mafb enhances oncogenic notch signaling in t cell acute ... · served signaling pathway that...

SC I ENCE S I GNAL ING | R E S EARCH ART I C L E

LEUKEM IA

1Department of Pharmacology, College of Medicine, University of Illinois at Chicago,Chicago, IL 60612, USA. 2Abramson Family Cancer Research Institute, University ofPennsylvania, Philadelphia, PA 19104, USA. 3Department of Pathology and LaboratoryMedicine, University of Pennsylvania, Philadelphia, PA 19104, USA. 4The James, OhioState University Comprehensive Cancer Center, Columbus, OH 43210, USA. 5Depart-ment of Pediatric Oncology/Hematology, Erasmus Medical Center, Rotterdam, Netherlands.6Princess Maxima Center for Pediatric Oncology, Utrecht, Netherlands. 7Department ofBiological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston,MA02115, USA. 8Department ofMicrobiology, University of Pennsylvania, Philadelphia,PA 19104, USA.*Corresponding author. Email: [email protected] (K.V.P.); [email protected] (W.S.P.)

Pajcini et al., Sci. Signal. 10, eaam6846 (2017) 14 November 2017

Copyright © 2017

The Authors, some

rights reserved;

exclusive licensee

American Association

for the Advancement

of Science. No claim

to original U.S.

Government Works

Dow

nloaded fro

MAFB enhances oncogenic Notch signaling in T cellacute lymphoblastic leukemiaKostandin V. Pajcini,1,2,3* Lanwei Xu,2,3 Lijian Shao,1 Jelena Petrovic,2,3 Karol Palasiewicz,1

Yumi Ohtani,2,3 Will Bailis,2,3 Curtis Lee,2,3 Gerald B. Wertheim,3 Rajeswaran Mani,4

Natarajan Muthusamy,4 Yunlei Li,5 Jules P. P. Meijerink,6 Stephen C. Blacklow,7

Robert B. Faryabi,2,3 Sara Cherry,8 Warren S. Pear2,3*

Activating mutations in the gene encoding the cell-cell contact signaling protein Notch1 are common in human T cellacute lymphoblastic leukemias (T-ALLs). However, expressing Notch1mutant alleles in mice fails to efficiently inducethe development of leukemia.We performed a gain-of-function screen to identify proteins that enhanced signaling byleukemia-associated Notch1 mutants. The transcription factors MAFB and ETS2 emerged as candidates that individu-ally enhancedNotch1 signaling, andwhen coexpressed, they synergistically increased signaling to an extent similar tothat induced by core components of the Notch transcriptional complex. In mouse models of T-ALL, MAFB enhancedleukemogenesis by the naturally occurring Notch1 mutants, decreased disease latency, and increased disease pene-trance. DecreasingMAFB abundance inmouse and human T-ALL cells reduced the expression of Notch1 target genes,including MYC and HES1, and sustained MAFB knockdown impaired T-ALL growth in a competitive setting. MAFBbound to ETS2 and interacted with the acetyltransferases PCAF and P300, highlighting its importance in recruitingcoactivators that enhance Notch1 signaling. Together, these data identify a mechanism for enhancing the oncogenicpotential of weak Notch1 mutants in leukemia models, and they reveal the MAFB-ETS2 transcriptional axis as apotential therapeutic target in T-ALL.

hm
on June 18, 2019
ttp://stke.sciencemag.org/

INTRODUCTIONT cell acute lymphoblastic leukemia (T-ALL) is an aggressive malig-nancy of immature T cell blasts that occurs in both children and adults(1). Although current treatments are relatively successful, especially inchildren (2), ~20% of patients are not cured by current therapy (1).Activating mutations in NOTCH1 are frequent, occurring in >60%of T-ALLs (3).

The intercellular Notch receptor–ligand interaction activates a con-served signaling pathway that regulates multiple cellular functions (4).Physiologic Notch signaling occurs when a Notch receptor interactswith a ligand of the Jagged or Delta-like family in a neighboring cell.This initiates a series of metalloproteinase- and g secretase–mediatedcleavages that release the intracellular Notch (ICN) domain from theplasma membrane. The ICN then translocates to the nucleus where itforms theNotch transcriptional complex (NTC)with theDNAbindingprotein RBPJ and a member of the Mastermind-like (MAML) family.This complex activates transcription of Notch target genes (5). TheNTC is short-lived and is tagged for degradation by proteins includingthe ubiquitin ligase Fbxw7, which recognizes PEST sequences residingin the ICN C terminus (6).

Activating NOTCH1mutations in T-ALL occur in the extracellularNotch1 regulatory region (NRR) and/or the C-terminal PEST domain(7). NRR mutations lead to ligand-independent signaling, whereas

PEST mutations limit ICN degradation. Thus, these mutations eitherincrease nuclearNotch1 and/or inhibit NTC turnover, which ultimatelyleads to dysregulated (increased) Notch1-mediated transcription. Theenhanced Notch1 signaling resulting from either of these mutationscan be inhibited by g-secretase inhibitors (GSIs), which prevent releaseof the ICN from the plasma membrane (3).

Expressing ICN1 inmurineT-ALLmodels rapidly induces leukemiain allmice; however, this formofNotch1 rarely occurs in humanT-ALL(3). In contrast, expressing mutated NOTCH1 alleles commonly asso-ciated with human T-ALL results in T-ALL with a much longer latencythat is incompletely penetrant (8). These findings suggest that eventsthat synergize with the weak Notch1 mutants and/or increase theirsignaling strength likely contribute to T-ALL. In support of this idea,coexpressing weak Notch1 alleles with mutations found in human pa-tients, such as oncogenic Ras, decreases T-ALL latency and increasespenetrance (8).

To identify potentially oncogenic hits that directly modify Notch1signaling, we performed a gain-of-function complementary DNA(cDNA) screen to discover molecules that enhance the ability of weakoncogenic NOTCH1 mutants. Among the hits were the transcriptionfactors MAFB and ETS2. MAFB belongs to the Maf family of AP1transcription factors, all of which contain a basic leucine zipper (bZIP)domain that binds two long palindromic sequences referred to as“MARE” sequences (9). MAFB also contains an N-terminal transcrip-tional activation domain, which optimally induces Maf target genetranscription by recruiting other transcriptional regulators (10, 11).MAFB serves many roles in embryonic development, including hema-topoiesis, where it exerts important functions in macrophage differen-tiation. In cancer, translocations of MAFB and its closely relatedhomolog, MAF, are frequent in multiple myeloma (12). ETS2 belongsto a large and nearly ubiquitously expressed family of transcriptionfactors that function in a wide variety of developmental roles (13). Inhematopoiesis, ETS2, like ETS1, with whom it shares close homology,is important for cortical thymocyte proliferation and survival (14–16).

1 of 12

http://stke.sciencemag.org/


D

ETS transcription factors are also dysregulated in multiple cancers, in-cluding Ewing’s sarcoma (17) and prostate cancer (18).

To determine the relevance of the findings of our screen, we inves-tigated the function of MAFB and ETS2 in multiple assays relevant toT-ALL pathogenesis. We found that although both MAFB and ETS2individually enhanced the signal strength of the Notch1 gain-of-function alleles, their coexpression resulted in synergistic activity thatwas comparable to the core NTC. Furthermore, MAFB alone increasedthe penetrance and decreased the latency of T-ALL induced in micewith weakNotch1 gain-of-functionmutants, whereas inhibitingMAFBin both human and murine T-ALL cells inhibited their growth and de-creased the expression of a subset of Notch target genes. We found thatMafB interacts with ETS2 and, in doing so, cooperates with the NTC toaugment Notch1-mediated transcription. We thus propose that MAFBfunctions to amplify the signaling output of naturally occurring Notch1mutants, a finding consistent with its expression in a high percentage ofhuman T-ALLs. Not only do these data identify new proteins that en-hance Notch1 function in T-ALL but they also identify MAFB as apotential new therapeutic target in T-ALL.

on June 18, 2019http://stke.sciencem

ag.org/ow

nloaded from

RESULTSA cDNA screen detects enhanced Notch signalingOurNotch1 gain-of-function screen relies on three genetic componentstransfected into U2OS cells: (i) a sensitive, synthetic Notch signaling re-porter (TP1) containing 12 iterated RBPJ-binding sites driving lucifer-ase expression in a pSP72 backbone; (ii) a cytomegalovirus (CMV)vector (pcDNA3) expressing a NOTCH1 mutant; and (iii) the cDNAlibrary, containing 18,000 open reading frames in the Sport6 CMVvector, individually preplated in 384-well plates (Fig. 1A). U2OS cellswere used because of their high transfectability and low basal Notchsignaling. We assayed several Notch mutants previously identified inprimary patient samples. We chose NOTCH1 L1601P-DeltaPest(LPDP) (8), which contains both heterodimerization domain (HD)and PEST mutations, because it consistently yielded a luciferase signalabove background and produced a significant z score of 0.602 abovebackground (fig. S1A). In contrast, the weaker NOTCH1 L1601P mu-tant (8), which lacks a PEST mutation, only marginally increasedbackground Notch signaling in U2OS cells. Both mutants were consid-erably weaker transcriptional activators than ICN1 (fig. S1A).

From the screen, we identified the top 30 candidate genes, ranked byrelative fold induction of reporter activity (Fig. 1B and table S1). Asexpected, the positive control MAML1, a critical NTC component,produced the greatest enhancement. Additional evidence that thescreen was specific was the identification of ATP2A3, which encodesSERCA3, and ERO1L, both of which are known to function in theNotch signaling pathway (19, 20).

MAFB induces dose-dependent enhancement ofNotch signalingWe independently validated the ability of several top candidate hits toactivate the TP1 reporter (Fig. 1C). Verified hits comprised severaltranscription factors includingMAFB and ETS2. Of the confirmed can-didates that we assayed, only MAFB showed a significant dose-dependent enhancement ofNotch reporter activity in combinationwithLPDP (Fig. 1D). Thiswas not a general effect ofMAFBon transcriptionalreporters because MAFB had minimal effects on a nuclear factor kB(NF-kB) reporter (fig. S1B). These findings led us to focus on MAFB.Although MAFB was not expressed in U2OS cells, it was expressed in


murine and human T-ALL cell lines and primagrafts (fig. S1, D and E).Furthermore, analysis of two independent patient data sets (21, 22) iden-tified a range of MAFB expression in primary human T-ALL samples(fig. S1, F and G).

MAFB and ETS2 combine to enhance Notch signalingETS2 was also identified as an enhancer in our screen (Fig. 1B), and itsclosely related homolog, ETS1, is known to interact with MAFB (23).We used Notch reporter assays to test the potential cross-talk betweenMAFB and ETS2. The two geneswere transfected intoU2OS cells alongwith LPDP. Not only did MAFB and ETS2 synergistically increase re-porter activity but the signal was also comparable to that induced by theMAML1 positive control (Fig. 1E). Although MAFB and ETS2 syner-gized in this reporter assay, MAFB appeared to be the limitingcomponent. A twofold decrease in the amount of MAFB decreasedthe reporter signal by ~50%, whereas a fourfold drop in ETS2 DNAconcentration resulted in ~25% decrease in Notch1 reporter activity(fig. S1C). These results support a robust, two-component enhance-ment of the LPDP mutant, with MAFB playing the major role.Consistent with MafB being the limiting component, both Ets1 andEts2 are highly expressed in after b-selection thymocytes, whereasMafBexpression is much lower in these populations [www.immgen.org/databrowser/index.html (24)].

MAFB increases penetrance and decreases latency ofNotch-induced T-ALLTo assess the effect of MAFB in vivo, we assayed its ability to influencethe leukemogenic activity of LPDP in a retroviral transduction/bonemarrow transplant (BMT) model (Fig. 2A) (25). Notch LPDP wasexpressed from a murine stem cell virus retroviral vector (MigR1) co-expressing green fluorescent protein (GFP) (26), whereas MAFB retro-viral particles coexpressed truncated nerve growth factor receptor(NGFR) (8), thus providing the ability to distinguish between them.

Reconstitutedmice weremonitored at various times after BMT. At4 weeks after BMT, CD4+CD8+ T cells accumulated in the peripheralblood of ICN and LPDP+MAFB mice (Fig. 2B). This population alsoexpressed the GFP+ (ICN or LPDP) or GFP+NGFR+ (LPDP+MAFB+)surrogate markers, indicating that they originated from the trans-duced progenitors. Consistent with previous data, mice reconstitutedwith ICN1 succumbed toT-ALLwith a 100%penetrancewithin 80 daysafter BMT, with amedian survival time of 58 days, whereasmice receivingLPDPalonedevelopedT-ALLwithapenetranceof36%and latencygreaterthan 100days (Fig. 2C) (8, 25, 27).None of themice receivingMAFBalonesuccumbed to leukemia. In contrast, 16 of 16 mice reconstituted withLPDP+MAFB succumbed to T-ALL with a median survival of 72 days.Consistent with the Kaplan-Meier plots, the white blood cell counts(WBCs) of the LPDP+MAFB mice were significantly higher than theLPDP-only transduced mice (Fig. 2D), as were the spleen weights andpercentage of infiltrating tumor cells in tissues compared to the LPDP-only mice (fig. S2). Together, these data show that MAFB strongly en-hances the ability of weakly activating Notch1 mutants to induce T-ALL.

Suppressing MafB inhibits Notch signaling and T-ALLcell growthTo understand the function of MafB in T-ALL, we suppressedMafBin T6E cells with fluorophore-conjugated small interfering RNAs(siRNAs). T6E cells were chosen because they express high levelsof MafB (fig. S1D). At 48 hours after treatment, >90% of T6E cellsexpressed the fluorophore (fig. S3A), and both siRNAs reduced

2 of 12

http://www.immgen.org/databrowser/index.html

http://www.immgen.org/databrowser/index.html



MafB expression by ~50% (Fig. 3A). There was a concomitant decreasein the direct Notch1 targets Hes1, Myc, Notch3, and Deltex1 as well asthe Myc target CAD (Fig. 3B). In contrast, neither the expression ofHey1 nor that of the negative control, GAPDH, changed (Fig. 3B andfig. S3B).

To persistently inhibitMafB, we transduced T6E cells with retroviralvectors expressing MafB short hairpin RNAs (shRNAs). Both shRNAssuppressed MafB as well as Hes1 andMyc expression (fig. S3, C to E).Because NTCs recruit p300 to activate transcription (28, 29), we per-formed chromatin immunoprecipitation (ChIP)–PCR for this proteinon T6E cells treated withMafB shRNAs to determine p300 occupancyat the 5′ promoter region of Hes1 and at the 3′ Notch-dependentMycenhancer (NDME), both of which are known to recruit p300 in a Notch-dependent manner (30). When compared to scrambled shRNA


(shScrmb)–treated cells, the loss of MafB significantly reduced p300 in-teraction at both the Hes1 promoter and the NDME (Fig. 3C).

To gain further insights into the effect ofMafB onNotch1-dependenttranscription, we performed ChIP sequencing (ChIP-seq) for the histoneacetylation mark H3K27Ac on T6E cells treated with shScrmb orMafBshRNAs. We chose H3K27Ac because changes in Notch occupancyproduce dynamic alterations in H3K27Ac levels at both enhancers andpromoters of Notch1-dependent genes in T-ALL (31). To identifyNotch1-dependent genes in T6E cells, we performed a GSI-washout ex-periment (32) to compare expressed genes in theNotch-off toNotch-onstates (31, 32). Using stringent criteria (see Materials andMethods), weidentified 59 Notch1 positively regulated transcripts (table S2). Wethen analyzed the effect ofMafB knockdown on the putative enhancers,marked by H3K27Ac of these 59 Notch positively regulated transcripts.


ag.org/D

ownloaded from

A

NOTCH1-LP P

pcDNA3 TP1

Notch luciferase reporter

Light

U2OS cells

transfection

Preplated cDNA Lysis reagent High-throughput readout

Screen cDNA gene symbol

Fold induction over empty

vector

Fold induction over NOTCH1-

LPΔP• MAML 27.69 6.71 • PKACA 15.32 3.72 KLF15 14.54 3.52 HMGB2 12.62 3.06 TSPAN1 11.27 2.74 • SERCA3 11.20 2.72 METRNL 11.11 2.70 TYSND1 10.64 2.58 SUMO2 10.42 2.53 • ERO1L 10.37 2.51 BDH1 10.27 2.50 MMP14 10.20 2.47 • ARF4 10.17 2.47 TSPAN4 10.09 2.46 • MAFB 9.61 2.33 TMPRSS2 9.56 2.32 RAD18 9.42 2.29 • ERO1-A 9.25 2.24 HMG4 9.23 2.24 MGAT1 9.21 2.24 CALLA 9.15 2.22 MKP5 9.13 2.15 CAC 9.10 2.11 MAL2 9.09 2.11 MAFG 8.82 2.09 CED 8.78 2.01 OP1 8.69 1.99 HAI-2 8.47 1.97 • ETS2 8.45 1.97 ARH1 8.44 1.97

B

C

***

** ***** * * *

**

D

******

control

LPΔP LPΔP

EVLP

ΔP

MAMLETS2

MAFB + ETS2

0.0

2.5

5.0

7.5

10.0

12.5**

NS

**

E

0

10

20

30

0

10

20

30

40

50

LPΔP

MAFB

Fig. 1. Screen to identify novel enhancers of Notch signaling. (A) Schematic of the methodology used in the cDNA gain-of-function screen. (B) List of candidategenes potentiating NOTCH1 LPDP activity. MAML1control is the MAML1 positive control. Black dots indicate candidates that were independently verified in reporterassays. (C) Luciferase induction using the Notch-responsive TP1 reporter and LPDP to validate candidates identified in the screen. Data were quantified relative to theempty vector (EV) control. (D) Luciferase assay using the TP1 reporter (40 ng per well) and LPDP (40 ng per well) and assaying dose dependency of Notch activation byETS2 (40, 80, and 120 ng per well) or MAFB (40 and 80 ng per well). (E) Luciferase TP1 reporter assay with LPDP when MAFB and ETS2 were singly or cotransfected (at 40 ngeach). To normalize the amount of plasmid per well, we added EV so that the total amount of DNA was 80 ng per well (not including reporters). Data are from threeindependent experiments. *P ≤ 0.05, **P ≤ 0.005, ***P ≤ 0.0005, ****P ≤ 0.0001 by unpaired t tests. NS, not significant.

3 of 12



http://stke.scieD

ownloaded from

Suppression ofMafB decreasedH3K27Ac by at least 1.4-fold in 37 of 59(62%) Notch1-responsive genes (Fig. 3D and table S2). These includedthewell-known direct Notch targetsDtx1,Myc,Notch3,NRarp,Notch1,and IL2RA (Fig. 3E, fig. S3F, and table S2). Although Hes1 expressionsignificantly decreased in the GSI-washout condition, the decrease inH3K27Ac abundance did not meet our 1.4-fold threshold, because itdecreased by only 1.2-fold; nevertheless, there was a decrease inH3K27Ac loading at the 5′ site of the Hes1 transcription start site (fig.S3F). Furthermore, shMafB is not a global inhibitor of transcription,given that many genes, such as Trib1, which is not a Notch1 target,showed no change in H3K27Ac (fig. S3F). Together, these data suggestthat inhibiting MafB decreases Notch-mediated transcription at a sig-nificant number of direct Notch target genes (binomial P value = 0.06).

To test the fitness of T-ALL cells treated withMafB-shRNAs, we per-formed an in vitro competition assay comparing the shMafB-transducedT6E cells to cells receiving the shScrmb control (Fig. 3F). Unlike cellstransduced with scrambled control vectors, the shMafB-transduced cellswere outcompeted by the shScrmb cells (Fig. 3G). These findings suggestthat inhibiting MafB represses T-ALL cell growth by inhibiting the ex-pression of crucial Notch1 targets, such asMyc, Dtx1, and Hes1.

Increased MAFB expression promotes growth and subvertsthe effects of GSI in T-ALL cellsTobetter understand the effect of increasedMAFB expression inT-ALLcells, we retrovirally expressed human-MAFB in T6E cells. Because ofthe poor quality of commercial anti-MafB antibodies, we appended 5′HA or FLAG molecular tags to the MAFB coding sequence. Weselected cell lines with different amounts of MAFB overexpression;HA-MAFB was slightly higher, whereas FLAG-MAFB was much high-


er than endogenous murine MafB protein (Fig. 4A). In both cell lines,the expression of theNotch1 target genesHes1 andMycwas significant-ly increased (Fig. 4, B and C), and this was accompanied by increasedcell proliferation (fig. S4A).

We tested whether increased MAFB expression could compensatefor decreased Notch1 signaling in T-ALL cells treated with GSIs. To de-termine the appropriate dose of GSI treatment for T6E cells, we titratedthe concentration of GSI and determined that the range 0.1 to 0.01 mMreducedHes1 expression by ~50% (fig. S4B).We next performed aGSI-washout experiment (33). As expected, GSI treatment down-regulatedthe Notch targets Hes1 and Myc, which were up-regulated after GSIwashout (Fig. 4, D and E, black bars). However, the effects of boththeGSI treatment and thewashout were blunted in T6E cells expressingHA-MAFB (Figs. 4, D and E, gray bars). We next assayed cell growthunder GSI treatment. As anticipated, MigR1 cells treated with DMSOcontinued to proliferate, whereas those treated with GSI experiencedgrowth arrest as early as 48 hours after treatment. On the other hand,the MAFB-overexpressing cells continued to expand (Fig. 4F). Thesefindings support a role forMAFB to enhance Notch1 function and sug-gest that T-ALL tumors expressing high amounts of MAFB may bemore resistant to GSI-based therapies.

MAFB enhances Notch signaling by interacting with ETSMAFBandETS2were initially detected by our luciferaseNotch reporterscreen; thus, we testedwhetherMAFBdirectly binds to theRbpj/Notch1sites in the TP1 reporter. For this, we used oligo-IP (OIP) assays, wherea biotinylated oligonucleotide containing the consensus Rbpj/Notch1(CSL) binding sequence (CGTGGGAA) found in the TP1 reporterwas added to the lysate of U2OS cells transfected with vector control,

on June 18, 2019ncem

ag.org/

A

B

C

D Days posttransplant

T-A

LL fr

ee (%

)

***

GFP

NG

FR

CD4CD

8

LPΔP+MAFBLPΔPMafBICN

0

40

80

120

160

200

ICN MafB LPΔP LPΔP+MAFB

***

ICNMAFB-onlyLPΔP-onlyLPΔP+MAFB

59.0

0 100 200 3000

50

100

Fig. 2. MAFBenhances T-ALL onset of aweak Notch gain-of-function allele. (A) Schematic representation of experimental design for retroviral transduction of 5-fluorouracil(5-FU)–treated BM progenitors. When only a single cDNA was expressed (MAFB-only, ICN-only, or LPDP-only), an equivalent dose of the retroviral vector (either MigR1 or MigR1-NGFR)was used to normalize the total retroviral titers. (B) Peripheral blood analysis of the four cohorts of transplantedmice (ICN, n= 8;MAFB n= 9; LPDP, n= 14; and LPDP+MAFB,n = 15) 4 weeks after BMT. Representative populations shown were gated for live, singlet, and Lin− cells. NGFR is the surrogate marker for MAFB transduction, and GFP is thesurrogatemarker for Notch-mutant transduction. (C) Kaplan-Meier plot indicating percent T-ALL–freemice (that is, insert space between free andmice) after BMT. Additional animalsthat succumbed to non–T-ALL conditions, such as irradiation poisoning (MAFB-only, n = 1; LPDP-only, n = 1) and BM failure or anemia (LPDP-only, n = 1), were excluded from theanalysis. (D) WBC counts in the peripheral blood of the mice in each of the experimental cohorts. A diagnostic threshold for tumor onset of 40 million/ml of WBCs and circulatingdouble-positive (DP) T cells in the peripheral blood was used as a benchmark for T-ALL, as previously described (8, 25). ***P ≤ 0.0005 by Mantel-Cox test (C) or unpaired t test (D).

4 of 12



MAFB, ETS2, or MAFB and ETS2 (Fig. 5A). Of particular relevance, weidentified the core DNA sequence for ETS factor binding (C/A)GGAA(G/A) (34) interspaced between the Rbpj binding sequences of the TP1 re-porter (underlined in Fig. 5A). TheOIP assay revealed ETS2 binding to theTP1 oligo; however,MAFBbound only in the presence of exogenous ETS2,which is only marginally expressed in U2OS cells (Fig. 5B). This same de-pendency of MAFB on ETS factors was confirmed for ETS1 (fig. S5A).

These data also suggest that lack of Ets factors will limit MafB-dependent enhancement of Notch signaling and delay T-ALL onsetin vivo.We tested this using the BMTmodel described in Fig. 2; however,for these studies, we transplanted the BM from ETS1−/− donor hemato-poietic progenitors (35) thatwere transducedwith ICN1orLPDP+MAFB.


Although Ets1 deficiency had minimal effects on T-ALL onset in cellstransducedwith ICN1, the loss of a single Ets factor significantly decreasedT-ALLpenetrance in recipientmice,withmedian survival increasing from72 days in wild-type (WT) BM donors transduced with LPDP+MAFB to160 days in ETS1−/−BMdonors transducedwith LPDP+MAFB (fig. S5B).These results suggest that the amount of Etsmay influence disease latency,even in the presence of MafB.

MAFB interacts with ETS2 through its bZIP domain andfunctions to recruit transcriptional coactivatorsTo determine whetherMAFB directly binds ETS factors in T-ALL cells,we transduced T6E cells with epitope-taggedMAFB and performed IPs


ag.org/D

ownloaded from

BA

untre

ated

Scrmb-s

iRNA0.0

0.5

1.0

1.5

Maf

B ex

pres

sion

***

DMafB-si

RNA#1

MafB-siRNA#2

MafB-dependent H3K27Ac MafB-independent H3K27Ac

Notch-dependent transcripts

F

Day 0 Day 3 Day 6 Day 9 Day 120

20

40

60

80

(%) l

ive

cells

shScrmb-GFPshScrmb-NGFR

G


20

40

60

80


20

40

60

80

shScrmb-GFPshMafB#1-NGFR

shScrmb-GFPshMafB#3-NGFR

Transduce with shRNA

Recover for 24 hours in culture

FACS

Seed in equal numbers for competition

Harvest RNA for expression analysis

T6E

37 (62.7%)

22

Myc

E 20 kb mm10chr5: 120,675,000

Dtx1

shScrmb

shScrmb

500 kb mm10chr15: 62,100,000

Pvt1

2.2

2.2

Myc

2.2

2.2

shMafB#3

shMafB#3

NDME

siScrmbMafB-siRNA#1

C

Hes1

NDME

GAPDH0.0

0.2

0.4

0.6

0.8

1.0

% o

f P30

0 in

put

shScrmbMafB-shRNA#3

Myc

*** ***

Rela

tive

expr

essio

n

Fig. 3. MafB-deficient T-ALL cells down-regulate Notch targets and perform poorly in competitive culture conditions. (A) MafB expression measured by quantitativereverse transcription polymerase chain reaction (qRT-PCR) in T6E cells 48 hours after treatment with indicated siRNAs relative to that in cells cultured with transfection reagent(untreated). *P ≤ 0.05, **P ≤ 0.005 by unpaired t test. (B) Relative expression analysis by qRT-PCR of Notch signaling and Myc signaling (CAD) targets and expression controls(GAPDH) inMafB-siRNA#1–treated cells relative to each in Scrmb-siRNA–treated cells. (C) ChIP assaymeasuring the occupancy of P300 at the Hes1 promoter and at the NDME inMafB-shRNA#3–treated T6E cells. Genomic DNA sequence of GAPDH is used as the nonspecific control. ***P < 0.0005 by unpaired t test. (D) Pie chart representation of Notch-dependent gene expression stratified on the basis of differential H3K27Ac abundancemeasured byChIP-seq analysis of T6E cells transfectedwith shScrmbor shMafB#3. Of the59 Notch-dependent transcripts, as determined by a GSI-washout experiment, 37 have nearby MafB-dependent H3K27Ac regions, which display a fold change of ≤−1.5 (darkgray portion of the pie chart). (E) Genome tracts of individual examples of MafB-dependent H3K27Ac for Notch target genes (Dtx1, top; Myc, bottom) in T6E cells transfectedwith shScrmb or shMafB#3. kb, kilobase. (F) Schematic representation of the experimental design forMafB shRNA–treated T-ALL cells. The cells were sorted for their respectivemarkers and subsequently cultured in equal numbers directly afterward. Every 3 days, the percentage of the cellular population bearing each marker was determined in analiquot of the competition culture. FACS, fluorescence-activated cell sorting. (G) Left: Competition assay of T6E cells treated with GFP+ or NGFR+ shScrmb plated in equalnumbers (2.5 × 105) at day 0 (no significant difference; n = 3). Middle and right: Competition assay of T6E cells treated with GFP+ shScrmb or one of two NGFR+ MafB shRNAsplated in equal numbers (2.5 × 105) at day 0 (n = 3). P = 0.02 and 0.03, respectively.

5 of 12



to identify binding partners (Fig. 5C).MAFB strongly bound both ETS1and ETS2, which are highly homologous (16). Previous studies of theMAFB homolog, MAFA, showed that it forms complexes with impor-tant transcriptional coactivators with histone acetyltransferase activity,including the P300/CBP-associated factor (PCAF) complex (36) andp300 (37), both of which are recruited to NTCs where they activatetranscription (38, 39). To test whether MAFB interacts with PCAFand P300, we performed IPs in T6E cells expressing FLAG-taggedMafB. Our results indicate that MafB interacts with both PCAF andP300 in T-ALL cells (Fig. 5D), suggesting a mechanism through whichit enhances Notch signaling.

We next set out to determine how MAFB interacts with ETS2. Weused site-directedmutagenesis to remove the bZIP domain fromMAFB(Fig. 5C) (9, 11, 23). Using T6E cell lysates, we first verified the deletionand the size of the mutant (Fig. 5C, right). We then performed IPexperiments (Fig. 5E), which showed that deleting the MAFB bZIP do-mainmarkedly diminished theMAFB-ETS2 interaction.MAFBDbZIP


also markedly decreased p300 binding; however, the bZIP domain wasnot required for the PCAF interaction (Fig. 5E). Previous ChIP-seqanalysis showed that ETS binding sites are enriched within 250 basepairs (bp) of Notch1/RBPJ binding sites, thus placing ETS factorsin the immediate vicinity of the NTC (40). We tested whether MAFBcan interact with components of the NTC, specifically the cleavedICN1, as detected by the Val1744 antibody and RBPj. We found thatMAFB coimmunoprecipitated in T6E cells with cleaved Notch1 (Fig.5F) and RBPj (Fig. 5G) and that this interaction with the NTC was lostwhen the MAFB bZIP domain was deleted (Fig. 5G). These findingsfurther highlight the ability ofMAFB-ETS complexes to cooperate withthe NTC to activate transcription.

To determine the effect of theMAFB DbZIPmutant on Notch tran-scriptional activity, we tested its effect in T6E cells using the TP1 reporter.TheMAFB DbZIPmutant decreased reporter activity bymore than 60%(Fig. 5H). When ETS2 was cotransfected in the assay with the MAFBDbZIP mutant, the overall Notch activity was increased, but the loss of


ag.org/D

ownloaded from

the bZIP domain did not significantly en-hance Notch signaling more than whenETS2orMAFBwere addedalone, thus sug-gesting that MAFB-mediated enhancementof Notch transcription occurs through itsbZIP domain. We next assayed the MAFBdeletion mutant in vivo using the BMTmodel. As before, MAFB greatly decreasedthe latency and increased the penetrance ofT-ALL development. In contrast, theMAFBDbZIP mutant markedly limited the abilityof MAFB to enhance LPDP leukemo-genicity (Fig. 5I). Together, these datashow that the bZIP domain of MAFB isrequired for MAFB to enhance LPDP ac-tivity both in vitro and in vivo.

MAFB enhances Notch signaling inhuman T-ALL cellsTo determine whether MafB served a simi-lar role in human T-ALL, we determinedthe levels ofMAFB in three T-ALL cell lines(Fig. 6A).Of these, KOPT-K1 had the high-est levels of MAFB expression. KOPT-K1cells were treated with shRNAs designedagainst human MAFB, which decreasedMAFB expression by more than 50% (Fig.6B). The effect of suppressing MAFB inhumanKOPT-K1 cells was similar tomu-rine T6E cells as the expression of the di-rect Notch target genesHES1,DTX1, andMYCwas suppressed (Fig. 6C). Suppressionof MAFB did not affect the expression ofETS factors or ZMIZ1 nor did it alter theoccupancyofETS2 at the5′HES1promoterin T-ALL cells (fig. S6, A to D). Likewise,KOPT-K1 cells treated with anti–MAFB-HU-shRNAs were at a disadvantage incell growth assays when compared to cellstreated with shScrmb (Fig. 6D).

We next tested whether ETS factorsalso played a similar role in human T-ALL

A B

0

10

20

30

40

50

**

MigR1

HA-MAFB

Hes1 Myc

*******

MigR1

HA-MAFB

FLAG-M

AFB0

20

40

60

80

100

MigR1-D

MSO

MigR1-G

SI

MigR1-W

ash

HA-MAFB-D

MSO

HA-MAFB-G

SI

HA-MAFB-W

ash

0

10.0

20.0

30.0

Abs.

qua

n tity

rela

tive

to E

F1a

C

D

Abs.

qua

ntity

rela

tive

to E

F1a

Abs.

qua

ntity

rela

tive

to E

F1a

0

25

50

75

100

125

FLAG-M

AFB

MigR1-D

MSO

MigR1-G

SI

MigR1-W

ash

HA-MAFB-D

MSO

HA-MAFB-G

SI

HA-MAFB-W

ash

Abs.

qua

n tity

rela

tive

to E

F1a

E

F

Hes1 Myc

MigR1-DMSO

MigR1-GSIHA-MAFB-DMSO

HA-MAFB-GSI ***

NS*

******

NS*

** **

Day 0

Day 1

Day 2

Day 3

Day 4

0

1

2

3

4

Cel

l num

ber (

×10

MafB

GAPDH

MigR1

FLAG-M

AFBHA-M

AFB

6 )

Fig. 4. Ectopic MAFB expression in T-ALL cells enhances Notch target gene expression and limits the effect of GSItreatment. (A) Western blotting for MafB (with anti-MafB antibody; Abcam) and loading control (GAPDH) in whole-celllysates (10 mg) from T6E cells expressing Flag-MAFB or HA-MAFB. MigR1, empty vector. (B and C) Hes1 (B) and Myc (C) ex-pression measured by qRT-PCR in T6E cells overexpressing MAFB. EF1a, elongation factor 1a. (D and E) Hes1 (D) andMyc (E) expression measured by qRT-PCR in T6E cells treated with dimethyl sulfoxide (DMSO) or GSI (0.1 mM) for 24 hoursand subsequently washed out for 6 hours. Black bars, control cells; gray bars, MAFB-overexpressing cells. (A to E) n = 3 to6 experiments. (F) Proliferation of MigR1-transfected control or MAFB-overexpressing T6E cells (2.5 × 105) plated in amedium containing DMSO or GSI (10 nM). n = 2 experiments with three technical replicates per experiment. *P ≤ 0.05,**P ≤ 0.005, ***P ≤ 0.0005, ****P ≤ 0.00001 by unpaired t test.

6 of 12




cells. First, we confirmed that three humancell lines expressed ETS1 and ETS2 (Fig.6E). Next, we testedwhetherMAFB bindsETS2 in humanT-ALL cells.We transducedKOPT-K1 cells with FLAG-tagged MAFBand performed IPs to detect interactionsand found that MAFB strongly bound bothETS2 and RBPJ in KOPT-K1 cells (Fig. 6F).This suggests that a similar MAFB-ETS2pathwayenhancesNotchsignaling inhumanT-ALL.


ag.org/D

ownloaded from

DISCUSSIONThe finding thathumanandmurineT-ALLswith activating NOTCH1 mutations fre-quently require persistent Notch signalingfor growth and survival led to the idea thatNotch is adruggable target in thisdisease.Al-though multiple studies support this idea,one paradox is that the common NOTCH1mutations in T-ALL patients are weak onco-genic drivers in murine T-ALLmodels. Thisraises the question of whether there are addi-tional molecules that potentiate Notchsignaling, which could identify additionaltherapeutic targets.

Here, we set out to identify proteinsthat enhance the activity of the commonNotch1 mutations in T-ALL patients.Our screen identified multiple genes,some of which were previously verifiedto be important in Notch signaling (19, 20).We chose to focus on MAFB and ETS2.These transcription factors have well-established roles inmyeloid and lymphoiddevelopment (15, 41), respectively; how-ever, their involvement inT-ALL is poorlyunderstood. In reporter assays, MAFBand ETS2 demonstrated strong synergyand enhanced Notch activity to a levelon par with MAML1, a core componentof the NTC. In our functional studies,MAFB seems particularly important be-cause expressing MAFB along with theweak oncogenic NOTCH1 mutant LPDPin BM progenitors accelerated T-ALLonset and increased T-ALL penetrance.Inhibiting MAFB, by either siRNA orshRNA, down-regulated the expressionof multiple direct Notch targets, includingMYC, DTX1, and HES1, in both murineand human T-ALL cells and also decreasedthe proliferation of murine and humanT-ALL cells. In contrast, overexpressingMAFB enhanced the expression of theseNotch targets and promoted T-ALLgrowth. Thus, we propose that the com-bination of MAFB and ETS2 has the

10%

loading

A

U2OS cell lysate

EBS and CSL sites in TP1 reporter 5' Biotin - AATGGGCGGAAGGGCACCGTGGGAAAATAGTAGATCCCGA 3’ TCGGGATCTACTATTTTCCCACGG TGCCCTTCCGCCCATT-Biotin

Biotin-tagged oligo Streptavidin beads

EV ETS2FLAG-M

AFB

ETS2+FLAG-MAFB

Transfected component WB:

ETS2

FLAG

OIP

gnid

aol

%01

GAPDH

C

N CbZIPFLAG or HA-tagged MAFB

TAD

N CHA-tagged MAFB-ΔbZIP

TAD

bZIP

D

HA-MAFB

ETS2 PCAF

E

MigR1

HA

FLAG-MAFB

MigR1

ETS2

GAPDH

P300

FLAG

WB:

IP

PCAF

P300

B

ETS2

PCAF

P300

P300

GAPDH

HA-MAFB

HA-MAFBΔbZIP

H

ETS1

ETS1

MigR1

I

IP

F

FLAG-MAFBΔbZIP

RBPJ

FLAG

MigR1

FLAG-MAFB

RBPJ

GAPDH

IP

GAPDH

HA-IP of

T6E Lysates

HA-MAFB

HA-ΔbZIP

EVMAML

MAFBETS2

MAFB+ETS2

MAFB-ΔbZIP

+ETS2

MAFB-ΔbZIP

0

2

4

6

8

10

12

**

**

**NS

Days posttransplant

T-A

LL fr

ee (%

)

LP P-onlyLP P+MAFBLP P+MAFB- bZIP ***

3’ TCGGGATAA CTACTT TATT TAA TTTCCCACGG TGCCCTCC TCCGCCCATAA T-TT Biotin

G

IP

HA-MAFB

MigR1

HA

Notch1

Notch1

GAPDH

ETS2

FLAG

ETS2

PCAF

FLAG

HA 10%

loading

10%

loading

10% loading

0 50 100 150 2000

50

100

MAFBbZIP

Stp

Tag

Stp

Tag

Fig. 5. MAFB interacts with ETS proteins and recruits cofactors to Notch/RBPj binding sites. (A) Schematic repre-sentationof the experimental design for theOIP assay inU2OScells. A biotin-taggedoligo from the TP1Notch reporterwasused as the bait to immunoprecipitate proteins interacting at the CSL or EBS regions. (B) Representative results of OIP assayin U2OS cells transfected with MigR1, ETS2, Flag-MAFB, or ETS2 + Flag-MAFB and probed with ETS2 and Flag antibodiesafter OIP. Ten percent loading of nuclear lysates indicates protein abundance; GAPDH is the loading control. (C) Schematicrepresentationof the taggedMafB andMafBDbZIPmutant. Right:Westernblotting (WB) onmixed lysates of HA-MAFB andHA–MAFB DbZIP immunoprecipitated from doubly transduced T6E cells to show relative protein size and HA-pulldownefficiency. (D) Representative results of HA- or FLAG-IP assessingMAFB interactions with ETS1, ETS2, P300, and PCAF in T6ET-ALL cells. (E) Representative HA-IP in T6E cells transducedwithMigR1, HA-MAFB, or HA–MAFB DbZIP and probed for HA,ETS2, PCAF, and P300. The background bands in the HA 10% loading control likely result from the blot being probed andrestriped multiple times. (F) Representative HA-IP in T6E cells transduced with HA-MafB and probed for cleaved-Notch1(Val1744). (G) Representative FLAG-IP in T6E cells transducedwithMigR1, FLAG–MAFBDbZIP, or FLAG-MAFB andprobed forRBPJ and FLAG. (H) Notch TP1 reporter assay in T6E cells transfectedwith LPDP and the indicated plasmids. EV is the vectorcontrol. **P ≤ 0.005 by unpaired t test; n = 3. (I) Kaplan-Meier plot comparing percent of T-ALL–free survival after BMTwith progenitors transduced with LPDP-only, LPDP+MAFB, or LPDP + MAFB DbZIP domain deletion mutant. LPDP, n = 6;LPDP+MAFB, n = 12; LPDP+MAFB DbZIP, n = 10. Animals that succumbed to non–T-ALL conditions, such as BM failure/anemia (LPDP-only, n = 1), were excluded from the analysis. ***P ≤ 0.0001 by Mantel-Cox test.

7 of 12



Dow

nlo

potential to amplify the activity of weak activating Notch1 muta-tions. Although multiple Notch1 targets are inhibited by blockingMAFB, additional analyses are needed to determine whetherMAFB in-fluences all direct Notch1 target genes. It is unlikely that withdrawal ofMafB broadly represses transcription because the expression of manygenes, such as Trib1, was not affected by MafB knockdown.

HowMAFB boosts the signaling of mutant Notch receptors was notimmediately obvious. A previous work characterized MafB as a differ-entiation factor, with roles in monocyte-to-macrophage differentiation(42). In T cells, MAFB expression is low (43); however, data from pub-lished databases and our own analysis of cell lines, patient primagrafts,and primary tumors show thatMAFB is frequently expressed in T-ALLcells andprimarypatient samples. Therewasno correlationwithNotch1mutation subtypes, and there was no evidence of MAFB or ETS1/2 ge-netic amplification in primary T-ALLs (21, 22). Thus, we hypothesizethat in these tumors, MAFB expression, driven by unknown mechan-isms, potentiates both Notch signaling and its oncogenic capacity. Ourfindings also suggest that in other tumorswithweakly activatingNotch1mutations, such as chronic lymphocytic leukemia, additional cofactorsanalogous to MAFB may be required to potentiate oncogenic Notch1signals.


MAFB is a multidomain transcription factor that can bind DNA di-rectly and form protein-protein interactions (9, 44). In our T-ALLstudies, MAFB did not appear to bind DNA independently; instead,it appears to either bind cooperatively with ETS transcription factorsor be tethered to DNA through the ETS transcription factors. ETSbinding sites are common and in close proximity with RBPJ bindingsites (40). Because MAFB is known to directly interact with ETS1 (23),we believe thatMAFB is recruited near sites of NTC formation througha similar interaction with ETS2 or ETS1. We found that MafB interactswith both P300 and PCAF, which are important for Notch-inducedtranscriptional activation (38), and that the loss of MafB decreases theoccupancy of p300 at the Hes1 and Myc Notch-dependent enhancers.The bZIP domain of MafB is required for this activity, thus bringingPCAF and P300 and by connection, the Notch/RBPj/MAML complexinto a larger protein complex capable of high transcriptional output.This MAFB-ETS2 synergy and its ability to enhance Notch signalingare also conserved in human T-ALL cells. A recent work showed thatthe T cell transcription factor Zmiz1 interacts with Notch1 and regu-lates the expression of oncogenic Notch targets such as Myc (45), indi-cating that enhancing Notch signaling by cofactors is an important stepin T-ALL onset. In our studies, suppressing MafB did not affect Zmiz1


ag.org/aded from

expression. Circulating double-positiveT cells, which express high levels of ETSfactors, are observed in the BMT modelof NOTCH1 LPDP–induced T-ALL (8);however, these mice develop T-ALL at alow frequency. From the results of ourstudy, we predict that when MAFB isexpressed at sufficient levels, it creates anenvironment where transcriptional cofac-tors are recruited at a higher-density nearsites of Notch transcriptional targets, thusraising Notch1 signaling output to levelsthat exceed the threshold for oncogenictransformation.

In summary, our findings show thatthe MAFB-EST2 interaction enhancesNotch1 signaling in a leukemic settingby supporting the higher expression ofNotch targets. These findings suggest thatthe MAFB-ETS2 axis may serve as a ther-apeutic target in T-ALL. Our findings alsoraise issues regarding the efficacy of GSItherapy in tumors with increased MAFBabundance, because our data show thatcells expressing high amounts of MAFBwere less sensitive to GSI treatment. Thus,strategies that decreaseMAFB expressionor formation of theMAFB-ETS2 complexmay enhance the sensitivity of Notch-dependent T-ALL cells to GSI therapy.

MATERIALS AND METHODSCell cultureT-ALL cell lines were cultured in RPMI1640 (Invitrogen) supplemented with10% fetal bovine serum (FBS) (HyClone),2mML-glutamine, 1% nonessential amino

A

U2OS

CUTLL1

DND41

KOPT-K1

0.0

0.5

1.0

1.5

2.0

B

shScrm

b

MAFB-HU-sh

1

MAFB-HU-sh

20.0

0.5

1.0

1.5

2.0

2.5 ** **

C

Hes1

Deltex Myc

Hey1

0.0

0.5

1.0

Rel

ativ

e ex

pres

sion

to S

h-Sc

rmb shScrmb

MAFB-HU-sh2

Day 0 Day 1 Day 2 Day 30.0

0.5

1.0

1.5 shScrmbMAFB-HU-sh1MAFB-HU-sh2

Cel

l num

ber (

× 10

6 )

D

E

RBPJ

FLAG-MAFB

MigR1

RBPJ

GAPDH

ETS2

ETS2IP

10%

load

ing

FLAG-MAFB

F

ETS2

ETS1

GAPDH

KOPT-K1

DND41

CUTLL

Maf

B e

xpre

ssio

n re

lativ

e to

EF1

a

Maf

B e

xpre

ssio

n re

lativ

e to

EF1

a

***

Fig. 6. Loss of MAFB suppresses Notch target gene expression and cell proliferation in human T-ALL. (A) MAFBmRNA expression in human T-ALL cell lines (U2OS cells used as negative control). (B)MAFBmRNA expression after MAFBknockdown in KOPT-K1 cells by each of the two shRNAs. (C) Notch target gene expression in sorted KOPT-K1 cells 72 hoursafter transductionwith shRNA againstMAFB relative to KOPT-K1 cells treatedwith Scrmb-shRNA. (D) Proliferation of sortedKOPT-K1 cells after transductionwith shRNAsagainstMAFB. Growth is compared to cells treatedwith Scrmb-shRNA (n=3).(E) Representative Western blotting for ETS1 and ETS2 in human T-ALL cell lines. GAPDH is the loading control. (F) Repre-sentative FLAG-IP in KOPT-K1 cells transduced with MigR1 or FLAG-MAFB and probed for FLAG, ETS2, and RBPJ. Ten per-cent loading of lysates indicates RBPJ and ETS2 abundance. GAPDH is the loading control. **P ≤ 0.005, ***P ≤ 0.001.

8 of 12




ag.org/D

ownloaded from

acids (Gibco), 1% sodium pyruvate (Gibco), and 2-mercaptoethanol[0.0005% (v/v); Sigma), with antibiotics. U2OS cells were maintainedin Dulbecco’s modified Eagle’s medium (Invitrogen) with 10% FBS(Gibco) and antibiotics. Cells were grown at 37°C in 5%CO2. Retroviraltransduction, sorting, and expression analysis of T-ALL cells were per-formed as described previously (3). The GSI, compound E (Calbiochem,565790), was titrated on T6E cells for 12 hours at concentrations rangingfrom 1 mM to 1 nM. GSI-washout experiments were performed as de-scribed previously (32) after 24 hours of culture in 0.1 mM GSI.

Constructs and retrovirusesMigR1 (46), MigR1-NGFR, MigR1-Notch1-L1601P, and MigR1-Notch1LPDP are described previously (8). Sport6-MafB (780 bp; MafB codingsequence) andSport6-ETS2 (822bp;ETS2coding sequence)wereobtainedfrom the library screen. The 5′HAor FLAG tags added toMafBwere gen-erated by PCR. MafB deletions were generated using QuikChange II(Agilent Technologies), and primer design was based on the QuikChangePrimer Design program (www.genomics.agilent.com).

Luciferase screen and reporter assaysThe cDNAscreening strategy involved the use of three key components:(i) a pcDNA3 plasmid encoding a modestly strong NOTCH1 gain-of-functionmutant, LPDP, driven from a CMV promoter (40 ng of cDNAperwell), (ii) aNotch firefly luciferase reporter (TP1) containing 12CSLbinding sites (50 ng of cDNA per well), and (iii) a preplated cDNAlibrary cloned into the Sport6 plasmid (40 ng of cDNA per well). AMAML1 cDNA was the positive control for each screen plate, whereasempty vector and a DTX1 cDNA were background and negativecontrols (40 ng of cDNA per well), respectively. DNA spotting was per-formed using a Matrix PlateMate (Thermo Fisher Scientific) for thecontrol wells. The Matrix WellMate (Thermo Fisher Scientific) wasused to dispense the transfection mix containing the reporter andNotch1 mutant plasmids in combination with transfection reagent(FuGENE6, Promega), which were added to the wells (4000 U20Scells per well) after a 30-min incubation. Luminescence was measured48 hours after plating using Britelite plus (PerkinElmer) luciferase re-agent with LJL BioSystems Analyst HT96-384. Methods for screen val-idation are provided in the Supplementary Materials.

Luciferase screen validationFor the validation of screen candidates and independent luciferase as-says, 4000U2OS cells per well were seeded onCorning opaque 384-wellplates, and FuGENE6 transfection mix was prepared in Opti-MEM(Gibco) serum-free medium with three plasmid components: (i) 50 ngper well of Notch TP1 firefly reporter plasmid, (ii) 40 ng per well ofpcDNA3-LPDP plasmid, and (iii) 40 ng per well of screen-componentcDNAs cloned into pCMVSport6 (for example, MafB or ETS2).pcDNA3-MAML1 and Flag-CMV-DTX1 plasmids (40 ng per well)served as positive and negative controls, respectively. Five nanogramsof pRL-TK Renilla luciferase was used as internal control plasmid. After20 min at room temperature, 20 ml of the transfection reaction mix wasadded to the cells by amultichannel pipette. Twenty-four wells were ana-lyzed for each individual transfection sample set. After a 48-hour incuba-tion with the transfection mix, 35 ml per well of Britelite plus luciferasereagent was added by a multichannel pipette; luminescence wasmeasured by LJL BioSystems Analyst HT96-384 (LJL BioSystems Inc.).Stop & Glo buffer and Renilla luciferase reagent (Promega) were used toassess transfection efficiency. At least three individual repeats were per-formed for each experiment.


Human T-ALL data analysis and statistical analysisNormalized microarray expression analysis for the Haferlach data setwas obtained from the Oncomine database, and Zuurbier data setwas provided by J. P. P. Meijerink. Each set was separately analyzedfor the expression ofMafB, Notch1 receptor, and Notch1 target genes:Hes1,Deltex, andMyc. Each sample that displayed higher than twofoldNotch receptor and Notch target expression was parsed from the totaldata set.MafB expression was cross-referenced for any individual sam-ple that showed a Notch enhancement signature. The comparativevalues ofNotch1, Notch targets, andMafbwere plotted as a log2medianvalue for all the samples that showNotch enhancement in theHaferlachand Zuurbier data sets. Statistical analysis was performed using Prism 6(GraphPad). Survival curves were computed using Kaplan-Meier analy-sis, and comparison of survival curves was performed using Mantel-Coxtest provided through Prism. Predicted experimental mouse numbers forthe Notch1-LPDP and MafB experiment were powered (0.8). z score forNotch1 gain-of-function screen was determined by the followingformula: z score = 1 − [(3SD− + 3SD+)/(Av+ − Av−)]. An unpaired t testP value of less than 0.05 was considered to be significant in allexperiments, unless noted otherwise; *P ≤ 0.05, **P ≤ 0.005, ***P ≤0.0005, ****P ≤ 0.00001.

Quantitative PCRRNA was extracted using Qiagen RNeasy Mini and Micro Kits.cDNA was synthesized from RNA with the SuperScript III kit (In-vitrogen). Transcripts were amplified with SYBR Green PCR reagent(Applied Biosystems), and quantitative PCR (qPCR) was performedon the ABI Prism 7900HT system (Applied Biosystems). mRNAquantities, either in absolute or relative quantification, were nor-malized to elongation factor 1a and GAPDH, respectively. Primer3software was used for primer design, and sequences are providedin table S3.

siRNA and shRNARNA interference was carried out with siRNA duplexes designedand then screened for specific and effective knockdown of targetgenes. Fluorescence-conjugated duplexes (n = 3) targeting MafBwere ordered directly as ON-TARGETplus siRNA from ThermoFisher Scientific/Dharmacon. siRNA methods are provided in theSupplementary Materials. For shRNA suppression, two differentMafB-targeting shRNAs and a shScrmb were purchased from OpenBiosystems (sequences are provided in table S4). For siRNA controltransfections, nontargeting siRNA and siGLO Green were pur-chased from Thermo Fisher Scientific/Dharmacon. For transfec-tions of cells, siRNA duplexes were resuspended in siRNA buffer(Dharmacon) and added to the cell growth medium for 12 hourswith siIMPORTER transfection reagent (Millipore) as per the manu-facturer’s instructions. Forty-eight to 72 hours after transfection, RNAwas harvested from cells with RNeasy Mini kit (Qiagen), and 500 ngof total RNA was used in qPCR analysis. For shRNA suppression,two different MafB-targeting shRNAs and a shScrmb were purchasedfrom Open Biosystems (sequences are provided in table S3 and theSupplementary Materials) and were subcloned into the pLMP-GFPor pLPM-NGFR vector. For viral transduction, cells were centrifugedwith viral supernatant and hexadimethrine bromide (8 mg/ml) (Sigma)at 2500 rpm for 90 min at 25°C. FACS-purified shRNA-treated cellswere analyzed for growth or gene expression at the indicated timesafter transduction. For growth curves or competition assays, 5 × 105

sorted cells were seeded.

9 of 12

http://www.genomics.agilent.com




ag.org/D

ownloaded from

ChIP-seq analysisChIP-seq reads were aligned to mm10 using Burrows-Wheeler Aligner(47) and filtered to remove PCR duplicates andmultimapped reads. Allreads were postfiltered by known ENCODE blacklist regions. Peak call-ing was performed using MAC2 (version 2.0.9) (48) with the followingparameters: –no model, –shift size = (1/2 estimated fragment length),–keep-dup = 1, and a false discovery rate (FDR) threshold of 1 × 10−6.ChIP-seq display files were generated using SAMtools, BEDTools,and UCSC utilities. Scaling for all ChIP-seq tracks in figures is equalto local fragment coverage × (1,000,000/total count).

The peaks were associated to their most proximal gene as defined inEnsembl GRCm38 transcript model using BEDTools and HOMER-annotatePeaks (version 4.8) (49). H3K27Ac signal was compared be-tween the GSI and GSI-washout conditions on the 1500 base pair (bp)regions flanking the peak summits. Regions (1500 kb) flanking thesummits of peaks were merged across GSI and GSI-washout con-ditions using BEDTools-merge (version 2.25.0). In each library, peak-filteredH3K27Ac signal was quantified and normalized to fragment perkilobase per million reads (FPKM). The logarithmic fold change ofH3K27Ac load on with nonzero read counts in at least one conditionwas calculated as log2FPKM of the GSI versus GSI-washout conditionwith a pseudocount of 1, and the regions with absolute fold changegreater than or equal to log2(0.5) were indicated in table S2 andMafB-dependent.

Mice and BM transductionBM transductions and transplantation into lethally irradiated recipientswere performed as described previously (26, 50). Recipientmice used inthese experimentswere 6- to 8-week-oldC57BL/6 femalemice obtainedfrom Charles River Laboratories. In cases where two retroviruses (forexample, MigR1-LPDP and MigR1-NGFR-MafB) were used to trans-duce the BM progenitors, the total viral titer and multiplicity of infec-tionwere adjusted to reflect previously usedT-ALLNotch-mutant virustiters (8). Mice were maintained on antibiotics in the drinking water for2 weeks after BMT, and peripheral blood was drawn every 2 weeks tomonitor blood counts and evaluate the presence of circulating im-mature T cells by flow cytometry. Mice with WBC counts of >4.0 ×106/ml and a body condition score of ≤2 were euthanized, and tissueswere harvested for flow cytometry and histology (hematoxylin and eo-sin) analysis. All mice were housed in specific pathogen–free facilities attheUniversity of Pennsylvania. Experiments were performed accordingto the guidelines from the National Institutes of Health with approvedprotocols from the University of Pennsylvania Animal Care and UseCommittee.

Flow cytometryFlow cytometry was performed on BD LSR II, cell sorting was performedon BDAria II, and FlowJo software was used for analysis. The peripheralblood (bimonthly), spleen, thymus, andBM (terminal analysis) were har-vested, and cell suspensions were generated frommice transduced as de-scribed above. Antibodies used in staining of the tissues include: CD45.2(104, BD Biosciences), CD25 (PC61, BioLegend), CD44 (IM7,eBioscience), CD3 (17A2, eBioscience), CD4 (RM4-5, eBioscience),CD8 (53-6.7, eBioscience), CD19 (1D3, eBioscience), CD11b (M1/70,eBioscience), F480 (BM8, eBioscience), andGr-1 (RB6-8C5, eBioscience).4′,6-Diamidino-2-phenylindole (DAPI) was used for Live/Dead determi-nation. TransducedT6Ecell lineswere sorted on the basis of internalGFPfluorescence or surface staining with anti-NGFR–biotinylated antibodygenerated in-house from the 8737 hybridoma line.


Western blotting and IP analysesWhole-cell lysates were prepared with radioimmunoprecipitation assay(RIPA) buffer or FLAG-IP lysis buffer (50 mM tris, 150 mM NaCl,1 mM EDTA, 0.5% NP-40, and 10% glycerol), with protease inhibitortablets (cOmplete, Roche). Protein concentration was determined withthe Bio-Rad protein assay dye reagent (Bio-Rad). Proteins were separatedusing SDS–polyacrylamide gel electrophoresis and wet-transferred topolyvinylidene difluoride membranes. Blots were visualized with Super-SignalWest Pico Chemiluminescent or SuperSignalWest Femto Chemi-luminescent substrate (Thermo Fisher Scientific). Antibodies used forWestern blotting were cleaved Notch1 (Val1744) antibody (Cell SignalingTechnology, no. 2421), RBPJSUH (Cell Signaling Technology, D10),MafB (Santa Cruz Biotechnology, P20), rabbit monoclonal antibody(Abcam, ab66506), GAPDH (Santa Cruz Biotechnology, FL-335), ETS1(Santa Cruz Biotechnology, C-20), ETS2 (Sigma, E3783), PCAF (SantaCruz Biotechnology, E-8), P300 (Thermo Fisher Scientific, RW109),HA (Covance, MMS-101P), FLAG (Sigma, M2), and secondary anti-mousehorseradishperoxidase (HRP) (Pierce) or anti-rabbitHRP(Pierce).

IP experiments were performed using HA-probe agarose beads(Santa Cruz Biotechnology) or anti-FLAG agarose beads (Sigma,M1). Samples were loaded, and Western blot analysis was performedas described above. OIP experiments were performed as described pre-viously (51). Oligonucleotide sequences for the OIP experiments areprovided in table S3. For each pulldown, 0.5 to 1 mg of fresh proteinlysate was used and combined with 25 to 30 ml of beads for incubationovernight at 4°C with rotation. Beads were washed four times in lysisbuffer with increasing concentration ofNaCl [200 nM (2×) and 300 nM(2×)]. The IP experiments depicted in Figs. 5 and 6 were conducted insimilar fashion; however, the cells were lysed with FLAG-IP lysis bufferand washed only three times, once with lysis buffer and twice with lysisbuffer with higher NaCl concentration (150 nM). Protein was releasedfrom washed beads by addition of 2× Laemmli buffer and boiled for10 min at 95°C.

Microarray analysisMouse Gene 2.0 ST Affymetrix array CEL files were imported, normal-ized, and summarized using robust multichip average and median-polish algorithms, respectively, using the Bioconductor “oligo”package (52). Limma (53) was used for differential gene expressionon triplicate samples of GSI and GSI-washout conditions. Packagemogene20sttranscriptcluster.db in Bioconductor was used for annota-tion. Genes with greater than twofold change and a Benjamini-HochbergFDR of <0.1 were called as differentially expressed.

SUPPLEMENTARY MATERIALSwww.sciencesignaling.org/cgi/content/full/10/505/eaam6846/DC1Fig. S1. Validation of Notch1 gain-of-function screen and MAFB expression in murine andhuman T-ALL.Fig. S2. Analysis of spleen and peripheral blood after BMT.Fig. S3. Validation of MafB siRNA and shRNA reagents.Fig. S4. Ectopic MAFB expression enhances T6E cell growth.Fig. S5. MAFB interacts with DNA through ETS factors, and the loss of ETS1 delays onset ofT-ALL.Fig. S6. Zmiz1 expression in T6E cells is not affected by the loss of MafB.Table S1. Notch signaling enhancement of Notch-mutant LPDP by candidate genes from thecDNA library.Table S2. MafB suppression affects a subset of Notch signaling gene targets in T6Ecells.Table S3. List of oligo sequences and primer sets for qPCR and OIP.

10 of 12

http://www.sciencesignaling.org/cgi/content/full/10/505/eaam6846/DC1




ag.org/D

ownloaded from

REFERENCES AND NOTES1. C.-H. Pui, W. E. Evans, Acute lymphoblastic leukemia. N. Engl. J. Med. 339, 605–615

(1998).2. L. B. Silverman, R. D. Gelber, V. K. Dalton, B. L. Asselin, R. D. Barr, L. A. Clavell, C. A. Hurwitz,

A. Moghrabi, Y. Samson, M. A. Schorin, S. Arkin, L. Declerck, H. J. Cohen, S. E. Sallan,Improved outcome for children with acute lymphoblastic leukemia: Results of Dana-Farber Consortium Protocol 91-01. Blood 97, 1211–1218 (2001).

3. A. P. Weng, A. A. Ferrando, W. Lee, J. P. Morris IV, L. B. Silverman, C. Sanchez-Irizarry,S. C. Blacklow, A. T. Look, J. C. Aster, Activating mutations of NOTCH1 in human T cellacute lymphoblastic leukemia. Science 306, 269–271 (2004).

4. S. Artavanis-Tsakonas, M. D. Rand, R. J. Lake, Notch signaling: Cell fate control and signalintegration in development. Science 284, 770–776 (1999).

5. R. Kopan, M. X. G. Ilagan, The canonical Notch signaling pathway: Unfolding theactivation mechanism. Cell 137, 216–233 (2009).

6. R. Tsunematsu, K. Nakayama, Y. Oike, M. Nishiyama, N. Ishida, S. Hatakeyama,Y. Bessho, R. Kageyama, T. Suda, K. I. Nakayama, Mouse Fbw7/Sel-10/Cdc4 is requiredfor notch degradation during vascular development. J. Biol. Chem. 279, 9417–9423(2004).

7. W. R. Gordon, K. L. Arnett, S. C. Blacklow, The molecular logic of Notch signaling—Astructural and biochemical perspective. J. Cell Sci. 121, 3109–3119 (2008).

8. M. Y. Chiang, L. Xu, O. Shestova, G. Histen, S. L’Heureux, C. Romany, M. E. Childs,P. A. Gimotty, J. C. Aster, W. S. Pear, Leukemia-associated NOTCH1 alleles are weak tumorinitiators but accelerate K-ras-initiated leukemia. J. Clin. Invest. 118, 3181–3194 (2008).

9. K. Kataoka, K. T. Fujiwara, M. Noda, M. Nishizawa, MafB, a new Maf family transcriptionactivator that can associate with Maf and Fos but not with Jun. Mol. Cell. Biol. 14,7581–7591 (1994).

10. A. Eychène, N. Rocques, C. Pouponnot, A new MAFia in cancer. Nat. Rev. Cancer 8,683–693 (2008).

11. C. Kurschner, J. I. Morgan, The maf proto-oncogene stimulates transcription frommultiple sites in a promoter that directs Purkinje neuron-specific gene expression. Mol.Cell. Biol. 15, 246–254 (1995).

12. P. L. Bergsagel, W. M. Kuehl, Chromosome translocations in multiple myeloma. Oncogene20, 5611–5622 (2001).

13. I. G. Maroulakou, D. B. Bowe, Expression and function of Ets transcription factors inmammalian development: A regulatory network. Oncogene 19, 6432–6442 (2000).

14. I. G. Maroulakou, T. S. Papas, J. E. Green, Differential expression of ets-1 and ets-2proto-oncogenes during murine embryogenesis. Oncogene 9, 1551–1565 (1994).

15. A. Zaldumbide, F. Carlotti, P. Pognonec, K. E. Boulukos, The role of the Ets2 transcriptionfactor in the proliferation, maturation, and survival of mouse thymocytes. J. Immunol.169, 4873–4881 (2002).

16. M. K. Anderson, G. Hernandez-Hoyos, R. A. Diamond, E. V. Rothenberg, Precisedevelopmental regulation of Ets family transcription factors during specification andcommitment to the T cell lineage. Development 126, 3131–3148 (1999).

17. O. Delattre, J. Zucman, B. Plougastel, C. Desmaze, T. Melot, M. Peter, H. Kovar, I. Joubert,P. de Jong, G. Rouleau, A. Aurias, G. Thomas, Gene fusion with an ETS DNA-bindingdomain caused by chromosome translocation in human tumours. Nature 359, 162–165(1992).

18. S. A. Tomlins, D. R. Rhodes, S. Perner, S. M. Dhanasekaran, R. Mehra, X.-W. Sun,S. Varambally, X. Cao, J. Tchinda, R. Kuefer, C. Lee, J. E. Montie, R. B. Shah, K. J. Pienta,M. A. Rubin, A. M. Chinnaiyan, Recurrent fusion of TMPRSS2 and ETS transcription factorgenes in prostate cancer. Science 310, 644–648 (2005).

19. G. Roti, A. Carlton, K. N. Ross, M. Markstein, K. Pajcini, A. H. Su, N. Perrimon, W. S. Pear,A. L. Kung, S. C. Blacklow, J. C. Aster, K. Stegmaier, Complementary genomic screensidentify SERCA as a therapeutic target in NOTCH1 mutated cancer. Cancer Cell 23,390–405 (2013).

20. A.-C. Tien, A. Rajan, K. L. Schulze, H. D. Ryoo, M. Acar, H. Steller, H. J. Bellen, Ero1L, a thioloxidase, is required for Notch signaling through cysteine bridge formation of theLin12-Notch repeats in Drosophila melanogaster. J. Cell Biol. 182, 1113–1125 (2008).

21. T. Haferlach, A. Kohlmann, L. Wieczorek, G. Basso, G. T. Kronnie, M.-C. Béné, J. De Vos,J. M. Hernández, W.-K. Hofmann, K. I. Mills, A. Gilkes, S. Chiaretti, S. A. Shurtleff, T. J. Kipps,L. Z. Rassenti, A. E. Yeoh, P. R. Papenhausen, W.-m. Liu, P. M. Williams, R. Foà, Clinicalutility of microarray-based gene expression profiling in the diagnosis andsubclassification of leukemia: Report from the International Microarray Innovations inLeukemia Study Group. J. Clin. Oncol. 28, 2529–2537 (2010).

22. L. Zuurbier, I. Homminga, V. Calvert, M. L. te Winkel, J. G. C. A. M. Buijs-Gladdines, C. Kooi,W. K. Smits, E. Sonneveld, A. J. P. Veerman, W. A. Kamps, M. Horstmann, E. F. Petricoin III,R. Pieters, J. P. P. Meijerink, NOTCH1 and/or FBXW7 mutations predict for initial goodprednisone response but not for improved outcome in pediatric T-cell acutelymphoblastic leukemia patients treated on DCOG or COALL protocols. Leukemia 24,2014–2022 (2010).

23. M. H. Sieweke, H. Tekotte, J. Frampton, T. Graf, MafB is an interaction partner andrepressor of Ets-1 that inhibits erythroid differentiation. Cell 85, 49–60 (1996).


24. T. S. P. Heng, M. W. Painter; Immunological Genome Project Consortium, TheImmunological Genome Project: Networks of gene expression in immune cells. Nat.Immunol. 9, 1091–1094 (2008).

25. W. S. Pear, J. C. Aster, M. L. Scott, R. P. Hasserjian, B. Soffer, J. Sklar, D. Baltimore, Exclusivedevelopment of T cell neoplasms in mice transplanted with bone marrow expressingactivated Notch alleles. J. Exp. Med. 183, 2283–2291 (1996).

26. J. C. Aster, L. Xu, F. G. Karnell, V. Patriub, J. C. Pui, W. S. Pear, Essential roles for ankyrinrepeat and transactivation domains in induction of T-cell leukemia by Notch1. Mol. Cell.Biol. 20, 7505–7515 (2000).

27. J. C. Aster, E. S. Robertson, R. P. Hasserjian, J. R. Turner, E. Kieff, J. Sklar, Oncogenic formsof NOTCH1 lacking either the primary binding site for RBP-Jk or nuclear localizationsequences retain the ability to associate with RBP-Jk and activate transcription. J. Biol.Chem. 272, 11336–11343 (1997).

28. Q. Jin, L.-R. Yu, L. Wang, Z. Zhang, L. H. Kasper, J.-E. Lee, C. Wang, P. K. Brindle, S. Y. R. Dent,K. Ge, Distinct roles of GCN5/PCAF-mediated H3K9ac and CBP/p300-mediated H3K18/27ac innuclear receptor transactivation. EMBO J. 30, 249–262 (2011).

29. F. Oswald, B. Täuber, T. Dobner, S. Bourteele, U. Kostezka, G. Adler, S. Liptay, R. M. Schmid,p300 acts as a transcriptional coactivator for mammalian Notch-1. Mol. Cell. Biol. 21,7761–7774 (2001).

30. Y. Yashiro-Ohtani, H. Wang, C. Zang, K. L. Arnett, W. Bailis, Y. Ho, B. Knoechel, C. Lanauze,L. Louis, K. S. Forsyth, S. Chen, Y. Chung, J. Schug, G. A. Blobel, S. A. Liebhaber,B. E. Bernstein, S. C. Blacklow, X. S. Liu, J. C. Aster, W. S. Pear, Long-range enhancer activitydetermines Myc sensitivity to Notch inhibitors in T cell leukemia. Proc. Natl. Acad. Sci.U.S.A. 111, E4946–E4953 (2014).

31. H. Wang, C. Zang, L. Taing, K. L. Arnett, Y. J. Wong, W. S. Pear, S. C. Blacklow, X. S. Liu,J. C. Aster, NOTCH1–RBPJ complexes drive target gene expression through dynamicinteractions with superenhancers. Proc. Natl. Acad. Sci. U.S.A. 111, 705–710 (2014).

32. W. Bailis, Y. Yashiro-Ohtani, W. S. Pear, Identifying direct Notch transcriptional targetsusing the GSI-washout assay. Methods Mol. Biol. 1187, 247–254 (2014).

33. W. Bailis, Y. Yashiro-Ohtani, T. C. Fang, R. D. Hatton, C. T. Weaver, D. Artis, W. S. Pear, Notchsimultaneously orchestrates multiple helper T cell programs independently of cytokinesignals. Immunity 39, 148–159 (2013).

34. G.-H. Wei, G. Badis, M. F. Berger, T. Kivioja, K. Palin, M. Enge, M. Bonke, A. Jolma,M. Varjosalo, A. R. Gehrke, J. Yan, S. Talukder, M. Turunen, M. Taipale, H. G. Stunnenberg,E. Ukkonen, T. R. Hughes, M. L. Bulyk, J. Taipale, Genome-wide analysis of ETS-familyDNA-binding in vitro and in vivo. EMBO J. 29, 2147–2160 (2010).

35. N. Muthusamy, K. Barton, J. M. Leiden, Defective activation and survival of T cells lackingthe Ets-1 transcription factor. Nature 377, 639–642 (1995).

36. N. Rocques, N. Abou Zeid, K. Sii-Felice, L. Lecoin, M.-P. Felder-Schmittbuhl, A. Eychène,C. Pouponnot, GSK-3-mediated phosphorylation enhances Maf-transforming activity.Mol. Cell 28, 584–597 (2007).

37. Q. Chen, D. H. Dowhan, D. Liang, D. D. Moore, P. A. Overbeek, CREB-binding protein/p300co-activation of crystallin gene expression. J. Biol. Chem. 277, 24081–24089 (2002).

38. R. A. Kovall, S. C. Blacklow, Mechanistic insights into Notch receptor signaling fromstructural and biochemical studies. Curr. Top. Dev. Biol. 92, 31–71 (2010).

39. H. Kurooka, T. Honjo, Functional interaction between the mouse Notch1 intracellularregion and histone acetyltransferases PCAF and GCN5. J. Biol. Chem. 275, 17211–17220(2000).

40. H. Wang, J. Zou, B. Zhao, E. Johannsen, T. Ashworth, H. Wong, W. S. Pear, J. Schug,S. C. Blacklow, K. L. Arnett, B. E. Bernstein, E. Kieff, J. C. Aster, Genome-wide analysisreveals conserved and divergent features of Notch1/RBPJ binding in human and murineT-lymphoblastic leukemia cells. Proc. Natl. Acad. Sci. U.S.A. 108, 14908–14913 (2011).

41. L. M. Kelly, U. Englmeier, I. Lafon, M. H. Sieweke, T. Graf, MafB is an inducer of monocyticdifferentiation. EMBO J. 19, 1987–1997 (2000).

42. T. Moriguchi, M. Hamada, N. Morito, T. Terunuma, K. Hasegawa, C. Zhang, T. Yokomizo,R. Esaki, E. Kuroda, K. Yoh, T. Kudo, M. Nagata, D. R. Greaves, J. D. Engel, M. Yamamoto,S. Takahashi, MafB is essential for renal development and F4/80 expression inmacrophages. Mol. Cell. Biol. 26, 5715–5727 (2006).

43. T. Taghon, M. A. Yui, R. Pant, R. A. Diamond, E. V. Rothenberg, Developmental andmolecular characterization of emerging b- and gd-selected pre-T cells in the adult mousethymus. Immunity 24, 53–64 (2006).

44. K. Kataoka, Multiple mechanisms and functions of maf transcription factors in theregulation of tissue-specific genes. J. Biochem. 141, 775–781 (2007).

45. N. Pinnell, R. Yan, H. J. Cho, T. Keeley, M. J. Murai, Y. Liu, A. S. Alarcon, J. Qin, Q. Wang,R. Kuick, K. S. J. Elenitoba-Johnson, I. Maillard, L. C. Samuelson, T. Cierpicki, M. Y. Chiang,The PIAS-like coactivator Zmiz1 is a direct and selective cofactor of Notch1 in T celldevelopment and leukemia. Immunity 43, 870–883 (2015).

46. A. P. Weng, Y. Nam, M. S. Wolfe, W. S. Pear, J. D. Griffin, S. C. Blacklow, J. C. Aster, Growthsuppression of pre-T acute lymphoblastic leukemia cells by inhibition of notch signaling.Mol. Cell. Biol. 23, 655–664 (2003).

47. H. Li, R. Durbin, Fast and accurate short read alignment with Burrows–Wheeler transform.Bioinformatics 25, 1754–1760 (2009).

11 of 12



Dow

nloaded f

48. Y. Zhang, T. Liu, C. A.Meyer, J. Eeckhoute, D. S. Johnson, B. E. Bernstein, C.Nusbaum, R.M.Myers,M. Brown, W. Li, X. S. Liu, Model-based analysis of ChIP-Seq (MACS). Genome Biol. 9, R137 (2008).

49. S. Heinz, C. Benner, N. Spann, E. Bertolino, Y. C. Lin, P. Laslo, J. X. Cheng, C. Murre, H. Singh,C. K. Glass, Simple combinations of lineage-determining transcription factors primecis-regulatory elements required for macrophage and B cell identities. Mol. Cell 38, 576–589(2010).

50. J. C. Pui, D. Allman, L. Xu, S. DeRocco, F. G. Karnell, S. Bakkour, J. Y. Lee, T. Kadesch,R. R. Hardy, J. C. Aster, W. S. Pear, Notch1 expression in early lymphopoiesis influencesB versus T lineage determination. Immunity 11, 299–308 (1999).

51. D. M. Gerhardt, K. V. Pajcini, T. D’altri, L. Tu, R. Jain, L. Xu, M. J. Chen, S. Rentschler,O. Shestova, G. B. Wertheim, J. W. Tobias, M. Kluk, A. W. Wood, J. C. Aster, P. A. Gimotty,J. A. Epstein, N. Speck, A. Bigas, W. S. Pear, The Notch1 transcriptional activation domainis required for development and reveals a novel role for Notch1 signaling in fetalhematopoietic stem cells. Genes Dev. 28, 576–593 (2014).

52. B. S. Carvalho, R. A. Irizarry, A framework for oligonucleotide microarray preprocessing.Bioinformatics 26, 2363–2367 (2010).

53. G. K. Smyth, Linear models and empirical bayes methods for assessing differentialexpression in microarray experiments. Stat. Appl. Genet. Mol. Biol. 3, Article3 (2004).

Acknowledgments: We thank K. Toscano and S. Yu for technical assistance; P. Gimmoty forstatistical consultation; J. Aster, M. Chiang, A. Ferrando, and D. Gerhardt for insightfulcomments; J. Aster for reagents; J. Soulier and C. Mullighan for the advice on patient T-ALLdata sets; and the following cores at the University of Pennsylvania that contributed to thisstudy: Mouse husbandry (University Laboratory Animal Resources), the Abramson CancerCenter Flow Cytometry Core (P30-CA016520), and the Abramson Family Cancer ResearchInstitute Cores. This work benefited from data assembled by the Immunological Genome(Immgen) Project Consortium. Funding: This work was supported by a Leukemia andLymphoma Society Fellow Award and T32HL007843 (K.V.P.) and the NIH [grants P01CA119070


(to W.S.P. and S.C.B.), R01HL134971 (to K.V.P.), and R01AI047833 (to W.S.P.)]. This work wasalso supported by a grant from the KiKa foundation Stichting Kinderen Kankervrij [KIKA-2010-082 (to Y.L.)]. Author contributions: K.V.P. designed and performed most of theexperiments, interpreted the results, wrote the manuscript, and assembled the figures. L.X.performed in vivo mouse experiments and BMTs. L.S. and K.P. performed the experiments andgenerated the data for Fig. 6. J.P. performed the H3K27Ac experiments for Fig. 3. Y.O. andW.B. performed the array shown in table S2. C.L. performed the experiments shown in fig. S4(B and C). G.B.W. analyzed the histology and tumor infiltration in leukemic transplants.R.M. and N.M. provided the ETS1 knockout BM and helped design the experiments shown infig. S5. Y.L. and J.P.P.M. analyzed the human T-ALL data sets shown in fig. S2. S.C.B. helpeddesign the experiments and edited the manuscript. R.B.F. helped design the ChIP-seq andanalyzed the results for the experiment in Fig. 3. S.C. helped design the Notch gain-of-functionscreen, provided the cDNA library, and assembled and analyzed the data shown in Fig. 1.W.S.P. designed the experiments in this study, interpreted all the data, and helped writethe manuscript. Competing interests: The authors declare that they have no competinginterests. Data and materials availability: The H3K27Ac ChIP-seq and Affymetrix data havebeen deposited to Gene Expression Omnibus (accession no. GSE104993).

Submitted 6 January 2017Resubmitted 9 February 2017Accepted 13 October 2017Published 14 November 201710.1126/scisignal.aam6846

Citation: K. V. Pajcini, L. Xu, L. Shao, J. Petrovic, K. Palasiewicz, Y. Ohtani, W. Bailis, C. Lee,G. B. Wertheim, R. Mani, N. Muthusamy, Y. Li, J. P. P. Meijerink, S. C. Blacklow, R. B. Faryabi,S. Cherry, W. S. Pear, MAFB enhances oncogenic Notch signaling in T cell acute lymphoblasticleukemia. Sci. Signal. 10, eaam6846 (2017).

rom

12 of 12


ag.org/


MAFB enhances oncogenic Notch signaling in T cell acute lymphoblastic leukemia

Faryabi, Sara Cherry and Warren S. PearB. Wertheim, Rajeswaran Mani, Natarajan Muthusamy, Yunlei Li, Jules P. P. Meijerink, Stephen C. Blacklow, Robert B. Kostandin V. Pajcini, Lanwei Xu, Lijian Shao, Jelena Petrovic, Karol Palasiewicz, Yumi Ohtani, Will Bailis, Curtis Lee, Gerald

DOI: 10.1126/scisignal.aam6846 (505), eaam6846.10Sci. Signal.

may be a more targeted therapy for leukemia patients.critical for the maintenance of various healthy adult tissues, developing a way to inhibit MAFB or its interacting partners acetyltransferases. Expressing MAFB enhanced the development of Notch1-mutant T-ALL in mice. Because Notch1 isincreased the expression of Notch1 target genes in mouse and human T-ALL cells by recruiting histone

found that the transcription factors MAFB and ETS2et al.these mutants frequently fail to develop T-ALL. Pajcini mediates cell-cell contact signaling in embryonic development and adult tissue maintenance. However, mice expressing

T cell acute lymphoblastic leukemias (T-ALLs) are often caused by mutations in the gene encoding Notch1, whichNew targets, better mouse model for leukemia

ARTICLE TOOLS http://stke.sciencemag.org/content/10/505/eaam6846

MATERIALSSUPPLEMENTARY http://stke.sciencemag.org/content/suppl/2017/11/10/10.505.eaam6846.DC1

CONTENTRELATED

http://stke.sciencemag.org/content/sigtrans/7/317/ra28.fullhttp://stke.sciencemag.org/content/sigtrans/8/369/ra30.fullhttp://stke.sciencemag.org/content/sigtrans/10/477/eaag1598.full

REFERENCES

http://stke.sciencemag.org/content/10/505/eaam6846#BIBLThis article cites 53 articles, 27 of which you can access for free

PERMISSIONS http://www.sciencemag.org/help/reprints-and-permissions

Terms of ServiceUse of this article is subject to the

registered trademark of AAAS.is aScience Signaling Association for the Advancement of Science. No claim to original U.S. Government Works. The title

York Avenue NW, Washington, DC 20005. 2017 © The Authors, some rights reserved; exclusive licensee American (ISSN 1937-9145) is published by the American Association for the Advancement of Science, 1200 NewScience Signaling


ag.org/D

ownloaded from

http://stke.sciencemag.org/content/10/505/eaam6846

http://stke.sciencemag.org/content/suppl/2017/11/10/10.505.eaam6846.DC1

http://stke.sciencemag.org/content/sigtrans/10/477/eaag1598.full

http://stke.sciencemag.org/content/sigtrans/8/369/ra30.full

http://stke.sciencemag.org/content/sigtrans/7/317/ra28.full

http://stke.sciencemag.org/content/10/505/eaam6846#BIBL

http://www.sciencemag.org/help/reprints-and-permissions

http://www.sciencemag.org/about/terms-service


mafb enhances oncogenic notch signaling in t cell acute ... · served signaling pathway that...

Documents