RESEARCH Open Access

Long non-coding RNA HIF1A-AS2 facilitatesadipose-derived stem cells (ASCs)osteogenic differentiation through miR-665/IL6 axis via PI3K/Akt signaling pathwayRuoyu Wu1†, Jihao Ruan2†, Yongjin Sun1, Mengyu Liu3, Zhuang Sha4, Cunyi Fan2* and Qingkai Wu2,3*

Abstract

Background: This study was aimed to investigate the role and specific molecular mechanism of HIF1A-AS2/miR-665/IL6 axis in regulating osteogenic differentiation of adipose-derived stem cells (ASCs) via the PI3K/Akt signalingpathway.

Methods: RNAs’ expression profile in normal/osteogenic differentiation-induced ASCs (osteogenic group) was fromthe Gene Expression Omnibus database. The analysis was carried out using Bioconductor of R. Gene Set EnrichmentAnalysis and Kyoto Encyclopedia of Genes and Genomes dataset were applied to identify up- and downregulatedsignaling pathways. Co-expression network of specific lncRNAs and mRNAs was structured by Cytoscape, while bindingsites amongst lncRNA, mRNA, and miRNA were predicted by TargetScan and miRanda. ASCs were derived from humanadipose tissue and were authenticated by flow cytometry. ASC cell function was surveyed by alizarin red and alkalinephosphatase (ALP) staining. Molecular mechanism of HIF1A-AS2/miR-665/IL6 axis was investigated by RNAi,cell transfection, western blot, and qRT-PCR. RNA target relationships were validated by dual-luciferase assay.

Results: HIF1A-AS2 and IL6 were highly expressed while miR-665 was lowly expressed in induced ASCs.HIF1A-AS2 and IL6 improved the expression level of osteoblast markers Runx2, Osterix, and Osteocalcin andalso accelerated the formation of calcium nodule and ALP activity, yet miR-665 had opposite effects. HIF1A-AS2 directly targeted miR-665, whereas miR-665 repressed IL6 expression. Moreover, the HIF1A-AS2/miR-665/IL6 regulating axis activated the PI3K/Akt signaling pathway.

Conclusions: LncRNA HIF1A-AS2 could sponge miR-665 and hence upregulate IL6, activate the PI3K/Aktsignaling pathway, and ultimately promote ASC osteogenic differentiation.

Keywords: HIF1A-AS2, miR-665, IL6, ASC, Osteogenic differentiation

BackgroundThe human skeleton is remodeling continuously through-out adult stage [1]. But on the condition of osteoporosisor severe traumatism such as fractures, the body usuallyloses bone mass and bone strength and suffers deficits inbone density and quality [2]. Although bone marrowmesenchymal stem cells (BMSCs) can differentiate into

osteoblasts, the proliferative capability and osteogenicdifferentiation ability of BMSCs decrease with age [3,4], the supply of such autologous stem cells is alsolimited [5]. As a potential alternative source, adipose-derived stem cells (ASCs), which is a kind of multipo-tential mesenchymal stem cell (MSC) capable of boneregeneration and reconstruction [6], have arousedinterest of researchers on account of their widespreadand abundance storage, easy access, and low-levelpain/harm extraction [2]. ASCs are of great import-ance to the exploration of novel autologous therapies.

* Correspondence: cyfan@sjtu.edu.cn; wuqingkai@sjtu.edu.cn†Ruoyu Wu and Jihao Ruan contributed equally to this work.2Department of Orthopaedics, Shanghai Jiao Tong University Affiliated SixthPeople’s Hospital, No.600 Yishan Road, Xuhui District, Shanghai 200233, ChinaFull list of author information is available at the end of the article

© The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, andreproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link tothe Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Wu et al. Stem Cell Research & Therapy (2018) 9:348 https://doi.org/10.1186/s13287-018-1082-z

Long noncoding RNAs (lncRNAs) were found as anovel subset of non-coding RNAs, those which have over200 nucleotides. Evidence showed that lncRNAs wererelated to multiple physiological and pathological pro-cesses by diverse mechanisms [7]. Recent studies indicatedthat some lncRNAs played a role in regulating osteogenicdifferentiation of stem cells [8], usually as competing en-dogenous RNA (ceRNA) which sponged at microRNAs(miRNAs), by which they regulated the expression ofdownstream messenger RNA (mRNA) [9]. HIF1A-AS2 isa kind of lncRNA which facilitates several cancers, such ascolorectal cancer, bladder cancer, and glioblastoma [10–12]; it is considered as a diagnostic biomarker of the de-velopment in differentiation between diverse breast cancertypes [13], as well as an influence on other processesincluding HUVEC angiogenesis [14]. A recent study re-vealed that HIF1A-AS1 and HIF1A-AS2 played a role inregulating hypoxia-inducible factor-1α (HIF-1α) and fur-ther affected periodontal ligament cell (PDLC) osteogenicdifferentiation [15]. But the effect of HIF1A-AS2 on ASCosteogenic differentiation still needs more exploration. Upto now, research on the relationship between HIF1A-AS2and ASC osteogenic differentiation is very scarce, leavingus an ample room to explore and an arduous task tofulfill.MicroRNAs (miRNAs) are clustered as single-stranded,

highly conserved, non-coding RNA molecules, whichregulate target gene expression by establishing directinteraction with homologous mRNA target 3′-untrans-lated regions (3′UTR) [16]. Several miRNAs have beenconfirmed to have important roles in skeletal developmentand disorders [17, 18], and the expression of some criticalmiRNAs also reflected the progress of bone-related dis-eases [19, 20]. According to a previous report, miR-665took part in regulating carcinoma cell migration, invasion,and proliferation [21] and influenced the cell cyclethrough targeting mRNAs [22]. In terms of ASCs, somespecific miRNAs also referred to an osteogenic differenti-ation process [23]. MiR-665 was reported functioning as arepressor of odontoblast osteogenic differentiation andmineralization [24]. It was of great significance toinvestigate the function of miR-665 in an ASC osteogenicdifferentiation process. In this research, we focus on theregulating mechanism of miR-665, regarding it as a bridgeconnecting lncRNA and mRNA. Interleukin-6 (IL6) withIL6 receptor (IL6R) plays a crucial part in the tissue regen-eration in vivo, especially bone metabolism [25]. It wasobserved related to osteogenic differentiation of MSCsaccording to recent reports [26, 27]. IL6 can combinemiRNAs [28], transmit the information to the signalingpathway PI3K/Akt which contains IL6 receptor, and pro-mote osteogenic differentiation. It is worth noting that IL6can also regulate the differentiation functions of ASCs[29]. Bakhit et al. revealed for the first time that SrRn

promoted proliferation and odonto-/osteogenic differenti-ation/mineralization of methylene diphosphonates viaPI3K/Akt signaling activated by CaSR in vitro; mineralizedtissue forms from the dental pulp in vivo [30]. PI3K/Aktplayed a role in aortic valve interstitial cell (AVIC) inflam-mation and calcification promoted by IFN-α [31]. A grow-ing number of studies revealed the possibility that thePI3K/Akt pathway affects osteogenic differentiation, butthe effect of the PI3K/Akt pathway in ASC osteogenic dif-ferentiation remains to be studied.In our study, we compared the expression of lncRNAs

and mRNAs between induced ASCs and undifferentiatedASCs and found the intersectional miRNA of lncRNA,mRNA, and the signaling pathway. According to bioinfor-matics analysis results, experiments were designed to ex-plore the specific regulatory mechanism of the HIF1A-AS2/miR-665/IL6 chain which targeted the PI3K/Aktsignaling pathway in the process of ASC osteogenic differ-entiation. This exploration may provide a primary founda-tion for future investigation of osteogenic differentiationand theories of bone-related diseases, contributing to thediscovery of new therapeutic targets for illness and in-novative skeleton modeling methods.

MethodsBioinformatics analysisThe total RNA expression profile of obtained adipose-derived stem cells was from the Gene Expression Omni-bus (GEO) database (GSE89330). We filtered lncRNAsand mRNAs which were differentially expressed by Rversion 3.4.1 (https://www.r-project.org/) with Limma.The criteria for DEGs were based on |fold change| > 2combined with adjusted P value less than 0.05, and theresults were exhibited as heatmaps.Gene Set Enrichment Analysis (GSEA) (http://software.

broadinstitute.org/gsea) and pathway gene set KyotoEncyclopedia of Genes and Genomes (KEGG) (https://www.kegg.jp/kegg/) were used to implement gene set en-richment analysis. The data of mRNA involved in pathwayswas from KEGG and is showed in Additional file 1: TableS1. According to a report of GSEA, the joyplot and dotplotof highest up- or downregulated signaling pathways (ad-justed P value < 0.05) were depicted.Cytoscape version 3.6.0 (http://www.cytoscape.org/)

was used to construct co-expression network of differen-tially expressed lncRNAs and mRNAs. Node and edgefiles were generated by R with the filtering condition ofadjusted P value < 0.05 and threshold > 0.7.Prediction of lncRNA and miRNA/miRNA and mRNA

binding sites was carried out using the miRcode (http://www.mircode.org/) and TargetScan (http://www.targetscan.org/vert_71/) databases. The relationship between mRNAand the pathway/miRNA and pathway was investigated by

Wu et al. Stem Cell Research & Therapy (2018) 9:348 Page 2 of 13

String (https://string-db.org/) or DIANA Tools (http://dia-na.imis.athena-innovation.gr/DianaTools).

Tissue specimensHuman ASCs were collected from 10 patients (5 males,5 females) whose subcutaneous fat was taken by liposuc-tion. The operation was conducted at Shanghai JiaoTong University Affiliated Sixth People’s Hospital. All ofour participants have signed informed consents, andexperiments have been authorized by the ethics commit-tee of Shanghai Jiao Tong University Affiliated SixthPeople’s Hospital.

Cell isolation and cultureDisinfected adipose tissues with 75% ethanol were rinsedby PBS for three times. Adipose tissue was cut into smallfragments (< 5 mm) using a razor blade and digested bycollagenase type II (0.1 mg/mL) (Sigma-Aldrich, St.Louis, MO, USA) for 60 min at 37 °C. We transferredthe liquid into a centrifuge tube and did low-speed cen-trifugation at 800 r/min × 10 min. Suspension cells werefiltrated by a 70-μm-diameter cell filter (BD Falcon, SanJose, CA, USA) and then were cultivated in low-glucoseDMEM (Gibco, Grand Island, NY, USA) with 10% fetalbovine serum (FBS, Gibco) and 1% penicillin at 5% CO2

and 37 °C. On the next day, the unattached cells wereremoved and then ASCs were collected, washed thrice,and used for subsequent experiments.To implement dual-luciferase assay, human embryo

kidney cell line HEK-293 was purchased from BeNa Cul-ture Collection (Beijing, China) and cultivated in high-glucose DMEM (Gibco) with 10% FBS.

Osteogenic inductionFor osteogenic induction, ASCs were seeded at a densityof 2.0 × 105 cells/well into 12-well plates with routinemedium. When cells reached 80–90% confluence, themedium was changed (contained 10% FBS, 50 μg/mLL-ascorbic acid, and 10 mM β-glycerophosphate), andcells were grown in osteogenic induction medium withthe StemPro™ Osteogenesis Differentiation Kit (Gibco).The osteogenic induction medium was replaced every3 days.

Flow cytometryCD29, CD31, CD44, and CD45 were selected to identifythe isolated ASCs. CD29 and CD44 were primary stablepositive markers of ASCs while CD31 and CD45 wereprimary negative markers of ASCs [32]. Additional 1 × 106

cells were respectively incubated with PE-conjugatedmouse antibody against CD31 (ab233642, 4 μL, Abcam),FITC-conjugated mouse antibody against CD29 (ab21845,1.5 μL, Abcam), FITC-conjugated mouse antibody againstCD44 (ab27285, 10 μL, Abcam), and PE-conjugated mouse

antibody against CD45 (ab155385, 5 μL, Abcam) andisotype-matched control IgG (ab154450, 0.1 μg, Abcam).Flow cytometry was conducted by a FACSCanto™ II FlowCytometer (BD Biosciences, San Jose, CA, USA).

Cell transfectionAgomiR-665, antagomiR-665, pcDNA3.1-HIF1A-AS2,pcDNA3.1-sh-HIF1A-AS2 (sh-HIF1A-AS2), pcDNA3.1-IL6, pcDNA3.1-sh-IL6 (sh-IL6), and their respectivelynegative control (NC) came from GenePharma (Shang-hai, China). 7.5 μL Lipofectamine 3000 (Invitrogen,Carlsbad, CA, USA) and 5 μg transfection object wererespectively diluted by 250 μL serum-free DMEM withhigh glucose and incubated for 5 min in a roomtemperature environment. Then, pre-mixed solution wasadded into 2 × 105 exponential phased ASCs which wereinoculated into six-well plates and incubated for 48 h at37 °C and 5% CO2. Puromycin was used to filter stabilizedtransfected cells.

qRT-PCRRNAs of ASCs were extracted using a TRIzol reagent(Invitrogen) and then reverse transcribed to cDNA usinga SuperScript™ III Reverse Transcriptase Kit (Invitrogen)(for lncRNA and mRNA reverse transcription) andmiRCURY LNA RT Kit (Qiagen, Duesseldorf, Germany)(for miRNA reverse transcription). qRT-PCR was con-ducted by a LightCycler 480 PCR System (Roche, Rotk-reuz, Switzerland) using SYBR Green qPCR Master Mix(Takara, Tokyo, Japan). Relative expression of RNAs wascalculated by a 2−ΔΔCt method. Meanwhile, GAPDH wasbrought in as internal reference. PCR primers were syn-thesized by Sangon Biotech (Shanghai, China), and se-quence information is exhibited in Table 1.

Western blotProteins were leached by RIPA lysis buffer (Beyotime,Shanghai, China) and quantified by an Enhanced BCAProtein Assay Kit (Beyotime). Total 20 μg protein was splitup by SDS-PAGE and transferred to PVDF membranes(Beyotime). Blocked by 5% concentration of bovine serumalbumin (BSA, Sigma-Aldrich) at 37 °C for 0.5 h, themembranes were cultivated with primary antibodies at 4 °Covernight (using GAPDH as internal reference). Then, sec-ondary antibody was added and the culture continued atroom temperature for another 1 h. Washed three times byTBST, HRP-labeled proteins were introduced by BeyoECLStar Kit (Beyotime) and filmed. The primary antibodieswere as follows: rabbit anti-IL6 (ab6672, 1:2000, Abcam,Cambridge, MA, USA), rabbit anti-IL6R (ab128008, 1:500),rabbit anti-pan-Akt (ab8805, 1:500), rabbit anti-pan-Akt(phospho T308) (ab38449, 1:500), and rabbit anti--GAPDH(ab181603, 1:10000). The secondary antibody was HRPlabeled goat anti-rabbit IgG (ab205718, 1:2000).

Wu et al. Stem Cell Research & Therapy (2018) 9:348 Page 3 of 13

Dual-luciferase reporter gene assayHEK-293 cells were seeded into 12-well plates and cul-tured until the confluence of cells reached 80–90%. PCRwas used to amplify the 3′UTR segments of the HIF1A-AS2 sequence and IL6 mRNA sequence containing thepredicted miR-665 binding sites. The direct binding sitesof miR-665 to HIF1A-AS2/IL6 were confirmed by miR-Code or TargetScan. 3′UTR of HIF1A-AS2 or IL6 wildtype (wt)/mutant type (mut) PmirGLO vectors (Pro-mega, Madison, WI, USA) were built by an XL Site-directed Mutagenesis Kit (Qiagen). According to themanufacturer’s instructions, cells were transiently co-transfected with 0.2 μg HIF1A-AS2/IL6 3′UTR orHIF1A-AS2/IL6 3′UTR mutant reporter plasmids to-gether with 100 nmol/L miR-665 or miR-NC using Lipo-fectamine™ 3000 (Invitrogen). Corresponding luciferaseactivity was evaluated by a Dual-luciferase ReporterAssay Kit (Promega) 48 h after transfection conformingto the manufacturer’s direction.

Alizarin red stainingAlizarin red staining was conducted 21 days after theosteoblastic induction. The cells that were cultured on12-well plates thrice were fixated with 4% paraformalde-hyde for 30 min and stained with 1% alizarin red S solu-tion (pH = 8.4) (Sigma-Aldrich) for 5 min. Later, theywere washed by PBS again and were filmed under an op-tical microscope (Olympus, Tokyo, Japan). To quantifymatrix mineralization, alizarin red-stained cultures wereincubated in 100 mM cetylpyridinium chloride for 1 h atroom temperature to solubilize calcium-bound alizarinred, the absorbance of which was measured at 570 nmand normalized to the cells without any treatment.

Alkaline phosphatase stainingFourteen days after osteogenic induction, a BCIP/NBTAlkaline Phosphatase Color Development Kit (Beyotime)was used to perform alkaline phosphatase (ALP) stain-ing. The cells cultured in 12-well plates were rinsedthree times by PBS and fixated for 30 min using 4%paraformaldehyde. Next, BCIP/NBT ALP staining bufferwas added and cells were cultivated (room temperature,

2 h) in a darkroom. After that, cells with ddH2O wererinsed and filmed under an optical microscope. Theabsorbance at 405 nm of each well was measured with amicroplate reader according to the manufacturer’sinstruction.

Statistical analysisAll of the experiments were done repetitively at leastthree times. Using GraphPad Prism version 6.0 (Graph-Pad Software, La Jolla, CA, USA), we collected the dataand visualized their mean ± standard deviation (SD). Thedifference between two groups was compared using Stu-dent’s t test, and comparison amongst three groups orabove was done by one-way ANOVA. P < 0.05 indicatedstatistical significance.

ResultsDifferently expressed lncRNAs and mRNAs in induced ASCsExpression data of GSE89330 was analyzed by R packageLimma. Based on the screening conditions that log2 (foldchange) > 1 and adjusted P value < 0.05, 985 lncRNAs(507 down, 478 up) and 2535 mRNAs (1384 down, 1151up) were screened out which were differently expressedin induced ASCs. We chose top-30 up- and downregu-lated lncRNAs and mRNAs to draw the heatmaps(Fig. 1a, b).

KEGG pathway enrichment analysisGSEA was performed using data profile of differentiallyexpressed mRNAs screened out by R and KEGG data-set. Top-7 up- and downregulated signaling pathwaysare shown in Fig. 2a. Herein, we discovered that thePI3K/Akt signaling pathway was notably activated ininduced ASCs (Fig. 2b). Pathway expressions were alsovisualized in the form of a joyplot (Fig. 2c) and dotplot(Fig. 2d); the results showed hepatitis B, hepatitis C,cAMP, drug metabolism cytochrome P450, measles,JAK/STAT, and PI3K/Akt, and tyrosine metabolism sig-naling pathways were significantly activated while pro-tein processing in endoplasmic reticulum, lysosome,and rheumatoid arthritis, epithelial cell signaling inhelicobacter pylori infection, and phagosome signaling

Table 1 Primer sequences for qRT-PCR

Gene Forward primer 5′–3′ Reverse primer 5′–3′

HIF1A-AS2 AGATCTGTGGCTCAGTTCCTTT AATCACTATGAATCCCTGCACCT

miR-665 ACCAGGAGGCTGAGGCCCCT Involved in the kit

IL6 TCAATATTAGAGTCTCAACCCCCA GAGAAGGCAACTGGACCGAA

Runx2 CCTTCAAGGTGGTAGCCCTC CCCTAAATCACTGAGGCGGT

Osterix (SP7) AGACCTCCAGAGAGGAGAGAC GGGGACTGGAGCCATAGTGA

Osteocalcin AATAGCCCTGGCAGATTCCC CTCTCATGGTGTCTCGGTGG

GAPDH GACAGTCAGCCGCATCTTCT GCGCCCAATACGACCAAATC

Wu et al. Stem Cell Research & Therapy (2018) 9:348 Page 4 of 13

pathways were conspicuously suppressed. All of theseresults suggested the PI3K/Akt signaling pathway wasactivated in induced ASCs.

Construct co-expression network and filter miRNAsWe intersected differentially expressed mRNAs inosteogenesis ASCs and mRNAs involved in the PI3K/Akt signaling pathway. A related mRNA IL6 was foundremarkably highly expressed in osteogenesis ASCs (log2(fold change) = 3.302) by Limma package. According toString and KEGG analyses (Fig. 3a), we affirmed thatIL6 could activate protein IL6R. Moreover, to verify apossible relationship between IL6 and lncRNAs, weused R and Cytoscape to build a co-expression networkbetween differentially expressed lncRNAs and mRNAsaccording to the screening condition in which Pearsoncorrelation coefficient > 0.7 and P < 0.05 (Fig. 3b). Thenetwork indicated that IL6 was in co-expression withlncRNAs HIF1A-AS2. Hence, we proposed a hypothesisthat HIF1A-AS2 might regulate IL6 by sponging miR-NAs. Using TargetScan and miRcode databases, we fil-tered all miRNAs that would bind to HIF1A-AS2 orIL6 3′UTR. DIANA Tools was applied to search miR-NAs related to the PI3K/Akt signaling pathway.MiR-665 was figured as a link between HIF1A-AS2 andIL6 (Fig. 3c), and binding sites were predicted for eachrelationship (Fig. 3d). Therefore, the following experi-ments were designed to explore the HIF1A-AS2/miR-665/IL6 axis.

Identification of ASCs and HIF1A-AS2 expression in ASCsFlow cytometry was performed to identify ASC surfacemarkers including CD29, CD31, CD44, and CD45(Fig. 4a), and the results showed that 90.5% of ASCsexpressed CD29, 82.3% expressed CD44, 9.4% expressedCD45, and 8.6% expressed CD31, making clear the iden-tity of isolated ASCs. Then, we carried out osteogenicinduction and identified HIF1A-AS2 expression innormal/induced ASCs using qRT-PCR at time nodes of1, 2, or 3 weeks. It is shown that HIF1A-AS2 expressionin induced ASCs was remarkably higher than in normalones, and the expression went up over time (P < 0.01,Fig. 4b). Expression of HIF1A-AS2 was obviously up- ordownregulated after transfection of pcDNA3.1-HIF1A-AS2 or sh-HIF1A-AS2 (P < 0.01, Fig. 4c); there was alsoan upward regulation of Runx2, Osterix, and Osteocalcinbecause of HIF1A-AS2 overexpression while HIF1A-AS2 silencing downregulated these markers (P < 0.05,P < 0.01, Fig. 4d, e). Alizarin red and ALP stainingresults indicated calcium nodule formation, and ALPactivity was facilitated by HIF1A-AS2 overexpression andsuppressed by HIF1A-AS2 silencing (P < 0.05, P < 0.01,Fig. 4f). These results showed that HIF1A-AS2 acted apositive part in ASC osteogenic differentiation.

HIF1A-AS2 regulated ASC osteogenic differentiationthrough miR-665Expression of miR-665 was lower in induced ASCs anddownregulated over time (P < 0.01, Fig. 5a). Dual-luciferase assay confirmed the predicted targeting

Fig. 1 Differentially expressed lncRNAs and mRNAs in normal/induced ASCs. a Heatmap of top-30 up- or downregulated lncRNAs in normal/induced ASCs. b Heatmap of top-30 up- or downregulated mRNAs in normal/induced ASCs

Wu et al. Stem Cell Research & Therapy (2018) 9:348 Page 5 of 13

relationship between miR-665 and HIF1A-AS2 (Fig. 5b)wherein co-transfection of wt HIF1A-AS2 3′UTR andagomiR-665 significantly reduced luciferase activity (P < 0.01,Fig. 5c). Transfection of agomiR-665 or antagomiR-665 not-ably facilitated or suppressed miR-665 expression, while theeffects were neutralized by HIF1A-AS2 overexpression orsilencing (P < 0.01, Fig. 5d). Expression of Runx2, Osterix,and Osteocalcin also reduced after transfection of agomiR-665 while antagomiR-665 brought an opposite effect (P <0.05, P < 0.01, Fig. 5e, f). Alizarin red and ALP staining indi-cated that agomiR-665 suppressed calcium nodule formation

and ALP activity, but antagomiR-665 or HIF1A-AS2 overex-pression could reverse the process (P < 0.01, Fig. 5g).

MiR-665 regulated ASC osteogenic differentiationthrough IL6Similar to HIF1A-AS2, IL6 was observed to be highlyexpressed in induced ASCs and upregulated over time(P < 0.01, Fig. 6a). Moreover, agomiR-665 could remark-ably suppress IL6 expression, while antagomiR-665 hada reverse effect (P < 0.05, Fig. 6b). Dual-luciferase assayverified the target relationship between miR-665 and IL6

Fig. 2 Pathway enrichment analysis based on differentially expressed mRNAs. a GSEA plot for top-7 upregulated signaling pathways in normal/induced ASCs. b GSEA report for the PI3K/Akt signaling pathway showed that it was upregulated in induced ASCs. c Joyplot of GSEA reportsshowed that the PI3K/Akt signaling pathway was upregulated. d Dotplot of GSEA reports showed that the PI3K/Akt signaling pathwaywas upregulated

Wu et al. Stem Cell Research & Therapy (2018) 9:348 Page 6 of 13

(Fig. 6c); co-transfection of agomiR-665 and wt IL6 3′UTRcould prominently reduce luciferase activity (P < 0.01,Fig. 6d). The impact of agomiR-665 on Runx2, Osterix, andOsteocalcin expression can also be overturned by IL6(P < 0.05, P < 0.01, Fig. 6e, f ). Alizarin red and ALPstaining displayed a similar result that IL6 couldneutralize the impact of miR-665 on calcium noduleformation and ALP activity (P < 0.01, Fig. 6g).

HIF1A-AS2/miR-665/IL6 axis jointly regulated the PI3K/Aktsignaling pathwayPI3K inhibitor LY294002 (10 μM) was applied to explorethe impact of HIF1A-AS2/miR-665/IL6 on the PI3K/Aktsignaling pathway. According to the result of western blot,overexpression of HIF1A-AS2/IL6 facilitates expression ofprotein IL6R which was the upstream protein of PI3K,

Akt, and phosphorylated Akt (p-Akt), whereas agomiR-665 hinders their expression (P < 0.05, P < 0.01, Fig. 7a, b),indicating that HIF1A-AS2 might sponge miR-665, thusupregulating IL6, and high expression of IL6 leads to thePI3K/Akt signaling pathway activation. Enhancive calciumnodule formation and ALP activity was found whenHIF1A-AS2/IL6 were overexpressed and agomiR-665/LY294002 groups had reverse results, which validatesour conclusion on the cellular level (P < 0.05, P < 0.01,Fig. 7c).

DiscussionStatistical analysis and experiment results verified thatlncRNA HIF1A-AS2 and mRNA IL6 were highly expressedin osteogenic induced ASCs, while knockdown of HIF1A-AS2/IL6 reduced osteoblast markers Runx2, Osterix, and

Fig. 3 Analysis of lncRNA/miRNA/mRNA axis. a String: downstream proteins of IL6, including IL6R. b Co-expression network of lncRNA/mRNAbuilt by Cytoscape. HIF1A-AS2 and IL6 had a positive correlation. c Venn diagram of miRNA binding HIF1A-AS2/IL6 and miRNA involved in thePI3K/Akt signaling pathway. MiR-665 was screened out. d Predicted binding sites between miR-665 and HIF1A-AS2/IL6 3′UTR

Wu et al. Stem Cell Research & Therapy (2018) 9:348 Page 7 of 13

Osteocalcin and impaired the osteogenic function. Onthe molecular level, HIF1A-AS2 sponged on miR-665,leading to IL6 increase and activation of the PI3K/Akt signaling pathway.Recently, adipose-derived stem cells (ASCs) have

gained extensive attention on their application in tissue

engineering [33]. Scientists argued ASCs’ own multipo-tential in differentiation [3]; apart from adipose cells,they can also play a role in angiogenesis and soft tissueregeneration [34, 35], and as a prospective alternativeautologous cell-based therapy to bone marrow stemcells [36], ASC transplant has been successfully applied

Fig. 4 Identification of ASCs and effect of HIF1A-AS2 on ASC osteogenic differentiation. a Flow cytometry for CD29/CD31/CD44/CD45 detection.b qRT-PCR: expression of HIF1A-AS2 in normal/induced ASCs over time. c qRT-PCR: expression of HIF1A-AS2 in induced ASCs after pcDNA3.1-HIF1A-AS2 or sh-HIF1A-AS2 transfection. d qRT-PCR: expression of Runx2, Osterix, and Osteocalcin after transfection. e Western blot analysis ofRunx2, Osterix, and Osteocalcin after transfection. f Alizarin red staining (21 days) and ALP staining (14 days): changes of calcium noduleformation and ALP activity after transfection. *P < 0.05, **P < 0.01, compared with NC group; #P < 0.05, ##P < 0.01, compared with sh-NC group

Wu et al. Stem Cell Research & Therapy (2018) 9:348 Page 8 of 13

in bone regeneration [37]. Evidence suggested that ASCswere analogous to BMSCs in many characteristics: morph-ology, transcriptome profiles, immunophenotype, and

multilineage differentiation function [38–40]. By contrast,ASCs possess easier accessibility due to the abundance inthe body, and less-invasive extraction procedures, lower

Fig. 5 Targeting relationship between HIF1A-AS2 and miR-665 and their effects on ASCs. a qRT-PCR: expression of miR-665 in normal/inducedASCs over time. b Predicted binding site between miR-556 and wt/mut HIF1A-AS2 3′UTR. c Dual-luciferase assay: luciferase activity in wt HIF1A-AS2 3′UTR + agomiR-665 group was significantly lower than that in wt HIF1A-AS2 3′UTR + agomiR-NC group. d qRT-PCR: expression of miR-665 ininduced ASCs after agomiR-665, antagomiR-665, pcDNA3.1-HIF1A-AS2, or sh-HIF1A-AS2 transfection. e qRT-PCR: expression of Runx2, Osterix, andOsteocalcin after transfection. f Western blot analysis of Runx2, Osterix, and Osteocalcin after transfection. g Alizarin red staining (21 days)and ALP staining (14 days): changes of calcium nodule formation and ALP activity after transfection. *P < 0.05, **P < 0.01, compared withNC group; #P < 0.05, ##P < 0.01, compared with sh-NC group

Wu et al. Stem Cell Research & Therapy (2018) 9:348 Page 9 of 13

incidence rate, and relatively low cost expand the advan-tage. In this study, we found a brand new chain whichcould accelerate the ASC osteogenic process.HIF1A-AS2 has already been found upregulated in some

cancers; its influence on maintenance of mesenchymal

glioblastoma stem-like cells is noteworthy [11]. Chen et al.revealed that HIF1A-AS1 and HIF1A-AS2 took part inperiodontal ligament cell (PDLC) osteogenic differentiationwhich was regulated by hypoxia-inducible factor-1α (HIF-1α) [15]. It was primarily proved that HIF1A-AS1 played a

Fig. 6 Targeting relationship between miR-665 and IL6 and their effects on ASCs. a qRT-PCR: expression of IL6 in normal/induced ASCs over time.b qRT-PCR: expression of IL6 in induced ASCs after agomiR-665, antagomiR-665, pcDNA3.1-IL6, or sh-IL6 transfection. c Predicted bindingsite between miR-556 and wt/mut IL6 3′UTR. d Dual-luciferase assay: luciferase activity in wt IL6 3′UTR + agomiR-665 group was significantly lower thanthat in wt IL6 3′UTR + agomiR-NC group. e qRT-PCR: expression of Runx2, Osterix, and Osteocalcin after transfection. f Western blot analysis of Runx2,Osterix, and Osteocalcin after transfection. g Alizarin red staining (21 days) and ALP staining (14 days): changes of calcium nodule formation and ALPactivity after transfection. *P < 0.05, **P < 0.01, compared with NC group; #P < 0.05, ##P < 0.01, compared with sh-NC group

Wu et al. Stem Cell Research & Therapy (2018) 9:348 Page 10 of 13

role in PDLC osteogenic differentiation and it still neededfurther research in ASCs. In our research, HIF1A-AS2 andIL6 were found both upregulated in osteogenic cellsthrough bioinformatics analysis. Besides, we found bindingsites between HIF1A-AS2 and miR-665, and miR-665 couldtarget IL6 by establishing sequence-specific interactionbased on high-level consistency with 3′UTR, which indi-cated the upstream role of HIF1A-AS2 in the whole regula-tion process by sponging miR-665 to affect IL6 expression.It was reported HIF1A-AS2 could promote angiogenesis ofthe human umbilical vein endothelial cell by sponging tomiRNA [14] and this regulation mode was consistent withthe direction of our research. Heair et al. discovered thatmiR-665 functioned as a repressor of odontoblastmaturation and mineralization by directly repressing theexpression of the transcription factor Dlx3 and thus itsdownstream targets [24]. This was consistent with theinhibition of osteogenic differentiation by miR-665 in ourexperimental results.Interleukin-6 (IL6) is a cytokine that stimulates the

growth and differentiation of B lymphocytes and is also agrowth factor for hybridomas and plasmacytomas. It is pro-duced by many different cells including T lymphocytes,

monocytes, and fibroblasts and concerns a variety of patho-logical and physiological processes [41]. Particularly, IL6plays a crucial part in keeping the dynamic equilibriumbetween osteogenesis and bone resorption [42], and IL6excreted by osteoblasts promotes osteoclast differentialactivities [43]. It is also reported that IL6 produced byadipose-derived stromal cells increases on account of theregulation of upstream factors and promotes the osteo-genic differentiation of ASCs [44]. As an extensivelyresearched signaling pathway, PI3K/Akt has been verifiedto be related to ossification [45, 46]. Our experiment re-sults showed the level of IL6 increased in osteogenic-induced ASCs and activated the PI3K/Akt signalingpathway which contains an IL6 receptor, hence furtherpromoting osteogenic differentiation. These results werein accord with previous reports.

ConclusionsIn conclusion, the present work found out the regulatorymechanism of HIF1A-AS2/miR-665/IL6 axis via thePI3K/Akt signaling pathway in ASC osteogenic differen-tiation. HIF1A-AS2 was upregulated in induced ASCs,strengthening the miR-665 sponge, thereby promoting

Fig. 7 Effects of HIF1A-AS2/miR-665/IL6 axis on the PI3K/Akt signaling pathway. a, b Western blot: effects of pcDNA3.1-HIF1A-AS2/pcDNA-IL6/agomiR-665 and PI3K inhibitor LY294002 (10 μM) on expression of PI3K/Akt-related proteins IL6/IL6R/Akt/p-Akt, reflecting the activation of thePI3K/Akt signaling pathway. c Alizarin red staining (21 days) and ALP staining (14 days): changes of calcium nodule formation and ALP activityafter pcDNA3.1-HIF1A-AS2/pcDNA3.1-IL6/agomiR-665 transfection or LY294002 treatment. *P < 0.05, **P < 0.01, compared with NC group; #P < 0.05,##P < 0.01, compared with sh-NC group

Wu et al. Stem Cell Research & Therapy (2018) 9:348 Page 11 of 13

the expression of the target gene IL6 through activatingthe PI3K/Akt signaling pathway. This study provided anew idea for exploring new methods in stimulating ASCosteogenic induction and may be conducive for the de-velopment of tissue engineering and treatment for bonediseases and injuries.

Additional file

Additional file 1: Table S1. KEGG pathway information of human.(DOCX 77 kb)

Abbreviations3′UTR: 3′-Untranslated regions; ALP: Alkaline phosphatase; ASCs: Adipose-derived stem cells; AVICs: Aortic valve interstitial cells; BMSCs: Bone marrowmesenchymal stem cells; BSA: Bovine serum albumin; ceRNA: Competingendogenous RNA; FBS: Fetal bovine serum; GEO: Gene Expression Omnibus;GSEA: Gene Set Enrichment Analysis; IL6: Interleukin-6; IL6R: IL6 receptor;KEGG: Kyoto Encyclopedia of Genes and Genomes; lncRNAs: Long noncodingRNAs; miRNAs: MicroRNAs; mRNA: Messenger RNA; MSC: Mesenchymal stemcell; PDLCs: Periodontal ligament cells; SD: Standard deviation; wt: Wild type

AcknowledgementsNot applicable.

FundingThis work was supported by the National Natural Science Foundation(81771523,81472110).

Availability of data and materialsThe datasets used and analyzed during the current study are available fromthe corresponding author on reasonable request.

Authors’ contributionsYS and CF researched the conception and design. ML and RW analyzed andinterpreted the data. ZS and JR analyzed statistically. RW and JR drafted themanuscript. CF and QW revised the manuscript critically. All authors approvedthe final manuscript.

Ethics approval and consent to participateAll experiments have been authorized by the ethics committee of ShanghaiJiao Tong University Affiliated Sixth People’s Hospital. Informed consentswere collected from all participants involved in this study.

Consent for publicationNot applicable.

Competing interestsThe authors declare that they have no competing interests.

Publisher’s NoteSpringer Nature remains neutral with regard to jurisdictional claims in publishedmaps and institutional affiliations.

Author details1Institute of Microsurgery on Extremities, Shanghai Jiao Tong UniversityAffiliated Sixth People’s Hospital, Shanghai 200233, China. 2Department ofOrthopaedics, Shanghai Jiao Tong University Affiliated Sixth People’s Hospital,No.600 Yishan Road, Xuhui District, Shanghai 200233, China. 3Department ofObstetrics and Gynecology, Shanghai Jiao Tong University Affiliated Sixth People’sHospital, Shanghai 200233, China. 4Institute of Nervous System Diseases, XuzhouMedical University, Xuzhou 221004, Jiangsu, China.

Received: 15 August 2018 Revised: 10 October 2018Accepted: 19 November 2018

References1. Crane JL, Cao X. Bone marrow mesenchymal stem cells and TGF-beta

signaling in bone remodeling. J Clin Invest. 2014;124:466–72.2. Huang G, Kang Y, Huang Z, Zhang Z, Meng F, Chen W, et al.

Identification and characterization of long non-coding RNAs inosteogenic differentiation of human adipose-derived stem cells. CellPhysiol Biochem. 2017;42:1037–50.

3. Wang CZ, Chen SM, Chen CH, Wang CK, Wang GJ, Chang JK, et al. Theeffect of the local delivery of alendronate on human adipose-derived stemcell-based bone regeneration. Biomaterials. 2010;31:8674–83.

4. Mueller SM, Glowacki J. Age-related decline in the osteogenic potential ofhuman bone marrow cells cultured in three-dimensional collagen sponges.J Cell Biochem. 2001;82:583–90.

5. Liu X, Shi S, Feng Q, Bachhuka A, He W, Huang Q, et al. Surface chemicalgradient affects the differentiation of human adipose-derived stem cells viaERK1/2 signaling pathway. ACS Appl Mater Interfaces. 2015;7:18473–82.

6. Jin C, Jia L, Huang Y, Zheng Y, Du N, Liu Y, et al. Inhibition of lncRNAMIR31HG promotes osteogenic differentiation of human adipose-derivedstem cells. Stem Cells. 2016;34:2707–20.

7. Guttman M, Amit I, Garber M, French C, Lin MF, Feldser D, et al. Chromatinsignature reveals over a thousand highly conserved large non-coding RNAsin mammals. Nature. 2009;458:223–7.

8. Zhuang W, Ge X, Yang S, Huang M, Zhuang W, Chen P, et al. Upregulationof lncRNA MEG3 promotes osteogenic differentiation of mesenchymal stemcells from multiple myeloma patients by targeting BMP4 transcription. StemCells. 2015;33:1985–97.

9. Huang Y, Zheng Y, Jia L, Li W. Long noncoding RNA H19 promotesosteoblast differentiation via TGF-beta1/Smad3/HDAC signaling pathway byderiving miR-675. Stem Cells. 2015;33:3481–92.

10. Lin J, Shi Z, Yu Z, He Z. LncRNA HIF1A-AS2 positively affects the progressionand EMT formation of colorectal cancer through regulating miR-129-5p andDNMT3A. Biomed Pharmacother. 2018;98:433–9.

11. Mineo M, Ricklefs F, Rooj AK, Lyons SM, Ivanov P, Ansari KI, et al. The longnon-coding RNA HIF1A-AS2 facilitates the maintenance of mesenchymalglioblastoma stem-like cells in hypoxic niches. Cell Rep. 2016;15:2500–9.

12. Chen M, Zhuang C, Liu Y, Li J, Dai F, Xia M, et al. Tetracycline-inducibleshRNA targeting antisense long non-coding RNA HIF1A-AS2 represses themalignant phenotypes of bladder cancer. Cancer Lett. 2016;376:155–64.

13. Liu M, Xing LQ, Liu YJ. A three-long noncoding RNA signature as adiagnostic biomarker for differentiating between triple-negative and non-triple-negative breast cancers. Medicine (Baltimore). 2017;96:e6222.

14. Li L, Wang M, Mei Z, Cao W, Yang Y, Wang Y, et al. lncRNAs HIF1A-AS2facilitates the up-regulation of HIF-1alpha by sponging to miR-153-3p,whereby promoting angiogenesis in HUVECs in hypoxia. BiomedPharmacother. 2017;96:165–72.

15. Chen D, Wu L, Liu L, Gong Q, Zheng J, Peng C, et al. Comparison ofHIF1AAS1 and HIF1AAS2 in regulating HIF1alpha and the osteogenicdifferentiation of PDLCs under hypoxia. Int J Mol Med. 2017;40:1529–36.

16. Rastgoo N, Pourabdollah M, Abdi J, Reece D, Chang H. Dysregulation ofEZH2/miR-138 axis contributes to drug resistance in multiple myeloma bydownregulating RBPMS. Leukemia. 2018. https://doi.org/10.1038/s41375-018-0140-y.

17. Sun YX, Zhang JF, Xu J, Xu LL, Wu TY, Wang B, et al. MicroRNA-144-3pinhibits bone formation in distraction osteogenesis through targetingConnexin 43. Oncotarget. 2017;8:89913–22.

18. Liao J, Yu X, Hu X, Fan J, Wang J, Zhang Z, et al. lncRNA H19 mediatesBMP9-induced osteogenic differentiation of mesenchymal stem cells (MSCs)through Notch signaling. Oncotarget. 2017;8:53581–601.

19. Nugent M. MicroRNAs: exploring new horizons in osteoarthritis. OsteoarthrCartil. 2016;24:573–80.

20. Seeliger C, Karpinski K, Haug AT, Vester H, Schmitt A, Bauer JS, et al. Fivefreely circulating miRNAs and bone tissue miRNAs are associated withosteoporotic fractures. J Bone Miner Res. 2014;29:1718–28.

21. Hu Y, Yang C, Yang S, Cheng F, Rao J, Wang X. miR-665 promoteshepatocellular carcinoma cell migration, invasion, and proliferation bydecreasing Hippo signaling through targeting PTPRB. Cell Death Dis.2018;9:954.

Wu et al. Stem Cell Research & Therapy (2018) 9:348 Page 12 of 13

22. Sun WC, Liang ZD, Pei L. Propofol-induced rno-miR-665 targets BCL2L1 andinfluences apoptosis in rodent developing hippocampal astrocytes.Neurotoxicology. 2015;51:87–95.

23. Deng Y, Zhou H, Zou D, Xie Q, Bi X, Gu P, et al. The role of miR-31-modifiedadipose tissue-derived stem cells in repairing rat critical-sized calvarialdefects. Biomaterials. 2013;34:6717–28.

24. Heair HM, Kemper AG, Roy B, Lopes HB, Rashid H, Clarke JC, et al. MicroRNA665 regulates dentinogenesis through microRNA-mediated silencing andepigenetic mechanisms. Mol Cell Biol. 2015;35:3116–30.

25. Xie Z, Tang S, Ye G, Wang P, Li J, Liu W, et al. Interleukin-6/interleukin-6receptor complex promotes osteogenic differentiation of bone marrow-derived mesenchymal stem cells. Stem Cell Res Ther. 2018;9:13.

26. Pricola KL, Kuhn NZ, Haleem-Smith H, Song Y, Tuan RS. Interleukin-6maintains bone marrow-derived mesenchymal stem cell stemness by anERK1/2-dependent mechanism. J Cell Biochem. 2009;108:577–88.

27. Sammons J, Ahmed N, El-Sheemy M, Hassan HT. The role of BMP-6, IL-6,and BMP-4 in mesenchymal stem cell-dependent bone development:effects on osteoblastic differentiation induced by parathyroid hormone andvitamin D(3). Stem Cells Dev. 2004;13:273–80.

28. Berenstein R, Nogai A, Waechter M, Blau O, Kuehnel A, Schmidt-Hieber M, etal. Multiple myeloma cells modify VEGF/IL-6 levels and osteogenic potentialof bone marrow stromal cells via notch/miR-223. Mol Carcinog. 2016;55:1927–39.

29. Bastidas-Coral AP, Bakker AD, Zandieh-Doulabi B, Kleverlaan CJ, BravenboerN, Forouzanfar T, et al. Cytokines TNF-alpha, IL-6, IL-17F, and IL-4differentially affect osteogenic differentiation of human adipose stem cells.Stem Cells Int. 2016;2016:1318256.

30. Bakhit A, Kawashima N, Hashimoto K, Noda S, Nara K, Kuramoto M, et al.Strontium ranelate promotes odonto-/osteogenic differentiation/mineralization of dental papillae cells in vitro and mineralized tissueformation of the dental pulp in vivo. Sci Rep. 2018;8:9224.

31. Parra-Izquierdo I, Castanos-Mollor I, Lopez J, Gomez C, San Roman JA,Sanchez Crespo M, et al. Calcification induced by type I interferon in humanaortic valve interstitial cells is larger in males and blunted by a Janus kinaseinhibitor. Arterioscler Thromb Vasc Biol. 2018. https://doi.org/10.1161/ATVBAHA.118.311504.

32. Bourin P, Bunnell BA, Casteilla L, Dominici M, Katz AJ, March KL, et al.Stromal cells from the adipose tissue-derived stromal vascular fraction andculture expanded adipose tissue-derived stromal/stem cells: a jointstatement of the International Federation for Adipose Therapeutics andScience (IFATS) and the International Society for Cellular Therapy (ISCT).Cytotherapy. 2013;15:641–8.

33. Liu J, Wang X, Jin Q, Jin T, Chang S, Zhang Z, et al. The stimulation ofadipose-derived stem cell differentiation and mineralization by ordered rod-like fluorapatite coatings. Biomaterials. 2012;33:5036–46.

34. Lindstad T, Qu S, Sikkeland J, Jin Y, Kristian A, Maelandsmo GM, et al.STAMP2 is required for human adipose-derived stem cell differentiation andadipocyte-facilitated prostate cancer growth in vivo. Oncotarget. 2017;8:91817–27.

35. Xu FT, Liang ZJ, Li HM, Peng QL, Huang MH, Li de Q, et al. Ginsenoside Rg1and platelet-rich fibrin enhance human breast adipose-derived stem cellfunction for soft tissue regeneration. Oncotarget. 2016;7:35390–403.

36. Man Y, Wang P, Guo Y, Xiang L, Yang Y, Qu Y, et al. Angiogenic andosteogenic potential of platelet-rich plasma and adipose-derived stem cellladen alginate microspheres. Biomaterials. 2012;33:8802–11.

37. Schubert T, Xhema D, Veriter S, Schubert M, Behets C, Delloye C, et al. Theenhanced performance of bone allografts using osteogenic-differentiatedadipose-derived mesenchymal stem cells. Biomaterials. 2011;32:8880–91.

38. Lu Z, Roohani-Esfahani SI, Kwok PC, Zreiqat H. Osteoblasts on rod shapedhydroxyapatite nanoparticles incorporated PCL film provide an optimalosteogenic niche for stem cell differentiation. Tissue Eng Part A. 2011;17:1651–61.

39. Monaco E, Bionaz M, Hollister SJ, Wheeler MB. Strategies for regeneration ofthe bone using porcine adult adipose-derived mesenchymal stem cells.Theriogenology. 2011;75:1381–99.

40. Farre-Guasch E, Marti-Page C, Hernadez-Alfaro F, Klein-Nulend J, Casals N.Buccal fat pad, an oral access source of human adipose stem cells withpotential for osteochondral tissue engineering: an in vitro study. Tissue EngPart C Methods. 2010;16:1083–94.

41. Rincon M. Interleukin-6: from an inflammatory marker to a target forinflammatory diseases. Trends Immunol. 2012;33:571–7.

42. Scheller J, Chalaris A, Schmidt-Arras D, Rose-John S. The pro- and anti-inflammatory properties of the cytokine interleukin-6. Biochim Biophys Acta.2011;1813:878–88.

43. Palmqvist P, Persson E, Conaway HH, Lerner UH. IL-6, leukemia inhibitoryfactor, and oncostatin M stimulate bone resorption and regulate theexpression of receptor activator of NF-kappa B ligand, osteoprotegerin, andreceptor activator of NF-kappa B in mouse calvariae. J Immunol. 2002;169:3353–62.

44. Huh JE, Lee SY. IL-6 is produced by adipose-derived stromal cells andpromotes osteogenesis. Biochim Biophys Acta. 2013;1833:2608–16.

45. Scanlon V, Walia B, Yu J, Hansen M, Drissi H, Maye P, et al. Loss of Cbl-PI3Kinteraction modulates the periosteal response to fracture by enhancingosteogenic commitment and differentiation. Bone. 2017;95:124–35.

46. Meng J, Ma X, Wang N, Jia M, Bi L, Wang Y, et al. Activation of GLP-1receptor promotes bone marrow stromal cell osteogenic differentiationthrough beta-catenin. Stem Cell Reports. 2016;6:579–91.

Wu et al. Stem Cell Research & Therapy (2018) 9:348 Page 13 of 13