low levels of human hip14 are sufficient to rescue … · 2017. 3. 23. · the thioesterase ppt1...

Low Levels of Human HIP14 Are Sufficient to RescueNeuropathological, Behavioural, and Enzymatic DefectsDue to Loss of Murine HIP14 in Hip142/2 MiceFiona B. Young, Sonia Franciosi, Amanda Spreeuw, Yu Deng, Shaun Sanders, Natalie C. M. Tam,

Kun Huang, Roshni R. Singaraja, Weining Zhang, Nagat Bissada, Chris Kay, Michael R. Hayden*

Department of Medical Genetics and Centre for Molecular Medicine and Therapeutics, Child and Family Research Institute, University of British Columbia, Vancouver,

British Columbia, Canada

Abstract

Huntingtin Interacting Protein 14 (HIP14) is a palmitoyl acyl transferase (PAT) that was first identified due to alteredinteraction with mutant huntingtin, the protein responsible for Huntington Disease (HD). HIP14 palmitoylates a specific setof neuronal substrates critical at the synapse, and downregulation of HIP14 by siRNA in vitro results in increased cell death inneurons. We previously reported that mice lacking murine Hip14 (Hip142/2) share features of HD. In the current study, wehave generated human HIP14 BAC transgenic mice and crossed them to the Hip142/2 model in order to confirm that thedefects seen in Hip142/2 mice are in fact due to loss of Hip14. In addition, we sought to determine whether human HIP14can provide functional compensation for loss of murine Hip14. We demonstrate that despite a relative low level ofexpression, as assessed via Western blot, BAC-derived human HIP14 compensates for deficits in neuropathology, behavior,and PAT enzyme function seen in the Hip142/2 model. Our findings yield important insights into HIP14 function in vivo.

Citation: Young FB, Franciosi S, Spreeuw A, Deng Y, Sanders S, et al. (2012) Low Levels of Human HIP14 Are Sufficient to Rescue Neuropathological, Behavioural,and Enzymatic Defects Due to Loss of Murine HIP14 in Hip142/2 Mice. PLoS ONE 7(5): e36315. doi:10.1371/journal.pone.0036315

Editor: Xiao-Jiang Li, Emory University, United States of America

Received February 1, 2012; Accepted April 2, 2012; Published May 23, 2012

Copyright: � 2012 Young et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: FBY is supported by the Canadian Institutes of Health Research-Institute of Genetics Walter and Jessie Boyd and Charles Scriver MD/PhD studentship(funding reference number IMD 78843; http://www.cihr-irsc.gc.ca). She has also received funding from the Michael Smith Foundation for Health Research asa Junior Trainee (Award Number: ST-JGS-00607(06-1)BM; http://www.msfhr.org/). MRH is a Killam University Professor and holds a Canada Research Chair inHuman Genetics and Molecular Medicine. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of themanuscript.

Competing Interests: The authors have declared that no competing interests exist.

* E-mail: [email protected]

Introduction

Protein palmitoylation involves the reversible addition of

palmitic acid to cysteine residues via a thioester bond, and plays

a key role in protein trafficking and neuronal function [1,2].

Twenty-three mammalian palmitoyl-acyl transferases (PATs), each

bearing a characteristic DHHC domain [3] and displaying distinct

substrate specificity [4] were identified as the enzymes responsible

for catalyzing protein S-palmitoylation. Palmitoylation plays

a critical role in neuronal function and health [5,6]. For example,

PAT dysfunction or loss has been associated with several human

diseases, including mental retardation (OMIM *300646, *300576)

[7,8], schizophrenia (OMIM *608784) [9–11], and Alzheimer’s

Disease (#104300) [12]. In contrast, far less is known about the

acyl protein thioesterases that are thought to catalyze palmitate

removal [13], but their importance in regulation of protein

palmitoylation has been highlighted by patients with mutations in

the thioesterase PPT1 (Entrez Gene ID 5538) that result in

neuronal ceroid lipofuscinosis [14].

Huntington Disease (HD, OMIM #143100) is an autosomal

dominant neurodegenerative disease that presents with cognitive,

motor, and psychiatric signs and symptoms [15]. Striatal volume

loss due to medium spiny neuron (MSN) degeneration is a key

feature of the disease [16]. HD results from an expansion of the

CAG repeat in the HD gene, resulting in a polyglutamine (poly-Q)

expansion in the N-terminus of the huntingtin (HTT) protein [17].

Huntingtin Interacting Protein 14 (HIP14, Entrez Gene ID

23390), also known as DHHC17, was first identified as part of

a yeast-two-hybrid screen for proteins that interact with HTT

(Entrez Gene ID 3064) [18]. Sequence similarity of HIP14 to

Akr1p (Entrez Gene ID 851857; one of the first reported PATs

and a protein required for endocytosis) together with the ability of

human HIP14 to rescue Akr1p trafficking defects, led to the formal

description of HIP14 as the first mammalian PAT soon after [19].

Many widely divergent proteins interact with HTT [20].

However, HIP14 was selected for further study because its

interaction with HTT is reduced in the presence of the mutation

responsible for HD [18], resulting in less robust palmitoylation of

HIP14 substrates [21] fulfilling genetic criteria for having

a potential relationship to the disease. The enrichment of HIP14

in the brain, its expression in the medium spiny neurons primarily

affected in HD, and its co-localization with HTT are all features

supportive of a role for HIP14 in the pathogenesis of HD [18].

HIP14 demonstrates PAT substrate specificity for many neuronal

proteins, including HTT as well as PSD-95 (Entrez Gene ID

1742), SNAP-25 (Entrez Gene ID 6616), and NR2B (Entrez Gene

ID 2904) [19]. More recently, the major site of palmitoylation of

HTT was identified as cysteine 214 and mutation of this site,

rendering HTT non-palmitoylatable, increases inclusion forma-

tion and neuronal toxicity. Similar results are obtained by treating

PLoS ONE | www.plosone.org 1 May 2012 | Volume 7 | Issue 5 | e36315

cells with HIP14 siRNA, whereas overexpression of HIP14 reduces

the appearance of inclusions [22].

Evidence supporting a protective role for HIP14 and further

implicating HIP14 in the pathogenesis of HD was obtained

through generation and characterization of a mouse lacking

murine Hip14 (Hip142/2, Entrez Gene ID 320150) [23]. These

mice bear features similar to those seen in the YAC128 mouse

model of HD. The latter transgenic model is widely studied and

recapitulates many features of human HD, including loss of MSNs

and striatal volume with accompanying motor, cognitive, and

affective dysfunction [24–26]. However, these phenotypes appear

earlier in the Hip142/2 mouse and are of greater severity, in

addition to being non-progressive [23]. For example, the Hip142/

2 mouse displays a 17% loss in striatal volume by embryonic day

E17.5, as compared to 9 months in the YAC128 mouse [24]. In

addition, the Hip142/2 mice demonstrate deficits in motor

function and palmitoylation of HIP14 substrates, again both

features observed in the YAC128 model.

Due to the putative protective role for HIP14 in HD suggested

by features of HD observed in the Hip142/2 mice, we sought to

create a mouse that overexpresses HIP14 in order to obtain

a greater understanding of HIP14 biology in vivo. To help ensure

a pattern of HIP14 overexpression closely resembling that of

normal physiology, we selected a Bacterial Artificial Chromosome

(BAC) transgenic approach, which permits inclusion of endoge-

nous regulatory DNA surrounding the gene of interest [27,28].

Because our primary goal remains to understand HIP14 biology as

it pertains to human disease, we selected a human HIP14

transgene.

The advantages of using the human gene when generating

transgenic mice in relation to the study of human disease has been

demonstrated in mouse models where the human gene is used in

artificial chromosome systems of transgenesis [29,30]. These

studies have been highly successful in generating mice that

accurately recapitulate the key aspects of the disease phenotype

and likely the underlying molecular cause of disease in patients,

rendering these models suitable for future use in preclinical studies.

Ultimately, a mouse overexpressing human HIP14 may be crossed

to mouse models of HD, anticipating that HIP14 overexpression

might delay the onset of the features of HD, or reduce their

severity.

Because of the very high level of sequence conservation between

human and mouse HIP14 protein (98% identical), we predicted

that human HIP14 would be compatible with the murine cellular

and transcriptional machinery. Previous studies demonstrate that

many human proteins can fully [29,31] or partially [32–35] rescue

the murine null phenotype.

The objective of this study was to confirm that defects seen in

Hip142/2 mice are indeed the result of the absence of HIP14. In

addition, we sought to determine the levels of HIP14 sufficient to

rescue the phenotype in Hip142/2 mice and whether certain

endpoints are more sensitive to loss of murine Hip14. Finally, we

wanted to address whether human HIP14 can compensate for loss

of the murine protein.

In this study, we have generated a human HIP14 BAC

transgenic mouse and confirmed a functional rescue of the

neuropathological, behavioral, and enzymatic deficits observed in

the Hip142/2 mouse by the human HIP14 transgene. In this

humanized mouse model, we report that human HIP14

Table 1. Sequences of primers used in this study.

Primer name Description Application Primer sequence

1 HIP14h_Pr1 Upstream/promoter area 1 F PCR genotyping cccagaggtccaaacaacat

R gcttttccaaccaggcttc

2 HIP14h_Pr2 Upstream/promoter area 2 F PCR genotyping tatttccctgcttccaatgc

R ttccccacttcctgtctctg

3 HIP14h_Ex1 Exon 1 F PCR genotyping cgggaggagggatttaacac

R gagtccggggaagaaagg

4 HIP14h_Int1 Intron 1 F PCR genotyping gaaccgtgctgagtggattc

R acacctccacctctgtcctc

5 Ex_7 Exon 7 F PCR genotyping cacagtcattagccttcttctgg

R gggtcctcctatcaacaccat

6 STOP Stop codon (spans stop codon) F PCR genotyping tttggggtgctgtttttagc

R attttcaggcaccactcagc

7 39UTR 39 untranslated region F PCR genotyping aatgggcgtaaaacagcatc

R ccacagaataacacggtaagtagc

8 hHIP14 F2/R2 Exon 1 F qPCR ccccgggagggtgaaac

R agcccgcttcggtatcgta

9 hHIP14 F1/R1 Exon 1–2 (intron-spanning) F qRT-PCR taccgaagcgggctgtgt

R agttttccgtccaagaggttcac

10 mHIP14 rt2f_F1/R1 Exon 14–15 (intron spanning) F qRT-PCR tggttgtgtctcttactgggg

R catccacggggagcatgtg

11 mbact F1/R1 mouse actin (endogenous control) F qPCR & qRT-PCR acggccaggtcatcactattg

R caagaaggaaggctggaaaaga

doi:10.1371/journal.pone.0036315.t001

Human HIP14 Rescues Loss of Murine HIP14 In Vivo


compensates for the key features resulting from loss of the murine

ortholog.

Materials and Methods

All experiments were carried out in accordance with protocols

(Animal protocols A07-0106 and A07-0262) approved by the UBC

Committee on Animal Care and the Canadian Council on Animal

Care.

Generation of HIP14 BAC mice & animal breedingstrategyA,190 kb long human Bacterial Artificial Chromosome (BAC)

containing the entire HIP14 gene (RP11-463M12) was obtained

from the Children’s Hospital Oakland Research Institute

(CHORI) (Figure S1a).

BAC DNA was prepared according to a standard protocol

obtained from the Rockefeller University NINDS GENSAT BAC

Transgenic project (http://www.gensat.org/GensatProtocols.pdf),

microinjected into FVB/N fertilized embryos, and implanted in

pseudopregnant female mice. Seven human-specific primers

spanning the HIP14 gene and surrounding sequence were

designed in order to characterize founders carrying the entire

construct, and for subsequent routine PCR genotyping (Table 1).

Animal breeding strategyBAC founders were identified using a standard genotyping

protocol. The highest-expressing line (HB4) was chosen for further

study, and BAC,Hip14+/26HIP14+/2 matings were set up to

obtain mice for use in the study, namely wildtype (WT) (Hip14+/+), Hip142/2 (Hip142/2), and the humanized BAC mice

(BAC,Hip142/2).

Figure 1. HIP14 mRNA and protein expression in Hip142/2 and HIP14 BAC mice. Human HIP14 mRNA (a) is expressed in BAC mice(p,0.0001) and no signal is detected in WT or Hip142/2 littermates (ANOVA p,0.0001, n = 6). Murine Hip14 mRNA transcript (b) is significantlyreduced in Hip142/2 mice (p,0.0001) and is not altered in the presence of human HIP14 (ANOVA p,0.0001, n = 6). Primers for mouse actin wereused as an endogenous control. HIP14 protein expression in striatum (c) and cortex (d) was assessed by western blot using an in-house HIP14polyclonal antibody. Beta-tubulin was used as a loading control. Striatum and cortex both n= 5. Post-hoc Tukey tests: ***p,0.0001.doi:10.1371/journal.pone.0036315.g001



Mice were genotyped at wean using tail clips, with two PCR

reactions: One for the human HIP14 BAC (Table 1, primer pair

5), and one for mouse Hip14 as described previously [23].

Genotypes of mice were re-confirmed at time of sacrifice.

Transgene copy number assessment by quantitative PCRA primer pair specific for human HIP14 exon 1 (Table 1, primer

pair 8) was designed using Primer Express 3.0 software (ABI).

Relative transgene copy number was assessed on the ABI 7500

Fast system using Power SYBR Green PCR Mastermix (Applied

Biosystems) and the relative quantitation settings. Signal was

normalized to mouse actin (Table 1, primer pair 11).

Isolation of RNA & quantitative RT-PCRTotal RNA was isolated using the Qiagen RNeasy Plus Mini kit

according to the kit instructions. Samples were subsequently

treated with DNase I (Invitrogen). cDNA was generated using the

SuperScriptH III First-Strand Synthesis System (Invitrogen). qRT-

PCR was performed on the ABI 7500 Fast Real Time PCR

System (Applied Biosystems).

Primers specific for human HIP14 mRNA (Table 1, primer pair

9) were used in Figure 1a. For Figure 1b, primers specific for

murine Hip14, annealing 39 to the gene-trap site in intron 5 were

used. Relative gene expression was normalized to mouse actin (as

above).

Preparation of protein lysate and Western Blots1 month mouse cortex or striatum tissue was homogenized

using a Dounce homogenizer on ice in 1 volume of TEEN

(50 mM Tris pH 7.5, 1 mM EDTA, 1 mM EGTA, 150 mM

NaCl) +1% SDS buffer. After initial lysis, 4 volumes of TEEN

+1% Triton X-100 was added. The sample was passed through

a 25 gauge needle 5 times and sonicated for 5 seconds on 20%

power, spun at 14,000 rpm at 4 degrees for 15 minutes, and the

supernatant transferred to a new tube. Protein concentration was

determined using the Bradford Assay (Biorad). The above buffers

were supplemented with the following reagents: 16 Complete

Protease Inhibitors (Roche), 1 mM sodium orthovanadate (Sigma),

800 mM PMSF (Sigma), 5 mM zVAD (Calbiochem). Equal

amounts of protein were loaded and run on 4–12% Bis-Tris

SDS-PAGE gels (Invitrogen). Immunoblots were obtained using

an in-house polyclonal rabbit HIP14 antibody (PEP1) described

previously [18]. Beta tubulin antibody T4026 was assessed as

a loading control (Sigma).

Stereology & Neuropathological AssessmentsMice aged 1 month received tail injections of heparin and were

terminally anesthetized by intraperitoneal injection of avertin,

followed by intracardiac perfusion with fresh cold 4% para-

formaldehyde in PBS, pH 7.0 for 10 minutes. Neuropathological

assessments were performed as previously described [24]. All

analysis was performed with the researcher blind to genotypes.

Quantification of DARRP-32, Enkephalin and Substance PImmunohistochemistry stainingImmunohistochemistry was performed on 1 month old mice of

mixed gender.

Primary antibodies were: mouse anti-DARPP32, #C24-6a

(from Dr. P. Greengard and Dr. H. Hemming), rabbit anti-

enkephalin (Chemicon), rat anti-substance P (Accurate Chemical).

Sections were incubated with horseradish peroxidase (HRP)

conjugated secondary antibodies (Jackson ImmunoResearch Lab-

oratories) followed by DAB and 0.5% cresyl violet and visualized

using a Zeiss Axioplan 2 microscope. Staining was quantified using

MetaMorph (Universal Imaging Corporation). Relative levels of

staining were calculated as the sum of the integrated optical

density divided by the area selected, then multiplied by the

sampling interval (68) and section thickness (25 mm). The

individual values were normalized to wild type.

Behavioral analysisMice were acclimatized to the behavioral testing holding room

under reverse lighting (12–10 pm dark cycle) at least one week

prior to behavioral testing at 3 months. Group-housed mice of

both genders were assessed. Single-housed mice were removed

from the analysis, and the experimenter was blind to genotype.

Table 2. A table summarizing the genotyping results for the 11 founders.

Primer Primer 1 Primer 2 Primer 3 Primer 4 Primer 5 Primer 6 Primer 7

RegionPromoterregion 1

Promoterregion 2 Exon 1 Intron 1 Exon 7 STOP 39 UTR

Founder line

HB1 + + + + + + +

HB2 + + + + + + +

HB3 + + + + + + +

HB4 + + + + + + +

HB5 + + + + + + +

HB6 + + + + + + +

HB7 + + + + + + +

HB8 + + 2 2 2 2 2

HB9 + + + + + + +

HB10 + + + 2 2 2 2

HB11 + + + + + + +

A ‘‘+’’ sign indicates that a PCR product was detected. A ‘‘2’’ sign indicates that no PCR product was detected, suggesting that a truncated BAC construct wasintegrated in these lines.doi:10.1371/journal.pone.0036315.t002



Accelerating rotarod test of motor coordination and

balance. Motor coordination and balance was assessed as

latency to fall on the accelerating rotarod apparatus (Ugo-Basile,

Norfolk, UK). Mice were trained for 3 days on a fixed-speed

rotarod at 3 months of age. On the fourth day, mice were tested

for latency to fall on an accelerating rotarod apparatus as

described [25]. Testing was repeated at 6 months of age (without

further training).

Med Associates spontaneous activity. Spontaneous activ-

ity was assessed using the Med Associates activity monitor system

(Med Associates Inc., St Albans, VT, USA) as described [23].

Mice were given transgel (Charles River) and acclimatized to the

room for at least 1 hour prior to testing, and testing did not

commence until 1 hour after the beginning of the dark lighting

cycle. The chamber was cleaned with ethanol and allowed to dry

between each animal. Each mouse was placed in the center of the

testing chamber. Spontaneous activity was recorded for 1 hour.

Palmitoylation assaysProtein palmitoylation was assessed using the Acyl-Biotin-

Exchange with Immunoprecipitation (ABE/IP) method [36] as

described previously [23]. For PSD-95, rabbit polyclonal antibody

used for IP was generously provided by the late Dr. Alaa El-

Husseini. PSD-95 mouse monoclonal antibody MAI-25629 was

used for western blot (Affinity Bioreagents, Golden, CO).

For SNAP-25, a mouse monoclonal antibody SMI-81 (Covance,

Emeryville, CA) was used for IP, and a rabbit polyclonal SNAP-25

antibody used for western blot (Synaptic Systems #111 002).

Palmitoylation (the Biotin-BMCC label) was detected using

a Streptavidin Alexa Fluor 680 conjugate antibody (Molecular

Probes #S-32358). All palmitoylation assessments were done on

whole brain of mice of combined gender aged 1–3 months. Each

sample was split in two and processed as technical replicates, in

order to reduce assay variability.

Body weightBody weight of mice was recorded at 3 & 6 months of age prior

to behavioral testing.

Figure 2. HIP14 rescues the neuropathological deficits seen in the Hip142/2 mouse. Mice aged 1 month were perfused with 4% PFA andsectioned using a cryostat, stained with anti-NeuN, mounted and volumes and neuronal counts were measured using Stereo investigator. a. Totalbrain weight shows a trend to rescue in mice aged 1 month, although one-way ANOVA analysis is not significant (WT: 321.563.78, Hip142/2:309.863.74, BAC: 319.265.32 g, ANOVA p= 0.14). Pairwise t-tests reveal that Hip142/2 whole brain weight is significantly decreased compared toWT (p= 0.04) and that BAC do not differ from WT (p= 0.7). b. Cerebellum weight is significantly decreased in Hip142/2 mice and is rescued to WTlevels in BAC mice at 1 month (WT: 51.4160.82, Hip142/2: 46.4560.83, BAC: 50.3461.38 g, ANOVA p= 0.0038). Pairwise t-test analysis similarlyreveals that Hip142/2 cerebellum is significantly decreased compared to WT (p= 0.0003) and that BAC do not differ from WT (p= 0.5). c. Forebrainweight shows a similar trend to rescue at 1 month of age (WT: 270.163.15, Hip142/2: 263.463.06, BAC: 268.964.27 g, ANOVA p=0.36). d. Striatalvolume is significantly rescued in BAC mice at 1 month of age (WT:10.460.3, Hip142/2: 8.860.4 mm3, BAC: 10.360.2 mm3; ANOVA p=0.002). e.Striatal neuron count is likewise rescued by the human HIP14 BAC at 1 month of age (WT:2.060.1, Hip142/2: 1.760.08, BAC: 2.160.03 million cells;ANOVA p=0.004). f. Finally, cortical volume loss observed in Hip142/2mice is also rescued by human HIP14 at 1 month (WT:26.8660.52, Hip142/2:23.6660.75, BAC: 26.2260.60 mm3; ANOVA p=0.003). Similar observations are made at 3 months of age (data not shown). 1 month n= 12, 12, and11 for WT, Hip142/2, and BAC respectively. * p,0.05, **p,0.01, ***p,0.0001.doi:10.1371/journal.pone.0036315.g002



Statistical AnalysisAll statistical analyses were performed using the Graphpad

Prism software, version 5a. Parametric analysis of single timepoint

data was performed using one-way ANOVA, with post-hoc Tukey

test. Non-parametric analysis (for western blot and palmitoylation

assays) was done using the one-way ANOVA Kruskal-Wallis test

with post-hoc analysis using Dunn’s Multiple comparison test.

Behavioral data collected over multiple time points is assessed

using repeated measures ANOVA with Bonferroni post-hoc

analysis. Data are reported as mean 6 SEM.

Results

Generation of HIP14 BAC miceA total of 494 FVB/N embyros were injected with a human

HIP14 BAC containing the entire HIP14 gene, 378 of which

survived and were implanted to pseudopregnant females. Forty-

five live-born pups were produced, of which 11 were positive for

the BAC by PCR genotyping. Nine of these 11 pups produced

a PCR product for all primer sets (Figure S1b), indicating

integration of an intact BAC construct. Two of eleven lines

integrated a partial construct (Table 2).

Assessment of transgene copy number by qPCR in the founders

indicated HB4 and HB6 as the two lines with the highest copy

number (Figure S1c & d). These were selected for further study,

and found to have comparable levels of HIP14 expression (data

not shown). Line HB4 was crossed to the existing Hip142/2 line

in order to asses for rescue in the present study.

mRNA levels in WT, Hip142/2, and BAC miceIntron-spanning primers specific for human HIP14 transcript

confirmed the presence of human HIP14 expression in mice

carrying the BAC transgene (BAC). An absence of amplification in

the WT or Hip142/2 mice (Figure 1a) confirmed that this

transcript arises from the human HIP14 transgene.

As mRNA expression had not been previously assessed in

Hip142/2 mice, we investigated transcript levels in WT,

Figure 3. BAC-derived HIP14 rescues the neurochemical phenotype seen in Hip142/2mice. Immunohistochemistry was assessed in miceaged 1 month. Staining intensity was reduced in the Hip142/2 and restored to normal levels for a. DARRP-32 (WT: 98.861.4, Hip142/2: 71.664.9,BAC: 92.463.9; ANOVA p,0.0001) and b. Enkephalin (WT: 91.968.5, Hip142/2: 40.568.2, BAC: 87.7612.3; ANOVA p= 0.0002). c. Substance-P wasunchanged in all three genotypes (WT: 100.0614.8, Hip142/2: 110.8613.0, BAC: 106.466.4; ANOVA p=0.8)***p,0.0001, **p,0.01.doi:10.1371/journal.pone.0036315.g003



Figure 4. Human HIP14 rescues behavioural alterations in the Hip142/2mouse. Deficits in motor coordination and balance are rescued byBAC-derived human HIP14. a. Repeated measures ANOVA in combined genders reveals a significant effect of genotype F(2,300) = 600, p = 0.0035.Bonferroni post-hoc analysis reveals that BAC mice perform consistently better on the accelerating rotarod task than Hip142/2mice (p,0.05 in trials1,4; p,0.01 in trials 5,6) and superior to WT mice in later trials (p,0.05 trial 5). All other post-hoc comparisons are non-significant (p.0.05). n = 25, 20,and 17 for WT, Hip142/2, and BAC respectively. (b–j) Human HIP14 normalizes the hyperactivity observed in Hip142/2 mice to WT levels.Spontaneous activity was assessed in Med Associates boxes at 3 and 6 months of age. Repeated measures ANOVA reveals a significant effect ofgenotype in ambulatory time (b; F(2,53) = 5.05, p = 0.0099) and counts (e; F(2,53) = 5.36, p = 0.0076), stereotypic time (c; F(2,53) = 19.70, p,0.0001)



Hip142/2, and BAC mice. A murine Hip142/2 specific intron-

spanning primer was designed to anneal downstream (exon 14–15)

of the gene trap used to create the Hip142/2 mice, which lies in

intron 5. Murine Hip14 transcripts were significantly reduced in

Hip142/2 compared to WT littermates, but still detectable in

Hip142/2 cortex. This was not significantly affected by the

presence of the human HIP14 BAC in BAC mice (Figure 1b).

The human HIP14 transgene generates a modest level ofhuman HIP14 protein expressionWe confirmed protein expression of HIP14 from the transgene

using a previously described HIP14 antibody [18], which detects

both mouse and human HIP14; thus, the band detected represents

total HIP14 protein. A faint band visible in Hip142/2 lanes was

confirmed to be non-specific, as it is not eliminated upon peptide

competition assay using a .500 molar excess of the peptide used

to generate the antibody (Figure S2). The human HIP14 transgene

is expressed at 36% and 35% of WT levels in striatum (Figure 1c)

and cortex (Figure 1d) respectively. Protein expression was

normalized to a beta tubulin loading control, and values are

shown relative to wildtype levels. HIP14 levels were significantly

increased in BAC mice relative to Hip142/2 in both striatum

(p= 0.0091 normalized to WT, p= 0.0083 as raw values) and in

cortex (p = 0.0016 normalized to WT, p= 0.019 as raw values).

Human HIP14 compensates for the neuropathologicaldeficits in Hip142/2 miceMice lacking murine Hip14 demonstrate neuropathological

deficits, including a 17% loss in striatal volume by embryonic day

E17.5, and an accompanying reduction in striatal neuron count

[23]. In order to assess whether the protein expressed from the

human HIP14 BAC is functional, we assessed a series of similar

neuropathological endpoints in Hip142/2 mice carrying the

human HIP14 BAC transgene, as compared to wildtype and

Hip142/2 littermates.

Brain weight is significantly decreased in Hip142/2 mice

throughout their lifespan [23]. In the current study, whole brain

weight and cerebellum are significantly decreased at 1 month in

Hip142/2 mice relative to WT; BAC mice are not significantly

different from WT in whole brain, cerebellum, or forebrain weight

(Figures 2a–c). One-way ANOVA analysis shows significant rescue

in cerebellum (Figure 2b) and a trend to restoration of WT values

in whole brain (Figure 2a) and forebrain (Figure 2c). Similar

observations are seen at 3 months (data not shown).

Similar to previous findings [23], Hip142/2 mice demonstrate

a 15.7% reduction in striatal volume at 1 month. This is fully

rescued to wildtype levels in Hip142/2 carrying the BAC

transgene (Figure 2d). Striatal neuron count is reduced by 14.3%

at 1 month in Hip142/2mice and this is also significantly rescued

to WT values in BAC (Figure 2e). Finally, an 11.9% reduction of

cortical volume in Hip142/2 at 1 month is rescued in the

presence of human HIP14 (Figure 2f).

and counts (f; F(2,53) = 15.13, p,0.0001), distance traveled (d; F(2,53) = 3.60, p = 0.034), time resting (g;(2,53) = 4.99, p = 0.010), and ambulatoryepisodes (j; F(2,53) = 8.68, p = 0.0005). A significant effect was not seen in vertical counts (h; F(2,51) = 1.89, p = 0.1611), and average velocity (i;F(2,54) = 0.68, p = 0.51). The most robust effects were observed for stereotypic time (c) and counts (f). Single-housed mice were excluded from allanalyses.*p,0.05, **p,0.01, ***p,0.0001.doi:10.1371/journal.pone.0036315.g004

Figure 5. Rescue of palmitoylation of key HIP14 in substrates in the Hip142/2 mouse. Rescue of palmitoylation deficits of key HIP14substrates in the Hip142/2mouse, as assessed by Biotin BMCC assay on HIP14 substrates PSD-95 (a) and SNAP-25 (b). ANOVA p=20.007, n = 5 each.*p,0.05.doi:10.1371/journal.pone.0036315.g005



Human HIP14 restores levels of DARPP32 and enkephalinin Hip142/2 MSNsThe striatal neuron populations affected in HD consist of

GABAergic projection neurons and parvalbuminergic interneur-

ons, while other neuron populations in the striatum remain

relatively spared. The majority (95%) of striatal neurons consist of

projection neurons; therefore, the striatal atrophy and cell loss

observed in HD is largely due to loss of striatal GABAergic MSNs,

cells that express high levels of DARPP-32 [37]. These MSNs are

subdivided into two types: those expressing enkephalin and

dopamine D2 receptors, and those expressing substance-P and

dopamine D1 receptors. Levels of enkephalin and DARPP-32 are

affected early in HD, whereas substance P remains largely

unchanged until later in the disease [37]. As in HD patients,

Hip142/2 mice demonstrate reduced levels of DARPP-32 and

enkephalin in the striatum, while levels of substance-P are

unchanged [23]. Similar to previous findings, striatal levels of

DARPP-32 were reduced by ,28% in Hip142/2 mice as

compared to wildtype, and this was restored to wildtype levels in

Hip142/2 expressing the human HIP14 BAC (Figure 3a).

Enkephalin levels were reduced by ,56% compared to wildtype,

while the BAC mice were similar to wildtype (Figure 3b). Striatal

levels of substance-P were similar for all genotypes (Figure 3c).

This data demonstrates that BAC-derived human HIP14 com-

pensates for the neurochemical deficits observed in the Hip142/2

mice.

Motor coordination impairments & altered locomotoractivity in the Hip142/2 mouse is restored to normal byhuman HIP14Hip142/2 mice demonstrate deficits in motor coordination as

early as 3 months of age [23]. We therefore assessed mice for

performance on an accelerating rotarod at 3 and 6 months of age.

Repeated measures ANOVA reveals a significant effect of

genotype (Figure 4a). BAC mice performed consistently better

than Hip142/2 littermates, remaining on the rotarod apparatus

for a longer time before falling. BAC performance was also

superior to WT littermates, and this was more apparent at later

trials. A non-significant trend of WT performance superior to

Hip142/2 is apparent. The consistently superior performance in

BAC mice suggests that human HIP14 BAC can completely

compensate for motor coordination deficits seen in Hip142/2

mice.

Hip142/2 mice are hyperactive in various measures of dark-

phase assessment of spontaneous activity, similar to the observa-

tions of hyperactivity in young YAC128 mice [24,25]. Spontanous

activity measures were assessed at 3 and 6 months of age

(Figure 4b–j). The most robust changes were observed in

stereotypic time (Figure 4c) and counts (Figure 4f), where repeated

measures ANOVA revealed a significant effect of genotype. Post-

hoc Bonferroni testing revealed an increase in both measures in

Hip142/2 vs. WT, and a robust rescue in BAC mice. A

significant effect of genotype was also observed in ambulatory time

(Figure 4b) and counts (Figure 4e), distance traveled (Figure 4d),

time resting (Figure 4g), and ambulatory episodes (Figure 4j),

where Hip142/2 mice displayed hyperactivity and a normaliza-

tion to wildtype values in BAC was observed. In summary, human

HIP14 compensates for the behavioral deficits observed in mice

lacking murine Hip14.

Palmitoylation deficits of HIP14 substrates in Hip142/2mice are normalized to wildtype levels by human HIP14HIP14 functions as a PAT for a number of critical neuronal

proteins, including PSD-95 and SNAP-25 among others [19].

Palmitoylation of these neuronal proteins is decreased in the

Hip142/2 mouse model, and the defect in palmitoylation may

underlie defects in trafficking observed in HD [23]. We sought to

Figure 6. BAC-derived Human HIP14 is not sufficient to rescue body weight in the Hip142/2mice. Hip142/2mice demonstrate reducedbody weight as early as 2 weeks of age (data not shown). a. Body weight is decreased in Hip142/2 females (89.2% of WT) at 3 months of age, andthis is partially rescued (93.8% of WT) in BAC mice (WT 23.4760.76, Hip142/2 20.9460.23 g, BAC 22.0260.44 g). At 6 months, a similar partial rescueis observed (WT 30.0061.74, Hip142/2 24.7560.49 g and 82.5% of WT, BAC 26.2960.69 g and 87.6% of WT). Repeated measures ANOVA revealsa significant effect of genotype in females alone (F(2,27) = 7.53, p = 0.0025). Bonferroni post-tests reveal that WT differs significantly from bothHip142/2 (p,0.0001) and BAC (p,0.01). n = 10, 10, and 9 for WT, Hip142/2, and BAC respectively. b. In males, Hip142/2 body weight is similarlydecreased at 3 months (86.7% of WT) with partial rescue (91.7% of WT) in BAC (WT 28.7960.56, Hip142/2 24.9560.57 g, BAC 26.3960.47 g). By 6months, partial rescue is further apparent (WT 33.9160.71, Hip142/2 28.3060.70 g and 83.45% of WT, BAC 30.7860.44 g and 90.75% of WT). Ahighly significant effect of genotype is present in males (F(2,37) = 26.81, p,0.0001). Bonferroni post-tests reveal a highly significant differencebetween WT and Hip142/2 at 3 and 6 months of age (p,0.0001), and a significant, but less robust, difference between WT and BAC mice at bothages (3 months p,0.05, 6 months p,0.01). However, BAC mice are also significantly different from Hip142/2 at both 3 (p,0.05) and 6 months(p,0.0001). n = 15, 10, and 8 for WT, Hip142/2, and BAC respectively.doi:10.1371/journal.pone.0036315.g006



confirm that the functional enzyme activity of BAC-derived

human HIP14 is intact, and to assess whether the human protein

product can compensate for the loss of murine HIP14. Similar to

previous findings, we observed reduced palmitoylation of PSD-95

in the Hip142/2 mice (Figure 5a). Palmitoylation of SNAP-25

was similarly reduced in the Hip142/2 mice, and returned to

wildtype levels in the BAC mouse (Figure 5b).

The reduction in body weight seen in Hip142/2 mice isonly partially rescued by human HIP14One of the features of HD in human patients is a progressive

loss of weight [15], and Hip142/2 mice fail to gain weight [23].

We therefore assessed whether BAC-derived human HIP14 can

compensate for this deficit. Hip142/2 mice aged 3 months

demonstrate reduced body weight relative to WT, and this is

partially rescued by human HIP14 in BAC mice in both genders

(Figure 6). This pattern is more apparent by 6 months of age in

both females (Hip142/2 82.5% and BAC 87.6% of WT) and

males (Hip142/2 83.5% and BAC 90.8% of WT). Weekly

measurements in a small subset of mice revealed that a similar

pattern of partial rescue in body weight is present at early as 2

weeks of age (data not shown).

Discussion

In this study we have demonstrated that human HIP14 can

compensate for the Hip142/2 phenotype in functional measures

of neuropathology, behavior, and PAT enzyme function. The

similarities in phenotype between HD and the Hip142/2 mice

highlighted a potentially important role for HIP14 in the

pathogenesis of HD. However, it remained to be conclusively

demonstrated that these phenotypes are the result of loss of HIP14

itself, and not, for example, a spontaneous mutation or a by-

product of unintended mutagenesis events occurring in the

generation of the Hip142/2 mouse model [38]. We created

humanized HIP14 BAC transgenic mice by crossing human

HIP14 BAC mice to mice lacking murine Hip14.

qRT-PCR experiments demonstrate that the transgene is

expressed in BAC mice, but entirely absent in WT and

Hip142/2 mice. However, the murine Hip14 transcript is

detectable in the Hip142/2 and BAC mice. This is not without

precedent; similar detection of mRNA transcripts in gene-trapped

mouse models has been previously reported [39–43]. It is possible

that alternative splicing may allow excision of the gene trap vector,

resulting in a low level of expression of the WT transcript.

However, whether murine HIP14 is generated from the deleted

transcript in the Hip142/2 mice was unclear. To determine if

HIP14 protein is completely absent in the Hip142/2 mice, and to

determine the level of HIP14 overexpression from the human

BAC, we performed western immunoblotting.

Western blot analysis in cortex and striatum demonstrates loss

of HIP14 in Hip142/2 mice, and expression at ,35% of

wildtype levels in BAC mice. Therefore, we have confirmed that

human HIP14 is expressed from the BAC transgene. A faint band

appeared in the Hip142/2 mice. This band appears to be non-

specific, as it remains after the antibody was inactivated with

a peptide competition assay (Figure S2), suggesting that any Hip14

mRNA generated does not generate HIP14 protein.

As human and mouse HIP14 protein are highly similar (98% of

amino acids identical), we anticipated that the human transgene

would compensate for the loss of its murine ortholog. Previous

studies demonstrated rescue of the murine huntingtin (Hdh2/2)

knockout phenotype by human HTT despite only 90% conserved

amino acid identity [29,44]. In addition, previous findings showed

that human HIP14 is able to partially compensate for the

endocytosis defect and temperature sensitive lethality resulting

from loss of Akr1p, a yeast ortholog of HIP14 [18]. As anticipated,

BAC-derived human HIP14 was capable of restoring a normal

phenotype in neuropathological, behavioral, and functional

enzymatic measures in mice lacking murine Hip14. Thus, our

findings suggest that human HIP14 undergoes the necessary post-

translational modifications and protein interactions necessary to

perform these functions in the mouse cellular context, and can

compensate for the loss of its murine ortholog in most measures

assessed. Because neuropathological deficits in the Hip142/2

mouse appear during prenatal development by embryonic day

E17.5, these findings furthermore suggest that the human HIP14

BAC transgene is appropriately expressed in prenatal develop-

ment.

As part of our study, we sought to assess what levels of HIP14

expression are sufficient to rescue the Hip142/2 phenotype.

Surprisingly, the human HIP14 transgene is expressed at only

,35% of endogenous levels in cortex and striatum of mice lacking

murine Hip14. Despite this relatively low level of expression, the

neuropathological, behavioral, and biochemical measures of

HIP14 assessed in this study are all fully rescued.

It is interesting to note previous investigations of another

DHHC PAT null mouse model, Zdhhc82/2, which revealed

similar deficits in both heterozygotes (Zdhhc8+/2) and homo-

zygotes (Zdhhc82/2) relative to WT littermates [11]. For

example, the density of glutamatergic synaptic contacts was

decreased to a similar extent in both Zdhhc8+/2 and Zdhhc82/2

mice. In addition, the number of mushroom spines, number of

dendritic branch points, and number of primary dendrites were

also affected in both genotypes [11]. In contrast, neuropatholog-

ical assessments of Hip14+/2 mice at 12 months revealed no loss

in striatal volume, an endpoint showing the greatest changes in

Hip142/2 mice as early as E17.5 [23]. As Hip14+/2 mice

express only 50% of endogenous HIP14, this data is in agreement

with the findings of the current study; namely, that only a fraction

of endogenous HIP14 expression levels are sufficient to prevent the

neuropathological changes observed in Hip142/2 mice.

Many studies report partial rescue of murine knockout

phenotypes by the human ortholog transgene. For example,

human NR2E1 rescues a murine Nr2e1 null phenotype in all

aspects except for retinal vessel number, which appeared to be

partially rescued but still significantly different from wildtype mice

[33]. Another study demonstrated the ability of a human CFTR

YAC transgene to partially rescue the murine knockout phenotype

[45].

While most major endpoints in the Hip142/2 mice were

restored to wildtype levels in the presence of the human HIP14

transgene, the reduced body weight observed in the Hip142/2

mice was only partially restored to wildtype levels. The incomplete

rescue of body weight in the humanized mice may occur for

a number of reasons. Firstly, as observed for retinal vessel number

in a similar study on Nr2e1 null mice [33], maintenance of some

physiological features may be more sensitive to gene dosage than

the other endpoints assessed in this study. A higher level of

expression (.35% of endogenous) may be required to restore body

weight to wildtype levels. Alternatively, the role of HIP14 in the

periphery may require a regulatory cis-element that is absent in

the human BAC transgene used in this study. Finally, some

functions of HIP14 may require an interaction between transcrip-

tional machinery and DNA regulatory elements that is in-

compatible between the former in mice and the latter in humans.



ConclusionsIn summary, we have generated the first transgenic mouse

model for HIP14, and demonstrate intact palmitoyl-transferease

activity in a transgenic DHHC PAT model. Humanized mice for

HIP14 were able to rescue defects in neuropathology, behavior,

and HIP14 PAT activity, and partially restored body weight to

wildtype levels. We report that human HIP14 compensates for the

key features resulting from loss of the murine ortholog at an

expression level equivalent to only ,1/3 that of endogenous

murine HIP14, which is sufficient for full rescue of most

phenotypes.

This latter finding carries important therapeutic implications.

We have previously shown that HIP14 is dysfunctional and

displays impaired PAT activity in the brain of the YAC128 mouse

model of HD despite normal levels of HIP14 protein [23]. The

current study suggests that therapeutic interventions in human HD

patients could be directed toward approaches to increase HIP14

activity, and that rescue of some phenotypes in YAC128 mice may

be achieved with less than wildtype levels of functional HIP14.

Supporting Information

Figure S1 Creation of aHIP14 BAC transgenic mouse. a.Schematic of genomic DNA included in human HIP14 BAC

RP11-463M12, which includes ,84 kb of upstream and ,6 kb

downstream regulatory sequence, excluding other intact genes or

clearly defined promoter sequences. Numbers indicate location of

seven primer pairs used to ascertain founders, listed in Table 1. b.PCR genotyping confirmation of tail DNA from FVB mice

generated from microinjections with a human HIP14 BAC. Eleven

mice tested positive for the transgene, of which 9 were positive for

all 7 primer sets assessed. Figure shows results for primer pair 2

(Table 1). BAC=HIP14 BAC (5 ng), S = FVB WT genomic DNA

spiked with HIP14 BAC at 1-copy number (200 ng), WT=FVB

WT genomic DNA, H20= ddH2O, * = these mice not positive on

all primer sets. c. qPCR assessment of relative transgene genomic

copy number in HIP14 BAC founder mice. HIP14 BAC-spiked

FVB genomic DNA was run in a standard curve for estimation of

BAC copy number on the same plate as genomic tail DNA from

each HIP14 BAC founder mouse. Relative quantitation was

calculated relative to the standard curve one-copy equivalent.

Each sample was loaded in triplicate, and the plate run in

duplicate. Error bars indicate the variation between the two plates.

The highest BAC copy number was detected in lines HB2, HB4,

and HB6. HB5F1 and HB7F1 are tail DNA from F1 offspring of

founders HB5 and HB7, respectively, run on the same plate. d.qPCR assessment transgene copy number in the HIP14 BAC F1

offspring reveals a pattern consistent with that observed in

founders (n = 6). Copy number estimates of F1 were calculated

relative to HB7.

(TIF)

Figure S2 Peptide Competition Assay on PEP1 HD82antibody for HIP14. Identical WT and Hip142/2 samples of

(a) Cortex and (b) Striatum lysate were run in duplicate on the

same gel on SDS-PAGE gels and transferred to PVDF membrane.

After blocking, membranes were cut in half and subsequently

processed in parallel. One half of each membrane was incubated

in PEP1 primary antibody according to the standard protocol

(control). The remaining half of the membrane was inciubated

with PEP1 primary antibody solution that had been pre-incubated

with a .500 molar excess of the peptide used to generate the

antibody. Subsequently, both membranes were washed and

incubated with secondary antibody according to the standard

protocol described in Materials and Methods. Beta tubulin was

probed as a loading control. Incubation with peptide-competed

primary antibody enables identification of non-specific bands. The

bands that disappear upon peptide-competition are specifically

recognized by the antibody; those that remain are non-specific.

Notably, the faint band apparent in Hip142/2 samples remains

in the peptide-competed membrane, indicating that this is a non-

specific band.

(TIF)

Acknowledgments

We thank Drs. Rona Graham and Mahmoud Pouladi for proofreading the

manuscript.

Author Contributions

Conceived and designed the experiments: FBY SF AS SSS RRS MRH.

Performed the experiments: FBY SF AS YD SSS NCMT KH RRS WZ

NB CK. Analyzed the data: FBY SF AS YD SSS NCMT KH MRH.

Contributed reagents/materials/analysis tools: FBY SF AS YD SSS RRS

MRH. Wrote the paper: FBY SF AS YD SSS NCMT KH RRS WZ NB

CK MRH. Approval of submitted version of article: FBY SF AS YD SSS

NCMT KH RRS WZ NB CK MRH.

References

1. Linder ME, Deschenes RJ (2007) Palmitoylation: policing protein stability and

traffic. Nat Rev Mol Cell Biol 8: 74–84.

2. Huang K, El-Husseini A (2005) Modulation of neuronal protein trafficking and

function by palmitoylation. Curr Opin Neurobiol 15: 527–535.

3. Greaves J, Chamberlain LH (2011) DHHC palmitoyl transferases: substrate

interactions and (patho)physiology. Trends Biochem Sci 36: 245–253.

4. Huang K, Sanders S, Singaraja R, Orban P, Cijsouw T, et al. (2009) Neuronal

palmitoyl acyl transferases exhibit distinct substrate specificity. FASEB J 23:

2605–2615.

5. El-Husseini AE-D, Bredt DS (2002) Protein palmitoylation: a regulator of

neuronal development and function. Nat Rev Neurosci 3: 791–802.

6. Fukata Y, Fukata M (2010) Protein palmitoylation in neuronal development and

synaptic plasticity. Nat Rev Neurosci 11: 161–175.

7. Mansouri MR, Marklund L, Gustavsson P, Davey E, Carlsson B, et al. (2005)

Loss of ZDHHC15 expression in a woman with a balanced translocation

t(X;15)(q13.3; en) and severe mental retardation. Eur J Hum Genet 13:

970–977.

8. Raymond FL, Tarpey PS, Edkins S, Tofts C, OMeara S, et al. (2007) Mutations

in ZDHHC9, which encodes a palmitoyltransferase of NRAS and HRAS, cause

X-linked mental retardation associated with a Marfanoid habitus. Am J Hum

Genet 80: 982–987.

9. Chen W-Y, Shi Y-Y, Zheng Y-L, Zhao X-Z, Zhang G-J, et al. (2004) Case-

control study and transmission disequilibrium test provide consistent evidence

for association between schizophrenia and genetic variation in the 22q11 gene

ZDHHC8. Hum Mol Genet 13: 2991–2995.

10. Mukai J, Liu H, Burt RA, Swor DE, Lai W-S, et al. (2004) Evidence that the

gene encoding ZDHHC8 contributes to the risk of schizophrenia. Nat Genet 36:

725–731.

11. Mukai J, Dhilla A, Drew LJ, Stark KL, Cao L, et al. (2008) Palmitoylation-

dependent neurodevelopmental deficits in a mouse model of 22q11 microdele-

tion. Nat Neurosci 11: 1302–1310.

12. Sidera C, Parsons R, Austen B (2005) Post-translational processing of beta-

secretase in Alzheimer’s disease. Proteomics 5: 1533–1543.

13. Zeidman R, Jackson C, Magee A (2009) Protein acyl thioesterases (Review). Mol

Membr Biol 26: 32–41.

14. Vesa J, Hellsten E, Verkruyse LA, Camp LA, Rapola J, et al. (1995) Mutations

in the palmitoyl protein thioesterase gene. Nature 376: 584–587.

15. Roos RA (2010) Huntington’s disease: a clinical review. Orphanet J Rare Dis 5:

40.

16. Vonsattel JPG, Difiglia M (1998) Huntington Disease. J Neuropath Exp Neur

57: 369–384.

17. Huntington Disease Collaborative Research Group (1993) A novel gene

containing a trinucleotide repeat that is expanded and unstable on Huntington’s

disease chromosomes.The Huntington’s Disease Collaborative Research Group.

Cell 72: 971–983.



18. Singaraja RR, Hadano S, Metzler M, Givan S, Wellington CL, et al. (2002)

HIP14, a novel ankyrin domain-containing protein, links huntingtin tointracellular trafficking and endocytosis Hum Mol Genet 11: 2815–2828.

19. Huang K, Yanai A, Kang R, Arstikaitis P, Singaraja R, et al. (2004) Huntingtin-

Interacting Protein HIP14 Is a palmitoyl transferase involved in palmitoylationand trafficking of multiple neuronal proteins. Neuron 44: 977–986.

20. Harjes P, Wanker EE (2003) The hunt for huntingtin function: interactionpartners tell many different stories. Trends Biochem Sci 28: 425–433.

21. Huang K, Sanders SS, Kang R, Sutton L, Wan J, et al. (2011) Wildtype HTT

modulates the enzymatic activity of the neuronal palmitoyl transferase HIP14.Hum Mol Genet 20: 3356–3365.

22. Yanai A, Huang K, Kang R, Singaraja RR, Arstikaitis P, et al. (2006)Palmitoylation of huntingtin by HIP14is essential for its trafficking and function.

Nat Neurosci 9: 824–831.23. Singaraja RR, Huang K, Sanders SS, Milnerwood A, Hines R, et al. (2011)

Altered palmitoylation and neuropathological deficits in mice lacking HIP14.

Hum Mol Genet 20: 3899–3909.24. Slow EJ, Van Raamsdonk JM, Rogers D, Coleman SH, Graham RK, et al.

(2003) Selective striatal neuronal loss in a YAC128 mouse model of HuntingtonDisease. Hum Mol Genet 12: 1555–1567.

25. Van Raamsdonk JM, Pearson J, Slow EJ, Hossain SM, Leavitt BR, et al. (2005)

Cognitive dysfunction precedes neuropathology and motor abnormalities in theYAC128 mouse model of Huntington’s Disease. J Neurosci 25: 4169–4180.

26. Van Raamsdonk JM, Warby SC, Hayden MR (2007) Selective degeneration inYAC mouse models of Huntington disease. Brain Res Bull 72: 124–131.

27. Gong S, Yang X (2005) Modification of bacterial artificial chromosomes (BACs)and preparation of intact BAC DNA for generation of transgenic mice. Current

Protocols in Neuroscience: John Wiley & Sons, Inc.. pp 1–14.

28. Yang XW, Model P, Heintz N (1997) Homologous recombination basedmodification in Esherichia coli and germline transmission in transgenic mice of

a bacterial artificial chromosome. Nat Biotechnol 15: 859–865.29. Hodgson JG, Smith DJ, McCutcheon K, Koide HB, Nishiyama K, et al. (1996)

Human huntingtin derived from YAC transgenes compensates for loss of murine

huntingtin by rescue of the embryonic lethal phenotype Hum Mol Genet 5:1875–1885.

30. Sarsero JP, Li L, Holloway TP, Voullaire L, Gazeas S, et al. (2004) HumanBAC-mediated rescue of the Friedreich ataxia knockout mutation in transgenic

mice. Mamm Genome 15: 370–382.31. Coutinho JM, Singaraja RR, Kang M, Arenillas DJ, Bertram LN, et al. (2005)

Complete functional rescue of the ABCA1 mouse by human BAC transgenesis.

J Lipid Res 46: 1113–1123.

32. Bradley SV, Hyun TS, Oravecz-Wilson KI, Li L, Waldorff EI, et al. (2007)

Degenerative phenotypes caused by the combined deficiency of murine HIP1and HIP1r are rescued by human HIP1. Hum Mol Genet 16: 1279–1292.

33. Abrahams BS, Kwok MCH, Trinh E, Budaghzadeh S, Hossain SM, et al. (2005)

Pathological aggression in ‘‘Fierce’’ mice corrected by human Nuclear Receptor2E1. J Neurosci 25: 6263–6270.

34. Chen JY, Levy-Wilson B, Goodart S, Cooper AD (2002) Mice expressing thehuman CYP7A1 gene in the mouse CYP7A1 knock-out background lack

induction of CYP7A1 expression by cholesterol feeding and have increased

hypercholesterolemia when fed a high fat diet. J Biol Chem 277: 42588–42595.35. Cheung C, Akiyama TE, Ward JM, Nicol CJ, Feigenbaum L, et al. (2004)

Diminished hepatocellular proliferation in mice humanized for the nuclearreceptor Peroxisome Proliferator-Activated Receptor alpha Cancer Res 64:

3849–3854.36. Drisdel RC, Green W (2004) Labeling and quantifying sites of protein

palmitoylation. Biotechniques 36: 276–285.

37. Deng YP, Albin RL, Penney JB, Young AB, Anderson KD, et al. (2004)Differential loss of striatal projection systems in Huntington’s disease:

a quantitative immunohistochemical study. J Chem Neuroanat 27: 143–164.38. Osokine I, Hsu R, Loeb GB, McManus MT (2008) Unintentional miRNA

ablation is a risk factor in gene knockout studies: A short report. PLoS Genet 4:

e34.39. Hoshii T, Takeo T, Nakagata N, Takeya M, Araki K, et al. (2007) LGR4

regulates the postnatal development and integrity of male reproductive tracts inmice. Biology of Reproduction 76: 303–313.

40. Lako M, Hole N (2000) Searching the unknown with gene trapping. ExpertReviews in Molecular Medicine 2: 1–11.

41. Roshon M, DeGregori JV, Ruley HE (2003) Gene trap mutagenesis of hnRNP

A2/B1: a cryptic 39 splice site in the neomycin resistance gene allows continuedexpression of the disrupted cellular gene. BMC Genomics 4: 1–11.

42. Trimborn M, Ghani M, Walther DJ, Dopatka M, Dutrannoy V, et al. (2010)Establishment of a mouse model with misregulated chromosome condensation

due to defective Mcph1 function. PLoS One 5: 1–13.

43. Voss AK, Thomas T, Gruss P (1998) Efficiency assessment of the gene trapapproach. Developmental Dynamics 212: 171–180.

44. Leavitt BR, Guttman JA, Hodgson JG, Kimel GH, Singaraja R, et al. (2001)Wildtype huntingtin reduces the cellular toxicity of mutant huntingtin in vivo.

Am J Hum Genet 68: 313–324.45. Manson AL, Trezise AEO, MacVinish LJ, Kasschau KD, Birchall N, et al.

(1997) Complementation of null CF mice with a human CFTR YAC transgene.

EMBO J 16: 4238–4249.



low levels of human hip14 are sufficient to rescue … · 2017. 3. 23. · the thioesterase ppt1...

Documents