magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake

Company LOGO

Magnetic silica spheres with large nanopores for nucleic acid adsorptio

nand cellular uptake

Jian Liu, Bo Wang, Sandy Budi Hartono BiomaterialsUniversity of Queensland, Australia

www.themegallery.com,

contents

Introduction Experimental Section Results and Discussion Conclusions


IntroductionMesoporous materials Large specific surface area Large pore volume Uniform pore size distribution

Mesoporous silica nanoparticles (MSNs)

Biocompatibility Low toxicity

Catalysis

Imaging

Drug delivery

Biological application


Introduction

Other properties that MSNs required for biological application

Large pore sizes Appropriate magnetic properties Appropriate functional surface


Introduction1 、 Large pore size Large internal surface Large mesoporous volume

Cytochrom C 2.6×3.2×3.3 nm

a-L-arabinofuranosidase 3.9×9.7×14.4 nm

Suitable pore sizes for immobilisation of these proteins can vary from10 to 50 nm


Introduction

2 、 Magnetic properties Bioseparation Cell sorting Diagnostic analysis Simultaneous imaging and drug delivery


IntroductionPreparation methods ： Large pore size mesoporous materials Templates ： Pluronic P123 Swelling agent ： 1,3,5-trimethyl benzene (TMB) or alkanes Condition ： Strong acidic Magnetic mesoporous materials Templates ： Brij56 micelles Condition ： Basic


Introduction3 、 Functional surface To delivery nucleic acids, the silica surface with posit

ive charge is needed to electrostatically bind DNA and RNA molecules

Methods ： Functionalisation with amine-derivative group such as APTES Conjugations with cationic polymers such as PEI


Introduction

Develop synthesis methods to prepare MSNLP Establish a surface functionalisation method to enabl

e adsorption and delivery of nucleic acids


Experimental SectionSynthesis of monodisperse superparamagnetic Fe3O4 nanocrystals

Fe3+

1-octadecene

Iron stearic acid

1,2-hexadecanediol+

Static conditions at 250℃in a Teflon-lined autoclave for 6~12 h

The concentration of the magnetic nanocrystals is 10 or 30 mg/ mL and suspended in hexane


Experimental Section Synthesis of magnetic silica nanospheres with large nanopores

30-glycidox-ypropyltrimethoxysilane (GOPS)

PLL


Experimental Section

DNA adsorption CpG DNA 1826 (5‘ to 3‘, TCCATGACGTTCCTGACGTT ） Measuring A260 absorbance at 260 nm

Transfection of cells CyTM3-labeled miRNA Rat kidney epithelial cells (NRK-52E)


Results and DiscussionSynthesis of magnetic silica nanospheres with large nanopores


Results and Discussion

Fig. 1. SEM (a, c), TEM (b, d-f), and HRTEM (g, h) images of MSNLP synthesised with different amount of hexane: MSNLP-0-350 (a, b), MSNLP-10-350 (c, d), MSNLP-10-700 (e), MSNLP-10-1400 (f-h).



Brij56: polyoxyethylene 10 cetyl ether, C16H33EO10

N0I0 route


Results and DiscussionMagnetic properties of magnetic silica nanospheres with large nanopores



Fig. (A) Field-dependent magnetisation at 300 K of MSNLP with different amounts of magnetite: a) MSNLP-10-350, b) MSNLP-10-700, c) MSNLP-10-1400, and d) MSNLP-30-1400; and (B) the separation process of MSNLP-30-1400 nanospheres from solution by magnet (right picture) and their re-dispersion by as slight shake (left picture).


Results and DiscussionComposition of PLL functionalised MSNLP


Results and DiscussionAdsorption of DNA on PLL functionalisedmagnetic silica nanospheres with largenanopores

MSNLP-0-350-PLL qm=22.5μg/mg

MSNLP-10-350-PLL qm =15μg/mg

MSNLP-10-1400-PLL qm=10μg/mg



Fig. Left panel a-d, cells transfected with fluorescent oligonucleotide only; middle panel e-h, cells transfected with nanoparticles alone; andright panel i-l, cells transfected with nanoparticles loaded with fluorescent oligonucleotide. From top to bottom: cy5 channel - images of fluorescence of CyTM3 labeled miRNA (red),F-actin - images of F-actin stained by FITC-Phalloidin (green), DAPI - images of nuclei stained with DAPI (blue), and merge - the merged picture.


Conclusions

Magnetic silica nanospheres with large nanopores(13-20 nm) were synthesised for the first time

The saturation magnetisation values can be conveniently controlled by changing the amount of Fe3O4 magnetic nanocrystals encapsulated

After functionalisation with PLL, high adsorption capacity ranging from 10 to22.5 μg/mg for CpG DNA and efficient cellular delivery capability for miRNA were achieved

The materials synthesised in this study could find broad applications


Thank You

magnetic silica spheres with large nanopores for nucleic acid adsorption and cellular uptake

Documents