Major Histocompatibility Major Histocompatibility ComplexComplexProject IIProject II

byby

Aramak AfzalAramak Afzal

Ezzeddin KamilEzzeddin Kamil

Fatemeh KavehFatemeh Kaveh

Hawlader Abdullah Al-Hawlader Abdullah Al-MamunMamun

IntroductionIntroduction

The Major Histocompatibility Complex The Major Histocompatibility Complex (MHC) is a large genomic region or (MHC) is a large genomic region or gene family found in most vertebrates gene family found in most vertebrates containing many genes with containing many genes with important immune system roles.important immune system roles.

Three types of MHC: Class I, Class II Three types of MHC: Class I, Class II and Class IIIand Class III

Class II MHC molecules are associated Class II MHC molecules are associated with many autoimmune diseases.with many autoimmune diseases.

Immune SystemImmune System

The The immune systemimmune system is the system is the system of specialized cells and organs that of specialized cells and organs that protect an organism from outside protect an organism from outside biological influences. biological influences.

it protects the body against bacteria it protects the body against bacteria and viral infections, destroying and viral infections, destroying cancer cells and foreign substances cancer cells and foreign substances

Two types of immune system: Innate Two types of immune system: Innate Immunity and Adaptive Immunity Immunity and Adaptive Immunity

Immune System continued…Immune System continued…

Innate Immunity:Innate Immunity: generally generally comprising a set of germ-line comprising a set of germ-line encoded receptors to pathogens, encoded receptors to pathogens, that does not change during the that does not change during the lifetime of the organism lifetime of the organism

Adaptive ImmunityAdaptive Immunity: The provision of : The provision of long lasting and specific protection long lasting and specific protection against formerly encountered against formerly encountered pathogens, which takes days to developpathogens, which takes days to develop

The MHC molecules belongs to adaptive The MHC molecules belongs to adaptive immune system. immune system.

Location of MHC in Human GenomeLocation of MHC in Human Genome

Class I, II and III MHCClass I, II and III MHC

MHC is encoded by several genes on MHC is encoded by several genes on chromosome 6.chromosome 6.

The class I region encodes class I molecules that The class I region encodes class I molecules that perform antigen-presenting function to CD8 T-perform antigen-presenting function to CD8 T-lymphocytes,lymphocytes,

The class II region encodes the class II molecules The class II region encodes the class II molecules that present antigen to CD4 T-lymphocytes. that present antigen to CD4 T-lymphocytes.

The class III region harbors a diverse array of The class III region harbors a diverse array of structurally unrelated genes, among them several structurally unrelated genes, among them several genes involved in innate immunity. genes involved in innate immunity.

Class I MHCClass I MHC

Class I molecules are composed of two Class I molecules are composed of two polypeptide chains; one encoded by the BCA polypeptide chains; one encoded by the BCA region and another (ß2-microglobulin) that is region and another (ß2-microglobulin) that is encoded elsewhere. encoded elsewhere.

The MHC-encoded polypeptide is about 350 The MHC-encoded polypeptide is about 350 amino acids long and total molecular weight of amino acids long and total molecular weight of about 45 kDa about 45 kDa

This polypeptide folds into three separate This polypeptide folds into three separate domains called alpha-1, alpha-2 and alpha-3. domains called alpha-1, alpha-2 and alpha-3.

ß2-microglobulin is a 12 kDa polypeptide that is ß2-microglobulin is a 12 kDa polypeptide that is non-covalently associated with the alpha-3 non-covalently associated with the alpha-3 domain. domain.

Class I MHCClass I MHC

Class I MHC Side view Class I MHC Side view Top viewTop view

Class II MHCClass II MHC

Class II molecules are composed of Class II molecules are composed of two polypeptide chains, both encoded two polypeptide chains, both encoded by the D region. by the D region.

These polypeptides (alpha and beta) These polypeptides (alpha and beta) are about 230 and 240 amino acids are about 230 and 240 amino acids long, and molecular weights of about long, and molecular weights of about 33 kDa and 28 kDa. 33 kDa and 28 kDa.

These polypeptides fold into two These polypeptides fold into two separate domains; alpha-1 and alpha-2 separate domains; alpha-1 and alpha-2 for the alpha polypeptide, and beta-1 for the alpha polypeptide, and beta-1 and beta-2 for the beta polypeptide. and beta-2 for the beta polypeptide.

Class II MHCClass II MHC

Class II MHC Side view Top Class II MHC Side view Top viewview

Basic Features of MHCBasic Features of MHC

The MHC is associated with more The MHC is associated with more diseases than any other region of the diseases than any other region of the human genome.human genome.

It is the most polymorphic region in It is the most polymorphic region in the genome.the genome.

the best known genes in the MHC the best known genes in the MHC region are the subset that encodes region are the subset that encodes cell-surface antigen-presenting cell-surface antigen-presenting proteins. In humans, these genes are proteins. In humans, these genes are referred to as referred to as human leukocyte human leukocyte antigenantigen (HLA) (HLA) genes genes

Basic Features of MHC Basic Features of MHC continuedcontinued……

The most intensely studied HLA The most intensely studied HLA genes are the nine so-called classical genes are the nine so-called classical MHC genes: HLA-A, HLA-B, HLA-C, MHC genes: HLA-A, HLA-B, HLA-C, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRA, and HLA-HLA-DQB1, HLA-DRA, and HLA-DRB1. DRB1.

In humans, the A, B, and C genes In humans, the A, B, and C genes belong to MHC class I while the six belong to MHC class I while the six D genes belong to class II D genes belong to class II

Origin of MHCOrigin of MHC Origin not knownOrigin not known Class II first or Class I first?Class II first or Class I first? Hypothesis 1: Class I MHC originated Hypothesis 1: Class I MHC originated

first as a result of a recombination between an first as a result of a recombination between an immunoglobulin-like C-domain and the peptide-immunoglobulin-like C-domain and the peptide-binding domain of an HSP70 heat-shock binding domain of an HSP70 heat-shock protein. protein.

Hypothesis 2: the ancestral MHC molecule Hypothesis 2: the ancestral MHC molecule had a class II-like structure and it gave rise to had a class II-like structure and it gave rise to the class I molecule. the class I molecule.

second hypothesis is supported by more second hypothesis is supported by more evidence.evidence.

One research suggest MHC region may be as One research suggest MHC region may be as old as 370 million years. old as 370 million years.

MHC is not present in all invertebrates as well MHC is not present in all invertebrates as well as primitive vertebrates.as primitive vertebrates.

MHC seems to evolved from the primitive jawed MHC seems to evolved from the primitive jawed vertebrates and upwards.vertebrates and upwards.

Species That Have MHC GenesSpecies That Have MHC Genes

Group Group Species Included Species Included Researcher Researcher

BoLABoLA CattleCattle Shirley EllisShirley Ellis

DLADLA Domestic Dogs, WolvesDomestic Dogs, Wolves Lorna KennedyLorna Kennedy

FLAFLA Domestic Cats Domestic Cats Lorna Kennedy Lorna Kennedy

NHPNHP Apes, Old and New World Apes, Old and New World MonkeysMonkeys

Ronald Bontrop Ronald Bontrop

RT1RT1 RatRat Lutz Walter Lutz Walter

SLASLA PigPig Douglas Smith Douglas Smith

Chicken MHC Chicken MHC ChickensChickens Jim KaufmannJim Kaufmann

Fish Fish SalmonSalmon René StetRené Stet

Sheep Sheep SheepSheep Keith Ballingall / Keith Ballingall / Mike StearMike Stear

BoLA:BoLA: The MHC of cattle is found on The MHC of cattle is found on the chromosome 23the chromosome 23

OLA:OLA: The MHC of sheep OLA has The MHC of sheep OLA has been localized to chromosome 20 been localized to chromosome 20 between bands q15-q23between bands q15-q23

Chicken MHCChicken MHC is located on is located on microcromosome 16 and it is called microcromosome 16 and it is called the B-F/B-L regionthe B-F/B-L region

H-2/RT1:H-2/RT1: Chromosome 20p12 Chromosome 20p12 encompasses the MHC of mouse/rat.encompasses the MHC of mouse/rat.

comparative analysis of structure and sequence of the MHC region in mouse H2 (top), rat RT1 (center), and human HLA (bottom).

MHC Related DatabasesMHC Related DatabasesIPDIPD

The Immune Polymorphism Database (IPD) is a set of The Immune Polymorphism Database (IPD) is a set of specialist databases related to the study of polymorphic genes specialist databases related to the study of polymorphic genes in the immune system.in the immune system.

The IMGT/HLA Sequence DatabaseThe IMGT/HLA Sequence Database The IMGT/HLA Sequence Database provides a The IMGT/HLA Sequence Database provides a

specialist databases for sequences of the human specialist databases for sequences of the human major histocompatibility complex (HLA) and major histocompatibility complex (HLA) and includes the official sequences for the WHO HLA includes the official sequences for the WHO HLA Nomenclature Committee for Factors of the HLA Nomenclature Committee for Factors of the HLA System. The IMGT/HLA Sequence Database is System. The IMGT/HLA Sequence Database is part of the international part of the international ImMunoGeneTicsImMunoGeneTics project project

(IMGT).(IMGT).

PART II PART II

DISTRIBUTED ANNOTATION DISTRIBUTED ANNOTATION SERVERSERVER

Definition :Definition :

““The distributed annotation system The distributed annotation system (DAS) is a client-server system in which (DAS) is a client-server system in which a single client integrates information a single client integrates information from multiple servers. It allows a single from multiple servers. It allows a single machine to gather up genome annotation machine to gather up genome annotation information from multiple distant web information from multiple distant web sites, collate the information, and display sites, collate the information, and display it to the user in a single view. Little it to the user in a single view. Little coordination is needed among the coordination is needed among the various information providers” various information providers”

(biodas.org). (biodas.org).

DAS SpecificationDAS Specification Distributed Annotation System (DAS);Distributed Annotation System (DAS);

A server system for the sharing of A server system for the sharing of Reference Sequences, and their Reference Sequences, and their annotations.annotations.

Reference Sequence;Reference Sequence; A sequence.A sequence.

Annotation - An entity which:Annotation - An entity which: Is anchored to the reference sequence via Is anchored to the reference sequence via

a stop and start value.a stop and start value. Possesses an ID unique to the server and a Possesses an ID unique to the server and a

structured description of its types, structured description of its types, methods, and categories.methods, and categories.

Global Annotation:Global Annotation: Annotation that applies to the entire Annotation that applies to the entire

reference sequence; start and stop are reference sequence; start and stop are voidvoid

ZFIN

Zeb

rafi

sh

Gen

om

e R

esou

rces W

ork

sh

op

- D

resd

en

2005

www.biodas.org

reference sequence

genome browser

local storage

remote storage

DAS server

remote storage

DAS server

remote storage

DAS server

XML

DAS client

Distributed Annotation System (DAS)

<?xml version='1.0' standalone='no' ?><!DOCTYPE DASDSN SYSTEM 'dasdsn.dtd' ><DASDSN> ... <DSN> <SOURCE id="ensembl_Fugu_rubripes_core_28_2d" version="28_2d">pufferfish ensembl 28_2d</SOURCE> <MAPMASTER>http://servlet.sanger.ac.uk:8080/das/ensembl_Fugu_rubripes_core_28_2d/</MAPMASTER> <DESCRIPTION>ensembl pufferfish Curation Reference Source</DESCRIPTION> </DSN> <DSN> <SOURCE id="ensembl_Homo_sapiens_core_32_35e" version="32_35e">human ensembl 32_35e</SOURCE> <MAPMASTER>http://servlet.sanger.ac.uk:8080/das/ensembl_Homo_sapiens_core_32_35e/</MAPMASTER> <DESCRIPTION>ensembl human Curation Reference Source</DESCRIPTION> </DSN> <DSN> <SOURCE id="ensembl_Homo_sapiens_core_32_35e_cds" version="32_35e">ensembl cds</SOURCE> <MAPMASTER>http://das.ensembl.org/das/ensembl_Homo_sapiens_core_32_35e</MAPMASTER> <DESCRIPTION>Clone centric view of ensembl human CDS</DESCRIPTION> </DSN> <DSN> <SOURCE id="ensembl_Mus_musculus_core_28_33d" version="28_33d">mouse ensembl 28_33d</SOURCE> <MAPMASTER>http://servlet.sanger.ac.uk:8080/das/ensembl_Mus_musculus_core_28_33d/</MAPMASTER> <DESCRIPTION>ensembl mouse Curation Reference Source</DESCRIPTION> </DSN> <DSN> <SOURCE id="ensembl_Saccharomyces_cerevisiae_core_29_1" version="29_1">yeast ensembl 29_1</SOURCE> <MAPMASTER>http://servlet.sanger.ac.uk:8080/das/ensembl_Saccharomyces_cerevisiae_core_29_1/</MAPMASTER> <DESCRIPTION>ensembl yeast Curation Reference Source</DESCRIPTION> </DSN> ...</DASDSN>

HTTP query example : (to retrieve all the data sources in a databases)

http://servlet.sanger.ac.uk:8080/das/dsn

HTTP query example : (to retrieve the list of sequence entry HTTP query example : (to retrieve the list of sequence entry points available and their sizes in base pairs)points available and their sizes in base pairs)

http://servlet.sanger.ac.uk:8080/das/http://servlet.sanger.ac.uk:8080/das/ensembl_Homo_sapiens_core_32_35eensembl_Homo_sapiens_core_32_35e/entry_points//entry_points/

<?xml version='1.0' standalone='no' ?><?xml version='1.0' standalone='no' ?><!DOCTYPE DASEP SYSTEM 'dasep.dtd' ><!DOCTYPE DASEP SYSTEM 'dasep.dtd' ><DASEP><DASEP> <ENTRY_POINTS href="http://servlet.sanger.ac.uk:8080/das/ensembl_Homo_sapiens_core_32_35e<ENTRY_POINTS href="http://servlet.sanger.ac.uk:8080/das/ensembl_Homo_sapiens_core_32_35e /entry_points/" version="32_35e">/entry_points/" version="32_35e"> ...... <SEGMENT id="15_NT_079547" size="168820" subparts="yes" /><SEGMENT id="15_NT_079547" size="168820" subparts="yes" /> <SEGMENT id="8_NT_079523" size="13036" subparts="yes" /><SEGMENT id="8_NT_079523" size="13036" subparts="yes" /> <SEGMENT id="17" size="78774742" subparts="yes" /><SEGMENT id="17" size="78774742" subparts="yes" /> <SEGMENT id="6" size="170975699" subparts="yes" /><SEGMENT id="6" size="170975699" subparts="yes" /> <SEGMENT id="7_NT_086714" size="182896" subparts="yes" /><SEGMENT id="7_NT_086714" size="182896" subparts="yes" /> <SEGMENT id="17_NT_079570" size="31181" subparts="yes" /><SEGMENT id="17_NT_079570" size="31181" subparts="yes" /> <SEGMENT id="17_NT_079556" size="142595" subparts="yes" /><SEGMENT id="17_NT_079556" size="142595" subparts="yes" /> <SEGMENT id="8_NT_079517" size="50950" subparts="yes" /><SEGMENT id="8_NT_079517" size="50950" subparts="yes" /> <SEGMENT id="DR52" size="170972699" subparts="yes" /><SEGMENT id="DR52" size="170972699" subparts="yes" /> <SEGMENT id="21" size="46944323" subparts="yes" /><SEGMENT id="21" size="46944323" subparts="yes" /> ......</ENTRY_POINTS></ENTRY_POINTS></DASEP></DASEP>

HTTP query example : (to retrieve the annotations HTTP query example : (to retrieve the annotations across one or more segments of sequence)across one or more segments of sequence)

http://servlet.sanger.ac.uk:8080/das/ensembl_Homo_sapiens_core_32_35e/ http://servlet.sanger.ac.uk:8080/das/ensembl_Homo_sapiens_core_32_35e/ features?segmentfeatures?segment=6=6:31400000,31500000:31400000,31500000

<?xml version='1.0' standalone='no' ?><?xml version='1.0' standalone='no' ?><!DOCTYPE DASGFF SYSTEM 'dasgff.dtd' ><!DOCTYPE DASGFF SYSTEM 'dasgff.dtd' ><DASGFF><DASGFF> <GFF version="1.0" href="http://servlet.sanger.ac.uk:8080/das/ensembl_Homo_sapiens_core_32_35e/<GFF version="1.0" href="http://servlet.sanger.ac.uk:8080/das/ensembl_Homo_sapiens_core_32_35e/ features?segment=6:31400000,31500000">features?segment=6:31400000,31500000"> <SEGMENT id="<SEGMENT id="66" version="32_35e" start="31400000" stop="31500000">" version="32_35e" start="31400000" stop="31500000"> ...... <FEATURE id="AL645933.8.2001.111328" label="AL645933.8.2001.111328"><FEATURE id="AL645933.8.2001.111328" label="AL645933.8.2001.111328"> <TYPE id="<TYPE id="contigcontig" reference="yes" subparts="no">contig</TYPE>" reference="yes" subparts="no">contig</TYPE> <METHOD id="ensembl">ensembl</METHOD><METHOD id="ensembl">ensembl</METHOD> <START>31460758</START><START>31460758</START> <END>31570085</END><END>31570085</END> <SCORE>-</SCORE><SCORE>-</SCORE> <ORIENTATION>+</ORIENTATION><ORIENTATION>+</ORIENTATION> <PHASE>-</PHASE><PHASE>-</PHASE> <TARGET id="AL645933.8.2001.111328" start="1" stop="109328" /><TARGET id="AL645933.8.2001.111328" start="1" stop="109328" /> </FEATURE></FEATURE> <FEATURE id="ENST00000359635" label="HLA-B"><FEATURE id="ENST00000359635" label="HLA-B"> <TYPE id="<TYPE id="transcripttranscript">transcript</TYPE>">transcript</TYPE> <METHOD id="ensembl">ensembl</METHOD><METHOD id="ensembl">ensembl</METHOD> <START><START>3143023931430239</START></START> <END><END>3143293531432935</END></END> <SCORE>-</SCORE><SCORE>-</SCORE> <ORIENTATION>-</ORIENTATION><ORIENTATION>-</ORIENTATION> <PHASE>-</PHASE><PHASE>-</PHASE> </FEATURE></FEATURE> ...... </SEGMENT></SEGMENT> </GFF></GFF></DASGFF></DASGFF>

HTTP query example : (to retrieve DNA corresponding to HTTP query example : (to retrieve DNA corresponding to the indicated segment)the indicated segment)

http://servlet.sanger.ac.uk:8080/das/ensembl_Homo_sapiens_core_32_35e/ http://servlet.sanger.ac.uk:8080/das/ensembl_Homo_sapiens_core_32_35e/ dna?segmentdna?segment=6=6:31430239,31432935:31430239,31432935

<?xml version='1.0' standalone='no' ?><?xml version='1.0' standalone='no' ?><!DOCTYPE DASDNA SYSTEM 'dasdna.dtd' ><!DOCTYPE DASDNA SYSTEM 'dasdna.dtd' ><DASDNA><DASDNA> <SEQUENCE id="6" version="32_35e" start="31430239" stop="31432935"><SEQUENCE id="6" version="32_35e" start="31430239" stop="31432935"> <DNA length="2697"><DNA length="2697">

tcaagctgtgagagacacatcagagccctgggcactgtcgctgcctggagtagaacaaaaacaggacctggtcagagcccgcaggagacgtgggacaggaggaattcaagctgtgagagacacatcagagccctgggcactgtcgctgcctggagtagaacaaaaacaggacctggtcagagcccgcaggagacgtgggacaggaggaattatggggtgggtgagctcctccacactcccacccccaccacttacacgcagcctgagagtagctccctccttttccacctgtgggaagaaaatgtcctgtgagggcactgtatggggtgggtgagctcctccacactcccacccccaccacttacacgcagcctgagagtagctccctccttttccacctgtgggaagaaaatgtcctgtgagggcactgggaggaagcagggccatgagatcttagaggaacctcctagtcttggacccaaaaggaatttccagaagtatgactacagacccagggcaggatcaggaaacacgagggaggaagcagggccatgagatcttagaggaacctcctagtcttggacccaaaaggaatttccagaagtatgactacagacccagggcaggatcaggaaacacgaggaaagcaagtgtgggtcctggaccaactgccctcctaaggtctgtccttagcagggaccttcccctgactcatgaatgctggaatcaggaccccaacaccacaaccatcgaaagcaagtgtgggtcctggaccaactgccctcctaaggtctgtccttagcagggaccttcccctgactcatgaatgctggaatcaggaccccaacaccacaaccatcaaggtgatacatccatccttcattgtcacatgtgctgcacaaaagagtaagtgctggcacacagggtcccaggctgcgttagcccctgtgtgcatgctgcttcccagtaataaggtgatacatccatccttcattgtcacatgtgctgcacaaaagagtaagtgctggcacacagggtcccaggctgcgttagcccctgtgtgcatgctgcttcccagtaatgaggcagggaacacttctacctggggcttgaaacccccagtgggacaagaaaacccagaccccacccctcaccccttccctacctgaactcttcctcctacacatcacagaggcagggaacacttctacctggggcttgaaacccccagtgggacaagaaaacccagaccccacccctcaccccttccctacctgaactcttcctcctacacatcacagcagcgaccacagctccgatgaccacaactgctaggacagccaggccagcaacaatgcccacgatggggacggtggactgggaagacggctctgggaaaggagggcagcgaccacagctccgatgaccacaactgctaggacagccaggccagcaacaatgcccacgatggggacggtggactgggaagacggctctgggaaaggaggggaagatgaggggccctgaccctgctgaagggctcctgctttccctgagaagagatatgacccctcatccccctccttaccccatctcagggtgaggggcttcggcagcggaagatgaggggccctgaccctgctgaagggctcctgctttccctgagaagagatatgacccctcatccccctccttaccccatctcagggtgaggggcttcggcagcccctcatgctgtacatggcatgtgtatctctgctcttctccagaaggcaccaccacagctgcccacttctggaaggttctatctcctgctggtctggtctccacaagctcagtccctcatgctgtacatggcatgtgtatctctgctcttctccagaaggcaccaccacagctgcccacttctggaaggttctatctcctgctggtctggtctccacaagctcagtgtcctgagtttggtcctcgccatcccgctgccaggtcagtgtgatctccgcagggtagaaacccagggcccagcacctcagggtggcctcatggtcagagatggggtggtcctgagtttggtcctcgccatcccgctgccaggtcagtgtgatctccgcagggtagaaacccagggcccagcacctcagggtggcctcatggtcagagatggggtggtgggtcacgtgtgtctttggggggtctgatgggaagagtcagaaaattcaggcgctttgcatctttcatgggacaccctaggaccacccatgtgaccagcctgagaatgtgggtcacgtgtgtctttggggggtctgatgggaagagtcagaaaattcaggcgctttgcatctttcatgggacaccctaggaccacccatgtgaccagcctgagaatggacaggacacctggggtggggaaggggcacagaacccagacaccagcctggacgcaggcacctgggataatctcctattcattggaaagttcgagtctctgagcgggacaggacacctggggtggggaaggggcacagaacccagacaccagcctggacgcaggcacctgggataatctcctattcattggaaagttcgagtctctgagcggggaacagggacttctgctcctgatctgagtggaggtaaagtgactcagaagtgctggaatcagagccccaaacacactgagtgtgaggcagagaacaaggcctgagggaacagggacttctgctcctgatctgagtggaggtaaagtgactcagaagtgctggaatcagagccccaaacacactgagtgtgaggcagagaacaaggcctgagaggaaaagtcacggttcccaaggctgctgcaggggtcaaaggggacccctgatcagtattctagggactgtcttcccctccatttcctcagagacgtcattccttaattgaggaaaagtcacggttcccaaggctgctgcaggggtcaaaggggacccctgatcagtattctagggactgtcttcccctccatttcctcagagacgtcattccttaattgtctagagagaagagggggccctcagaggaaactcaggaaaactcatgccattctccattcaacggagggcgacattctagcgctgatcccattttcctcctcttctcgtgtctagagagaagagggggccctcagaggaaactcaggaaaactcatgccattctccattcaacggagggcgacattctagcgctgatcccattttcctcctcttctcgtgggaggccatccccggcgacctataggagatggggaaggctccccactgcccctggtaccagcgcgctccagcttgtccttcccgttctccaggtatctgcggagccagggaggccatccccggcgacctataggagatggggaaggctccccactgcccctggtaccagcgcgctccagcttgtccttcccgttctccaggtatctgcggagccactccacgcactcgccctccaggtaggctctccgctgctccgcctcacgggccgcctcccacttgcgctgggtgatctgagccgccgtgtccgcggcggtccaggagcgctccacgcactcgccctccaggtaggctctccgctgctccgcctcacgggccgcctcccacttgcgctgggtgatctgagccgccgtgtccgcggcggtccaggagcgcaggtcctcgttcagggcgatgtaatccttgccgtcgtaggcgtactggtcatgcccgcggaggaggcgcccgtccggccccacgtcgcagccgtacatgctctggagcaggtcctcgttcagggcgatgtaatccttgccgtcgtaggcgtactggtcatgcccgcggaggaggcgcccgtccggccccacgtcgcagccgtacatgctctggagggtgtgagaccctggccccggccccgcggtcagcccagtcccccgagccccgccccgccccgaccaacccgcggggattttggcctcaactgaaaatgaaaccgggggtgtgagaccctggccccggccccgcggtcagcccagtcccccgagccccgccccgccccgaccaacccgcggggattttggcctcaactgaaaatgaaaccgggtaaacgcgcctggggctctcgccggtcgagggtctgggcgggtcccgcggcctcagggaggcggatctcggacccggagactcggggcgacccgggccgtacgtgtaaacgcgcctggggctctcgccggtcgagggtctgggcgggtcccgcggcctcagggaggcggatctcggacccggagactcggggcgacccgggccgtacgtgggggatggggagtcgtgacctgcgccccgggccggggtcactcaccggcctcgctctggttgtagtagccgcgcaggttccgcaggctctctcggtcagtctgtgcctggggatggggagtcgtgacctgcgccccgggccggggtcactcaccggcctcgctctggttgtagtagccgcgcaggttccgcaggctctctcggtcagtctgtgcctgggccttgtagatctgtgtgttccggtcccaatactccggcccctcctgctctatccacggcgcccgcggctcctctctcggactcgcggcgtcgctgtcgaacctcacgagggccttgtagatctgtgtgttccggtcccaatactccggcccctcctgctctatccacggcgcccgcggctcctctctcggactcgcggcgtcgctgtcgaacctcacgaactgggtgtcgtccacgtagcccactgagatgaagcggggctccccgcggccgggccgggacacggaggtgtagaaatacctcatggagtgggagcctgggggtgactgggtgtcgtccacgtagcccactgagatgaagcggggctccccgcggccgggccgggacacggaggtgtagaaatacctcatggagtgggagcctgggggtgaggaggggctgagacccgcccgaccctcctcccggcgcggctcctcaggtcctgcgcccccgcctgcggtcccctcgctcctcccggcagaggccatttccctcccgaaggaggggctgagacccgcccgaccctcctcccggcgcggctcctcaggtcctgcgcccccgcctgcggtcccctcgctcctcccggcagaggccatttccctcccgacccgcactcaccggcccaggtctcggtcagggccagggccgccgagagcagcaggaggacggttcggggcgccatgaccagcatctcggcgtctgaggagactctcccgcactcaccggcccaggtctcggtcagggccagggccgccgagagcagcaggaggacggttcggggcgccatgaccagcatctcggcgtctgaggagactct

</DNA></DNA> </SEQUENCE></SEQUENCE></DASDNA></DASDNA>