolius samplesL at
4°C overnight. The PVDF membranes were then washed three times with 5 mLi of PBST for 10
minutes each on a rotary at room temperature. The PVDF membranes were incubated with 5
mL of PBST with 5% skim milk and 1 ilL of 2° antibody {1:5000L anti-rabbit IR Dye 800, for one
hour at room temperature on a sample rotator. Finally, the PVDF membranes were washed
twice with 5 ml of PBST on a rotary for 8 minutes and then washed twice with 5 mL of PBS on a
sample rotator for 8 minutes. The membranes were then scanned using a U-Cor Odyssey
Scanner {Mandel Scientific Co., ON, Canada}.
86
A
B
D
Figure 3.2. CrUgtB mRNA not detectable in young developing leaves of Catharanthus roseus. Paraffinembedded serial longitudinal 10 ~m sections were made from 10-15 mm long leaves of C. roseus. Sections were hybridized with digoxigenin-Iabelled transcripts to show localization of genes involved in MIA synthesis. (A) are 4x hybridized sections of C. rose us with antisense RNA of CrUGT8. Scale represents 500 ~m. (8) are 4x hybridized sections of C. roseus with sense RNA of CrUGT8. Scale represents 500 ~m. (C) are 40x hybridized sections of C. roseus with antisense RNA of CrUGT8. Scale represents 50 ~m. (0) are 40x hybridized sections of C. roseus with sense RNA of CrUGT8. Scale represents 50 ~m.
87
3.4 Results
3.4.1 Preferential expression of CrUGT8 in plant organs and leaf cells
The molecular cloning, functional expression and biochemical characterization of
Catharanthus roseus iridoid glucosyltransferases were recently described (Asada et al. 2011).
Among 3 separate UGTs identified, a single UGT (CrUGT8) converted 7-deoxyloganetic acid to
its glucoside, deoxyloganic acid, but it was unable to accept the closely related 7-deoxyloganin
as a suitable substrate (Asada et al. 2011). These studies suggested that O-glucosylation occurs
prior to O-methylation in the secologanin pathway in C. roseus, supporting similar conclusions
obtained from loganic acid O-methyltransferase (LAMT) substrate specificity studies (Murata et
al. 2008). With the localization of known secologanin biosynthetic genes, G10H to the
epidermis and LAMT and SLS to the epidermis, we performed a study to detect the site of
CrUGT8 (Catharanthus roseus UDPG-7-deoxyloganetic acid glucosyltransferase) expression in
leaves. This was conducted through the extraction of RNA from whole leaves and from
epidermis enriched extracts isolated by carborundum abrasion (CA) technique and by
determining the relative abundance of this transcript in each extract by quantitative real time
RT-PCR (Figure 3.1A). The expression of CrUGT8 transcripts were 33 time higher in the whole
leaf extracts than in the epidermal extracts (Figure 3.1A). Previous studies using CA technique
have shown that LAMT and SLS that catalyze the last 2 steps in secologanin biosynthesis are
preferentially expressed in the leaf epidermis (Murata et al. 2008). When whole leaf and leaf
epidermis enriched transcripts were analyzed for the levels of LAMT and SLS (Figure 3.1B and
C), SLS demonstrates almost 13 time higher expression in the leaf epidermal extracts in
A
C t;. C 'e'" ,.. -.:: --t.i -.... ~ ,.;
V .= :" = -.- Q V I. ;.. C. C.
-~ (J'. .... U -:;;;. Q Q
.... e c.
0.50
.;: '.: ~ ~ .... ;: J"':; ,,~ i J ..
0.40 B "'S' ~ .... ... ,,~-~ .. ~ ... .. ... ;;'. ... ..., - ~ -,~ .... .- . , hit- 5SUh . '* ........ ,.;- "" ---;
";2("
030 .i Ih '15!i,[}J" ...... ~
c: (11,\t11 ,\ t:/M,~if/'l/itlU,\
0.20
0.10
0.00 L --J:== C.l (}II g i/o/h1mi Croseus
88
o Willie Leaf
• Epidermis
Figure 3.3. Catharanthus longifolius demonstrates similar cellular organization of the MIA biosynthetic
steps, TOC and 04H, as Catharanthus roseus. First leaf pairs of both C. longifolius and C. roseus were
harvested and subjected to whole leaf protein extraction or carborundum abrasion for leaf epidermal
protein extraction. Depicted above are (A) activity results from 10 minute long TDC assays and (8)
western blots probing with tdc (SSkDa) and d4h (4SkDa) antibodies of the whole leaf extracts and leaf
epidermal extracts from C. roseus and C. longifolius.
89
comparison to whole leaf extracts (Figure 3.1 B). Similarly, LAMT demonstrates 4.5 time higher
expression in the leaf epidermal extracts in comparison to the whole leaf extracts (Figure 3.1C).
Taken together, these results strongly suggested that the glucosylation step in secologanin
biosynthesis could be spatially separate from the terminal 2 reactions in this pathway. These
results suggest that CrUGT8 may be found within the whole leaf of the first leaf pair rather than
in the leaf epidermis with LAMT and SLS.
3.4.2 ISH to detect CrUGT8 in young leaves of Catharanthus rose us
The results obtained from the CA and distribution studies (Figure 3.1), prompted efforts
to localize the specific cell type where CrUGT8 is expressed in the first leaf pairs of C. roseus.
Very young developing leaves were harvested, fixed, embedded, sectioned, and prepared for in
situ RNA hybridization. As displayed in Figure 3.2, ISH using antisense (Figure 3.2A and C) and
sense (Figure 3.2B and 0) probes failed to produce detectable hybridization results in
Catharanthus roseus leaves. Unfortunately, this experiment was only performed twice in
Catharanthus roseus due to certain time constraints and to breakdown problems with the
microtome and other issues.
90
A
B
c D ........
-
Figure 3.4. localization of ugtB mRNA in young developing leaves of Catharanthus /ongi/olius to the IPAP cells. Paraffin- embedded serial longitudinal 10 11m sections were made from 10-15 mm long leaves of C. longifolius. Sections were hybridized with digoxigenin-Iabelled transcripts to show localization of genes involved in MIA synthesis. (A) are 4x hybridized sections of C.longifolius with antisense RNA of CrUGT8. Scale represents 500 11m. (8) are 4x hybridized sections of C.longifo/ius with sense RNA of CrUGT8. Scale represents 500 11m. (C) are 40x hybridized sections of C.longifolius with antisense RNA of CrUGT8. Scale represents 50 11m. (0) are 40x hybridized sections of C. longifolius with sense RNA of CrUGT8. Scale represents 50 11m.
3.4.3 The cell-specific organization of MIA biosynthesis in Catharanthus rose us and in
Catharanthus longifolius.
91
While they are different species, Catharanthus longifolius is so closely related to
Catharanthus roseus that breeders have crossed them in their efforts to create cultivars with
novel ornamental and disease resistance properties. Previous studies have also shown that
Catharanthus longifolius produces the same MIAs as C. roseus, including catharanthine,
vindoline and related dimers. Previous studies also showed that most of the pathway leading
to MIAs, including TOC, is expressed in the leaf epidermis of Catharanthus roseus while the late
steps in vindoline biosynthesis, including deacetoxyvindoline 4 hydroxylase (04H), are
expressed in specialized cells within the leaf mesophyll (St. Pierre et al. 1999). To test ifthe leaf
epidermis of C. longifolius preferentially expresses the MIA pathway, CA harvested leaf
epidermis enriched and whole leaf protein extracts were analyzed for TOC enzyme activity and
for the presence of immunologically reactive TOC and 04H proteins, respectively (Figure 3.3).
The TOC specific activities of leaf epidermis enriched extracts from C. longifolius and C. roseus
were 11 and 32 times higher than those found in whole leaf extracts, respectively (Figure 3.3).
The greater abundance of TOC activity in the leaf epidermis of both species was also apparent
when they were submitted to 50S-PAGE and electrophoretic transfer to membranes and
probing with anti-TOC antibodies (Figure 3.3, inset). The relative intensities of TOC antigen were
significantly higher in leaf epidermis than in whole leaves in C. roseus and C. longifolius. In
contrast, the 04H antigen, a marker for an MIA pathway protein preferentially expressed within
C. roseus leaves, was significantly higher in whole leaves than in leaf epidermis of C. roseus and
C. longi/olius. Together the TDC enzyme assays, as well as the TDC and D4H Immunoblots,
provide evidence that the cell-specific organization of MIA biosynthesis may be identical in C.
roseus and in C. longifolius.
3.4.4 ISH to detect CrUGT8 in young leaves of Catharanthus longifolius
92
Although C. roseus failed to produce hybrids with CrUGTB through ISH, C. longi/olius
young leaves were selected for detecting CrUGT8 mRNA expression by in situ hybridization
because they demonstrated similar characteristics of the MIA biosynthetic pathway as well as
sharing 99% identity with the CrUGT8 probe. Very young developing leaves of Catharanthus
longifolius were harvested, fixed, embedded, sectioned, and prepared for in situ RNA
hybridization analysis to localize transcripts of CrUGTB (Figure 3.4). Labeling of longitudinal leaf
sections with the antisense probe produced a strong signal restricted to the adaxial internal
phloem parenchyma region around the vasculature cells (Figure 3.4A and 3.4C}, while no
significant background was observed with the sense probe as negative controls (Figure 3.48 and
3.4D). These results strongly suggested that that CrUGTB is expressed in adaxiallPAP cells.
3.5 Discussion
The principal goal of the present study has been to localize the site of UGT8 expression
in Catharanthus leaves in relation to the cellular organization of secologanin biosynthesis and
MIA biosynthesis in Catharanthus species. With the prior knowledge that MIA biosynthesis is
Cuticle ---r-
J I
MIA pathway
t strictosidine
t I
secologanin tryptamine t t
logan in t
tryptophan
loganlc acid t
7-deoxyloganic acid
?~
/'-'deOXYIOganiC acid
t 7-deoxyloganetic acid
t t
iridodial
l 10-hydroxygeraniol
t geraniol
t MEP pathway
Figure 3.5: Spatial model of iridoid biosynthesis and translocation in Catharanthus leaves.
93
Solid lines represent a single enzymatic step, whereas double arrows indicate the involvement of
multiple enzyme steps. '7' indicates the putative transportation system of 7-deoxyloganic acid from IPAP
cells to leaf epidermal cells.
94
compartmented within separate cell types in the leaves of Catharanthus species (Figure 1.7 and
1.8) (Murata et al. 2008 and 5t-Pierre et al. 1999), we focused our studies on the first leaf pair.
As Figure 1.9 demonstrates, there are two known areas of the leaf used in the production of
iridoids. The MEP pathway and the first 2 steps in secologanin biosynthesis are localized to the
leaf IPAP cells while the last 2 steps are expressed within the leaf epidermis (Figure 3.1 Band C)
(Oudin et al. 2007). Further qualitative studies using leaf epidermis enriched and whole leaf
extracts suggest the UGT8 is preferentially expressed with leaves rather than in the leaf
epidermis (Figure 3.1A). These results enabled us to suggest that UGT8 is preferentially
expressed within the leaves either in the IPAP cells similar to Gl0H or in an intermediate third
cell type in the young leaves.
The technique of RNA 15H was utilized to determine the specific leaf cell within young
leaves, which UGT8 is located and due to the previous results (Figure 3.1). As Figure 3.2
displays, the use of Catharanthus roseus to localize UGT8 failed due to lack of hybridization,
which can be attributed to a low transcript number. For this reason we had to find an
alternative candidate plant to localize UGT8. Previous research has demonstrated similar traits
between closely related species of Catharanthus (Figure 1.7) (Murata et al. 2008t which led us
to Catharanthus longifolius. To determine if C. longifolius was a plausible candidate to mimic
the localization of UGT8 in C. roseus, we analyzed the localization of TOC and 04H through
enzyme assays and immunoblots (Figure 3.3). From these experiments, we were able to
deduce that C. longifolius shares similar organization of the MIA biosynthetic steps with TOC in
95
the leaf epidermis and D4H within the leaf, which makes it an apt substitute for C. roseus in the
RNA ISH experiments.
Despite the fact the original UGT8 probe was generated based on the C. roseus UGT8
clone, it still shares 99% identity with that of the C. longifolius UGT8 gene. This enabled the use
of the CrUGT8 probe on the young leaves of Catharanthus longifolius for ISH analysis. As
demonstrated in Figure 3.4, UGT8 was finally localized to internal phloem associated
parenchyma (IPAP) cells of the young leaves of C. longifolius. The similarities between C.
longifolius and C. roseus in the organization of the MIA biosynthetic pathway (Figure 3.1)
enables the suggestion that UGT8 is localized in the IPAP cells in C. roseus and possibly in other
Catharanthus species. Due to the fact the steps of the MEP biosynthetic pathway (DXS, DXR and
MECS) and G10H, which precede UGT8, are also localized to the IPAP cells (Figure 1.8) (Burlat et
al. 2004), enables the suggestion that the uncharacterized intermediate steps between G10H
and UGT8 are also allocated to the IPAP cells, as demonstrated in the proposed biosynthetic
model in Figure 3.5. It is not evolutionary advantageous to waste energy on such tasks as the
transfer of the biosynthetic intermediates from one cell to another and then back to the IPAP
cells for UGT8. Despite the revelations made here, there are still many uncharacterized
enzymatic steps as well as an unknown transport system that translocates the iridoid
intermediate from the IPAP cell to the leaf epidermis for the enzymatic steps of LAMT and SLS.
Regardless, these results suggest that the IPAP cells express earlier steps in the iridoid
biosynthesis and that they are a sensible cell type within which to initially focus the search for
the uncharacterized intermediary enzymatic steps.
96
Several insects have evolved different strategies to utilize and/or avoid the anti-feedant
properties of iridoids ultimately rendering the plants defenceless (Beninger et 01. 2008 and
Burse et 01. 2007). There is an evolutionary pressure for the plants to develop a new strategy to
regain the upper hand on their insect predators. This study demonstrates that one of the
enzymatic steps that convert iridoids to MIAs, UGT8, is closely localized to the phloem cells in
leaves where the phloem mobile anti-feed ant iridoid compounds reside. Even though the exact
biological function of MIAs is still unknown, researchers have been able to demonstrate anti
herbivory properties in catharanthine, similar to the iridoids, as well as anti-fungal properties
(Roepke et 01. 2010). Due to the results presented in this study, one can suggest that the
enzymatic conversion of iridoids to MIAs is an adaptive evolutionary strategy to overcome
predator pressure.
We conclude that the UGT8 gene is preferentially expressed within the leaves and more
specifically within the IPAP cells of Catharanthus longifolius. These results enable the
hypothesis that this may be the organization for all Catharanthus species and that MIAs may
have evolved from iridoids. Future studies should focus on the IPAP cells as a starting point to
isolate and clone uncharacterized enzymatic steps between G10H and UGT8 and to identify the
transport system of compounds to the leaf epidermis.
97
3.6 Acknowledgments
The authors thank Prof. Peter J. Facchini (University of Calgary) for the generous gift of
pTRVl and pTRV2 vectors. This work was supported in part by Genome Canada, the Ontario
Centers of Excellence and by a discovery grant from the Natural Sciences and Engineering
Research Council of Canada (NSERC} to V.D.L. S.M.A is the recipient of postdoctoral funding
from Genome Canada and the Ontario Ministry of Research and Innovation.
References
Aimi, N., Asada, Y., Sakai, S. and Haginiwa, J. (1978) Studies on Plants containing Indole Alkaloids. VII. Isolation of several Aspidosperma- and Vincamine-type alkaloids from the seeds of Amsonia elliptica ROEM. et Schult. Chem. Pharm. Bull., 26,1182-1187
Aerts, R.J., Gisi, D., De Carolis, E., De Luca, V. and Baumann, T.W. (1994) Methyl jasmonate vapor increases the developmentally controlled synthesis of alkaloid in Catharanthus and Cinchona seedlings. Plant ).,5,635-643
98
Alers, J.C, Krijtenburg, P., Vissers, K.J. and van Dekken, H. (1999) Hybridization: EDTA Is Highly Preferable to a Routinely Used Acid Decalcifier Effect of Bone Decalcification Procedures on DNA In Situ Hybridization and Comparative Genomic. J. Histochem. Cytochem. 47: 703-709
Andras, S.C., Hartman, T.P., Alexander, J., McBride, R., Marshall, J.A., Power, J.B., Cocking, E.C., and Davey, M.R. (2000) Combined PI-DAPI staining (CPD) reveals NOR asymmetry and facilitates karyotyping of plant chromosomes. Chromosome Res. 8:387-91.
Angerer, L.M, and Angerer, R.C. (1990) In situ Hybridization- A Guided Tour. Technology Methods. 1: 2-29.
Asada Mai Nagatoshi, K., Terasaka, K., and Mizukami, H. (Dec. 10-15, 2011) Molecular cloning and characterization of an iridoid 1-0-glucosyltransferase (UGT) involved in secologanin biosynthesis. 50 th Anniversary meeting of the Phytochemical Society of North America, Kohala Coast, Hawaii.
Bardin, P.G., Pickett, M.A., Robinson, S.B., Sanderson, G., Holgate, S.T., and Johnston, S.L. (1993) Comparison of 3' and 5' biotin-labelled oligonucleotides for in-situ
hybridization. Histochemistry. 100: 387-392.
Beninger, C.W., Cloutier, R.R., and Grodzinski, B. (2008) The iridoid glucoside, Antirrhinoside, from Antirrhinum majus L. has differential effects on two generalist insect herbivores. J. Chem.
fco. 34:591-600.
Beninger, C.W., Cloutier, R.R., Monteiro, M.A., and Grodzinski, B. (2007) The distribution of two major iridoids in different organs of An tirrhin um majus L. at selected stages of development. J. Chem. fco. 33:731-747.
Bloch B. (1993) Biotinylated probes for in situ hybridization histochemistry-use for messenger RNA detection. J. Histochem. Cytochem. 41: 1751-1754.
Burlat, V., Oudin, A., Courtois, M., Rideau, M. and St-Pierre, B. (2004) Co-expression of three MEP pathway genes and geranioll0-hydroxylase in internal phloem parenchyma of Catharanthus roseus implicates multicellular translocation of intermediates during the
biosynthesis of monoterpene indole alkaloids and isoprenoid-derived primary metabolites. Plant J., 38: 131-141.
99
Brigati, D.J., Myerson, D., and Leary, J.J. (1983) Detection of viral genomes in cultured cells and paraffin-embedded tissues using biotin-labelled hybridization probes. Virology. 126: 32-50.
Cao, M., and Beckstead, J.H. (1989) Localization of Cytomegalovirus DNA in Plastic-Embedded Sections by In Situ Hybridization. American J. Path. 134: 457-463
Collu, G., Garcia, A.A., van der Heijden, R. and Verpoorte, R. (2002) Activity of the cytochrome P450 enzyme geraniol10-hydroxylase and alkaloid production in plant cell cultures. Plant Sci., 162:165-172
Courdavault V., Burlat V., St-Pierre B. and Giglioli-Guivarc'h N. (2005) Characterisation of CaaX-prenyltransferases in Catharanthus roseus: relationships with the expression of genes involved in the early stages of monoterpenoid biosynthetic pathway. Plant Sci., 168: 1097-1107.
Courdavault V. (2011) Spatial organization of the vindoline biosynthetic pathway in Catharanthus roseus. J. Plant Physiol., 168: 549-557.
Cox, K.H., Deleon, D.V., Angerer, L.M., and Angerer, R.C. (1984) Detection of mRNAs in sea urchin embryos by in situ hybridization using assymetric RNA probes. Devel. Bio. 101: 485-502
Daniel, M. (2006) Medicinal Plants- Chemistry and Properties. Enfield: Science Publishers.
De Luca, V. (1993) Indole alkaloid biosynthesis. In Methods in Plant Biochemistry. Enzymes of Secondary Metabolism, Vol. 9 (Lea, P., ed.). London: Academic Press, pp 345-368
De Luca, V. (2011) Monoterpenoid indole alkaloid biosynthesis. Plant Meta. and Biotech., pp 263-292. (eds. Ashihara, Crozier, Komamine).
De Luca, V., Balsevich, J., Tyler, R.T., Eilert, U., Panchuk, B.D. and Kurz, W.G.W. (1986) Biosynthesis of indole alkaloids: develop- mental regulation of the biosynthetic pathway from tabersonine to vindoline in Catharanthus roseus. J. Plant Physiol., 125: 417-156.
DeLuca, V., Marineau, C., and Brisson, N. (1989) Molecular cloning and analysis of cDNA encoding a plant tryptophan decarboxylase: comparison with animal dopa decarboxylases. PNAS.86: 2582-2586
DeLuca, V., and St-Pierre, B. (2000) The cell and developmental biology of alkaloid biosynthesis. Trends in plant Sci. 5 :168-173
100
Durrant, I., Dacre, B., and Cunningham, M. (1995) Evaluation of novel formulations of35S_ and 33P-labelled nucleotides for in situ hybridization. Histochem Journal. 27: 89-93.
Dutta, A., Batra, J., Pandey-Rai, 5., Singh, D., Jumar, 5., and Sen, J. (2004) Expression of terpenoid indole alkaloid biosynthetic pathway genes corresponds to accumulation of related alkaloids in Catharanthus roseus (L.) G. Don. Planta. 220:376-383.
Endress, M.E., van der Ham, R.W.J.M., Nilsson,S., Civeyrel, L., Chase, M.W., Sennblad B., Potgieter, K., Joseph, J., Powell, M., Lorence, D., Zimmerman Y-M., and Albert V.A. (2007) A Phylogenetic Analysis of Alyxieae (Apocynaceae) Based on rbcL, matK, trnL Intron, trnL-F Spacer Sequences, and Morphological Characters. In Annals of the Missouri Botanical Garden. Vol. 94 Missouri Botanical Garden Press, pp 1-34
Facchini, P.J. and De Luca, V. (2008) Opium poppy and Madagascar periwinkle: Model non model systems to investigate alkaloid biosynthesis in plants. Plant J., 54: 763-784.
Farananika, B., Akbarzadeh, T. Jahangirzadeh, A., Yassa, N., Ardekani, M.R.S., Mirnezami, A., Khanavi, M. (2011) Phytochemical investigation of Vinca minor cultivated in Iran. Iranian J of
Pharm. Res. 10: 777-785.
Feinberg, A.P., and Vogelstein, B. (1984) A technique for radiolabelling DNA restriction
endonuclease fragments to high specific activity. Anal Biochem 137:266-267.
Firn, R. (2010) Nature's Chemicals. Oxford: Oxford University Press.
Gang, D.R. (2005) Evolution of Flavors and Scents. Annual Reviews in Plant Biology. 56: 27.
Ge, C.J., and Li, Y.K. (1989) Observation on the chromosome numbers of medicinal plants of Shandong Province (II). Chinese Traditional and Herbal Drugs 20: 34-35.
Gorham, H., Sugino, T., Bolodeoku, J., Yoshida, K., Goodison, 5., and Tarin, D. (1996)
Distribution of CD44 messenger RNA in archival paraffin wax embedded tumours and normal tissues viewed by in situ hybridization. J Clin Pathol Clin Mol Pathol. 49: 147-150.
Guirimand, G., Courdavault, V., Lanoue, A., Mahroug, 5., Guihur, A., Blanc, N., GiglioliGuivarc'h, N., St-Pierre, B. and Burlat, V. (2010) Strictosidine activation in Apocynaceae:
towards a 'nuclear time bomb'? BMC Plant BioI., 10: 182.
Guirimand, G., Guihur, A., Ginis, 0., Poutrain, P., Hericourt, F., Oudin, A., Lanoue, A., StPierre, B., Burlat, V., and Courdavault, V. (2011) The subcellular organization of strictosidine
biosynthesis in Catharanthus roseus epidermis highlights several trans-tonoplast translocations
of intermediate metabolites. FEBS J., 278: 749-763.
Hoffman, G.E., and Le, W. (2004) Just cool it! Cryoprotectant anti-freeze in immunocytochemistry and in situ hybridization. Pep tides. 25:425-431
101
Hofler, H., Childers, H., Montminy, M.R., Lechan, R.M., Goodman, R.H., and Wolfe, H.J. (1986) In situ hybridization methods for the detection of somatostatin mRNA in tissue sections using antisense RNA probes. Histochem J. 18:597-604.
Irmler, 5., Schroder, G., St-Pierre, B., Crouch, N.P., Hotze, M., Schmidt, J., Strack, D., Matern, U. and Schroder, J. (2000) Indole alkaloid biosynthesis in Catharanthus roseus: new enzyme activities and identification of cytochrome P450 CYP72A1 as secologanin synthase. Plant J., 24: 797-804.
Jensen,S., and Schripsema, J. (2002) Chemotaxonomy and pharmacology of Gentianaceae. Gentianaceae-Systematics and Natural History. Cambridge University Press.
Jiang, J., and Gill, B.S. (1994) Nonisotopic in situ hybridization and plant genome mapping: the first 10 years. Genome.37:717-725
Kadkol,S.S., Gage, W.R., and Pasternack, G.R. (1999) In Situ Hybridization-Theory and Practice. Molecular Diagnostics. 4:169-183
Kalaus, G., Greiner, I., Kajatar-Peredy, M., Brlik, 1, Szabo, L., Szantay, C. (1993) Synthesis of Vinca Alkaloids and Related Compounds. A new synthetic pathway for preparing alkaloids and related compounds with Aspidosperma skeleton. Total syntheses of (+}-vincadifformine, (+)tabersonine, and (+}-3-oxotabersonine, J. Org. Chem., 58: 1434-1442.
Kam, T.S., Loh, K.Y. and Wei, C. (1993) Conophylline and conophyllidine: new dimeric alkaloids from Tabernaemontana divaricata. J. Nat. Prod., 56: 1865-1871
Kutchan, T.M. (2005) A role for intra- and intercellular translocation in natural product biosynthesis. Cur. Op. Plant 8io.,8: 292-300
Kutney, J.P., Chan, K.K., Faitli, A., Fromson, 1M., Gletsos, C. and Nelson, V.R. (1968) Total synthesis of some monomeric vinca alkaloids: dl-vincadine, dlvincaminoreine, dl-vincaminorine, dl-vincadifformine, dl-minovine, and dl-vincaminoridine. J. Am. Chem. Soc., 90: 3891-3893.
Levac, D., Murata, J., Kim, W.S. and De Luca, V. (2008) Application of carborundum abrasion for investigating the leaf epidermis: Molecular cloning of Catharanthus roseus 16-hydroxytabersonine-16-0-methyltransferase. Plant J., 53: 225-236.
Liscombe, O.K., Usera, A.R. and O'Connor, S.E. (2010) Homolog of tocopherol C methyltransferases catalyzes N methylation in anticancer alkaloid biosynthesis. Proc. Natl Acad. Sci. USA, 107: 18793-18798.
Liu, H-M., Wu, B., Zheng, Q-T. and Feng, X-Z. (1991) New Indole Alkaloids from Amsonia sinensis. Planta Med., 57: 566-568.
102
Livak, K.J. and 5chmittgen T.D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 25: 402-408
Loyola-Vargas, V.M., Galaz-Avalos, R.M., and Ku-Cauich, R. (2007) Catharanthus biosynthetic enzymes: the road ahead. Phytochemistry Reviews. 6: 307-339
Maddox, P.H., and Jenkins, D. (1987) 3-Aminopropyltriethoxysilane (APES): a new advance in section adhesion. Journal of Clinical Pathology 40: 1256-1257.
Mahroug, 5., Burlat, V. and St-Pierre, B. (2007) Cellular and sub-cellular organisation of the monoterpenoid indole alkaloid pathway in Catharanthus roseus. Phytochem. Rev., 6: 363-381.
Mahroug, 5., Courdavault, V., Thiersault, M., St-Pierre, B., and Burlat, V. (2006) Epidermis is a pivotal site of at least four secondary metabolite pathways in Catharanthus roseus aerial organs. Planta. 223: 1191-1200
Majumder, P.L., Chanda, T.K. and Dinda, B.N. (1974) Alkaloids of the leaves of Voacanga grandifolia. Phytochem., 13: 1261-1264.
Malkov, V.M. and Yunusov, 5.Y. (1977) Vinca alkaloids. Chem. Nat. Comp., 13: 497-512.
Mansoor, T.A., Ramalho, R.M., Mulhovo, 5., Rodrigues, C.M.P. and Ferreira, M.J.U. (2009) Induction of apoptosis in HuH-7 cancer cells by monoterpene and ~-carboline indole alkaloids isolated from the leaves of Tabernaemontana elegans. Bioorg. Med. Chem. Lett., 19: 4255-4258.
McCreery, T. (1997) Digoxigenin labeling. Molecular Biotechnology. 7: 121-124
McNicol, A.M., and Farquharson, M.A. (1997) In Situ Hybridization and its Diagnostics Applications in Pathology. Journal of Pathology. 182:250-261
Miller MA, Kolb PE, Raskind MA. (1993) A method for simultaneous detection of multiple mRNAs using digoxigenin and radioisotopic cRNA probes. J Histochem Cytochem. 41: 1741-1750.
Murata, J. and De Luca, V. (2005) Localization of tabersonine 16-hydroxylase and 16-0H tabersonine-16-0-methyltransferase to leaf epidermal cells defines them as a major site of precursor biosynthesis in the vindoline pathway in Catharanthus roseus. Plant J., 44: 581-594.
103
Murata, J., Roepke J., Gordon, H. and De Luca, V. (2008) The leaf epidermome of Catharanthus roseus reveals its biochemical specialization. Plant Cell., 20: 524-542.
Naoumov, N.V., Alexander, G.J.M., and Eddleston, A.L.W.F. (1988) In situ hybridization in formalin fixed paraffin embedded liver specimens. A method for the detection of human and viral DNA using biotinylated probes. Journal of Clinical Pathology. 41: 793-798.
Neuwinger, H.D. (2000) African traditional medicine: a dictionary of plant use and applications. Stuttgart: Medpharm Scientific, pp.58
Noe, W., Mollenschott, c., and Berlin, J. (1984) Tryptophan decarboxylase from Catharanthus roseus cell suspension cultures: purifications, molecular and kinetic data of the homogenous protein. Plant Molecular Biology. 3:281-288
Nuovo, G.J. (1991) Comparison of Bouin solution and buffered formalin fixation on the detection rate by in situ hybridization of human papillomavirus DNA in genital tract lesions. J Histotechno/14: 13-17.
Ortho. (2003) The complete perennial book. Ortho. (San Fransisco, CAl
Oudin, A., Courtois, M., Rideau, M., and Clastre, M. (2007) The iridoid pathway in Catharanthus roseus alkaloid biosynthesis. Phytochemistry Reviews. 6:259-276
Oudin, A., Mahroug 5., Courdavault, V., Hervouet, N., Zelwer, C., Rodriguez-Concepcion, M., St-Pierre, B. and Burlat, V. (2007) Spatial distribution and hormonal regulation of gene products from methyl erythritol phosphate and monoterpene-secoiridoid pathways in Catharanthus roseus. Plant Mol. BioI., 65: 13-30.
Peiiuelas, J., Sardans, J., Stefanescu, c., Parella, T., and Filella, I. (2006) Lonicera Implexa Leaves Bearing Naturally Laid Eggs of the Specialist Herbivore Euphydryas Aurinia have Dramatically Greater Concentrations of Iridoid Glycosides than other Leaves. Journal of Chemical Ecology. 32:1925-1933
Pringle, J.H., Primrose, L., Kind, C.N., Talbot, I.C., and Lauder, I. (1989) In situ hybridization demonstration of poly-adenylated RNA sequences in formalin-fixed paraffin sections using a biotinylated 01igonucleotide poly d(T) probe. J Pathol. 158: 279-286.
Pratchayasakul, W., Pongchaidecha, A., Chattipakorn, N. and Chattipakorn, S. (2008) Ethnobotany and ethnopharmacology of Tabernaemontana divaricata. Indian J. Med. Res., 127: 317-335
Rakhimov, D. A., Malikov, V. M., Yagudaev, M. R., and Yunusov, S. Yu. (1970) Structure of ervinceine, ervamicine, and ervincinine. Khim. Prir. Soedin., 6: 226-231.
Rigby, P.W.J. and Dieckmann, M. (1977) Labelling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase I. Journal of Molecular Biology 113: 237-251.
104
Rodriguez-Concepcion, A., and Boronat, A. (2002) Elucidation of the methylerythritol phosphate pathway for isoprenoid biosynthesis in bacteria and plastids. A metabolic milestone achieved through genomics. Plant Physiology. 130: 1079-1089
Roepke, 1, Salim, V., Wu, M., Thamm, A.M.K., Murata, J., Ploss, K., Boland, W. and De Luca, V. (2010) Vinca drug components accumulate exclusively in leaf exudates of Madagascar periwinkle. Proc. Natl Acad. Sci. USA., 107: 15287-15292
Rohmer, M., Knani, M., Simonin, P., Suttdr, B., and Sahm, H. (1993) Isoprenoid biosynthesis in bacteria:a novel pathway for the early steps leading to isopentenyl diphoosphate. Biochem J. 295:517-524
Samuels, L., Kunst, L., and Jetter, R. (2008) Sealing plant surfaces: Cuticular wax formation by epidermal cells. Annual Review in Plant Biology. 59:683-707.
Singer, R.H., Lawrence, J.B., and Villname, C. (1986) Optimization of in situ hybridization using isotopic and non-isotopic detection methods. Biotechniques 4: 230-244.
St-Pierre, B., Vazquez-Flota, F.A. and De Luca, V. (1999) Multicellular compartmentation of Catharanthus roseus alkaloid biosynthesis predicts intercellular translocation of a pathway intermediate. Plant Cell., 11: 887-900
Taiz, L. and Zeiger, E. (2006) Plant Physiology 4th Edition. Sunderland: Sinauer Associates, Inc., Publishers.
Urieli-Shoval, 5., Meek, R.L., Hanson, R.H., Ferguson, M., Gordon, D., and Benditt, E.P. (1992) Preservation of RNA for in situ hybridization-Carnoy versus formaldehyde fixation. J Histochem
Cytochem 40: 1879-1885.
Valletta, A., Trainotti, L., Santamaria, A.R. and Pasqua, G. (2010) Cell-specific expression of tryptophan decarboxylase and 10-hydroxygeraniol oxidoreductase, key genes involved in camptothecin biosynthesis in Camptotheca acuminata Decne (Nyssaceae). BMC plant BioI., 10:
69
105
van Beek, T.A. and van Gessel, M.A.J.T. (1988) Alkaloids of Tabernaemontana species. In Alkaloids: Chemical and biological perspectives Vol. 6 (Pelletier, S.W. ed). New York: Wiley, pp. 75-226.
van Beek, T.A., Verpoorte, R., Baerheim Svendsen, A., Leeuwenberg, A.J.M. and Bisset, N.G. (1984) Tabernaemontana L. (Apocynaceae): a review of its taxonomy, phytochemistry, ethnobotany and pharmacology. J. Ethnopharmacol., 10: 1-156.
van der Heijden, R., Louwe, c.L., Verhey, E.R., Harkes, P.A. and Verpoorte, R. (1989) Characterization of a Suspension Culture ofTabernaemontana elegans on Growth, Nutrient Uptake, and Accumulation of Indole Alkaloids. Planta Med., 55: 158-62.
van der Heijden, R., Brouwer, R.L., Verpoorte, R., Wijnsma, R., van Beek, T.A., Haekes, P.A.A. and Baerheim Svendsen A. (1986) Indole alkaloids from a callus culture of Tabernaemontana elegans. Phytochem., 25: 843-846.
van der Heijden, R., Brouwer, R.L., Verpoorte, R., van Beek, T.A., Haekes, P.A.A. and Baerheim Svendsen A. (1986) Indole alkaloids from Tabernaemontana elegans. planta Med., 52 144-147.
van der Heijden, R., Jacobs, 0.1., Snoeijer, W., Hallard, D., and Verpoorte, R. (2004) The Catharanthus alkaloids: pharmacognosy and biotechnology. Current Medicinal Chemistry. 11: 607-628.
Wilkinson, D.G. (1995) RNA detection using non-radioactive in situ hybridization. Current Opinion in Biotechnology. 6:20-23
Wilcox, J.N. (1993) Fundamental Principles of In Situ Hybridization. Journal of Histochemistry and Cytochemistry. 41:1725-1733
Weiss, L.M., and Chen, V.V. (1991) Effects of different fixatives on detection of nucleic acids from paraffin-embedded tissues by in situ hybridization using oligonucleotide probes. J Histochem Cytochem 39: 1237-1241.
Weiss, H., Pasierbek, P., and Maluszynska, J. (1999) An Improved Nonfluorescent Detection System for In Situ Hybridization in Plants. Biotechnic and Histochemistry. 75:49-53
Ziegler, J., and Facchini, P.J. (2008) Alkaloid Biosynthesis: Metabolism and Trafficking. Annual Review Plant Biology. 59:735-769
105
Appendix I
1 A. orientalis 2 A. ciliata 3 A. tabernaemonata var. salicifolia 4. A. hubrichtii 5. A. iIIustris 6. A. tabernaemontana 7. A. jonesii
.: H
o.AOCHJ
-:.;,.~ C02CH3
Tabersonine std.
I
107
~ __________ -JJ-- Vincadifformine
Strictamine -
L......:".-----------..::::;Jd-- Isoeburnamine
12 7T 4536
Figure 51: Comparative TLC analysis of leaf surface extracts from Amsonia orientalis, ciliata, tabernaemontana var. salicifolia, hubrichtii and jonsii. Individual MIAs were harvested from TLC plates and tentatively identified by UPLC MS. The TLC was sprayed with CAS reagent and photographed after color development.
CacTDC I CacTDC] OpuTDC CraTDC RvelOC VmtTDC TelTDC
CacTOCl CacTDC2 OpulOC CralOC RvelOC VmlTOC TeilOC
CaclOCI CacTOC2 OpulOC CrolOC RveTOC VmlTOC TelTDC
CacTOC I CacTDC2 OpulOC CraTOC RveTDC VmtTDC TelTOC
CacTOC I CacTDC] OpuTDC CraTDC RveTDC VmlTOC TeilOC
CacTOCI CacTDc] OpuTOC CraTDC RvelOC VmtTDC TelTDC
CacTDC1 CacTOC:' OpuTDC CruTOC RvelOC VmtTDC TelTDC
(acTDC I CaclOC2 OpuTOC CraTDC RvelOC VmllOC TelTOC
CacTDC I CacTOU OpuTOC (raTDC RvelOC VnuTDC TeilOC
F F F L L L L
YDTESPA - - SVGQ(il I'1 YOTES- - - - -AGQ
CDDSI I ---LAA TN-VA M N - SPVG TD - VA I A - SPVA TrW V A L 1,1 G S S V G TN-VA P T -P SIA
SPI HF I VIVI< " D "' SI VD " DG ' 1\ I ME " E "' I', L PO · E " ' EL vo ~, . , '" '" mE"' DI<L QO
EFRHYLOGIER OSLSLSPHKWLL EFRHYLOGIER OSLSLSPHKWLL EFRZYLDGIE VDsliIsLSPHKWLL EFRHYLDGIERVOSLSLSPHKWLL EF~HYLDGIERVOSLsDsPHKWLL EFRHYLOGIERVOSLSLSPHKWLL EFRHYLOGIERVOSLS SPHK~ L
MLKLPKSFMFSGTGGGV Q MLKLPmSFDFmGTGGGVIQ MLKLPKSFMFIDGTGGGVIQ
LKLPKSFMFSGTGGGVIQ MLKLPKSFMFSGTGGGVIQ MLKLP~FMFSGTGGGVIQ MLKLPKSFMFSGTGGGVIQ
502 498 506 500 499 501 499
58 55 57 58 58 60 58
118 115 117 118 118 120 118
LI' 178 L " 175 L " 177 I " 178 I " 178 I " 180 I " 178
DSNI VSI L L I 238 A V A N L S " D S 235
RIO N MS " I A 237 V T D GIS " QV 238 A T O GI A" EV 238 L T D I D " H V 240 A TO I A " E V 238
HVDAAYAGSACICP HVDAAYAGSACICP HVDAAYAGSACICP HVDAAYAGSACICP HVOAAYAGSACICP HVOAAYAGSACICP HVOAAYAGSACICP
298 295 297 298 298 300 29a
358 355 357 358 358 360 358
418 415 417 418 418 420 418
476 473 476 474 473 475 473
108
Figure 52: Protein sequence alignment of Camptotheca acuminata (CaTDC1, AAB39708.1;
CaTDC2, AB39709.1), Ophiorrhiza pumila (OpTDC, BAC41515.1), Catharanthus raseus (CrTDC; AAA33109.1), Rauvolfia verticillata (RvTDC, ABP96805.1), Vinca minor (VmTDC, JN644945),
Tabernamontana elegans (TeTDC, JN644946).
OJaSTR OpuSTR CroSTR RseSTR Vm,STR TelSTR
OJ"STR OpuSTR CroSTR RseSTR VmlSTR TelSTR
OJaSTR OpuSTR CroSTR RseSTR Vm,STR TelSTR
OpSTR OpuSTR CroSTR RseSTR Vm,STR TelSTR
OJaSTR OpuSTR CroSTR RseSTR VmiSTR TelSTR
OJaSTR OpuSTR CroSTR RseSTR Vm,STR TelSTR
OJaSTR OpuSTR CroSTR RseSTR Vm,STR TelSTR
- - - I' IGSI§)EAIS I L CAI L I - -lJv --- MHSI§)EA v SIL CA L -- lJ v ---- ----M' FM FF L L S SSSS
Ivl A I, L S DI§)Q T 'L TV F L S - - - I A L ---- ----- 'L TA LL L S--- VL - - - M A NI§)Q I V ' T I F L p I§) - - A L
IEI-'IDI< -S K E I -I DI< -SN Q I -V E -NS Q I -V E -NS
AQ I-IL a-NS L -VL D -ET
;aEI'R I aD 'R EE Mr·1 QQ MD
lEA MG L'fJ EE I
I·: E F S S F 353 I\EF SSF 351 r·l- - - - _ ~7
~4 337 3~1
I PI R F PD H
I( Y S H A Y P H
A aLATS DGV F NLYA A aLATS DGV FKWLYA ATQLATSV GVPFKWLYA ATQLATSVDGVPFKWLYA
TQL TSVDGVPFKWLYA ATQL TSV GVPFKWLYA
TGRLIKYDPSTKE T L TGRLIKYDPST~E T L TGRL~KYDPSTKETTLL TGRL I KYDPSTKETTL L TGRL~YDPSTKETTLL TGRL I KYDPSTKETTL L
53 53 52 57 48 55
11 3 113 112 11 7 108 115
171 171 172 175 168 173
231 231 232 ~35 228 233
287 287 292 295 287 29,2
NYI(SSVDHH HQI·IQGGLN D A SF 347 YKSSVDHH Q- NSGGLN-A SF ~5
D---- -- HDN NSYISQLVI ~6 --- - - --DI~ NSF S SH-- ~4 -- -- -- -- YP 1 PS s sa-- 337 -------- -N NS G I<GO-- 341
109
Figure 53: Protein sequence alignment of Ophiorrhiza japonica {OjSTR, ACF21007.1L
Ophiorrhiza pumila {OpuSTR, BAB47180.1L Catharanthus raseus (CrSTR, CAA43936.1), Rauvolfia
serpentina {RsSTR, CAA68725.1} Vinca minor (VmSTR, JN644947), and Tabernaemontana
elegans {TeSTR, JN644948}.
c
" , " ... ~ l . "j, .~ • • f' ~ • • '.,
B
' .... ry 7" , ,. ,
• .J I " "\
Figure 54: In situ localization of str mRNA in young developing leaves of Tabernaemontana elegans and Vinca minor. Paraffin-embedded serial longitudinal 10 11m sections were made from 2-3 em long leaves of T. elegans and 6-10 mm long leaves of V. minor. The slides containing V. minor (A,B) and T.elegans (C, D) sections were hybridized with antisense (A, C) and control sense (6, D) digoxigenin-Iabeled STR transcripts.
110