TAXONOMY AND MOLECULAR PHYLOGENY OF Halymenia SPECIES (HALYMENIACEAE, RHODOPHYTA)

FROM SOUTHEAST ASIA

TAN PUI LING

FACULTY OF SCIENCE

UNIVERSITY OF MALAYA KUALA LUMPUR

2017

Univers

ity of

Mala

ya

TAXONOMY AND MOLECULAR PHYLOGENY OF

Halymenia SPECIES (HALYMENIACEAE,

RHODOPHYTA) FROM SOUTHEAST ASIA

TAN PUI LING

THESIS SUBMITTED IN FULFILMENT OF THE

REQUIREMENTS FOR THE DEGREE OF DOCTOR OF

PHILOSOPHY

INSTITUTE OF BIOLOGICAL SCIENCES

FACULTY OF SCIENCE

UNIVERSITY OF MALAYA

KUALA LUMPUR

2017

Univers

ity of

Mala

ya

ii

UNIVERSITY OF MALAYA

ORIGINAL LITERARY WORK DECLARATION

Name of Candidate: TAN PUI LING (I.C/Passport No:

Matric No: SHC120092

Name of Degree: DOCTOR OF PHILOSOPHY

Title of Project Paper/Research Report/Dissertation/Thesis (“this Work”):

TAXONOMY AND MOLECULAR PHYLOGENY OF Halymenia SPECIES

(HALYMENIACEAE, RHODOPHYTA) FROM SOUTHEAST ASIA

Field of Study: Algae Biotechnology

I do solemnly and sincerely declare that:

(1) I am the sole author/writer of this Work;

(2) This Work is original;

(3) Any use of any work in which copyright exists was done by way of fair

dealing and for permitted purposes and any excerpt or extract from, or

reference to or reproduction of any copyright work has been disclosed

expressly and sufficiently and the title of the Work and its authorship have

been acknowledged in this Work;

(4) I do not have any actual knowledge nor do I ought reasonably to know that

the making of this work constitutes an infringement of any copyright work;

(5) I hereby assign all and every rights in the copyright to this Work to the

University of Malaya (“UM”), who henceforth shall be owner of the

copyright in this Work and that any reproduction or use in any form or by any

means whatsoever is prohibited without the written consent of UM having

been first had and obtained;

(6) I am fully aware that if in the course of making this Work I have infringed

any copyright whether intentionally or otherwise, I may be subject to legal

action or any other action as may be determined by UM.

Candidate’s Signature Date:

Subscribed and solemnly declared before,

Witness’s Signature Date:

Name:

Designation:

Univers

ity of

Mala

ya

iii

ABSTRACT

Halymenia is a red algal genus classified in the family Halymeniaceae of which

many of the species are poorly known. Despite the abundance of Halymenia species in

the tropical and subtropical waters, there are very few studies from Southeast Asia.

Traditionally, the identification of Halymenia is largely based on morphological

observation in particular the vegetative features. However, these features are not

sufficiently distinctive and may overlap with other taxa due to convergent evolution.

The lack of distinct morphological characters has led to a need for molecular approach

to address the taxonomic confusion in these red algae. Hence, both molecular analyses

and morphological examination were undertaken on specimen from Malaysia, Thailand,

Indonesia and the Philippines to enhance our understanding of the taxonomy and

phylogeny of Halymenia in Southeast Asia. The rbcL, COI-5P, UPA and LSU (28S

rDNA) markers were used to resolve the taxonomic position of Halymenia species.

Combination of the following main diagnostic vegetative characters is crucial for

species identification: habit, branching pattern, order of branching, presence or absence

of surface proliferations or spines, blade margins, blade thickness, cortex thickness,

shape and size of outer cortical cells, shape and size of inner cortical cells and presence

or absence of a stipe. The molecular analyses showed that the genus Halymenia is

polyphyletic and seven distinct species of Halymenia were present in our collections.

Among the seven Halymenia, four were previously described (H. durvillei, H. tondoana,

H. cf. dilatata, H. maculata), two were new species described from the current study (H.

malaysiana, H. johorensis) and one putative new species to be described (Halymenia sp.

A). Phylogenetic analyses indicated that both rbcL and COI-5P are suitable markers to

elucidate taxonomic position, resolve intraspecific genetic variation of Halymenia and

as potential DNA barcodes for Halymenia. In contrast, both UPA and LSU (28S rDNA)

Univers

ity of

Mala

ya

iv

are not suitable markers for molecular phylogenetics and DNA barcoding studies in

Halymenia.

Univers

ity of

Mala

ya

v

ABSTRAK

Halymenia merupakan genus alga merah yang dikelaskan dalam family

Halymeniaceae yang mana banyak spesiesnya kurang dikenali. Walaupun terdapat

banyak spesies Halymenia di perairan tropika dan subtropika, kajian alga ini dari Asia

Tenggara agak terhad. Secara tradisinya, kebanyakan identifikasi Halymenia adalah

berdasarkan pemerhatian morfologi terutamanya ciri-ciri vegetatif. Walau

bagaimanapun, ciri-ciri ini tidak cukup berbeza dan mungkin bertindih dengan taksa

lain disebabkan oleh konvergen evolusi. Kekurangan ciri-ciri morfologi yang berbeza

telah mendorong kepada penggunaan pendekatan molekular untuk menangani

kekeliruan taksonomi dalam alga merah ini. Justeru itu, analisis molekular dan

pemeriksaan morfologi telah dijalankan ke atas specimen dari Malaysia, Thailand,

Indonesia dan Filipina untuk meningkatkan pemahaman terhadap taksonomi dan

filogeni bagi Halymenia di Asia Tenggara. Empat marker molekular [rbcL, COI-5P,

UPA dan LSU (28S rDNA)] telah digunakan untuk menyelesaikan kedudukan

taksonomi spesies Halymenia. Gabungan daripada karakter vegetatif diagnostik utama

berikut adalah penting untuk mengenal pasti spesies: perincian thallus, corak cabangan,

susunan cabangan, kehadiran atau ketiadaan percambahan atau spina di permukaan

thallus, margin thallus, ketebalan thallus, ketebalan korteks, bentuk dan saiz sel dalam

korteks luaran, bentuk dan saiz sel dalam korteks dalaman, kehadiran atau ketiadaan

tangkai. Analisis molekular menunjukkan bahawa genus Halymenia adalah polyphyletic

dan terdapat tujuh spesies Halymenia di dalam koleksi kami. Antara tujuh spesies

Halymenia tersebut, empat daripadanya telah dihuraikan sebelum ini (H. durvillei, H.

tondoana, H. cf. dilatata, H. maculata), dua spesies baru yang dihuraikan dalam kajian

ini (H. malaysiana, H. johorensis) dan satu berkemungkinan merupakan spesies baru

yang perlu dihuraikan (Halymenia sp. A). Analisis filogenetik menunjukkan bahawa

kedua-dua rbcL dan COI-5P adalah marker molekular yang sesuai untuk menjelaskan

Univers

ity of

Mala

ya

vi

kedudukan taksonomi Halymenia, mengungkaikan variasi genetik Halymenia dan

berpotensi sebagai marker barkod DNA untuk Halymenia. Sebaliknya, kedua-dua UPA

dan LSU (28S rDNA) adalah marker molekular yang tidak sesuai untuk molekular

filogenetik dan kajian barkoding DNA Halymenia.

Univers

ity of

Mala

ya

vii

ACKNOWLEDGEMENTS

First and foremost, I would like to express my sincere gratitude to my supervisors,

Assoc. Prof. Dr. Lim Phaik Eem and Prof. Dr. Phang Siew Moi for their guidance,

insight and support throughout my study. Their utmost advices and efforts have

improved my knowledge in particular molecular taxonomy and bioinformatics thus

made the accomplishment of this research possible. I am grateful to Dr. Stefano

Draisma for providing specimens of Halymenia species for my research and Prof. Lin

Showe Mei for her guidance in preparing sections and examining morphological

structures of Halymenia. Their dedications have greatly boosted my interest in this

particular field.

Sincere thanks to Dr. Tan Ji for his guidance in molecular analysis since

undergraduate studies. I am extremely grateful to Dr. Ng Poh Kheng and Dr. Poong Sze

Wan for their utmost assistance and insightful suggestions throughout this whole

research project. Special appreciations go to Dr. Yow Yoon Yen and Dr. Ng Poh Kheng

who have been great companions in the sampling collection trips. I would also like to

thank my wonderful lab members including Miss Jeannette Lai, Miss Fiona Keng, Dr.

Yeong Hui Yin, Dr. Victoria Ng Fong Lee, Dr. Sim Mei Chea, Miss Ou Mei Cing, Mr.

Lee Kok Keong, Mr. James Lim Yong Kian, Mr. Tan Cheng Yau, Mr. Tan Yong Hao

and Miss Yong Wai Kuan for their support.

This study was funded by Ministry of Science, Technology and Environment E-

science Fund (04-01-03-SF0672) and University of Malaya Postgraduate Research Fund

(PG081-2013A). I thank University of Malaya for offering me Fellowship Scheme.

Last but not least, I want to express my appreciation for my family for their

understanding, moral support and encouragement. Again I would like to thank everyone

who helped me in completing this project.

Univers

ity of

Mala

ya

viii

TABLE OF CONTENTS

Abstract ............................................................................................................................ iii

Abstrak .............................................................................................................................. v

Acknowledgements ......................................................................................................... vii

Table of Contents ........................................................................................................... viii

List of Figures ................................................................................................................. xii

List of Tables ................................................................................................................. xiv

List of Symbols and Abbreviations ................................................................................. xv

List of Appendices ........................................................................................................ xvii

CHAPTER 1: INTRODUCTION .................................................................................. 1

1.1 Importance of taxonomy studies .............................................................................. 1

1.2 Algal taxonomy ....................................................................................................... 2

1.3 Research Question ................................................................................................... 4

1.4 Research Objectives................................................................................................. 4

1.5 Research Hypotheses ............................................................................................... 5

CHAPTER 2: LITERATURE REVIEW ...................................................................... 7

2.1 Introduction to algae ................................................................................................ 7

2.2 Red algae ................................................................................................................. 8

2.3 Halymeniaceae ....................................................................................................... 11

2.3.1 Aeodes J. Agardh ...................................................................................... 13

2.3.2 Thamnoclonium Kützing .......................................................................... 14

2.3.3 Grateloupia C. Agardh ............................................................................. 15

2.3.4 Cryptonemia J. Agardh ............................................................................. 16

Univers

ity of

Mala

ya

ix

2.4 Halymenia C. Agardh ............................................................................................ 18

2.4.1 Importance and economic potential of Halymenia ................................... 23

2.5 Genetic diversity of seaweeds ............................................................................... 25

2.6 Molecular phylogenetic methods ........................................................................... 26

2.7 Molecular approaches for taxonomic inference .................................................... 32

2.7.1 Random Amplified Polymorphic DNA (RAPD) ..................................... 33

2.7.2 Restriction Fragment Length Polymorphism (RFLP) .............................. 34

2.7.3 Amplified Fragment Length Polymorphism (AFLP) ............................... 34

2.7.4 Nucleic acid sequencing ........................................................................... 35

2.8 DNA barcoding ...................................................................................................... 36

2.9 Molecular marker for phylogenetic inference ....................................................... 38

2.9.1 Nuclear markers ....................................................................................... 38

2.9.2 Plastid markers ......................................................................................... 40

2.9.3 Mitochondrial markers ............................................................................. 41

2.10 Molecular studies in Halymenia ............................................................................ 43

CHAPTER 3: MATERIALS AND METHODS ........................................................ 47

3.1 Sample collection and processing .......................................................................... 47

3.2 Morphological and anatomical studies .................................................................. 50

3.3 Molecular analyses ................................................................................................ 50

3.3.1 DNA extraction ........................................................................................ 50

3.3.2 Spectrophotometric determination of DNA concentration and purity ..... 51

3.3.3 Polymerase chain reaction (PCR) amplification ...................................... 51

3.3.3.1 rbcL……. .................................................................................. 52

3.3.3.2 COI-5P ...................................................................................... 53

3.3.3.3 UPA….. ..................................................................................... 54

Univers

ity of

Mala

ya

x

3.3.3.4 LSU (28S rDNA) ...................................................................... 55

3.3.4 Determination of the amplification yield and quality by gel

electrophoresis, DNA purification and gene sequencing ........................ 55

3.3.5 Sequence and phylogenetic analyses ........................................................ 56

3.3.6 Haplotype network analyses ..................................................................... 59

CHAPTER 4: RESULTS .............................................................................................. 60

4.1 Morphological and anatomical observations ......................................................... 60

4.1.1 Halymenia malaysiana P.-L. Tan, P.-E. Lim, S.-M. Lin & S.-M. Phang. 60

4.1.2 Halymenia maculata J. Agardh ................................................................ 65

4.1.3 Halymenia cf. dilatata Zanardini ............................................................ 68

4.1.4 Halymenia johorensis P.-L. Tan, P.-E. Lim, S.-M. Lin & S.-M. Phang...70

4.1.5 Halymenia tondoana O. DeClerck & J.J. Hernández-Kantun.................. 74

4.1.6 Halymenia durvillei Bory de Saint-Vincent ............................................. 76

4.1.7 Halymenia sp. A ....................................................................................... 79

4.2 Molecular analyses ................................................................................................ 82

4.2.1 DNA extraction ........................................................................................ 82

4.2.2 PCR amplification .................................................................................... 82

4.2.3 Sequence analyses .................................................................................... 84

4.2.3.1 rbcL………. .............................................................................. 84

4.2.3.2 COI-5P ...................................................................................... 85

4.2.3.3 UPA…. ...................................................................................... 86

4.2.3.4 LSU (28S rDNA) ...................................................................... 87

4.2.4 Phylogenetic analyses ............................................................................... 88

4.2.4.1 rbcL…… ................................................................................... 88

4.2.4.2 COI-5P ...................................................................................... 91

Univers

ity of

Mala

ya

xi

4.2.4.3 UPA…. ...................................................................................... 93

4.2.4.4 LSU (28S rDNA) ...................................................................... 95

4.2.5 Intraspecific genetic diversity of Halymenia malaysiana ........................ 97

4.2.5.1 Haplotype network analysis of Halymenia malaysiana for

rbcL marker .............................................................................. 97

4.2.5.2 Haplotype network analysis of Halymenia malaysiana for

COI-5P marker .......................................................................... 99

CHAPTER 5: DISCUSSION ..................................................................................... 102

5.1 Morphological and anatomical studies ................................................................ 102

5.1.1 Morphological and anatomical distinction among Halymenia species .. 104

5.2 Molecular analyses .............................................................................................. 114

5.2.1 DNA extraction ...................................................................................... 114

5.2.2 PCR amplification .................................................................................. 115

5.2.3 Sequence analyses and molecular phylogenies ...................................... 116

5.2.4 Markers performance and potential DNA barcodes ............................... 119

5.2.5 Genetic diversity of Halymenia malaysiana .......................................... 122

CHAPTER 6: CONCLUSION ................................................................................... 126

6.1 General conclusion and appraisal of this study ................................................... 126

6.2 Future studies on Halymenia ............................................................................... 129

References ..................................................................................................................... 131

List of Publications and Papers Presented .................................................................... 160

Appendices………………………………………………………………………… .. 161

Univers

ity of

Mala

ya

xii

LIST OF FIGURES

Figure ‎1.1: Flow chart summarizing the research approach of this study.

6

Figure 2.1: Taxonomic classification of Halymeniaceae according to Saunders

and Karft (1996).

12

Figure ‎3.1: Map showing the collection sites (arrowed and circled) of the

samples in this study.

48

Figure ‎3.2: Map of the collection sites in Malaysia.

48

Figure 3.3: Map of the collection sites in the Philippines.

49

Figure 4.1: Thallus habit of Halymenia malaysiana.

62

Figure ‎4.2: Vegetative structures of Halymenia malaysiana. 63

Figure ‎4.3: Tetrasporangial and cystocarp morphology of Halymenia

malaysiana.

64

Figure 4.4 : Thallus habit of Halymenia maculata.

66

Figure ‎4.5: Vegetative structures, cystocarp and tetrasporangial morphology

of Halymenia maculata.

67

Figure 4.6: Thallus habit and anatomy of Halymenia cf. dilatata. 69

Figure 4.7: Habit and vegetative morphology of Halymenia johorensis. 72

Figure 4.8: Cystocarp and tetrasporangial morphology of Halymenia

johorensis.

73

Figure 4.9: Thallus habit and anatomy of Halymenia tondoana. 75

Figure 4.10: Thallus habit of Halymenia durvillei. 78

Figure 4.11: Vegetative, tetrasporangial and cystocarp morphology of

Halymenia durvillei.

79

Figure 4.12: Thallus habit and anatomy of Halymenia sp. A 81

Figure ‎4.13: Electrophoretogram showing amplicons of the plastid rbcL

(~1,400bp) and mitochondrial COI-5P (~600bp) genetic markers.

83

Figure 4.14: Electrophoretogram showing amplicons of the plastid UPA

(~400bp) and nuclear LSU (28S rDNA) (~600bp) genetic markers.

84

Figure ‎4.15: ML phylogeny inferred based on the rbcL sequences.

90

Figure ‎4.16: ML phylogeny inferred based on the COI-5P sequences. 92

Univers

ity of

Mala

ya

xiii

Figure 4.17: ML phylogeny inferred based on the UPA sequences.

94

Figure 4.18: ML phylogeny inferred based on the partial LSU (28S rDNA)

sequences.

96

Figure ‎4.19: Statistical parsimony network for rbcL haplotypes of Halymenia

malaysiana.

98

Figure ‎4.20: Statistical parsimony networks for COI-5P haplotypes of

Halymenia malaysiana.

100

Univers

ity of

Mala

ya

xiv

LIST OF TABLES

Table ‎2.1: Summary of several methods of phylogenetic analyses (Adapted from

Soltis and Soltis, 2003; Yang and Rannala, 2012 with modification).

29

Table ‎3.1: Primers used for amplification of rbcL.

53

Table ‎3.2: Primers used for amplification of COI-5P.

54

Table ‎3.3: Primers used for amplification of UPA.

54

Table ‎3.4: Primers used for amplification of LSU (28S rDNA).

55

Table ‎3.5: Model and parameters selected by Kakusan3 for ML analysis of

rbcL, COI-5P, UPA and LSU (28S rDNA) datasets.

58

Table ‎4.1: Percentage of pairwise distance between rbcL sequences of seven

Halymenia species examined in this study, excluding gaps and

ambiguities.

85

Table ‎4.2: Percentage of pairwise distance between COI-5P sequences of six

Halymenia species examined in this study, excluding gaps and

ambiguities.

86

Table 4.3: Percentage of pairwise distance between UPA sequences of six

Halymenia species examined in this study, excluding gaps and

ambiguities.

87

Table ‎4.4: Percentage of pairwise distance between LSU (28S rDNA) sequences

of six Halymenia species examined in this study, excluding gaps and

ambiguities.

88

Table 4.5: A summary of the rbcL haplotype diversity of Halymenia malaysiana

with number of individuals (N) and number of haplotypes (Nh) from

each location.

99

Table 4.6: A summary of the COI-5P haplotype diversity of Halymenia

malaysiana with number of individuals (N) and number of haplotypes

(Nh) from each location.

101

Table 5.1: Comparison of morphological and anatomical characters among

closely related foliose Halymenia species in this study.

107

Table 5.2: Comparison of morphological and anatomical characters among

closely related branched Halymenia species in this study.

109

Univers

ity of

Mala

ya

xv

LIST OF SYMBOLS AND ABBREVIATIONS

A : Adenine

AFLP : Amplified fragment length polymorphism

AICc : Corrected Akaike Information Criterion

BI : Bayesian Inference

BICc : Corrected Bayesian Information Criterion

BP : Bootstrap Percentage

bp : base pair

C : Cytosine

CI : Consistency Index

cm : centimeter

cox1 or COI : cytochrome c oxidase subunit 1

COI-5P : 5’ end of the cytochrome c oxidase subunit 1 gene

cox2 : cytochrome c oxidase subunit 2

cox2-3 spacer : spacer region between cytochrome c oxidase subunit 2 and 3

cox3 : cytochrome c oxidase subunit 3

dATP : Deoxyadenosine triphosphate

dCTP : Deoxycytidine triphosphate

dGTP : Deoxyguanosine triphosphate

DNA : Deoxyribonucleic acid

dNTP : Deoxyribonucleotide triphosphate

G : Guanine

HCl : Hydrochloric acid

ITS : Internal transcribed spacer

kb : kilobase

LSU : Large subunit of ribosomal DNA (28S rDNA)

m : meter

MCMC : Markov chain Monte Carlo

ML : Maximum likelihood

mM : milimolar

MP : Maximum parsimony

N : Number of individuals

NJ : Neighbour joining

Univers

ity of

Mala

ya

xvi

Nh : Number of haplotypes

ng : nanogram

OD : Optical density

PAUP : Phylogenetic analysis using parsimony

PCR : Polymerase chain reaction

pmol : Picomole

PP : Posterior probabilities

RAPD : Random amplified polymorphic DNA

rbcL : ribulose-1, 5-bisphosphate carboxylase/oxygenase large subunit

rbcS : ribulose-1, 5-bisphosphate carboxylase/oxygenase small subunit

rDNA : Ribosomal deoxyribonucleic acid

RFLP : Restriction fragment length polymorphism

RI : Retention index

RNA : Ribonucleic acid

RNase : Ribonuclease

rRNA : Ribosomal ribonucleic acid

RuBisCO : Ribulose-1, 5-bisphosphate carboxylase/oxygenase

SSU : Small subunit of ribosomal DNA (18S rDNA)

T : Thymine

U : unit

UPA : Universal plastid amplicon

UV : Ultraviolet

μL : microlitre

μm : micrometer

°C : degree Celcius

Univers

ity of

Mala

ya

xvii

LIST OF APPENDICES

Appendix A: List of specimens examined in this study with information on

herbarium number, locality, collector, date of collection and field

number.

162

Appendix B: List of published sequences used for rbcL analyses with collection

details and GenBank accession numbers.

172

Appendix C: List of published COI-5P, UPA and LSU (28S rDNA) sequences

with collection details and GenBank accession numbers for

analyses.

174

Appendix D: Uncorrected pairwise distance matrix of the rbcL sequences.

175

Appendix E: Uncorrected pairwise distance matrix of the COI-5P sequences.

183

Appendix F: Uncorrected pairwise distance matrix of the UPA sequences.

188

Appendix G: Uncorrected pairwise distance matrix of the LSU (28S rDNA)

sequences

190

Univers

ity of

Mala

ya

1

CHAPTER 1: INTRODUCTION

1.1 Importance of taxonomy studies

Taxonomy is the science that deals with identification, description, naming and

classification of living organisms (Lincoln et al., 1998; Wägele, 2005). It is fundamental

to the inventory of life on earth and understanding the variety of life forms (Lincoln et

al., 1998; Wägele, 2005). Without taxonomy, nobody would be certain of the identity of

organisms they were interested in, or whether they belonged to the same or different

species as the organisms studied by others (Nature, 2002). According to Narendran

(2000), it is absolutely necessary to recognize the correct name of the organism before

initiating any kind of studies. This is because the correct scientific name of the organism

acts as a functional label, using which various pieces of information concerning that

organism, including all the past work done on it, can be retrieved and stored ensuing

ease of reference (Narendran, 2000).

Taxonomy provides basic understanding about biodiversity that is a prerequisite for

all other biological research including medicine, bioprospecting, fisheries, quarantine,

defense, etc. (Narendran, 2000). It also plays a significant role in conservation by

documenting, describing, and cataloguing all the living things. Taxonomic information

is essential to understand the pattern of biodiversity which is useful in determining

biodiversity hotspots (regions with exceptionally high species richness) and

subsequently extra conservation resources are focused on those areas (Myers et al.,

2000). We cannot certainly expect to conserve organisms that we cannot identify, and

cannot develop the species conservation plans if we cannot recognize and describe the

interacting components of natural ecosystems (Rojas, 1992; Samper, 2004). Thus,

Univers

ity of

Mala

ya

2

effective control and management measures can only be executed when invasive species

are accurately and promptly identified. As revealed by Guerra-García et al. (2008), it is

estimated that about 90% of the world species are still unknown and most of the extinct

species still undescribed. Obviously, effective and prompt conservation measures must

be taken to halt this decline (Guerra-García et al., 2008).

1.2 Algal taxonomy

The exercise of discovering and documenting biodiversity has been given an

increased sense of urgency as the anthropogenic impacts are perilously altering the biota

of the Earth (Cardinale et al., 2012). Studies by De Clerck et al. (2013) have shown that

unlike the well-studied groups such as birds, mammals and higher plants which have a

decrease in the description rates as fewer species remained to be described (Costello and

Wilson, 2011, Joppa et al. 2011), there is no evidence for a decrease in the description

rates of algal species. Additionally, there is a gradual overall increase in the description

rates of algal species over time (De Clerck et al., 2013). Thus, the algae are a group of

organisms worth for study since many species have not yet been identified and the

precise number of species remains elusive (Robba et al., 2006).

Algal taxonomy studies have been the focus of research, particularly on the

economically important species (e.g. Kappaphycus, Eucheuma, Gracilaria) which have

great potential for the commercialisation of seaweed industries, in addition to

physiological aspects related to mass cultivation and the production of useful products

(Chan et al., 2006). In order to fully utilize the commercially important seaweeds, it is

important to understand their biochemical composition, ecology and more importantly

their taxonomic status. Therefore, algal taxonomy studies lies mainly in correct

identification for cultivation, exploitation and conservation purposes. However, the

Univers

ity of

Mala

ya

3

identification of algae, particularly the Rhodophyta, can be extremely difficult based on

morphological criteria alone due to their simple morphology and anatomy, rampant

phenotypic plasticity, convergence and alternation of heteromorphic generations

(Saunders, 2005). Therefore, molecular tools have been used to evaluate the limits of

morpho-species and to delineate boundaries between species (Manhart and McCourt,

1992; John and Maggs, 1997).

The ordinal classification of the Florideophyceae which based largely on the

characters of female reproductive anatomy before and after fertilization by Kylin (1956)

gave significant contribution to red algal systematics. The ultrastructure studies of pit

connections also leading to the refinement of the Kylinian ordinal classification.

However, molecular approaches to systematics provided significant insights into the

evolution of red algae and led to the proposal of several new orders. The application of

molecular techniques for use in algal taxonomy has also greatly improved our

understanding of species and their relationships. There are two approaches extensively

used by phycologists to assess algal species level diversity and discover new species:

(1) DNA taxonomy in which species are delineated based on sequence data using

evolutionary species concepts (Vogler and Monaghan, 2007) and (2) DNA barcoding

which identifies specimens based on sequence similarity against a database of a priori

defined species (Hebert et al., 2003). Phylogenies offer new ways to estimate

biodiversity, to assess conservation priorities, and to evaluate the evolutionary history in

any set of species (Mace et al., 2003). Nevertheless, molecular phylogenies are not

completely congruent with morphological taxonomy (Fama et al., 2002) and might

detect cryptic species in “species” complexes that were previously identified solely by

morphology (Zuccarello and West, 2003; Lewis and Flechtner, 2004). Consequently,

the combination of both molecular and morphological techniques is a promising

Univers

ity of

Mala

ya

4

approach for delineating species boundaries (Nam et al., 2000; Yoshida et al., 2000; de

Senerpont Domis et al., 2003; Kawai and Sasaki, 2004).

In the context of Halymenia, the taxonomy studies of this genus in Southeast Asia

remain scarce. The identification of Halymenia is problematic if based solely on

morphological characteristics due to its immense morphological plasticity and few

distinctive morphological features (Tan et al., 2015; 2017). This impels the use of

molecular techniques in the identification of Halymenia species. More studies should be

performed to better understand the biodiversity, genetic diversity and phylogeny of this

red seaweed because (1) Halymenia is rich in carrageenan and can be a potential source

for carrageenan and food production (Freile-Pelegrin et al., 2011; Kho et al., 2016); (2)

Southeast Asia is well known to be a biodiversity hotspot, with many organisms yet to

be identified (Sodhi et al., 2004). We believe that there are many yet to be discovered

Halymenia species in Southeast Asia albeit our attempts.

1.3 Research Question

How much biodiversity of Halymenia in Malaysia, Thailand, Indonesia and the

Philippines?

1.4 Research Objectives

The purpose of this study is to undertake both morphological examination and

molecular analyses to understand the species diversity of Halymenia in Malaysia,

Thailand, Indonesia and the Philippines, and to elucidate the relationships between these

species.

Univers

ity of

Mala

ya

5

The objectives of this study are:

1. To collect, describe and document the diversity of Halymenia from various localities

in Malaysia, Thailand, Indonesia and the Philippines based on morphological and

anatomical features

2. To elucidate the phylogenetic relationship between Halymenia species using

molecular approaches based on the DNA sequences of selected genetic markers from

different genomes

3. To assess the utility of the genetic markers for molecular phylogenetics studies and

their potential as DNA barcode for Halymenia

1.5 Research Hypotheses

a) H0: All morphological features were equally reliable as diagnostic characters

H1: Not all morphological features were equally reliable as diagnostic characters

b) H0: Identification based on molecular phylogenies were coherent with morphological

characters

H1: Identification based on molecular phylogenies were not coherent with

morphological characters

c) H0: Phylogenies of different molecular genetic markers were congruent and have

similar levels of resolution

H1: Phylogenies of different molecular genetic markers were not congruent and do

not have similar levels of resolution

Univers

ity of

Mala

ya

6

A flow chart summarizing the research approach of this study is presented in Figure

1.1.

Figure 1.1: Flow chart summarizing the research approach of this study.

Sample collection from various

localities in Malaysia, Thailand, Indonesia

and the Philippines

Morphological studies

Gross morphology

Anatomy

Derivation of conclusion

Samples preserved in

formalin seawater or

herbarium

Silica-gel preserved

samples or herbarium

Molecular studies

DNA extraction

Polymerase Chain

Reaction (PCR)

PCR purification

DNA sequencing

Phylogenetic analyses

Univers

ity of

Mala

ya

7

CHAPTER 2: LITERATURE REVIEW

2.1 Introduction to algae

Algae are photosynthetic organisms mainly living in aquatic habitat but excluding

seagrasses (aquatic angiosperm). They have a tremendously confusing array of cell

cycles, cell morphologies and live in a multitude of habitats (Bhattacharya and Medlin,

1998). They exhibit a broad range of morphological diversity, ranging from the

unicellular microscopic phytoplankton (e.g. Chlorella) to the macroscopic marine algae

(e.g. huge kelps over 50 meters long).

The unicellular and multicellular forms of algae are known as microalgae and

macroalgae respectively. Microalgae are generally photosynthetic and heterotrophic

organism with the potential for cultivation as energy crops. They can be cultivated

under certain conditions to give rise to various commercial byproducts such as oils, fats,

sugars and functional bioactive compounds. On the other hand, macroalgae, which are

mainly found in the Divisions Chlorophyta (green algae), Phaeophyta (brown algae) and

Rhodophyta (red algae), are commonly called seaweeds owing to their size,

multicellular construction and attachment to form substrata (Dawes, 1998).

As reported by Dhargalkar and Kavlekar (2004), the criteria used to distinguish the

different algal group are based on the photosynthetic pigments, storage food products,

cell wall component and fine structure of the cell and flagella. The green algae

(Chlorophyta) possess photosynthetic pigments such as chlorophyll a and b, giving

them a bright green colour, as well as the accessory pigments beta-carotene and

xanthophylls. The cell walls of green algae are generally composed of cellulose, with

some incorporation of calcium carbonate in some species. They stored their food in the

Univers

ity of

Mala

ya

8

form of starch in chloroplast (Leliaert et al., 2012). Likewise, the brown algae

(Phaeophyta) possess large quantities of brown coloured pigment fucoxanthin which

masks the colour of other pigments such as beta-carotene, xanthophylls, chlorophyll a

and c. The cell walls of brown algae are made up of cellulose and polysaccharides

known as alginic acid. Laminarin, mannitol are the food reserve of the brown algae

(Dhargalkar and Kavlekar, 2004). On the other hand, the red algae (Rhodophyta)

possess photosynthetic pigments chlorophyll a and the accessory pigments such as α

and β carotenes, xanthophylls zeaxanthin, lutein, r-phycocyanin, r-phycoerythrin, c-

phycocyanin and allophycocyanin. The cell walls of red algae has a firm inner layer

containing cellulose and a mucilaginous or gelatinous outer layer composed of

sulphated carbohydrates such as agar, carrageenan and porphyran. They stored their

food as floridean starch in the cystoplasm (Maggs et al., 2007).

2.2 Red algae

The red algae (Rhodophyta) are an ancient photosynthetic eukaryotic lineage,

predominating along the coastal and continental shelf areas of tropical, temperate and

cold-water regions (Lüning, 1990). They are comprised of about 6000 species and about

680 genera ranging from unicellular to complex multicellular taxa that found mainly in

the marine environment (Woelkerling, 1990; Yoon et al., 2010). They play essential

roles as primary producers, habitat formers for benthic communities and provide

nurseries for fisheries (Mann, 1973).

Despite the red algae have evolved a diverse range of modifications in cellular

organization and general morphology (Pueschel, 1990), they are distinguishable

amongst eukaryotic lineages by a combination of biochemical and ultrastructural

features (Maggs et al., 2007). The most noticeable feature of the red algae is the absence

Univers

ity of

Mala

ya

9

of flagella, basal bodies and centrioles in all life stages (Pueschel, 1990; De Clerck et al.,

2012). The chlorophyll a is the only chlorophyll in the red algae (van den Hoek et al.,

1995). They also possess α and β carotenes, xanthophylls zeaxanthin and lutein, and

phycobiliproteins such as r-phycocyanin, r-phycoerythrin, c-phycocyanin and

allophycocyanin as the accessory photosynthetic pigments (Dawes, 1998). Despite not

all Rhodophyta appears red, the red colour of these algae results from the predominantly

phycoerythrin pigments which absorb blue-green light and reflect red light (Boney and

Corner, 1960). The lack of external endoplasmic reticulum within chloroplast and the

presence of unstacked thylakoids with stalked phycobilisomes in the red algal plastids

are also significant ultrastructural features that distinguished them from other eukaryotic

lineages (Woelkerling, 1990; Maggs et al., 2007). The red algae are also characterized

by the presence of floridean starch as storage product in the cystoplasm, whereas the

green algae and plants store starch in the chloroplasts (Maggs et al., 2007). The red algal

cell wall has a firm inner layer containing cellulose and a mucilaginous or gelatinous

outer layer composed of sulphated carbohydrates such as agar, carrageenan and

porphyran. Possession of pit plugs is also a unique and distinctive feature of

Rhodophyta. The cytokinesis in red algae is incomplete and resulted in a small pore left

in the middle of the newly formed partition then the pit plug formed by deposition of

cytoplasmic substance in the wall of the gap connected to the cells (Pueschel and Cole,

1982; Maggs et al., 2007).

Rhodophyta was traditionally divided into two distinct classes, Bangiophyceae and

Florideophyceae, based on morphological, anatomical, and life-history differences of

the red algae (Dixon, 1973; van den Hoek et al., 1995; Müller et al., 2001). The smaller

class Bangiophyceae encompasses the most primitive red algal forms with relatively

simple morphologies (Müller et al., 2001). Little is known about the life histories of the

bangiophytes which seem to be diverse (Brodie and Irvine, 2003). Meanwhile, the more

Univers

ity of

Mala

ya

10

complex Florideophyceae has much diverse morphological structures and an intricate

triphasic life history (Verbruggen et al., 2010). Instead of diploid sporophyte, the

immediate product of post-fertilization unique to Florideophyceae is a hemiparasitic

diploid tissue termed gonimoblast surrounded by female nutritive tissues, which known

as cystocarp (Maggs et al., 2007). In order to compensate for the lack of motile sperm in

the red algae (Searles, 1980), plenty genetically identical diploid spores that give rise to

sporophytes are released.

The ultrastructure studies of pit connections gave significant contribution to red algal

systematics. A number of molecular phylogenetic studies based on different markers

were performed and provided significant insights into the evolution and relationships of

red algae particularly for the refinement at ordinal level (Freshwater et al., 1994; Ragan

et al., 1994; Saunders and Hommersand, 2004; Yoon et al., 2006). A new taxonomic

scheme was then proposed by Saunders and Hommersand (2004) based on previous

molecular phylogenies and ultrastructural characters including the Golgi-endoplasmic

reticulum (ER) association. A new phylum Cyanidiophyta with a single class

Cyanidiophyceae under the new subkingdom Rhodoplantae was proposed in addition to

the phylum Rhodophyta (Saunders and Hommersand, 2004). Additionally, three

subphyla were established for Rhodophyta: (1) Rhodellophytina with a single class

Rhodellophyceae of which composed of unicells or pseudofilaments with the cells

arranged in a row surrounded by the common gelatinous envelope; they have no sexual

reproduction; (2) Metarhodophytina with a single class Compsopogonophyceae of

which composed of filamentous or pseudoparenchymatous members which have a

biphasic life cycle; and (3) Eurhodophytina which contains the classes Bangiophyceae

and Florideophyceae, is defined by the occurrence of pit plugs in at least one of the

phases of the life history (Saunders and Hommersand, 2004). Subsequently, Yoon et al.

(2006) proposed a different classification system where Rhodophyta is divided into two

Univers

ity of

Mala

ya

11

subphylums- Cyanidiophytina and Rhodophytina. Cyanidophytina with one class,

namely Cyanidophyceae, while the Rhodophytina with six classes, namely (1)

Bangiophyceae, (2) Compsopogonophyceae, (3) Florideophyceae, (4)

Porphyridiophyceae, (5) Rhodellophyceae, and (6) Stylonematophyceae. To date,

taxonomic position of Rhodophyta is still in a state of flux due to the limited studies

above ordinal level.

2.3 Halymeniaceae

The Halymeniaceae is one of the taxonomically challenging families, in which the

diagnostic features especially cryptic or uncertain (Gargiulo et al., 2013). The

Halymeniaceae was previously placed under the large order of Cryptonemiales (Kylin,

1956). Subsequently, Saunders and Kraft (1996) proposed that two families, the

Halymeniaceae and Sebdeniaceae should be placed under the new, smaller order

Halymeniales based on molecular data, along with a review of relevant literature

depicting vegetative and reproductive features of the studied taxa. The taxonomic

classifications of this family are shown in Figure 2.1.

The Halymeniaceae is the most diverse family in the order Halymeniales, consists of

31 genera and approximately 317 species (Guiry and Guiry, 2017). It is characterized by

its multiaxial thallus structure with a “medulla of slender to robust, sparse to dense,

filaments and a cortex of ovoid cells in anticlinal filaments or pseudoparenchymatous,

medulla with or without stellate or refractive ganglioid cells” (Womersley and Lewis,

1994) and sexual reproduction, involving carpogonial branches and auxiliary cells borne

in separate filamentous ampullae (Chiang, 1970; Hommersand and Fredericq, 1990).

Members of this family have a triphasic life history with isomorphic gametophytes and

tetrasporophytes (Womersley and Lewis, 1994; Norris, 2014). Cruciately divided

Univers

ity of

Mala

ya

12

Classification:

Empire Eukaryota

Kingdom Plantae

Subkingdom Biliphyta

Phylum Rhodophyta

Subphylum Eurhodophytina

Class Florideophyceae

Subclass Rhodymeniophycidae

Order Halymeniales

Family Halymeniaceae

Figure 2.1: Taxonomic classification of Halymeniaceae according to Saunders and

Kraft (1996).

tetrasporangia either scattered over the thallus surface, grouped in sori or borne in

modified areas of tissue (nemathecia), while spermatangia are superficial on the thallus,

cut off from terminal cortical cells (Norris, 2014). Sexual thalli are monoecious or

dioecious. Connecting filaments develop from the fertilized carpogonium, contact and

diploidize the auxiliary cell, which then develops to the carposporophyte. Cystocarps

are embedded in the thallus and in most genera are surrounded by sparse to conspicuous

involucres originated from the ampullary filaments or also including medullary

filaments (Womersley and Lewis, 1994; Norris, 2014).

Chiang (1970) proposed that the shape and the structure of the auxiliary cell

ampullae could be useful to define some genera within the red algal family

Halymeniaceae. Five types of auxiliary cell ampullae have been proposed: Aeodes,

Cryptonemia, Halymenia, Grateloupia and Thamnoclonium (Chiang, 1970). In addition,

Kawaguchi et al. (2004) suggested that the structure of carpogonial-branch ampullae

Univers

ity of

Mala

ya

13

may also have taxonomic value similar to that of auxiliary cell ampullae. Even though

reproductive anatomy and postfertilization development have been used for separating

many genara of red algae (Kraft, 1977; Gargiulo et al., 1986; Hommersand et al., 1999),

reproductive uniformity within halymeniacean genera has been claimed and supported

by several authors (Kylin, 1956; Balakrishnan, 1961; Kawabata, 1963). Moreover,

postfertilization development is not well documented in most of the members of the

Halymeniaceae (Balakrishnan, 1960; Kraft, 1977; Gargiulo et al., 2013). Therefore,

vegetative features were emphasized rather than reproductive characters in genus-level

taxonomy (Kylin, 1956; Guiry and Irvine, 1974; Kraft, 1977). It is clear that separation

of many of the genera in this family requires further study and species concepts within

these genera are in need of review (De Smedt et al., 2001). Four genera with different

types of auxiliary cell ampullae as proposed by Chiang (1970): Aeodes, Thamnoclonium,

Grateloupia and Cryptonemia were selected and discussed as follows.

2.3.1 Aeodes J. Agardh

Aeodes J. Agardh is one of the red algal genera in the family Halymeniaceae with

four taxonomically accepted species (Guiry and Guiry, 2017). It is mostly distributed in

New Zealand, South Africa, Mediterranean Sea (Guiry and Guiry, 2017). Aeodes, based

on the generitype, Aeodes nitidissima J. Agardh, is characterized by foliose, lobed or

divided thallus, spreading laterally from the holdfast with very short stipe, a medulla

with few slender rhizoids and a relatively thick but loose involucre (Womersley and

Lewis, 1994). It is most closely related to Pachymenia J. Agardh which differs in the

above features such as the characteristics of stipe and medulla.

Cruciately divided tetrasporangia scattered, attached to mid cells of the cortex while

spermatangia developed from the surface cortical cells (Womersley and Lewis, 1994).

Univers

ity of

Mala

ya

14

The carposporophyte is surrounded by a prominent involucre developed from the

ampullary filaments (Womersley and Lewis, 1994). According to Chiang (1970), the

Aeodes-type auxiliary cell ampulla is very bushy, with up to four (rarely five) orders of

ampullar filaments and is cup-shaped in outline. Carpogonial branches are two-celled

and the carpogonial branch ampullae in Aeodes are the most complex ampullae which

branched to the third or fifth orders (Kawaguchi et al., 2004).

2.3.2 Thamnoclonium Kützing

Thamnoclonium Kützing is one of the red algal genera in the family Halymeniaceae

with only two taxonomically accepted species (Guiry and Guiry, 2017), including

Thamnoclonium dichotomum (J.Agardh) J.Agardh and Thamnoclonium lemannianum

Harvey. Thamnoclonium was founded by Kützing (1843) based on the generitype,

Thamnoclonium hirsutum Kützing collected in Western Australia. Thamnoclonium

hirsutum is now regarded as a synonym of Thamnoclonium dichotomum. This genus is

characterized by terete to compressed thalli with irregularly to subdichotmously

branches, covered throughout with short, irregularly branches excrescences, coated with

a thin layer of sponge, a thick secondary cortex with numerous growth rings developing

below and reproductive structures borne in special small fertile leaflets clustered at the

apices and upper margins (Womersley and Lewis, 1994).

Cruciately divided tetrasporangia in nemathecia on fertile leaflets, cut off from

subsurface cells while spermatangia cut off from outer cortical cells (Womersley and

Lewis, 1994). The carposporophyte is enclosed by a prominent involucre developed

from branched ampullary filaments (Womersley and Lewis, 1994). According to Chiang

(1970), the Thamnoclonium-type auxiliary cell ampulla is comprised of a single primary

ampullar filament and three or five 2- to 5-celled secondary ampullar filaments and is

Univers

ity of

Mala

ya

15

irregular in outline. Carpogonial branches are two-celled and the carpogonial branch

ampullae in Thamnoclonium are the simplest ampullae which branched only to the

second orders (Kawaguchi et al., 2004).

2.3.3 Grateloupia C. Agardh

Grateloupia C. Agardh is the largest red algal genus in the family Halymeniaceae,

comprising of 96 taxonomically accepted species (Guiry and Guiry, 2017). It is widely

distributed in warm temperate to tropical waters throughout the world (Lin et al., 2008;

Guiry and Guiry, 2017). Grateloupia, based on the generitype, Grateloupia filicina (J.

V. Lamouroux) C. Agardh, is characterized by terete to bladelike thalli that range from

lubricous to cartilaginous in texture, the presence of irregularly oriented filaments in the

medulla and a two-celled carpogonial branch borne in an ampulla composed of two

orders of branches (Womersley and Lewis, 1994; Lin et al., 2008). This genus includes

taxa with diverse range of habits, ranging from finely pinnate (e.g. G. filicina), foliose

(eg. G. turuturu Yamada) to subdichotomous blades (eg. G. dichotoma J. Agardh)

(Mateo-Cid et al., 2005).

Cruciately divided tetrasporangia embedded in the outer cortex, scattered over the

blade surface while spermatangia are borne superficially in whitish sori or scattered

over the blade surface (Norris, 2014). The carposporophyte is surrounded by a moderate

involucre derived from the ampullary filaments as well as the medullary filaments

(Womersley and Lewis, 1994; Norris, 2014). The carpogonial branch ampullae in

Grateloupia are the simplest ampullae which branched only to the second orders

(Kawaguchi et al., 2004). According to Chiang (1970), the Grateloupia-type auxiliary

cell ampulla is simple with a single primary ampullar filament and two or three 7- to 13-

celled secondary ampullar filaments and the mature ampulla is conical in outline.

Univers

ity of

Mala

ya

16

Following, Lin et al. (2008) reported two different patterns of the development of the

auxiliary-cell ampullae: (1) G. taiwanensis-type composed of three orders of

unbranched filaments that branch after diploidization of the auxiliary cell, and (2) G.

orientalis-type composed of two orders of unbranched filaments that do not branch after

diploidization of the auxiliary cell.

According to Womersley and Lewis (1994), Grateloupia and Halymenia differs in

the following aspects: (1) a lax medulla with irregularly oriented filaments in the former

and anticlinal filaments in the latter; and (2) the auxiliary cell ampullae are simple,

conical with the filaments converging above in the former and the open, spreading one

in the latter. Species identification in Grateloupia is difficult due to its high

morphological plasticity which variable in overall habit, texture, cortex structure, and

the location of reproductive structures (De Clerck et al., 2005; Wilkes et al., 2005; Yang

et al., 2013b). Although many taxa are still in need of review, recent studies combining

both molecular and morphological analyses have contributed to clearer species

circumscriptions especially for the morphologically similar species (Wang et al., 2000;

Kawaguchi et al., 2001; Gavio and Fredericq, 2002; Yang et al., 2013b).

2.3.4 Cryptonemia J. Agardh

Cryptonemia J. Agardh is a red algal genus comprising of 45 taxonomically accepted

species (Guiry and Guiry, 2017). It is mostly distributed in warm temperate to tropical

waters (Womersley and Lewis, 1994; Guiry and Guiry, 2017). Cryptonemia was

established by J. Agardh (1842) based on the generitype, Cryptonemia lactuta J.Agardh.

Cryptonemia lactuta is now regarded as a synonym of Cryptonemia lomation (Bertoloni)

J.Agardh.

Univers

ity of

Mala

ya

17

Members of this genus are primarily characterized by the well-developed stipe and /

or midrib, the presence of periclinal filaments and highly refractive cells in the medulla,

a relatively thin cortex and bushy ampullar filaments with up to four orders (Abbott,

1967; Chiang, 1970, Womersley and Lewis, 1994; Kim et al., 2012). Cruciately divided

tetrasporangia embedded in the cortex, scattered over the thallus surface while

spermatangia are superficial over the thallus (Norris, 2014). The carposporophyte is

surrounded by a slight involucre originated from elongation of the ampullary filaments

(Womersley and Lewis, 1994; Norris, 2014). According to Chiang (1970), the

Cryptonemia-type auxiliary cell ampulla is very similar to the Aeodes-type with bushy

ampullar filaments branched up to four orders but the outline of the Cryptonemia-type is

conical instead of cup-shaped in the Aeodes-type. Carpogonial branches are two-celled

and the carpogonial branch ampullae in Cryptonemia are reported to be branched to the

third and rarely fourth orders (Kawaguchi et al., 2004).

The distinction between Halymenia and Cryptonemia is difficult. According to

Abbott (1967), Cryptonemia can be differentiated from Halymenia by having inner

cortex of unmodified cells (Halymenia with elongate or stellate inner cortical cells) and

medulla with predominantly periclinal filaments in contrast to the predominantly

anticlinal filaments in Halymenia. The majority of Cryptonemia species usually have

cartilaginous, branched, perennial stalks and midribbed blades (Womersley and Lewis,

1994; Guimarães and Fujii, 1998). However, some species of Halymenia such as H.

stipitata I. A. Abbott has well-developed stipe and H. vinacea M.Howe & W.R.Taylor

has short midrib too (Guimarães and Fujii, 1998; Kawaguchi et al., 2002). Although

Cryptonemia and Halymenia are grouped under different types of auxiliary cell

ampullae based on Chiang’s generic concept, the reliability of these features has been

doubted by different authors who have found intermediate forms (e.g. H. assymetrica

Gargiulo, de Masi & Tripodi by Gargiulo et al., 1986; H. maculata J. Agardh by

Univers

ity of

Mala

ya

18

Kawaguchi et al., 2002). As shown by D’Archino et al. (2014), although not all the

issues in the genera Cryptonemia and Halymenia have been solved, molecular analysis

has contributed to the clarification of generic boundaries in the family Halymeniaceae.

Continued molecular analyses in concert with detailed anatomical studies will help to

clarify the taxonomy of this family and may also reveal the anatomical characters that

can be used to identify the groups (D’Archino et al., 2014). A molecular analysis by

Kim et al. (2012) showed that C. rotunda (Okamura) Kawaguchi is distantly related to

other members of the genus, thus this genus is in need of revision.

2.4 Halymenia C. Agardh

The marine red algal genus Halymenia C. Agardh is one of several species-rich red

algal genera in the family Halymeniaceae and includes 79 taxonomically accepted

species (Guiry and Guiry, 2017). It is mostly distributed in tropical and subtropical

regions (Gargiulo et al., 1986; Hernández- Kantun et al., 2009; Tan et al., 2015).

Halymenia was established by C. Agardh (1817) based on the generitype, Halymenia

floresii (Clemente) C. Agardh collected from Cádiz, Spain.

The genus is mainly characterized by gelatinous thalli, presence of anticlinal

filaments and refractive ganglionic cells in the medulla, stellate cells in the inner cortex,

and auxiliary cell ampullae with branched secondary filaments (Balakrishnan, 1961;

Abbott, 1967; Chiang, 1970; De Smedt et al., 2001). In Halymenia, the medulla is lax in

young parts with mainly anticlinal filaments and becoming denser and irregular in older

parts (Balakrishnan, 1961; Abbott, 1967; Womersley and Lewis, 1994). Cruciately

divided tetrasporangia embedded in the outer cortex, scattered over the blade surface

while spermatangia are borne in whitish sori at the cortical layer surface (Norris, 2014).

The carposporophyte is enclosed by a slight involucre derived from elongation and

Univers

ity of

Mala

ya

19

expansion of the ampullary filaments (Womersley and Lewis, 1994; Norris, 2014). The

carpogonial branches are two-celled and the carpogonial branch ampullae in Halymenia

are reported to be branched to the third and rarely fourth orders (Kawaguchi et al.,

2004). Chiang (1970) used the architecture of auxiliary cell ampullae as a primary

feature to group species at the generic level in the Halymeniaceae. According to

Chiang’s generic concept, simple or once or more branched secondary ampullar

filaments may emerge from long and slender primary ampullary filaments in the

Halymenia-type auxiliary cell ampullae. The auxiliary cell ampulla of Halymenia is

flattish, expanded when mature, and is intermediate between the Grateloupia type and

the Cryptonemia-type of ampulla based on its shape and the degree of branching

(Chiang, 1970). For instance, Hernández-Kantún et al. (2009) confirmed the assignment

of specimens from the Gulf of California (Halymenia actinophysa M. Howe) to the

genus Halymenia through the combination of female reproductive structures and tertiary

branching of auxiliary cell ampullae.

According to Abbott (1967), a vegetative feature- the anticlinally oriented filaments

has been considered more diagnostic than reproductive characters that seem to overlap

considerably among genera of the family (Kraft, 1977; Maggs and Guiry, 1982).

However, anticlinal medullary filaments are not exclusive to Halymenia and can be

found in other genera such as Cryptonemia and Kallymenia J. Agardh (Abbott, 1967;

Guimarães and Fujii, 1998). Additionally, stellate cells and refractive ganglionic cells

also present in the genera Weeksia Setchell and Kallymenia which are placed under

order Gigartinales (Abbott, 1967). Therefore, Halymenia should not be characterized by

a single feature. This has been supported by Kawaguchi and Lewmanomont (1999)

which stated that “no single feature most distinctively characterizes Halymenia”. A

combination of features is important in the characterization of Halymenia.

Univers

ity of

Mala

ya

20

To date, seven species of Halymenia have been reported from Malaysia, including H.

floresii (Clemente) C. Agardh, H. durvillei Bory de Saint-Vincent, H. dilatata Zanardini,

H. maculata J. Agardh, H. formosa Harvey ex Kützingand and two recently described

species from the current study- H. malaysiana P-L Tan, P-E Lim, S-M Lin & S-M

Phang and H. johorensis P-L Tan, P-E Lim, S-M Lin & S-M Phang (Kawaguchi et al.,

2002; Tan et al., 2015; Phang et al., 2016; Tan et al., 2017). In Thailand, H. durvillei, H.

dilatata and H. maculata are the only three Halymenia species have been recorded

(Lewmanomont and Kawaguchi, 2002; Tsutsui et al., 2012). On the other hand, a total

of 14 taxa and 22 taxa of Halymenia (including synonym) have been recorded in the

Philippines and Indonesia respectively (Silva et al., 1987; Verheij and Prud'homme van

Reine, 1993; Kraft et al., 1999; De Smedt et al. 2001; Atmadja and Prud'homme van

Reine, 2012). Most of the records here were from checklists and without detailed

morphological description. Thus, many taxa remain poorly known due to the scarce

information available.

Southeast Asia is well known to be a biodiversity hotspot, with many organisms yet

to be identified (Sodhi et al., 2004). Yet, there are relatively few studies of Halymenia in

this region. Several attempts have been made to study species of Halymenia in

Southeast Asia based solely on morphological characters. Kawaguchi and

Lewmanomont (1999) made a detailed morphological study of Halymenia dilatata

Zanardini by comparing the vegetative and reproductive features of the material from

Vietnam and Japan with Indian material, and by studying the pattern of spore

development to establish a better classification system for the western Pacific species.

The results showed that vegetative and reproductive features of of H. dilatata were in

accordance with the original and complementary descriptions by Zanardini (1851, 1858).

The carpospores development of H. dilatata was also similar to H. floresii from the

Mediterranean Sea (van den Hoek and Cortel-Breeman, 1970) and H. latifolia P.

Univers

ity of

Mala

ya

21

Crouan & H. Crouan ex Kützing from Ireland (Maggs and Guiry, 1982). According to

De Smedt et al. (2001), Halymenia specimens from the Philippines were examined by

studying their vegetative and reproductive morphology and four species were

recognized: H. durvillei, H. dilatata, H. maculata, and H. porphyraeformis Parkinson.

De Smedt et al. (2001) also reduced all varieties and formas within H. durvillei as

proposed by Weber-van Bosse (1921) to synonyms of H. durvillei since the minor

differences in gross thallus morphology and branching pattern observed were not

sufficient to warrant recognition at the species level. In the following year,

Lewmanomont and Kawaguchi (2002) compared the morphological and anatomical

structures of both H. dilatata and H. maculata from Thailand. These two species can be

distinguished from each other based on the texture of fresh plants, the margins, the

thickness of thallus and cortex, the number of cell layers in the cortex and the shape of

the cells in the outermost cortex layer. Kawaguchi et al. (2002b) studied the

morphology of a foliose red alga from Vietnam and revealed that it belongs in H.

maculata and is distinct from H. stipitata. The presence of three species of Halymenia,

H. durvillei, H. dilatata and H. maculata in Malaysia was confirmed by Kawaguchi et al.

(2002a) based on their gross morphology and anatomical features. This was also the

first time of describing the reproductive anatomy of H. durvillei including the

Halymenia-type auxiliary cell ampullae in detail. In 2004, Kawaguchi also verified the

presence of H. floresii in Malaysia by comparing the Malaysian material with the

lectotype and other authentic material of H. floresii.

Collins and Howe (1916) and Taylor (1960) had earlier described Halymenia species

separation based on the fronds dimension, branching pattern, thickness, degree of

cystocarp protrusion and presence or absence of ganglioid cells. According to Abbott

(1967), species delineation in Halymenia is based on habit, color, number of cortical

cell layers and quantity of medullary filaments. In addition, Gargiulo et al. (1986)

Univers

ity of

Mala

ya

22

recognized a new species Halymenia asymmetrica Gargiulo, de Masi & Tripodi in the

Mediterranean Sea by comparing following characters with other known species: (1)

habit, (2) branch pattern, (3) the presence or absence of marginal proliferations or

papillae on thallus surface, (4) dimensions of the thallus, with particular regard to blade

width and (5) presence or absence of secretory cells. Five diagnostic features have been

used by Hernández-Kantún et al. (2012) to identify four Halymenia species, including

order of branching, spines on the thallus surface, shape of the cells in the inner cortex,

thickness of cortex and stipe size. A number of morphological studies in Halymenia

have highlighted several features useful in delineating species. These include habit,

thallus size, blade margin, order of branching, presence or absence of a midrib in the

basal region, presence or absence of a stipe, presence or absence of marginal

proliferations, presence or absence of papillae or spines on thallus surface, blade

thickness, cortex thickness, shape of inner cortical cells, inner cortical cell size, and

presence or absence of refractive ganglionic cells (Gargiulo et al., 1986; Guimarães and

Fujii, 1998; De Smedt et al., 2001; Ballantine and Ruiz, 2004; Hernández-Kantún et al.,

2012; Tan et al., 2015; Azevedo et al., 2016a; 2016b; Tan et al., 2017). For example,

Guimarães and Fujii (1998) differentiated Halymenia brasiliana S.M.P.B.Guimarães &

M.T.Fujii from other Brazilian Halymenia species by its absence of a rib at the base of

the thallus and its absence of refractive ganglionic cells in the medulla. Furthermore,

De Smedt et al. (2001) initiated the use of stipe anatomy in Halymenia and proposed

that it may be useful in distinguishing species of Halymenia. In contrast, Guimarães

and Fujii (1998) indicated that the degree of cystocarp protrusion, colour, the diameter

and the number of medullary filaments are highly variable features, and thus not useful

in delineating Halymenia species. Additionally, the taxonomic significance of surface

maculation as a specific feature in Halymenia is controversial and needs to be verified

(Kawaguchi, 2002).

Univers

ity of

Mala

ya

23

Traditionally, the identification of Halymenia is based solely on morphological

characteristics, which is problematic due to its immense morphological plasticity and

few distinctive morphological features (Tan et al. 2015; 2017). In addition, comparative

studies of Halymenia species are disconcerted by variations in features used for species

delimitation (Hernández-Kantún et al., 2009). The lack of distinct morphological

characters has led to a need for molecular approach to address the taxonomic confusion

in these red algae. Recent molecular studies in concert with morphological examination

have led to the taxonomic revision of existing taxa and the discovery of new species

(Hernández-Kantún et al., 2012; Tan et al., 2015; Azevedo et al., 2016a; 2016b, Tan et

al., 2017).

2.4.1 Importance and economic potential of Halymenia

Carrageenans are sulphated cell wall polysaccharides found in Rhodophyta. They

have been greatly used in the food, cosmetics and pharmaceutical industries due to their

gelling, thickening and stabilizing properties (McHugh, 2003; Pereira et al., 2007). They

are useful for stabilizing and texturing products in the food industry. Additionally, their

strong antitumoral, immunomodulatory, anticoagulant, and antiviral activities (Campo

et al., 2009) make them useful in pharmaceutical and medical applications as excipients

and for controlled release of pharmaceutical compounds (Kranz et al., 2009). Nowadays,

carrageenan supplies have been mainly focused on Kappaphycus Doty and Eucheuma J.

Agardh (McHugh, 2003). However, the search for new or additional raw material

sources has been given an increased sense of urgency as worldwide demand and

development of new applications for carrageenan are increasing (Freile-Pelegrin et al.,

2011).

Univers

ity of

Mala

ya

24

As revealed by Kho et al. (2014), Halymenia is a promising carrageenan source. This

was supported by the studies of Kho et al. (2016) which shown that H. durvillei can be a

potential source for carrageenan production owing to its highest carrageenan yield

compared to another two Halymenia species (H. dilatata and H. maculata). In addition,

many studies have indicated the high carrageenan content in species of Halymenia

include Halymenia venusta Bøergesen (Semesi and Mshigeni, 1977; Parekh et al., 1987),

Halymenia porphyroides Børgesen (Parekh et al., 1989), Halymenia ceylanica Harvey

ex Kützing (Lai et al., 1994) and H. durvillei (Fenoradosoa et al., 2009). Thus, these

indicated that Halymenia is a potential source for carrageenan production which

generates lucrative returns to the industry and economy.

Besides, Halymenia is also a potential food source for human and animal. For

instance, Halymenia floresii is an edible species consumed in some Asian markets

(Godínez-Ortega et al., 2007). Garcia et al. (2016) highlighted the nutritional potential

of H. floresii as food, either as fresh produce or as a processed food ingredient. Three

species of Halymenia (H. durvillei, H. maculata and H. dilatata) have also the potential

to be used as raw material or ingredients in human diet and animal feed as reported by

Kho et al. (2016). Halymenia is also desired for its pigments. H. durvillei is a source of

the red pigment R-phycoerythrin which used as a food and cosmetic colorant, a

therapeutic agent owing to its immunomodulating and anti-cancer activity, and a

fluorescent agent (Bermejo Román et al., 2002; Spolaore, 2006). Halymenia floresii has

also been proved to be a good source for the extraction and preparation of R-

phycoerythrins (Malairaj et al., 2016). The lutein content of H. floresii may be of

particular interest for the market of edible seaweeds (Godínez-Ortega et al., 2007).

Apart from these, Halymenia can be used as a biofilter in an integrated aquaculture

system. Halymenia microcarpa (Montagne) P. C Silva was employed and proven to be

Univers

ity of

Mala

ya

25

a useful biofilter for the nutrient removal in a lobster-seaweed integrated aquarium

system (Chen and Chen, 1996).

2.5 Genetic diversity of seaweeds

Genetic diversity is the genetic variability within a populations or a species. It can be

referred to any variation either in its most primary level of nucleotides, genes,

chromosomes, or whole genomes of an individual (Wright, 1920; Fisher, 1930). Genetic

diversity assessment is important for a better understanding of the nature of forces

acting on genetic variation, pattern, and level of genetic variation, evolutionary history

and adaptation of an organism (Yow et al., 2011). According to Hughes et al. (2008),

genetic diversity within a population also has ecological effects on productivity, growth

and sustainability, as well as inter-specific interactions within communities and

ecosystem level processes.

Genetic variation holds the key to the ability of populations and species to persist

over evolutionary time through changing environments (Freeman and Herron, 1998). In

general, individuals in small populations are less able to adapt themselves to diverse

environmental conditions as they are probably to be homogenous in terms of genetic,

anatomy and physiology (Bagley et al., 2002). In contrast, larger populations are more

likely to have greater allele diversity and also the greater capacity for evolutionary

adaptation to survive in changing environments. As reported by Frankham et al. (2004),

loss of genetic diversity may diminish evolutionary potential and reproductive fitness of

a population to endurance in stressful environments.

Natural evolutionary forces for example mutation, natural selection, migration and

genetic drift may induce changes in the allele frequencies of populations (Valero et al.,

Univers

ity of

Mala

ya

26

2001). In addition, anthropogenic activities such as fisheries and aquaculture, global

climate change, land-use change and water pollution have threatened biodiversity as

well as genetic diversity in marine organisms in particular the seaweeds. Development

of islands and coastal areas into resorts, increase marine traffic which add oil to the

waters and untreated discharges from industries are also some of the human activities

which cause losses in seaweed resources (Phang et al., 2006). Introduction of non-

indigenous species associated with shipping vectors (eg. ballastwater and fouling of

vessel hulls), aquaculture and the aquarium trade have also impacted diversity of the

seaweed genetic resources and marine ecosystem (Schaffelke et al., 2006). A number of

studies have shown the dispersal of seaweed species across their native ranges owing to

anthropogenic activities (Rueness, 1989; Curiel et al., 1998; Fletcher and Farell, 1999;

Rueness and Rueness, 2000; Boudouresque and Verlaque, 2002; Smith et al., 2002;

Hwang et al., 2004).

Assessment of genetic diversity of seaweed with molecular tools has been

accelerated with advanced in DNA based molecular marker technologies. According to

Féral (2002), the utilization of genetic markers for genetic variation studies provide

valuable information for gene flow, population structure, phylogenetic relationships,

biogeographic studies, and parentage and relatedness analysis.

2.6 Molecular phylogenetic methods

Phylogenetic studies have vast applications in diverse fields, including ecology,

molecular biology, and physiology (Doyle et al., 2003). The fundamental importance of

phylogenetic studies is to provide insights into organismal relationships and evolution.

Phylogenetic trees outlining the evolutionary history of species can be derived from

nucleic acid or protein sequences from those species. Phylogenetic trees facilitate the

Univers

ity of

Mala

ya

27

interpretation of the evolution of diverse characters (molecular, physiological and

genetic). For instance, they are useful in the investigations of biosynthetic and

developmental pathways, natural products chemistry, origins and migrations of

evolutionary lineages, and conservation (Daly et al., 2001).

Phylogenetic inference can be defined as the process of determining the estimated

evolutionary history by analysis of a given data set (Swofford, 1996). The phylogenetic

inference methods are either distance based or character based. The distance based

methods involve the calculation of pairwise distance of all studied sequences and then

the resulting distance matrix is used for tree reconstruction (Yang and Rannala, 2012).

The most widely used distance-based method is neighbour joining (NJ). While the

character based method derives trees that optimize the distribution of the actual data

pattern for each character (Roy et al., 2014). The most commonly used character based

methods include Maximum Parsimony (MP), Maximum Likelihood (ML) and Bayesian

Inference (BI) methods. These methods simultaneously compare all sequences in the

alignment, considering one character (a site in the alignment) at a time to calculate a

score for each tree. The ‘tree score’ is the minimum number of changes for maximum

parsimony, the log-likelihood value for maximum likelihood and the posterior

probability for Bayesian inference (Yang and Rannala, 2012). Generally, the distance

based methods tend to be much faster than character based methods but they typically

yield little information beyond the basic tree structure (Dowell, 2008).

On the other hand, the phylogenetic inference methods can also be divided to model-

based or non-model based depend on whether the trees are inferred with or without

using evolutionary model. Model-based methods incorporate branch-length information,

explicit models of character evolution, and quantifying uncertainty in ancestral-state

estimates therefore they are generally preferable to non-model based methods as they

Univers

ity of

Mala

ya

28

are less likely to provide misleading results. NJ, ML and BI are model-based whereas

MP does not have an explicit model and its assumptions are implicit (Yang and Rannala,

2012). Additionally, an optimality criterion which is the score used to assess the value

of a particular tree, needs to be defined before using an algorithm to compute the value

of this function for various trees and search for the best tree that maximizes or

minimizes the criterion. For instance, the tree with the smallest sum of branch lengths is

the preferred tree in NJ. Likewise, the most optimal tree in ML is the one with the

highest likelihood score while the tree that minimizes the number of character-state

changes is the preferred MP tree.

Four criteria have been used to judge phylogenetic inference methods: (1)

consistency, (2) efficiency, (3) robustness and (4) computational speed (Yang and

Rannala, 2012). Soltis and Soltis (2003; Table II, page 1797) and Yang and Rannala

(2012; Table 2, page 309) summarised some of the strengths and weaknesses of

phylogenetic inference methods and is reproduced here with modification as Table 2.1.

Univers

ity of

Mala

ya

29

Table 2.1: Summary of several methods of phylogenetic analyses (Adapted from Soltis

and Soltis, 2003; Yang and Rannala, 2012 with modification).

Method General Strengths Weaknesses

Neighbour

joining

(NJ)

Involves estimation of

pair-wise distances

between nucleotide

sequences

Fast computational

speed

Different results may

be obtained based on

the entry order of

sequences

Pair-wise distances

compensate for

multiple hits by

transforming observed

percent differences

into an estimate of the

no. of nucleotide

substitutions using

one of several models

of molecular evolution

Provides branch

lengths

Branch lengths

presented as

distances rather than

as discrete characters

(steps)

Minimum evolution is

a common distance

criterion for picking

an optional tree (sum

of all branch lengths is

the smallest)

Uses molecular

evolution model

(models for distance

calculation can be

chosen to fit data)

Distance calculation

is problematic when

sequences are

divergent and involve

many alignment gaps

NJ algorithm provides

a good approximation

of the minimum

evolution tree

Readily implemented

in PAUP* and MEGA

Do not consider

variances of distance

estimates

Cannot identify

characters that are

either informative

or problematic

Cannot infer

ancestral states

Parsimony Select the tree or trees

that minimize the

amount of change (no.

of steps)

By minimizing no. of

steps, it also

minimizes the no. of

additional hypothesis

(parallel or reversal

nucleotide

substitutions)

Different results may

be obtained based on

the entry order of

sequences (therefore,

perform multiple

searches)

Basic method can be

modified by weighting

schemes to

compensate for

multiple hits

Assumptions are

implicit and poorly

understood

Univers

ity of

Mala

ya

30

Table 2.1, continued

Method General Strengths Weaknesses

Parsimony

Searches identify

numerous equally

parsimonious

(shortest) trees; treats

multiple hits as an

inevitable source of

false similarity

(homoplasy)

Relatively slow

(compared with NJ)

with large data sets

Readily implemented

in PAUP*

Lack of a model

makes it nearly

impossible to

incorporate our

knowledge of

sequence evolution

Can identify

individual characters

that are

informative or

problematic

Branch lengths are

substantially

underestimated when

substitution rates are

high

Can infer ancestral

states

Highly unequal rates

of base substitution

may cause

difficulties (e.g. long

branch attraction

Maximum

likelihood

(ML)

Involves estimating

the likelihood of

observing a set of

aligned sequences

given a model of

nucleotide substitution

and a tree

A statistical test (the

likelihood ratio test)

can be used to

evaluate properties of

trees

Computationally very

intensive (much

slower than other

methods

Flexible, models that

can incorporate

parameters of base

frequencies,

substitution rates, and

variation in

substitution rates

and, therefore, are

“general”

Practical with only

small nos. (fewer

than 50) of sequences

Univers

ity of

Mala

ya

31

Table 2.1, continued

Method General Strengths Weaknesses

Maximum

likelihood

(ML)

Uses all of the data

(invariable sites and

unique mutations are

still informative,

unlike parsimony

analysis

Easily implemented in

PAUP*

Nucleotide

substitution models

are used directly

in the estimation

process, rather than

indirectly (as in

parsimony)

Bayesian Uses a likelihood

function and an

efficient search

strategy

Based on the

likelihood function,

from which it inherits

many of its favorable

statistical properties

Markov chain Monte

Carlo (MCMC)

involves heavy

computation

Based on a quality

called the posterior

probability of a tree

Uses models as in ML In large data sets,

MCMC convergence

and mixing problems

can be hard to

identify or rectify

Researcher may

specify belief in a

prior hypothesis prior

to analysis

Prior probability

allows the

incorporation of

information or expert

knowledge

Uninformative prior

probabilities may be

difficult to specify.

Multidimensional

priors may have

undue influence on

the posterior without

the investigator’s

knowledge

Posterior probability

for trees and clades

have ease

interpretations

Posterior

probabilities

(measure of internal

support) can be

overestimates

Can be used to

analyze relatively

large data sets

Model selection

involves challenging

computation

Univers

ity of

Mala

ya

32

2.7 Molecular approaches for taxonomic inference

The adoption of molecular techniques since the 1980s has improved the

understanding of many species and overcame the problem in species identification in

red algal taxonomy (Robba et al., 2006; Maggs et al., 2007). Due to the limitations of

morphological features in identification, molecular approaches in species identification

have come to rely heavily by algal systematists for close to two decades (Harper and

Saunders, 2001). The application of molecular data such as DNA, RNA and protein

allows investigation of the phylogenetic relationship and evolutionary patterns of

diversity between organisms. Some of the molecular techniques employed in the

taxonomic inference and genetic diversity studies of red algae, include random

amplified polymorphic DNA (RADP), restriction fragment length polymorphism

(RFLP), amplified fragment length polymorphism (AFLP) and nucleic acid sequencing.

The development of polymerase chain reaction (PCR) in the late 1980s has

facilitated the development of molecular technologies and revolutionized many aspects

of current research. It is widely used in applications such as gene expression analysis,

sequencing, cloning and mutagenesis. PCR is used to amplify selected sections of DNA

using DNA polymerase to synthesize new strand of DNA complementary to the offered

template strand by adding a nucleotide only onto a preexisting 3'-OH group. At the end

of the PCR reaction, the specific sequence will be amplified in numbers of billions.

Generally, there are three steps involved in PCR, namely denaturation, annealing and

extension. During denaturation, double stranded DNA (template DNA) is denatured by

heat, resulting in two single stranded, complementary DNA. During the annealing step,

each of the two DNA strands act as the templates for the synthesis of new strands of

DNA at a temperature optimal for primers to bind to specific site of the template DNA.

Subsequently, DNA polymerases synthesize new DNA strands by adding nucleotides

Univers

ity of

Mala

ya

33

complementary to that of the template DNA in a 5' to 3' direction during extension step.

These denaturation, annealing and elongation steps (one cycle) are repeated for 25-40

times so as to achieve large quantities of the DNA of interest.

PCR method has had a significant impact on molecular taxonomy because of its

simplicity and rapidness. It has great sensitivity and is capable of amplifying sequences

from minute amounts of DNA. Owing to the huge advantages it offers, PCR has become

an indispensable technique with a wide range of applications, particularly in forensic

science, diagnosis, genetic linkage analysis and molecular paleontology studies.

2.7.1 Random Amplified Polymorphic DNA (RAPD)

Random Amplified Polymorphic DNA (RAPD) is a PCR-based technique which

involves the use of short random primers (8-12 nucleotides) resulting in the

amplification of many discrete DNA that are separated by gel electrophoresis (Williams

et al., 1990; Kumari and Thakur, 2014). The significant advantage of RAPD is it does

not require prior knowledge of the target genome (Bardakci, 2001). Additionally, RAPD

provides a rapid and efficient screen for DNA sequence based polymorphism at a very

high number of loci (Kumari and Thakur, 2014). Moreover, only small amount of DNA

is needed and no isotope labelling is required for sample detection (Williams et al.,

1990). This technique has been used in the taxonomy and classification of seaweeds at

the genus and species level. For instance, RAPD was used for differentiating

morphologically similar algal taxa (Lim et al., 2001), analyzing genetic diversity and

determining intraspecific relationships (Patwary et al., 1993; van Oppen et al., 1996;

Alberto et al., 1997; Wright et al., 2000) and assessing patterns of geographic dispersal

of populations (Alberto et al., 1999).

Univers

ity of

Mala

ya

34

2.7.2 Restriction Fragment Length Polymorphism (RFLP)

Restriction fragment length polymorphism (RFLP) is a technique that exploits

variations in homologous DNA sequences to genetically differentiate between

individuals. In RFLP, the DNA is digested by specific restriction enzymes. The

resulting restriction fragments are separated according to their lengths by gel

electrophoresis and then transferred to a membrane via the Southern blot procedure.

Hybridization of the membrane to a labeled DNA probe then determines the length of

the fragments which are complementary to the probe (Singh, 2012). The length of a

detected fragment varies between individuals. Therefore, RFLP is useful in

investigating genetic diversity within and between species (Pierce et al., 2000). This

technique has been widely used in the studies of phylogenetic relationships of algae. For

example, it was used to differentiate morphologically similar taxa and identify

geographically distant conspecific taxa (Bird and Rice, 1990; Candia et al., 1999;

Guillemin et al., 2008). However, RFLP techniques require lengthy technical procedure,

laborious and time-consuming.

2.7.3 Amplified Fragment Length Polymorphism (AFLP)

Amplified Fragment Length Polymorphism (AFLP) is a technique based on the

selective PCR amplification of restriction fragments from a total digest of genomic

DNA (Vos et al., 1995). In AFLP, the genomic DNA is digested with restriction

enzymes followed by the ligation of adaptors to the restriction fragments. Next,

selective amplification of a subset of the restriction fragments can be implemented by

using primers containing defined common sequences with one to three arbitrary

nucleotides. The amplified restriction fragments are separated by gel electrophoresis

then detected by using radioactively or fluorescent labeling of PCR primer. AFLP is a

Univers

ity of

Mala

ya

35

method which combines the advantages of both RAPD and RFLP. It is a highly

sensitive method for detecting polymorphisms in DNA, requires no prior sequence

information, and has high reproducibility (Féral, 2002; Meudt and Clarke, 2007; Yi et

al., 2010). This technique has been used in species identification and genetic diversity

studies of algae (Zhang et al., 2009; Pang et al., 2010; Shan et al., 2011; Li et al., 2013).

2.7.4 Nucleic acid sequencing

Nucleic acid sequencing is also one of the important techniques in the field of

molecular biology because the precise order of the nucleotide bases in a molecule of

DNA can be determined (Brown, 2001). The advent of DNA sequencing has

significantly advanced biological research and discovery. Since the sequence of the

nucleotides in a segment of DNA carries the genetic information, the nucleotide

sequence themselves can serve as valuable molecular tools in phylogenetic and

population genetic studies. Analyzing DNA sequences is useful in identifying

taxonomic groups, reconstructing phylogenies as well as evaluating the evolution of

genomes.

Nucleic acid sequencing offers several advantages of being rapid, time-saving, less

laborious and able to provide more informative data with large numbers of

independently evolving characters which can be used to reconstruct phylogenies if

compared to the much smaller number of biochemical, morphology and other characters.

Various nucleic acid regions have been extensively used in algal taxonomic studies, for

example rbcL (Freshwater and Rueness, 1994; Nam et al., 2000; McIvor et al., 2001;

Wang et al., 2001; Gavio and Fredericq, 2002; Kawaguchi et al., 2002; De Clerk et al.,

2005; Russell et al., 2009; Yang et al., 2013b; Kim et al., 2014), cox1 (Geraldino et al.,

2006; Sherwood, 2008; Yang et al., 2008; Yow et al., 2011; Tan et al., 2012; Lim et al.,

Univers

ity of

Mala

ya

36

2013; Yow et al., 2013), cox3 (Coyer et al., 2004; Uwai et al., 2006b; Kim et al., 2014),

cox2-3 spacer (Zuccarello et al., 1999; Zuccarello and West, 2002; Zuccarello et al.,

2006; Andreakis et al., 2007; Vis et al., 2008; Teasdale & Klein, 2010; Tan et al., 2012;

Lim et al., 2013; Tan et al., 2013), RuBisCO spacer (Destombe and Douglas, 1991;

Goff et al., 1994, Tan et al., 2013) and ITS rDNA (Bellorin et al., 2002; Broom et al.,

2002; Marston and Villard-Bohnsack, 2002; Cho et al., 2007; Hu et al., 2009; Moniz

and Kaczmarska, 2010; Russell et al., 2009; Kim et al., 2014). It is also enable

comparison of results from one laboratory to one another which is impossible for

molecular techniques such as RAPD, RFLP and AFLP owing to the lack of

methodology standardization. Therefore, the phylogenetic relationship of any species

can be studied by comparing the respective sequence data from GenBank with data

from any current study.

2.8 DNA barcoding

DNA barcoding is referring to DNA sequence analysis of a short, diagnostic segment

(specific region of a genome) to identify species through reference to DNA sequence

libraries or databases (Hebert et al., 2003). It is a useful tool, especially when coupled

with traditional taxonomic tools and is fundamental in revealing hidden diversity

(Hebert et al., 2004a). Hebert (2005) also denoted that, DNA barcoding will hasten the

pace of species discovery by allowing taxonomists to speedily sort specimens and by

highlighting divergent taxa that may represent new species. There are a lot of benefits

derived from barcoding such as enabling species identification from any stages of life or

fragment, facilitating species discoveries based on cluster analyses of gene sequences

and providing insight into the diversity of life (Savolainen et al., 2005). Hence, DNA

Univers

ity of

Mala

ya

37

barcoding is potential to be used as a practical tool in identifying all the eukaryotic

organisms on earth.

As revealed by Saunders and Kucera (2010), DNA barcoding eliminates the reliance

on morphological characters which mostly used for species discrimination. This is

especially important for algal taxonomic studies since algae are well known for their

simple morphologies and phenotypic plasticity. Additionally, different molecular

markers have been used for algal species identification and there is a lack of

standardized marker for rapid specimen identification. The use of DNA barcode which

act as standard marker will facilitate universal comparisons (Saunders, 2005). Thus,

Saunders commenced the use of DNA barcode for red algal species identification in

2005.

The 5’ end of the cytochrome c oxidase subunit 1 gene (COI-5P) was first proposed

by Herbert et al. (2003) as DNA barcode. It has been successfully used across diverse

animal taxa (Herbert et al., 2004a; b), as well as red (Saunders, 2005; Robba et al., 2006)

and brown algae (Kucera and Saunders, 2008). In general, plastid and mitochondrial-

encoded molecular markers were frequently proposed as good DNA barcodes for red

algae (Saunders, 2005; Robba et al., 2006; Saunders, 2008; 2009; Le Gall and Saunders,

2010; Rueness, 2010; Zuccarello and West, 2011). Previous studies have employed

DNA barcoding for uncovering cryptic red algal species and inferring phylogenetic

affinities of red algae (Clarkston and Saunders, 2010; Clayden and Saunders, 2010; Le

Gall and Saunders, 2010; Saunders and McDonald, 2010; Milstein and Saunders, 2012;

Hind and Saunders, 2013; Saunders and McDevit, 2013). DNA barcoding has also been

utilized in biodiversity surveys and biomonitoring efforts (Conklin et al., 2009; Rueness,

2010; Sherwood et al., 2010a; Carlile and Sherwood, 2013).

Univers

ity of

Mala

ya

38

2.9 Molecular marker for phylogenetic inference

The use of DNA sequences as a tool in numerous fields has been widely discussed in

the past years. It is important to select an appropriate marker before implementing a

DNA taxonomy or DNA barcoding system (Sonnenberg et al., 2007). The selection of

marker is greatly influenced by the taxonomic question to be addressed. According to

Patwardhan et al. (2014), an ideal marker should possess characteristics as follows: (1) a

single-copy gene may be more useful than multiple-copy gene; (2) prior to phylogenetic

analysis, the alignment of marker gene sequences should be easy; (3) the substitution

rate should be optimum so as to provide enough information sites; (4) primers should be

available to selectively amplify the marker gene; and (5) too much of base variation

among the taxa may not reflect the true ancestry thus is not preferable. Some of the

widely used markers in phylogenetic studies are described below in detail.

2.9.1 Nuclear markers

Nuclear encoded ribosomal DNA (rDNA) has been widely used in the taxonomy of

algae. It is present as head-to-tail tandem repeats in eukaryotes and encoded for rRNA

gene. The rDNA contains a transcribed region that gives rise to a pre-rRNA transcript

and an intergenic region which known as the non-transcribed spacer (NTS) (Leitch et al.,

2013). The pre-rRNA transcript includes the small subunit (SSU, 18S rRNA), the first

internal transcribed spacer (ITS1), the 5.8S rRNA, the second internal transcribed

spacer (ITS2) and the large subunit (LSU, 28S rRNA) (Leitch et al., 2013).

Nuclear encoded ribosomal DNA (rDNA) is good for studying phylogenetic

relationship because it is universal and is composed of highly conserved as well as

variable domains (Patwardhan et al., 2014). In addition, it is evolved more slowly than

Univers

ity of

Mala

ya

39

protein encoding genes rendering them valuable for phylogenetic inference studies at

the higher taxonomic levels. For instance, the SSU (18S rDNA) has been found not able

to differentiate closely related species of Gracilaria but useful in the study of the

generic relationship within the Gracilariaceae (Bellorin et al., 2002). The SSU

sequences have also proven useful for familial and ordinal level taxonomy for red algae

(Bird et al., 1990; Ragan et al., 1994; Saunders and Kraft, 1996).

The LSU (28S rDNA) has proved to be useful in the studies of higher-level

relationships of red algae as reported by Freshwater et al. (1999). It also provided higher

number of phylogenetically informative sites and more divergent than SSU thus may

resolve phylogenetic problems where SSU (18S rDNA) sequences are uninformative

(Freshwater et al., 1999). The utility of partial LSU (28S rDNA) sequence as DNA

barcode was assessed by Sherwood et al. (2010a; 2010b) in Hawaiian Rhodophyta

Biodiversity Survey and confirmed not useful for rapid identification in future red algal

biodiversity surveys due to its lack of a reliable species-level resolution.

The non-coding internal transcribed spacers (ITS) have been adopted in studies of

species identification, genetic diversity and biogeographical in red algae (Broom et al.,

2002; Marston and Villalard-Bohnsack, 2002; Hu et al., 2009; Russell et al., 2009; Kim

et al., 2014). In general, ITS regions are useful for molecular investigations of closely

related taxa but inappropriate for higher lever phylogenetic comparison. This is because

ITS regions are highly conserved intraspecifically, but variable between different

species (Bruns et al., 1991; Hillis and Dixon, 1991). Additionally, ITS regions evolve at

a more rapid rate than other conserved region of rDNA (Baldwin et al., 1995; Harper

and Saunders, 2001). According to Hu et al. (2009), ITS marker is also a potential DNA

barcode for the species identification of Rhodophyta. Even so, this marker has several

drawbacks. Extensive sequence variation, length polymorphism of ITS could be

Univers

ity of

Mala

ya

40

accounted for PCR amplification difficulty (Bown et al., 2003). Furthermore, the

common occurrence of mononucleotide runs and heterogeneity in the multiple copies of

the ITS within an individual made it difficult to acquire clean sequence from both

strands across the entire ITS region (Saunders, 2005). Excessive indels in ITS alignment

can also resulted in difficulty in sequence comparison between taxa especially distantly

related species. The 5.8S rRNA gene was included in phylogenetic studies of various

red algal lineages (Goff et al., 1994; Patwary et al., 1998; Bellorin et al., 2002;

Guillemin et al., 2008; Hu et al., 2009; Hind and Saunders, 2013).

Elongation factor 2 (EF2), which is a nuclear protein coding gene, was also useful

for assessing the relationships between eukaryotic lineages (Hashimo et al., 1997). For

example, the sister relationship between green plants and red algae was supported by

using EF2 (Moreira et al., 2000). In addition to resolving supraordinal relationships,

EF2 has been shown to be useful in improving the phylogenetic inference within

Florideophyceae by resolving some novel ordinal affinities within the Nemaliophycidae

and Rhodymeniophycidae (Le Gall and Saunders, 2007).

2.9.2 Plastid markers

Ribulose-l, 5-bisphosphate carboxylase/oxygenase (RuBisCO) is the enzyme that

facilitates the primary carbon dioxide fixation step in the photosynthesis (Freshwater

and Rueness, 1994). The RuBisCO cistron consists of a large subunit (rbcL) and a small

subunit (rbcS) separated by an intervening spacer and is plastid-encoded (Valentin and

Zetsche, 1989). The rbcL marker has been proved to be very powerful for taxonomic

research of red algae because it has good resolution at the species level as well as higher

taxonomic levels in the red algae (Hommersand and Fredericq, 2003). The rbcL has

been widely used in Halymeniaceae to clarify taxonomic status (Wang et al., 2001;

Univers

ity of

Mala

ya

41

Kawaguchi et al., 2002; De Clerk et al., 2005; Russell et al., 2009), to clarify taxonomic

distribution (Kim et al., 2014; Lee et al., 2016) and to delimit species (Kawaguchi et al.,

2013; Tan et al., 2015; Azevedo et al., 2016a). Its large size which provides many

characters for phylogenetic analysis, availability of conserved primers that permit rapid

amplification and sequencing are some of the advantageous of the utility of rbcL

(Freshwater and Rueness, 1994). Moreover, the absence of insertion or deletion

mutations in rbcL eliminates the problems of alignment. The large number of published

sequences available in GenBank also made it a useful marker for species identification

(Costa et al., 2012). On the other hand, the RuBisCO spacer had been used to resolve

the phylogenetic relationships between different red algal genera but insufficient for

differentiating closely related species (Destombe and Douglas, 1991; Goff et al., 1994).

Universal plastid amplicon (UPA), which is in domain V of the 23S plastid rRNA

gene, has been proposed as a DNA barcode for algae lineages (Presting, 2006;

Sherwood and Presting, 2007). Primer universality and the ease of data acquisition with

a single primer set uphold its potential as a DNA barcode for red algae (Sherwood and

Presting, 2007; Sherwood et al., 2010a; 2010b). Several studies have shown that UPA

can discriminate among species within a single genus (Sherwood et al., 2008; Clarkston

and Saunders, 2010). However, this marker is not suitable for species identification in

some groups (e.g. plants by Newmaster et al., 2008; Bangiales by Kucera and Saunders,

2012).

2.9.3 Mitochondrial markers

Mitochondrial markers have been proved useful in addressing the phylogenetic

issues and population genetic within animals owing to their haploid nature, rapid

evolution, uniparental inheritance and lack of recombination (Avise, 1994; Zuccarello et

Univers

ity of

Mala

ya

42

al., 1999). The success of the utility of mitochondrial marker cytochrome c oxidase

subunit 1 (cox1 or COI) in animals has led to the assessment of this marker for

application in DNA barcoding in red algae (Saunders, 2005).

The mitochondrial cytochrome c oxidase subunit 1 (COI) gene encoded for an

enzyme involved in the last step of electron transport chain. COI gene has been used for

phylogenetic inference in red algae (Geraldino et al., 2006; Yang et al., 2008; Yow et al.,

2011), whereas the 5’ end of the cytochrome c oxidase subunit 1 gene (COI-5P) has

been recommended for DNA barcoding studies in red algae (Saunders, 2005; Robba et

al., 2006). A number of studies have shown the utility of COI-5P for the intra- and

interspecific studies, barcoding studies as well as the genetic diversity and

phylogeographical studies for the rhodophytes (Saunders, 2009; Clarkston and Saunders,

2010; Clayden and Saunders, 2010; Le Gall and Saunders, 2010; Saunders and

McDonald, 2010; Gulbransen et al., 2012; Milstein and Saunders, 2012; Carlile and

Sherwood, 2013; Hind and Saunders, 2013; Saunders and McDevit, 2013; Xie et al.,

2015).

The cox2-3 spacer is the first mitochondrial marker developed for red algal

intraspecific studies. It is an intergenic spacer, which is also a non-coding region,

separating the conserved cytochrome oxidase subunit 2 (cox2) and 3 (cox3) genes

(Zuccarello et al., 1999). Although the size of this marker is small (around 350 bp), it

demonstrates sufficient DNA sequence variability for population and phylogeographic

studies in red algae (Zuccarello et al., 1999). This marker has proven useful in intra- and

interspecific studies (Zuccarello et al., 1999; 2006; Tan et al., 2012), as well as the

genetic diversity and phylogeographical studies for the Rhodophytes (Zuccarello et al.,

2002; Andreakis et al., 2007; Vis et al., 2008). According to Zuccarello and West

(2011), the mitochondrial cox2-3 spacer demonstrated greater intraspecific variation

Univers

ity of

Mala

ya

43

than the plastid RuBisCO spacer, implying that the mitochondrion was evolving at a

rate that could make it more useful in phylogenetic and population studies. The cox2-3

spacer has also been proposed as the potential DNA barcode for coralline red algae

(Hernández-Kantún et al., 2014), as well as Kappaphycus and Eucheuma (Tan et al.,

2012, 2013).

Another mitochondrial marker, cytochrome c oxidase subunit 2 (cox2), was proposed

by Tan et al. (2012) as a promising maker for the DNA barcoding of Kappaphycus and

Eucheuma. However, its use for species identification has yet to be verified in other red

algae (Tan et al., 2012). On the other hand, Kim et al. (2014) indicated that cytochrome

c oxidase subunit 3 (cox3) gene can be a suitable tool for evaluating the phylogeography

and population structure of red algae.

2.10 Molecular studies in Halymenia

In spite of the large number of species discovered in Halymenia, many species

remain poorly studied and in need of review (De Smedt et al., 2001). The identification

of Halymenia based solely on morphological characters is difficult owing to its

extensive morphological plasticity and few distinctive morphological features (Tan et al.

2015; 2017). For example, Schneider et al. (2010) showed that two morphologically

similar species- H. pseudofloresii Collins & M. Howe and H. floresii were distinct

based on molecular evidence. Thus, the doubt has been cast on species recognition

based solely on morphology and the use of molecular identification is recommended for

species assignment (Hernández-Kantún et al., 2012). The adoption of molecular

techniques overcomes the problem related to morphology-based taxonomy and proved

useful in elucidating species boundaries and relationship and evolutionary history

Univers

ity of

Mala

ya

44

(Kawaguchi et al., 2006; Schneider et al., 2010; Hernández-Kantún et al., 2012; Tan et

al., 2015; Azevedo et al., 2016a; 2016b; Tan et al., 2017).

The molecular studies of Halymenia are very limited when compared to other genus

in Halymeniaceae, for instance Grateloupia. The genetic record of Halymenia in

GenBank is scanty with most of the taxonomically accepted species have been studied

based only on morphological characters. A total of seven studies attempt the use of both

molecular analyses and morphological examination to clarify the taxonomic position of

Halymenia. The first molecular study on Halymenia was carried out by Kawaguchi et al.

(2006). The rbcL marker was used in this study to clarify the range of morphological

variations of H. durvillei and its taxonomic relationships with the allied taxa from Indo-

Pacific. The result showed that regardless of their wide external variations, all the

branched samples were H. durvillei since they were enclosed in a monophyletic clade

with H. durvillei from Malaysia. The rbcL phylogeny also supported the identification

of two foliose plants by morphological observation: H. maculata and H. dilatata.

Subsequently, COI-5P and UPA were used as markers to evaluate intraspecific

divergence of H. pseudofloresii collections from Bermuda (Schneider et al., 2010).

Molecular evidence showed that all five collections with wide range of morphological

variation belong to a single species H. pseudofloresii since their UPA sequences were

identical while COI sequences were identical or varying at a single site. COI-5P was

also used to evaluate interspecific divergence between H. floresii and H. pseudofloresii

collections from Bermuda. The genetic variation between H. floresii and H.

pseudofloresii collections (approximately 7%) was sufficiently high to warrant

recognition as distinct species. In the same studies, LSU (28S rDNA) and the protein-

coding elongation factor 2 (EF2) of H. pseudofloresii were compared with other

members of the Halymeniales (Schneider et al., 2010). In both LSU (28S rDNA) and

EF2 ML trees, H. pseudofloresii grouped closely with the type, H. floresii which was

Univers

ity of

Mala

ya

45

consistent with anatomical assignment of this species to the genus Halymenia. The

results also demonstrated the polyphyly of Halymenia that needs further taxonomic

study.

In addition, Hernández-Kantún et al. (2012) employed the rbcL marker to delineate

branched Halymenia species in the Indo-Pacific and this have led to the recognition and

description of two new species, H. hawaiiana Hernández-Kantún & A. R .Sherwood

and H. tondoana O. DeClerck & Hernández-Kantún. Hernández-Kantún et al. (2012)

also highlighted the need to re-examine H. durvillei and H. floresii in the Indo-Pacific

based on molecular analysis. The rbcL marker was also utilized by Tan et al. (current

study) to study foliose Halymenia species which led to the discovery of new species H.

malaysiana in 2015 and H. johorensis in 2017. Besides, Azevedo et al. (2016a) assessed

the diversity of branched Halymenia species in Brazil by utilizing both rbcL and COI-

5P markers. Both rbcL and COI-5P phylogenies demonstrated that samples previously

assigned to H. floresii and H. pseudofloresii indeed correspond to three molecularly

divergent but morphologically similar lineages in which proposed as new species (H.

ignifera C. A. A. Azevedo, Cassano & M. C. Oliveira, H. pinnatifida C. A. A. Azevedo,

Cassano & M. C. Oliveira and H. silviae C. A. A. Azevedo, Cassano & M. C. Oliveira).

Azevedo et al. (2016a) also emphasized that without the use of molecular tools, the

morphological variations observed in Brazilian samples could be misinterpreted as

morphological plasticity. In the same year, phylogenetic relationships and species

diversity within the genus Halymenia in Brazil was also investigated by Azevedo et al.

(2016b). Three molecular markers included rbcL, COI-5P and UPA were adopted in

this study and revealed the presence of five Halymenia species in Brazil with the

description of a new species (H. cearensis C. A. A. Azevedo, Cassano & M. C.

Oliveira). This study also indicated the existence of at least two new genera classified to

Univers

ity of

Mala

ya

46

the Halymeniaceae and emphasized the importance of molecular tools in better

understanding of the diversity of Brazilian marine flora.

In general, the rbcL marker is the most widely used marker in the genus Halymenia.

It is mainly used to clarify taxonomic position of unknown species and to elucidate

phylogenetic relationships between species of Halymenia. Besides, the COI-5P marker

is the supplementary marker which useful in studying intra- and interspecific

relationships and revealing cryptic species.

Univers

ity of

Mala

ya

47

CHAPTER 3: MATERIALS AND METHODS

3.1 Sample collection and processing

Samples of Halymenia were collected from various localities in Malaysia, Thailand,

Indonesia and the Philippines (Figure 3.1) intertidally or subtidally by snorkelling or

scuba diving. A majority of Malaysian specimens were collected from several islands

around Peninsular Malaysia (Figure 3.2): Pulau Merambong, Johor; Pulau Babi Besar,

Johor; Pulau Tinggi, Johor and Pulau Besar, Malacca. Sample collection in Malaysia

was also made in Sabah, East Malaysia at four sites – Pulau Labuan, Pulau Mata Pahi,

Pulau Karindingan and Tun Mustapha Park (TMP) (Figure 3.2). The Philippines

specimens were sampled from Busuanga Island, Uson Island, Grande Island,

Paglugaban Island, Siargao Island, Camiguin Island and Subic Bay (Figure 3.3), while

the Thailand specimens were collected from populations in Koh Dok Mai (Figure 3.1).

Sample collection was also conducted in several localities in Indonesia: Pulau Weh,

Aceh; Amed, Bali; Ekas, Pulau Lombok; Ternate Island; South Gam, Raja Ampat and

Pulau Rote (Figure 3.1). Specimens are normally collected from specimens attached to

bedrock, shell, stone and coral rubble or as drift materials.

Univers

ity of

Mala

ya

48

Figure 3.1: Map showing the collection sites (arrowed and circled) of the samples in

this study. Map adapted from http://aseanup.com/free-maps-asean-southeast-asia/

Figure 3.2: Map of the collection sites in Malaysia.

Univers

ity of

Mala

ya

49

Figure 3.3: Map of the collection sites in the Philippines. Map adapted from

http://www.d-maps.com/carte.php?num_car=587&lang=en

The collected specimens were cleaned with seawater to remove epiphytes, mud or

dirt. Specimens were pressed on herbarium sheets or preserved in 3-5% of formalin

seawater for morphological and anatomical study; whereas, a subsample of each

specimen was blotted-dry prior to dessicated in silica gel for molecular studies. Voucher

specimens are deposited in the University of Malaya Seaweeds and Seagrasses

Herbarium (KLU) and Leiden Herbarium (L). List of specimens used in this study is

provided in Appendix A.

Univers

ity of

Mala

ya

50

3.2 Morphological and anatomical studies

For morphological examination, the gross morphology of samples include thalli

colour, thalli size, blade shape, branching pattern (if applicable), order of branching (if

applicable), blade margin, presence or absence of stipe, presence or absence of spines or

proliferation on blade surfaces were observed and documented. Anatomical studies

were conducted by cutting thin sections using a razor blade. Sections were then stained

with 1% aniline blue acidified with diluted 1% HCl and subsequently mounted in 25- 30%

Karo syrup (Englewood Cliffs, NJ, USA) or were treated with Wittmann’s aceto-iron-

haematoxylin-chloral hydrate (Wittmann, 1965) and mounted in 50% Hoyer’s mounting

medium (Lin et al., 2008). The anatomical characters include shape and size of outer

cortical cells, shape and size of inner cortical cells, cortex thickness, presence or

absence of refractive ganglionic cells, size of cystocarps and tetrasporangia of stained

sections were then observed under an Olympus BX51 microscope (Olympus, Japan) and

the photomicrographs were taken with a DP72 digital camera.

3.3 Molecular analyses

3.3.1 DNA extraction

Genomic DNA of species of Halymenia were extracted from approximately 3 - 5 mg

silica gel-dried or herbarium specimens using the i-genomic Plant DNA Extraction Mini

Kit (iNtRON Biotechnology Inc., South Korea) according to the manufacturer’s

protocol with minor modifications. The seaweed materials were pulverized in liquid

nitrogen using a micropestle. This was followed by chemical lysis with the addition of

lysis buffer, RNase and Proteinase K to degrade proteins and RNA. The mixture was

vortexed vigorously before subjected to sonication for 10 minutes. After incubation at

Univers

ity of

Mala

ya

51

65°C for 45-60 minutes, the mixture was incubated on ice for 20 minutes to precipitate

proteins and polysaccharides. Subsequently, the glutinous mixture was centrifuged for

5 minutes and the clear lysate was transferred to a new tube to which binding buffer

with ethanol was added. The mixture was transferred to a spin column and followed by

centrifugation for binding of the DNA on the membrane. Contaminants such as

polysaccharides and proteins were further removed by washing buffer, and the DNA

bound to the membrane was eluted in two fractions of 50 μL elution buffer. The eluted

samples were later kept at -20˚C for long term storage.

3.3.2 Spectrophotometric determination of DNA concentration and purity

The concentration and purity of the isolated DNA were estimated using a

BioPhotometer (Eppendorf, Germany). For concentration measurement, the absorbance

reading of 1 at 260 nm corresponds to 50 μg/ ml for double-stranded DNA. Meanwhile,

the ratio of the absorbance at 260 nm and 280 nm (A260/A280) implies the purity of DNA.

A good quality DNA has an A260/A280 ratio of 1.8- 2.0, a lower ratio indicates DNA is

contaminated by protein, while a higher ratio suggests that DNA is contaminated by

RNA.

3.3.3 Polymerase chain reaction (PCR) amplification

The DNA was subjected to PCR amplification for different molecular markers,

including the mitochondrial COI-5P, nuclear LSU (28S rDNA), plastid rbcL and UPA.

The PCR amplification was carried out by Eppendorf EP Gradient S (Hamburg,

Germany) thermal cycler or Labnet MultiGene™ Gradient Thermal Cycler (Labnet,

USA) using the i-Taq™ Plus DNA Polymerase Kit (iNtRON Biotechnology, Korea).

Univers

ity of

Mala

ya

52

Each reaction contained 1-3 μL (25-50 ng) DNA template, 2 μL 10x i-Taq plus reaction

buffer, 2 μL dNTP mixture (consisting of 2.5 mM each of dNTP), 1.5 μL of each

forward and reverse primer (10 pmol/ μL), 0.25 μL i-Taq plus DNA polymerase

(iNtRON Biotechnology, Korea) and ultrapure water was added to make up the final

volume of 20 μL. A negative control with the same constituents but without template

DNA was prepared in each set of PCR reactions to detect contamination and monitor for

false positives. Concentration of DNA and annealing temperature were slightly

modified to achieve high yield product.

3.3.3.1 rbcL

Primers used for amplification of the rbcL gene were listed in Table 3.1. The almost

complete length of the rbcL gene was obtained using the primer pairs of F7/R1381 or

F7/RrbcS start. When this failed, two smaller overlapping fragments of rbcL were

amplified where the primer pairs F7/R753 or F57/R753 for amplification of the 5’ end

and primer pairs F577/R1150, F577/R1381 or F577/RrbcS start for amplification of the

3’end. When the attempt was unsuccessful, nested PCR were carried out to amplify two

smaller overlapping fragments of rbcL by using the diluted amplicons from the first

PCR run using the primer pairs F7/RrbcS start as the template DNA. The amplification

parameter of the rbcL gene is as follows: an initial denaturation at 94oC for 4 minutes,

followed by 35 cycles of denaturation at 93oC for 1 minute, annealing at 50

oC for 1

minute, extension at 72oC for 1.5 minutes; with a final extension at 72

oC for 7 minutes.

Annealing temperature was modified in the range of 48ºC to 52ºC to optimize

amplifications.

Univers

ity of

Mala

ya

53

Table 3.1: Primers used for amplification of rbcL.

Primer Primer Sequence (5’ → 3’) References

F7 AACTCTGTAGAACGNACAAG Gavio and Fredericq, 2002

F57 GTAATTCCATATGCTAATGAAGG Freshwater and Rueness, 1994

F577 GTATATGAAGGTCTAAAAGGTGG Freshwater and Rueness, 1994

R753 GCTCTTTCATACATATCTTCC Freshwater and Rueness, 1994

R1150 GCATTTGTCCGCAGTGAATACC Freshwater and Rueness, 1994

R1381 ATCTTTCCATAGATCTAAAGC Freshwater and Rueness, 1994

RrbcS start TGTGTTGCGCCGCCCTGTGTTAGTCTCAC Freshwater and Rueness, 1994

3.3.3.2 COI-5P

Primers used for amplification of the 5’ end of the COI gene were listed in Table 3.2.

Two degenerated primers were designed based on the sequences available in GenBank

using the Primer3 software (Untergasser et al., 2012). Amplifications of the COI-5P

region were accomplished using the primer pairs GHa1F/GHa1R, M13LF3/M13Ri or

COI1F/COI1R. When this failed, nested PCR were carried out using the primer pairs

M13LF3/M13Ri or COI1F/COI1R where the diluted amplicons from the first PCR run

using the primer pairs GHa1F/GHa1R as the template DNA. The amplification

parameter of the COI-5P region is as follows: an initial denaturation at 94oC for 4

minutes, followed by 35 cycles of denaturation at 93oC for 1 minute, annealing at 50

oC

for 1 minute, extension at 72oC for 1 minute; with a final extension at 72

oC for 7

minutes. Annealing temperature was modified in the range of 46ºC to 50ºC to optimize

amplifications.

Univers

ity of

Mala

ya

54

Table 3.2: Primers used for amplification of COI-5P.

Primer Primer Sequence (5’ → 3’) References

GHa1F TCAACAAATCATAAAGATATYGG Saunders, 2008

GHa1R CTTCWGGATGRCCAAAAAATCA Clarkston and

Saunders, 2010

M13LF3 TGTAAAACGACGGCCAGTACHAAYCAYAARGATATHGG Saunders and

Moore, 2013

M13Ri CAGGAAACAGCTATGACGGRTGICCRAARAAYCARAA Saunders and

Moore, 2013

COI1F GGAACACTTTAYTTAATTTTTGG This study

COI1R TGRTATARAATTGGATCWCC This study

3.3.3.3 UPA

UPA region was amplified using the primer pair p23SrV-f1/p23SrV-r1 as in

Sherwood and Presting (2007) (Table 3.3). The amplification parameter of the UPA is

as follows: an initial denaturation at 94oC for 3 minutes, followed by 40 cycles of

denaturation at 94oC for 30 seconds, annealing at 55

oC for 30 seconds, extension at

72oC for 50 seconds; with a final extension at 72

oC for 10 minutes. Annealing

temperature was modified in the range of 50ºC to 55ºC to optimize amplifications.

Table 3.3: Primers used for amplification of UPA

Primer Primer Sequence (5’ → 3’) References

p23SrV-f1 GGACAGAAAGACCCTATGAA Sherwood and Presting, 2007

p23SrV-r1 TCAGCCTGTTATCCCTAGAG Sherwood and Presting, 2007

Univers

ity of

Mala

ya

55

3.3.3.4 LSU (28S rDNA)

The central portion of the LSU (28S rDNA) was amplified using the primer pair

nu28SF/nu28SR as in Sherwood et al. (2010b) (Table 3.4). The amplification parameter

of the LSU is as follows: an initial denaturation at 94oC for 3 minutes, followed by 40

cycles of denaturation at 94oC for 30 seconds, annealing at 55

oC for 30 seconds,

extension at 72oC for 50 seconds; with a final extension at 72

oC for 10 minutes.

Annealing temperature was modified in the range of 50ºC to 55ºC to optimize

amplifications.

Table 3.4: Primers used for amplification of LSU (28S rDNA).

Primer Primer Sequence (5’ → 3’) References

nu28SF GGAATCCGCYAAGGAGTGTG Sherwood et al., (2010b)

nu28SR TGCCGACTTCCCTTACCTGC Sherwood et al., (2010b)

3.3.4 Determination of the amplification yield and quality by gel

electrophoresis, DNA purification and gene sequencing

The yield, size and quality of PCR amplicons were examined by electrophoresing

through a 1% agarose gel pre-stained with SYBR Safe DNA gel stain (Invitrogen, NY,

USA). A 1kb DNA ladder (Bioron, Germany) was used as a reference to estimate the

yield and the size of amplicons. Gel electrophoresis was carried out at 100 volts for 30

minutes, and then the gel was viewed under UV transilluminator using AlphaImager

2200 gel documentation system (Alpha Innotech, USA). After the electrophoretogram

was analyzed, desired products with a single band were directly purified while PCR

products with multiple bands underwent gel purification using LaboPass Gel and PCR

Clean-up Kit (Cosmo Genetech, Seoul, Korea) according to the manufacturer’s

protocols. The purified PCR products were then sent for automated DNA sequencing

Univers

ity of

Mala

ya

56

service (Genomics BioScience and Technology Co., Ltd., Taiwan) and were sequenced

on an Applied Biosystems 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA,

USA) using the same primers used for PCR amplification and the BigDye Terminator

v3.1 Cycle Sequencing Kit (Applied Biosystems, USA).

3.3.5 Sequence and phylogenetic analyses

ChromasPro v1.5 (Technelysium Pty. Ltd., Australia) was employed to assemble the

forward and reverse sequence reads for each sample into contigs. Contigs were then

checked for nucleotide ambiguities and edited by examining electropherograms.

Published sequences of species of Halymeniaceae were downloaded from GenBank.

Consensus sequences and the published sequences were compiled and subsequently

aligned in ClustalX v. 2.0.8 (Larkin et al., 2007) to generate multiple sequence

alignments. The alignments were manually revised and trimmed in Bioedit v. 7.0.9.0

(Hall, 1999) by truncated sequences with longer lengths. In order to assess the level of

nucleotide variation between samples, MEGA6 (Tamura et al., 2013) was used to

compute uncorrected (p) pairwise genetic distances.

Two phylogenetic analyses ML and BI were implemented in this study. The

published sequences used for phylogenetic analyses are listed in Appendix B and C.

Each analysis dataset included the newly determined sequences for Halymenia and

reference sequences of Halymeniaceae downloaded from GenBank. Kakusan v.3

(Tanabe, 2007) was employed to search for the most appropriate model of sequence

evolution for ML and BI analyses with parameters inferred from the Akaike Information

Criterion (AIC) and the Bayesian Information Criterion (BIC) respectively. The models

and parameters selected for ML analyses are shown in Table 3.5. The best fit models

Univers

ity of

Mala

ya

57

for the BIC are as follow: GTR model for the rbcL dataset, HKY85 model for COI-5P,

HKY85+G for UPA and JC69+G for the LSU (28S rDNA) dataset.

ML analyses were performed in Treefinder v. October 2008 (Jobb et al., 2004) where

bootstrap support was estimated using 1000 bootstrap resamplings to evaluate

robustness. On the other hand, BI analyses were inferred in MrBayes v. 3.1.2 (Ronquist

and Huelsenbeck, 2003) where two parallel run of four chains of Markov Chain Monte

Carlo (MCMC) were conducted with one tree sampled every 100 generations for two

million generations. The two MCMC runs had reach convergence if the average

standard deviation of split frequencies less than 0.01. Convergence was evaluated using

Tracer v1.5 (Rambaut and Drummond, 2009b) by looking at the log likelihood plot.

Stationary was reached at generation 18,000. Therefore, the first 20,000 generations

were discarded as burn-in and the remaining generations were used to build the

consensus tree and determine the posterior probabilities.

All phylogenetic trees were visualized and processed using Figtree v1.3.1 (Rambaut

and Drummond, 2009a). All trees were rooted with appropriate outgroups and arranged

with decreasing node orders. Nodes with a bootstrap support lower than 70% and a

Bayesian posterior probability lower than 0.90 were weakly supported and considered

unresolved (Hillis and Bull, 1993; Huelsenbeck and Ronquist, 2001). Thamnoclonium

served as outgroups for the rbcL dataset, Grateloupia and Prionitis were the designated

outgroups for the COI-5P dataset, while Grateloupia selected as outgroups for both

UPA and LSU (28S rDNA) datasets.

Univers

ity of

Mala

ya

58

Table 3.5: Model and parameters selected by Kakusan3 for ML analysis of rbcL, COI-5P, UPA and LSU (28S rDNA) datasets.

Dataset Model

selected

-ln

likelihood

Nucleotide frequencies Substitution model rate matrix Gamma

distribution

shape

A C G T TC TA TG CA CG AG parameter

(alpha)

rbcL J2+G 7027.31 0.3132 0.1664 0.2037 0.3167 0.5118 0.0272 0.0504 0.2723 0.0504 0.3329 0.1814

COI-5P HKY+G 3447.21 0.2833 0.1534 0.1571 0.4062 0.4660 0.0170 0.0170 0.0170 0.0170 0.4660 0.1639

UPA HKY+G 1038.00 0.25 0.25 0.25 0.25 0.4523 0.2385 0.2385 0.2385 0.2385 0.4523 0.1450

LSU TVM+G 1108.32 0.2353 0.2249 0.3119 0.2280 0.2118 0.4128 0.0747 0.0765 0.0123 0.2118 0.1278

Univers

ity of

Mala

ya

59

3.3.6 Haplotype network analyses

In order to infer the genetic relationships among the haplotypes of H. malaysiana,

statistical parsimony implemented in TCS v1.21 (Clement et al., 2000) were employed

to construct haplotype networks for rbcL and COI-5P marker. This program collapsed

sequences with zero pairwise absolute distance into haplotype, treated gap as missing

data and connected the haplotypes with smaller differences until all haplotypes were

included in a single network based on parsimony limit (maximum number of

differences among haplotypes as a result of single substitutions with a 95% statistical

confidence).

Univers

ity of

Mala

ya

60

CHAPTER 4: RESULTS

4.1 Morphological and anatomical observations

Upon collection from field, the gross morphology of each specimen include thalli

colour, thalli size, blade shape, branching pattern (if applicable), order of branching (if

applicable), blade margin, presence or absence of stipe, presence or absence of spines or

proliferation on blade surfaces were observed and described. Anatomical characters

include shape and size of outer cortical cells, shape and size of inner cortical cells,

cortex thickness, presence or absence of refractive ganglionic cells, size of cystocarps

and tetrasporangia were then studied by examining the sections under microscope. The

morphological descriptions of each species were given below:

4.1.1 Halymenia malaysiana P.-L. Tan, P.-E. Lim, S.-M. Lin & S.-M. Phang,

Figures 4.1-4.3

Thalli are foliose (Figure 4.1), composed of mostly a single or, in some cases, few

blades, 6-25 cm long by 9-33 cm wide, arising from a small discoid holdfast without a

stipe, abruptly expanding into broad blades. Thalli ranging from pink to pinkish brown

with a supple cartilaginous and gelatinous (slimy) texture. Blades are oblong (Figures

4.1a-b) or suborbicular (Figure 4.1c) with a smooth surface, rarely with orbicular

proliferations (Figure 4.1d). Blade margins are mostly sinusoidally undulated (Figures

4.1a, 4.1c), sometimes minutely dentate (Figure 4.1b) or deeply cleft (Figure 4.1d).

The internal anatomy of blades is slightly different between young and old blades,

ranging from 150 µm to 700 µm in thickness (Figure 4.2) while the pigmented cortex is

Univers

ity of

Mala

ya

61

20-70 µm thick. Young blades are 150-200 µm in thickness, composed of 1-2 layers of

elongated outer cortical cells (8-13 µm long by 5-8 µm wide) and 2-3 layers of rounded

to ellipsoidal inner cortical cells (5-13 µm in diameter) (Figures 4.2a, 4.2c) with laxly

arranged medullary filaments (Figure 4.2b). Older blades are thickened, 240-700 µm in

thickness, consisting of elongated outer cortical cells and rounded inner cortex with

densely arranged medullary filaments (Figure 4.2d). Only few innermost cortical cells

become stellate, and refractive ganglionic cells are also present in the medulla, 40-90

µm in diameter, irregular in shape with 4-6 arms.

Spermatangial gametophytes were not found and only tetrasporic and female

structures were examined. Female gametophytes and tetrasporophytes are isomorphic.

Tetrasporangia sori are scattered over the thallus of fertile blades. Tetrasporangial

initials are first cut off from subcortical cells, then elongated (Figure 4.3a, arrows) and

divide into cruciately arranged tetraspores (Figures 4.3a-b). Mature tetrasporangia are

subspherical to oblong, 18-30 µm long by 15-18 µm wide (Figure 4.3b). Early post-

fertilization events were not observed. At one young stage of carposporophyte

development, ampullar filaments loosely surround the developing gonimolobes and

gonimoblast initial cell (Figure 4.3c, arrowhead), and the auxiliary cell (Figure 4.3c,

arrow) remains visible. Cystocarps are scattered over fertile blades and deeply

embedded in the layer between the inner cortex and medulla. Mature carposporophytes

are spherical, 90-120 µm in diameter, bearing several gonimolobes. Most cells of the

gonimolobes differentiate into ellipsoidal or ovoid carposporangia, 5-8 µm wide by 12-

20 µm long, released through an ostiole (Figures 4.3d-e).

Univers

ity of

Mala

ya

62

Figure 4.1: Thallus habit of Halymenia malaysiana. (a) A female thallus with oblong

blade (PSM12834). (b) A female thallus with minutely dentate margins (arrow)

(PSM12835). (c) A tetrasporic thallus with orbicular blade (PSM12850). (d) A sterile

thallus with orbicular proliferations on the surface (arrows) (PSM12838). [scale bars: a,

c, d = 5 cm; b = 1 cm]

Univers

ity of

Mala

ya

63

Figure 4.2: Vegetative structures of Halymenia malaysiana (PSM12835). (a) Cross-

section through the upper part of a young blade showing cortex and medulla. (b) Cross-

section through the median part of a young blade showing dense cortex and laxly

arranged medullary filaments. (c) Close up of Figure 4.2b showing details of cortical

and medullary filaments. (d) Cross-section through the basal part of an old blade

showing thickened cortex and densely arranged medullary filaments. [scale bars: a = 25

μm; c, d = 50 μm; b = 75 μm]

Univers

ity of

Mala

ya

64

Figure 4.3: Tetrasporangial (PSM12845) and cystocarp (PSM12834) morphology of

Halymenia malaysiana. (a) Cross-section through a tetrasporangia-bearing blade

showing tetrasporangial initials (arrows) and dividing tetrasporangium (arrowhead) cut-

off laterally from the subcortical cells. (b) Close up of a mature, cruciately divided

tetrasporangium (arrow). (c) Cross-section through a young cystocarp showing young

gonimolobe, gonimoblast initial (arrowhead), and basal fusion cell (arrow). (d) Cross-

section through a mature cystocarp. (e) Close up of mature cystocarp showing

carposporophyte borne on a basal fusion cell (arrow). [scale bars: a = 40 μm; b, d, e =

20 μm; c = 50 μm]

Univers

ity of

Mala

ya

65

4.1.2 Halymenia maculata J. Agardh, Figures 4.4-4.5

Thalli (Figure 4.4) are composed of single or few thick blades, 8-10 cm long by 9-15

cm wide, arising from a stiff stipe. Blades are circular to irregularly lobed and dark pink

to reddish brown in colour (Figure 4.4). Thallus texture is cartilaginous and gelatinous

(slimy). Blade surfaces are mottled with dark red, circular spots, some bearing

proliferations or small bladelets (Figures 4.4a-d). Margins of blades are irregularly to

regularly lobed (jigsaw-like) or denticulate (Figures 4.4a-b). In addition, some

specimens have surface protuberances on the thalli (Figure 4.4d).

The internal anatomy of blades is slightly different between young and old blades,

ranging from 170-480 µm in thickness (Figures 4.5a-b). Young blades are 170-220 µm

in thickness, composed of 1-2 layers of elongated outer cortical cells (8-23 µm long by

2-7 µm wide) and 3-4 layers of rounded to stellate inner cortical cells (4-16 µm in

diameter) with laxly arranged medullary filaments (Figure 4.5a). Older blades are

thickened, 250-480 µm in thickness, consisting of elongated outer cortical cells and

stellate inner cortex with densely arranged medullary filaments (Figure 4.5b). Refractive

ganglionic cells are also present in the medulla.

Spermatangial gametophytes were not found and only tetrasporic and female

structures were examined. Female gametophytes and tetrasporophytes are isomorphic.

Cystocarps are scattered over fertile blades and deeply embedded in the layer between

the inner cortex and medulla. Mature carposporophytes are spherical to pyriform, 80-

130 µm in diameter. Carposporangia are spherical to ovoid, 8-11 µm in diameter,

released through an ostiole (Figure 4.5c). Tetrasporangial sori are scattered over the

thallus of fertile blades. Tetrasporangial initials are first cut off from subcortical cells,

then elongated (Figure 4.5d) and divide into cruciately arranged tetraspores (Figure

Univers

ity of

Mala

ya

66

4.5e). Mature tetrasporangia are subspherical, 14-18 µm long by 16-20 µm wide (Figure

4.5e).

Figure 4.4: Thallus habit of Halymenia maculata. (a) A tetrasporic thallus showing

jigsaw-like blade margin and mottled surface (PSM12852). (b) A female thallus

showing jigsaw-like blade margin and mottled surface (PSM12833). (c) Part of a female

thallus showing surface proliferations (arrows) (PSM12833). (d) Part of a female thallus

showing surface protuberances (arrows) and bladelet (arrowhead) (PSM12833). [scale

bars: a,b = 2 cm; c, d = 1 cm]

Univers

ity of

Mala

ya

67

Figure 4.5: Vegetative structures (PSM12833), cystocarp (PSM12833) and

tetrasporangial (PSM12852) morphology of Halymenia maculata. (a) Cross-section

through the upper part of a young blade showing cortex and laxly arranged medullary

filaments. (b) Cross-section through the basal part of an old blade showing thickened

cortex and densely arranged medullary filaments. (c) Cross-section through a mature

cystocarp. (d) Cross-section through a tetrasporangia-bearing blade showing dividing

tetrasporangium (arrow) cut-off laterally from the subcortical cells. (e) Close up of a

mature, cruciately divided tetrasporangium (arrow). [scale bars: a, c = 50 μm; b, d = 30

μm; e = 20 μm]

Univers

ity of

Mala

ya

68

4.1.3 Halymenia cf. dilatata Zanardini, Figure 4.6

Thallus is foliose, reddish with darker spots, cartilaginous and gelatinous in texture.

Thallus (Figure 4.6a) is 7 cm high by 9 cm wide, arising from a short stipe (3 mm long,

2 mm wide) attached to a discoid holdfast. Blades are irregularly shaped (Figure 4.6a)

with smooth surface. Blade margins (Figure 4.6a) are minutely dentate.

Thallus blades (Figures 4.6b-c) are 180-200 µm thick in the apical region and 300-

320 µm thick in basal region. The pigmented cortex is 35-60 µm thick, with two to three

layers of subspherical to elongated outer cortical cells (7-12 µm long by 3-4 µm wide)

and two to four layers of irregularly stellate, tangentially flattened inner cortical cells (6-

18 µm in diameter). The medulla lax with anticlinal filaments in the apical region

(Figure 4.6b) and densely filled with both anticlinal and intertwined filaments (Figure

4.6c) in the basal region. Refractive ganglionic cells are present in the medulla but not

abundant, mostly with 6 arms.

Only female gametophyte was examined. Cystocarps are scattered over fertile blades

and deeply embedded in the layer between the inner cortex and medulla. Mature

carposporophytes are spherical to pyriform, 80-90 µm in diameter. Carposporangia are

spherical to ovoid, 10-17 µm in diameter (Figure 4.6d).

Univers

ity of

Mala

ya

69

Figure 4.6: Thallus habit and anatomy of Halymenia cf. dilatata (PSM12857). (a) A

female thallus. (b) Cross-section through the apical region of a blade showing cortex

and laxly arranged medullary filaments. (c) Cross-section through the basal region of a

blade showing thickened cortex and densely arranged medullary filaments. (d) Cross-

section through a mature cystocarp showing carposporophyte borne on a basal fusion

cell (arrow). [scale bars: a = 2 cm, b = 60 μm; c = 25 μm; d = 40 μm]

Univers

ity of

Mala

ya

70

4.1.4 Halymenia johorensis P.-L. Tan, P.-E. Lim, S.-M. Lin & S.-M. Phang,

Figures 4.7-4.8

Thalli are foliose, cartilaginous and gelatinous in texture, pink to pinkish red with

faded yellowish green in the middle regions of plants (Figures 4.7a-c). Thalli are 22-40

cm long by 10-30 cm wide, arising from a narrow-cuneate stipe (1-4 mm long, 2-3 mm

wide) attached to a discoid holdfast, expanding broadly into flat blades. Blades are

elliptical (Figure 4.7a), oblong (Figure 4.7b) or irregularly shaped (Figure 4.7c), incised

with some perforations. Blade surfaces are smooth or rugose with proliferations, while

rugose mainly found in the older plants (Figure 4.7c). Blade margins (Figures 4.7a-c)

are mostly irregularly dentate and cleft, sometimes smooth.

Thallus blades (Figures 4.7d–g) are 120-400 µm thick. The pigmented cortex is 15-

45 µm thick, with one to two layers of isodiametric outer cortical cells and one to four

layers of rounded to stellate inner cortical cells. The arrangement of cortex and medulla

in different aged blades differ slightly. Young blades are 120-200 µm thick, consisting

of one layer of isodiametric outer cortical cells (3-6 µm long by 2-4 µm wide) and one

to two layers of rounded to stellate inner cortical cells (4-12 µm in diameter) with laxly

arranged medullary filaments (Figure 4.7d). Older blades are 220-400 µm thick,

composed of one to two layers of isodiametric outer cortical cells and three to four

layers of rounded to stellate inner cortical cells with densely arranged medullary

filaments (Figure 4.7f). The medulla is primarily composed of anticlinal filaments in

young blades (Figures 4.7d-e) and both anticlinal and intertwined filaments (Figure 4.7f)

in older blades. A few refractive ganglionic cells are present in the medulla, these

irregular in shape with three to five arms (Figure 4.7g).

Male gametophytes were not found, and only female gametophytes and

tetrasporophytes were examined. Female gametophytes and tetrasporophytes are

Univers

ity of

Mala

ya

71

isomorphic. Carpogonial branches and early post-fertilization stages were not found.

The auxiliary cell ampulla is formed in the inner cortex, composed of a prominent

auxiliary cell and several orders of branched, filamentous cell rows (Figure 4.8a).

Following presumed diploidization, the auxiliary cell cuts off a gonimoblast initial

terminally from a cup-shaped depression (Figure 4.8b). The gonimoblast initial divides

to produce a primary gonimolobe. Basal ampullar cells become enlarged and the upper

ampullar cells are elongated (Figure 4.8b), while the inner cortical cells in vicinity of

the developing gonimoblasts produce secondary medullary filaments (Figure 4.8b). As

development of the gonimoblast continues, the auxiliary cell fuses with its adjacent

ampullar cells to form a fusion cell (Figures 4.8c-d). As cystocarp development

continues, more secondary medullary filaments are produced from the cell layer

between inner cortical cells and medulla (Figures 4.8c-d). Both elongated ampullar

filaments and secondary medullary filaments comprise the involucre that surrounds the

gonimolobe (Figures 4.8c–d). Mature carposporophytes (Figure 4.8e) are spherical to

pyriform, 80-250 µm in diameter, scattered over both surfaces of the fertile blades

except in the basal region. Cystocarps are embedded in the medulla but cause

protuberances on both sides of the thalli surfaces as small hemispherical blisters.

Carposporangia are spherical to ovoid, 6-12 µm in diameter, released through an ostiole

(Figure 4.8e). Mature tetrasporangia (Figure 4.8f, arrow) are cruciately divided,

subspherical to oblong, 14–20 µm long by 10–14 µm wide, scattered over the fertile

blades.

Univers

ity of

Mala

ya

72

Figure 4.7: Habit and vegetative morphology of Halymenia johorensis. (a) Cystocarpic

thallus (PSM12870). (b) Tetrasporic thallus (PSM10663). (c) Cystocarpic thallus

(PSM12873). (d) Cross section through upper part of a young blade showing thin cortex

and prominent anticlinal medullary filaments (PSM12870). (e) Cross section through

middle part of a young blade showing densely arranged cortical cells and laxly

arranged, filamentous medullary cells (PSM12870). (f) Cross section through middle

part of an old blade showing thickened cortex and densely arranged, filamentous

medullary cells (PSM12873). (g) Cross section through a young blade showing

refractive ganglionic cell (arrow) (PSM12874). [scale bars: a=7 cm; b=5 cm; c=2 cm; d,

f, g=50 µm; e=25 µm]

Univers

ity of

Mala

ya

73

Figure 4.8: Cystocarp (PSM12870) and tetrasporangial (PSM10663) morphology of

Halymenia johorensis. (a) Cross section through a young female blade showing

auxiliary cell ampulla, enlarged auxiliary cell (aux) and ampullar filaments

(arrowheads). (b) Young cystocarp showing auxiliary cell (aux) cutting off a

gonimoblast intial (gi), which produced a primary gonimolobe (g). Note that basal

ampullar cells (arrowheads) slightly enlarged, upper ampullar cells are elongated, and

the inner cortical cells in the vicinity of the gonimolobe have begun to send out

secondary medullary filaments (arrows). (c) Another young cystocarp showing a basal

fusion cell (fc), gonimoblast initial (gi) and gonimolobe enveloping by elongated

Univers

ity of

Mala

ya

74

ampullar filaments and secondary medullary filaments (arrows). (d) Immature cystocarp

showing fusion cell (fc), gonimoblast initial (gi), gonimoblasts enveloping by elongated

ampullar filaments and secondary medullary filaments (arrows). Note that the remnant

of ampullar filaments (arrowheads) do not divide any further. (e) Mature cystocarp

(arrow) showing gonimoblast initial (gi), basal fusion cell (fc) and gonimoblasts.

Arrowhead indicates ostiole. Note that most cells of gonimoblasts differentiate into

carposporangia. (f) Mature, cruciately divided tetrasporangium (arrow) immersed in the

cortex. [scale bars: a–e=25 μm; f= 15 μm]

4.1.5 Halymenia tondoana O. DeClerck & J.J. Hernández-Kantun, Figure 4.9

Thalli are pink to pinkish green, cartilaginous and gelatinous in texture. Thalli are 3-

6 cm long by 5–8 cm wide with unbranched cartilaginous stipe (7-10 mm long, 2-3 mm

in diameter) (Figure 4.9a). Blades resembling dichotomous bifurcations, branched up to

7 orders, branching distally from main axis. Marginal branchlets are abundant

throughout the thalli in the distal region. Blade surfaces are smooth with maculae

without spine. Margins of blades are lacerate and with proliferations.

Thallus blades are 150-400 µm thick. The pigmented cortex is 35-60 µm thick, with

one to two layers of elongated outer cortical cells and two to four layers of spherical

inner cortical cells. The arrangement of cortex and medulla in different aged blades

differ slightly. Young blades are 150-200 µm thick, consisting of one layer of elongated

outer cortical cells (5-8 µm long by 2-3 µm wide) and two to three layers of spherical

inner cortical cells (8-16 µm in diameter) with laxly arranged medullary filaments

(Figure 4.9b). Older blades are 300-400 µm thick, composed of two layers of elongated

outer cortical cells and three to four layers of spherical inner cortical cells with densely

arranged medullary filaments (Figure 4.9c). Refractive ganglionic cells are present in

the medulla, these irregular in shape with five to six arms.

Spermatangial gametophytes and tetrasporophytes were not found and only female

gametophytes were examined. Cystocarps are scattered over fertile blades and deeply

Univers

ity of

Mala

ya

75

embedded in the layer between the inner cortex and medulla. Mature carposporophytes

are pyriform, 100-150 µm in diameter. Carposporangia are spherical to ovoid, 10-15 µm

in diameter (Figure 4.9d).

Figure 4.9: Thallus habit and anatomy of Halymenia tondoana (PSM12955). (a) A

female thallus. (b) Cross-section through the apical region of a blade showing cortex

and laxly arranged medullary filaments. (c) Cross-section through the basal region of a

blade showing thickened cortex and densely arranged medullary filaments. (d) Cross-

section through a mature cystocarp showing carposporophyte borne on a basal fusion

cell (arrow). [scale bars: a = 2 cm; b, c = 30 μm; d = 60 μm]

Univers

ity of

Mala

ya

76

4.1.6 Halymenia durvillei Bory de Saint-Vincent, Figures 4.10-4.11

Thalli are red to reddish brown, cartilaginous and gelatinous in texture. Thalli

(Figures 4.10a-d) are up to 40 cm long with unbranched stipe (5-15 mm long, 1-6 mm

in diameter) bearing one or sometimes a few primary axes. Blades subdichotomously,

trichotomously or irregularly branched up to 7 orders (Figure 4.10a), axes either flat or

contorted and up to 4 cm wide, gradually tapering to apices. In some specimens,

secondary axes are arising as proliferations on the surface of the primary axes (Figure

4.10b). Blade surfaces are smooth in young plants (Figure 4.10c) and covered with

spiny proliferations in older plants (Figure 4.10b). Some specimens do not have surface

spine even in older thalli (Figures 4.10a, d). Margins of blades are dentate or laciniate,

sometime smooth with proliferations. Proliferations and spine-like marginal branchlets

are abundant throughout thalli in proximal and distal regions in some specimens

(Figures 4.10a-b) or abundant in the distal region but rare in the proximal region in

others (Figure 4.10d).

Thallus blades (Figures 4.11a-b) are 200-1300 µm thick. The pigmented cortex is 45-

150 µm thick, with one to four layers of subspherical to elongated outer cortical cells

and three to six layers of rounded to stellate inner cortical cells. The arrangement of

cortex and medulla in different aged blades differ slightly. Young blades are 200-600

µm thick, consisting of one to two layers of subspherical to elongated outer cortical

cells (8-13 µm long by 2-4 µm wide) and two to three layers of rounded to stellate inner

cortical cells (5-24 µm in diameter) with laxly arranged medullary filaments (Figure

4.11a). Older blades are 800-1300 µm thick, composed of elongated outer cortical cells

and rounded to stellate inner cortical cells with densely arranged medullary filaments

(Figure 4.11b). The medulla is primarily composed of longitudinal filaments in young

blades (Figure 4.11a) and both anticlinal and intertwined filaments (Figure 4.11b) in

Univers

ity of

Mala

ya

77

older blades. Refractive ganglionic cells are present in the medulla, these irregular in

shape with six to nine arms.

Spermatangial gametophytes were not found and only tetrasporophytes and female

gametophytes were examined. Tetrasporophytes and female gametophytes are

isomorphic. Tetrasporangial sori are scattered over the thallus of fertile blades.

Tetrasporangial initials are first cut off from subcortical cells, then elongated and divide

into cruciately arranged tetraspores (Figure 4.11c). Mature tetrasporangia (Figure 4.11c,

arrows) are cruciately divided, subspherical to oblong, 15-27 µm long by 10-15 µm

wide. Cystocarps are scattered over fertile blades and deeply embedded in the layer

between the inner cortex and medulla. Mature carposporophytes are spherical to

pyriform, 100-130 µm in diameter. Carposporangia are spherical to ovoid, 10-12 µm in

diameter, released through an ostiole (Figure 4.11d).

Univers

ity of

Mala

ya

78

Figure 4.10: Thallus habit of Halymenia durvillei. (a) Thallus which branched up to

seventh orders (PSM12836). (b) Thallus with surface spines, spine-like marginal

branchlets and several secondary axes are arising as proliferations on the surface of the

primary axes (PSM12999). (c) Young thallus with smooth surface (PSM12947). (d)

Thallus with proliferations and spine-like marginal branchlets which common in the

distal region but rare in the proximal region (PSM12942). [scale bars: a = 5 cm; b = 4

cm; c, d = 2.5 cm]

Univers

ity of

Mala

ya

79

Figure 4.11: Vegetative (PSM12942), tetrasporangial (PSM12939) and cystocarp

(PSM13011) morphology of Halymenia durvillei. (a) Cross-section through the median

part of a young blade showing cortex and laxly arranged medullary filaments. (b) Cross-

section through the basal part of an old blade showing thickened cortex and densely

arranged medullary filaments. (c) Cross-section through a tetrasporangia-bearing blade

showing dividing tetrasporangium (arrowhead) cut-off laterally from the subcortical

cells and cruciately divided tetrasporangia (arrows). (d) Cross-section through a mature

cystocarp showing carposporophyte borne on a basal fusion cell (arrow). Arrowhead

indicates ostiole. [scale bars: a, c = 20 μm; b, d = 40 μm]

4.1.7 Halymenia sp. A, Figure 4.12

Thalli are cartilaginous and gelatinous in texture. Thalli are 16-26.5 cm long by 11–

41 cm wide with stipe (4 mm long, 3 mm in diameter). Blades irregularly branched up

to 4 orders, branches and branchlets abruptly constricted at bases, gradually tapering to

apices (Figures 4.12a-b). Blade surfaces are smooth without spine or proliferations.

Univers

ity of

Mala

ya

80

Margins of blades are smooth with proliferations. Proliferations and spine-like marginal

branchlets are abundant throughout thalli in the distal region but rare in the proximal

region.

The internal anatomy of blades is slightly different between young and old blades,

ranging from 130 µm to 600 µm in thickness (Figures 4.12c-d) while the pigmented

cortex is 25-65 µm thick. Young blades are 130-300 µm in thickness, composed of 1-2

layers of subspherical to elongated outer cortical cells (5-9 µm long by 2-3 µm wide)

and 2-3 layers of rounded to stellate inner cortical cells (5-15 µm in diameter) with laxly

arranged medullary filaments (Figure 4.12c). Older blades are thickened, 400-600 µm in

thickness, consisting of subspherical to elongated outer cortical cells and rounded to

stellate inner cortex with densely arranged medullary filaments (Figure 4.12d). The

medulla is primarily composed of longitudinal filaments in young blades (Figure 4.12c)

and both anticlinal and intertwined filaments (Figure 4.12d) in older blades. Refractive

ganglionic cells are present in the medulla.

Spermatangial gametophytes and tetrasporophytes were not found and only female

gametophytes were examined. Cystocarps are scattered over fertile blades and deeply

embedded in the layer between the inner cortex and medulla. Mature carposporophytes

are spherical to pyriform, 85-100 µm in diameter. Carposporangia are spherical to ovoid,

8-10 µm in diameter (Figure 4.12e).

Univ

ersity

of M

alaya

81

Figure 4.12: Thallus habit and anatomy of Halymenia sp. A. (a) Cystocarpic thallus

(PSM12887). (b) Young cystocarpic thallus (PSM12888). (c) Cross-section through the

median part of a young blade showing cortex and laxly arranged medullary filaments.

(PSM12887). (d) Cross-section through the basal region of a blade showing thickened

cortex and densely arranged medullary filaments. (PSM12887) (e) Cross-section

through a mature cystocarp (PSM12887). [scale bars: a = 5 cm; b = 3 cm; c, d = 20 μm;

e = 30 μm]

Univers

ity of

Mala

ya

82

4.2 Molecular analyses

4.2.1 DNA extraction

The genomic DNA of species of Halymenia were extracted using the commercially

available i-genomic Plant DNA Extraction Mini Kit, (iNtRON Biotechnology Inc.,

South Korea) following the manufacturer’s protocol. A few minor modifications were

made by subjecting the mixture to sonication for 10 minutes before incubation,

extending the incubation time at 65°C and on ice. As measured by spectrophotometric,

the concentration of DNA extracted from herbarium was in the range of 10-25 ngμL-1

and the OD readings of A260/A280 were in the range of 1.40 to 1.80. While the

concentration of DNA extracted from silica gel-dried specimen was in the range of 30-

60 ngμL-1

and the OD readings of A260/A280 were in the range of 1.60 to 1.98. Only

good quality isolated DNA which have A260/A280 of 1.8 to 2.0 were subjected to PCR

amplification.

4.2.2 PCR amplification

The plastid rbcL, the mitochondrial COI-5P, the plastid UPA and the nuclear LSU

(28S rDNA) were subjected to PCR amplification. Most samples were successfully

producing amplicons over one PCR run. In contrast, a subsequent nested PCR was

performed to produce two smaller overlapping fragments of the rbcL and COI-5P,

which can thus be combined to form a contig representing the desired length of the

genetic marker.

Satisfactory amplifications of all genetic markers were attained with the optimum

annealing temperature of 50ºC. The amplicon sizes of the rbcL, COI-5P, UPA and LSU

(28S rDNA) were approximately 1400, 600, 400 and 600 base pairs (bp) respectively as

Univers

ity of

Mala

ya

83

shown in Figure 4.13 and Figure 4.14. Most of the species of Halymenia investigated in

this study were successfully producing amplicons for all genetic markers except H. cf.

dilatata which only the rbcL amplicon attained. The band of the highest intensity on the

gel mostly is the target band. In some cases, non-specific amplifications (more than one

band) were observed. This can be solved by identifying the desire band against the

ladder and subjected to gel purification the target band or adjusting the annealing

temperature for PCR amplification to get specific amplification.

Figure 4.13: Electrophoretogram showing amplicons of the plastid rbcL (~1,400bp)

and mitochondrial COI-5P (~600bp) genetic markers. Each number represents sample

as follow: 1= H. durvillei, 2= H. tondoana, 3= H. malaysiana, 4= H. maculata, 5= H.

johorensis, 6= Halymenia sp. A and 7= H. cf. dilatata. 1kb and –ve are 1 kilobase

DNA ladder and negative controls respectively.

Univers

ity of

Mala

ya

84

Figure 4.14: Electrophoretogram showing amplicons of the plastid UPA (~400bp) and

nuclear LSU (28S rDNA) (~600bp) genetic markers. Each number represents sample as

follow: 1= H. durvillei, 2= H. tondoana, 3= H. malaysiana, 4= H. maculata, 5= H.

johorensis and 6= Halymenia sp A. 1kb and –ve are 1 kilobase DNA ladder and

negative controls respectively.

4.2.3 Sequence analyses

4.2.3.1 rbcL

The rbcL gene for all samples was successfully amplified and sequenced. The length

of the rbcL sequences for Halymenia in this study ranged from 1250 to 1460 bp

depending on the primer sets used for sequencing. An unambiguous alignment was

generated since there is no insertion or deletion mutation in the rbcL sequences. The

length of the rbcL alignment used in this study was standardized and trimmed to 1250

bp.

There were no intraspecific divergences within samples of H. johorensis and

Halymenia sp. A respectively. The range of intraspecific rbcL sequence variation (Table

4.1) between H. durvillei populations, 0-2.56%, was considerably higher than other

Univers

ity of

Mala

ya

85

populations such as H. tondoana, 0.08-0.16%; H. maculata, 0.08-0.48%; H. malaysiana,

0-0.58%; H. johorensis, 0% and Halymenia sp. A, 0%. The interspecific pairwise

distance between these seven Halymenia species ranged from 1.22-1.46% between H.

maculata and H. cf. dilatata to 6.93-7.42% between H. maculata and H. malaysiana.

Halymenia tondoana and Halymenia sp. A were closely related as shown by their

genetic variation of 2.24-2.34%.

Table 4.1: Percentage of pairwise distance between rbcL sequences of seven

Halymenia species examined in this study, excluding gaps and ambiguities.

(1)

(2) (3) (4) (5) (6) (7)

(1) H. durvillei

0-2.56

(2) H. tondoana

5.04-6.00

0.08-0.16

(3) H. maculata

6.28-7.40 6.16-6.37 0.00-0.48

(4) H. malaysiana

5.48-6.70 6.66-7.11

6.93-7.42

0.00-0.58

(5) Halymenia sp. A

5.60-6.46 2.24-2.34 6.32-6.59

6.98-7.30 0.00

(6) H. johorensis

5.52-6.37

5.60-5.72 6.75-6.91 6.42-6.78 6.00 0.00

(7) H. cf. dilatata

6-7.03 5.89-5.93 1.22-1.46

6.45-6.77 6.13 6.45 -

4.2.3.2 COI-5P

The COI-5P region for all species of Halymenia examined in this study was

successfully amplified and sequenced except for H. cf. dilatata. The length of the COI-

5P sequences generated for Halymenia in this study ranged from 635 to 680 bp

depending on the primer sets used for sequencing. There was no alignment problem for

this dataset with no indels observed. The final alignment of the COI-5P sequences used

in this study was trimmed to 632 bp.

Univers

ity of

Mala

ya

86

There was no sequence variation between each sample of H. johorensis and

Halymenia sp. A respectively (Table 4.2). The range of intraspecific COI-5P genetic

variation between H. durvillei populations, 0-5.70 %, was remarkably higher than other

populations such as H. tondoana, 0.32%; H. maculata, 0.33%; H. malaysiana, 0-1.58%;

H. johorensis, 0% and Halymenia sp. A, 0%. H. tondoana was more closely related to

Halymenia sp. A with a divergence of 4.11-4.27%, while H. durvillei being most

divergent from H. maculata with a variation of 10.43-12.46%.

Table 4.2: Percentage of pairwise distance between COI-5P sequences of six

Halymenia species examined in this study, excluding gaps and ambiguities.

(1)

(2) (3) (4) (5) (6)

(1) H. durvillei

0.00-5.70

(2) H. tondoana

7.75-9.49 0.32

(3) H. maculata

10.43-12.46 10.22-10.91 0.33

(4) H. malaysiana

7.75-9.29 9.97-10.92 10.70-11.40 0.00-1.58

(5) Halymenia sp. A

7.21-8.54 4.11-4.27 10.54-11.07 9.81-10.13 0.00

(6) H. johorensis

6.49-8.07 7.91-8.07 9.27-9.59 7.44-8.07 8.07 0.00

4.2.3.3 UPA

The UPA region for all species of Halymenia examined in this study was

successfully amplified and sequenced with the primer pair p23SrV-f1/p23SrV-r1 except

for H. cf. dilatata. The length of the UPA sequences generated for the examined taxa

ranged from 410 to 420 bp. There was no alignment problem for this dataset since no

indels discovered. The final alignment of the UPA sequences generated in this study

was trimmed to 370 bp.

Univers

ity of

Mala

ya

87

The range of intraspecific UPA sequence divergence (Table 4.3) between H. durvillei

populations, 0-2.70%, was considerably higher than other populations such as H.

tondoana, 0%; H. maculata, 0.27-0.54%; H. malaysiana, 0.27-1.08%; H. johorensis, 0%

and Halymenia sp. A, 0%. The interspecific divergences between these six Halymenia

species ranged from 1.08% between H. tondoana and Halymenia sp. A to 4.59-5.14%

between H. maculata and H johorensis.

Table 4.3: Percentage of pairwise distance between UPA sequences of six Halymenia

species examined in this study, excluding gaps and ambiguities.

(1)

(2) (3) (4) (5) (6)

(1) H. durvillei

0.00-2.70

(2) H. tondoana

1.35-2.70 0.00

(3) H. maculata

2.70-4.59 3.24-3.78 0.27-0.54

(4) H. malaysiana

2.43-5.14 3.51-4.32 3.78-5.14 0.27-1.08

(5) Halymenia sp. A

1.35-2.70 1.08 3.24-3.78 3.51-4.32 0.00

(6) H. johorensis

2.97-3.78 3.24 4.59-5.14 3.78-4.59 3.24 0.00

4.2.3.4 LSU (28S rDNA)

The central portion of the LSU (28S rDNA) for all species of Halymenia examined

in this study was successfully amplified, sequenced with the primer pair

nu28SF/nu28SR except for H. cf. dilatata. The length of the LSU (28S rDNA)

sequences generated for the examined taxa ranged from 645 to 670 bp. The final

alignment of the LSU (28S rDNA) sequences generated in this study was limited to 643

sites, including a few introduced gaps.

Univers

ity of

Mala

ya

88

There were no intraspecific divergences within samples of each Halymenia species

except for H. durvillei with a variation of 0-0.16%. The interspecific divergences

between these six Halymenia species (Table 4.4) ranged from 0-0.16% between H.

tondoana and H. durvillei to 0.49-0.65% between H. durvillei and H. maculata.

Although there appeared to be no genetic distance between a few H. durvillei samples

(SGAD1405001, SGAD1209005, SGAD1012346, SGAD1211004 and SGAD1209204)

and also between these H. durvillei samples and H. tondoana, these entities actually

differed to each other by 2-3 bp indels which the gaps introduced were not taken into

consideration for the calculation of the sequence divergence.

Table 4.4: Percentage of pairwise distance between LSU (28S rDNA) sequences of

six Halymenia species examined in this study, excluding gaps and ambiguities.

(1) (2) (3) (4) (5) (6)

(1) H. durvillei

0.00-0.16

(2) H. tondoana

0.00-0.16 0.00

(3) H. maculata

0.49-0.65 0.49 0.00

(4) H. malaysiana

0.16 0.16 0.65 0.00

(5) Halymenia sp. A

0.16-0.32 0.16 0.64 0.32 0.00

(6) H. johorensis

0.32-0.49 0.32 0.81 0.49 0.49 0.00

4.2.4 Phylogenetic analyses

4.2.4.1 rbcL

A total of 128 taxa with 1250 bp in length were selected for rbcL phylogenetic

analyses. The identical sequences were collapsed to haplotypes. Two species of

Thamnoclonium Kützing (Halymeniaceae) were chosen as outgroups for this dataset.

Univers

ity of

Mala

ya

89

The topologies of rbcL phylogeny were inferred using both ML and BI phylogenetic

analyses and only the ML tree was presented (Figure 4.15).

The ML phylogenetic tree based on the rbcL sequences (Figure 4.15) showed that

the genera Halymenia, Gelinaria Sonder and Epiphloea J. Agardh formed an

assemblages with moderately bootstrap support (ML= 81%) but high posterior

probability (BI= 1.00). Seven species of Halymenia examined in this study were

distributed in three clades. Clade 1 composed mainly of branched Halymenia (H.

durvillei, H. harveyana, H. hawaiiana, H. tondoana, Halymenia sp. A, H. pinnatifida)

and a foliose Halymenia species (H. silviae) but their relationships were not supported

(ML<50%, BI<0.50). Halymenia durvillei was monophyletic and resolved with strong

bootstrap support (ML= 100%, BI= 1.00). There were three main subclades for H.

durvillei, dividing the specimens from (1) Malaysia, Indonesia, and the Philippines

(ML= 100%, BI= 1.00), (2) Sri Lanka, Indonesia, South Africa and Tanzania (ML=

100%, BI= 1.00) and (3) Japan, Malaysia, Indonesia and the Philippines (no support).

Halymenia tondoana formed a highly supported monophyletic clade (ML= 89%, BI=

1.00) which was also a sister to Halymenia sp. A (ML= 100%, BI= 1.00).

On the other hand, foliose Halymenia, two genera Gelinaria and Epiphloea were

resided in Clade 2 (ML= 51%, BI= 0.94). Halymenia malaysiana specimens were all

clustered together with strong support (ML= 96%, BI= 1.00) and occurred as a sister

group to H. dilatata from Japan with maximum support (ML= 100%, BI= 1.00).

Halymenia maculata formed a fully supported sister relationship (ML= 100%, BI= 1.00)

with H. cf. dilatata which itself was strongly supported (ML= 96%, BI= 1.00). Clade 3

consisted of H. johorensis which was sister to H. plana, this relationship was highly

supported (ML= 98%, BI= 1.00).

Univers

ity of

Mala

ya

90

Figure 4.15: ML phylogeny inferred based on the rbcL sequences. Numbers above each

branch indicate bootstrap percentage (BP) for ML and posterior probability (PP) for BI.

Branches without value indicate no support (BP <50% or PP < 0.50) or that internode

did not occur in the ML or BI tree. Specimens of this study are highlighted in bold.

Scale bar = 0.02 substitution per site. Asterisk (*) denoted H. malaysiana samples (S4,

S5, SGAD0712156, SGAD1007001, SGAD1205198, SGAD1205185, SGAD1205213,

J1, J2, J3, J4, J5, J6, J7, J9, J10, J12, J13, J14, J16, J20, J22, J24, J25, J26, J30, J31,

J33)

Univers

ity of

Mala

ya

91

4.2.4.2 COI-5P

The COI-5P sequence alignment for phylogenetic reconstruction included 99

sequences which the identical sequences were collapsed to haplotypes with a total

length of 632 bp. Grateloupia elliptica and Prionitis filiformis were selected as

outgroups for phylogenetic analyses.

The phylogenetic tree in Figure 4.16 showed that the species of Halymenia formed a

monophyletic assemblage with full support (ML= 100%, BI= 1.00). Six species of

Halymenia examined in this study were distributed in three clades. Clade 1 was

unsupported (ML<50%, BI= 0.55) and comprised of H. malaysiana, H. maculata, H.

johorensis and H. californica. Halymenia malaysiana and H. maculata were each

resolved with maximum support (ML= 100%, BI= 1.00). Halymenia maculata was also

resolved as a sister to H. johorensis, albeit with a long terminal branching and without

any support.

The monophyly of Clade 2, which composed solely of H. durvillei, was not

supported (ML<50%, BI= 0.60). Two major unsupported subclades were observed

within H. durvillei clade. In Clade 3, the monotypic H. tondoana was highly supported

(ML= 92%, BI= 0.99) and grouped with its sister taxon, Halymenia sp. A with high

support (ML= 88%, BI= 1.00).

Univers

ity of

Mala

ya

92

Figure 4.16: ML phylogeny inferred based on the COI-5P sequences. Numbers above

each branch indicate bootstrap percentage (BP) for ML and posterior probability (PP)

for BI. Branches without value indicate no support (BP <50% or PP < 0.50) or that

internode did not occur in the ML or BI tree. Specimens of this study are highlighted in

bold. Scale bar = 0.04 substitution per site. Asterisk (*) denoted H. malaysiana samples

(SGAD1007001, S4, S5, SGAD1205198, SGAD1205185, SGAD1205213, J1, J2, J3,

J4, J5, J6, J7, J9, J10, J12, J13, J14, J16, J20, J22, J24, J25, J26, J30, J31, J33)

Univers

ity of

Mala

ya

93

4.2.4.3 UPA

The UPA dataset involved 67 sequences of 370 bp in length. The identical sequences

were reduced to haplotypes. Two species of Grateloupia were chosen as outgroups for

phylogenetic analyses.

The phylogenetic tree depicted as Figure 4.17 showed that the species of Halymenia

formed a monophyletic cluster with maximum support (ML= 100%, BI= 1.00). Six

species of Halymenia were resolved in two main clades except for H. johorensis.

Halymenia johorensis was on its own and inferred as a basal to the rest of Halymenia

species including in this study.

In Clade 1, two major unsupported subclades were observed. The first subclade was

resolved as a polytomy, consisting of H. durvillei, H. formosa, H. cearensis and H.

pseudofloresii. Meanwhile, the second subclade was also a polytomy, where Halymenia

sp. A grouped with its sister taxon, H. silviae and formed an unsupported relationship

with H. pinnatifida and H. tondoana. In Clade 2, a polytomy of three lineages was

obtained. The first lineage was made up of H. malaysiana specimens, resolved with full

support (ML= 100%, BI= 1.00). Meanwhile, the second lineage comprised of H.

maculata specimens that was resolved with maximum support (ML= 100%, BI= 1.00)

and the third lineage, H. stipitata from Hawaii.

Univers

ity of

Mala

ya

94

Figure 4.17: ML phylogeny inferred based on the UPA sequences. Numbers above

each branch indicate bootstrap percentage (BP) for ML and posterior probability (PP)

for BI. Branches without value indicate no support (BP <50% or PP < 0.50) or that

internode did not occur in the ML or BI tree. Specimens of this study are highlighted in

bold. Scale bar = 0.008 substitution per site.

Univers

ity of

Mala

ya

95

4.2.4.4 LSU (28S rDNA)

The phylogenetic matrix for partial LSU (28S rDNA) involved 29 taxa with 643 sites,

including a few introduced gaps. The identical sequences were collapsed to haplotypes.

Grateloupia lanceolata and Grateloupia turuturu were used as outgroups for this

dataset.

As shown in the ML phylogeny (Figure 4.18), the genus Halymenia was resolved as

monophyletic with maximum support (ML= 100%, BI= 1.00). However, the

phylogenetic relationship within species of Halymenia was unresolved. Both partial

LSU (28S rDNA) sequences of H. tondoana from the Philippines were identical to the

H. formosa GenBank sequences (HQ422446). A few H. durvillei samples formed a

subclade with weak support (ML= 58%, BI<0.50). H. durvillei, H. malaysiana, H.

formosa, H. pseudofloresii, H. tondoana and Halymenia sp. A formed an unsupported

assemblages and were sister to a clade comprised of H. plana, H. maculata and H.

johorensis (ML= 80%, BI= 0.66). Halymenia maculata from Malaysia were not

grouped with H. maculata from Australia.

Univers

ity of

Mala

ya

96

Figure 4.18: ML phylogeny inferred based on the partial LSU (28S rDNA) sequences.

Numbers above each branch indicate bootstrap percentage (BP) for ML and posterior

probability (PP) for BI. Branches without value indicate no support (BP <50% or PP <

0.50) or that internode did not occur in the ML or BI tree. Specimens of this study are

highlighted in bold. Scale bar = 0.006 substitution per site.

Univers

ity of

Mala

ya

97

4.2.5 Intraspecific genetic diversity of Halymenia malaysiana

The usefulness of the rbcL and the COI-5P as potential markers to infer intraspecific

genetic variation of the Halymenia malaysiana from Southeast Asia were assessed. 42

specimens of H. malaysiana were collected from five localities in Malaysia: Pulau

Merambong (Johor), Pulau Tinggi (Johor), Pulau Karindingan (Sabah), Tun Mustapha

Park (Sabah) and Pulau Besar (Malacca); four localities in the Philippines: Siargao

Island, Grande Island, Subic Bay and Busuanga Island; and one locality in Indonesia:

Gam Island.

4.2.5.1 Haplotype network analysis of Halymenia malaysiana for rbcL marker

A total of 42 specimens with 1241 characters of the rbcL gene were employed for

haplotype analysis. Eight rbcL haplotypes were recognized in H. malaysiana (Figure

4.19) with nucleotide divergences 0-0.50% (0-7 bp). Three haplotypes were observed in

Tun Mustapha Park, two haplotypes were observed in Gam Island and Busuanga Island

while only one haplotype was found in other seven localities. Haplotype R1 was the

most frequent, detected in 27 of the 42 individuals of H. malaysiana sequenced. All H.

malaysiana populations in Peninsular Malaysia (Pulau Besar, Pulau Tinggi and Pulau

Merambong) were represented by haplotype R1, whereas three haplotypes represented

the populations in East Malaysia where haplotypes R1, R2 and R5 were identified from

Tun Mustapha Park (TMP) and one haplotype R5 from Pulau Karindingan (Figure 4.8).

Haplotypes R2, R3 and R4 were each exclusive to the population in Tun Mustapha Park,

Siargao Island and Gam Island. Haplotype R2 differed from haplotypes R1 and R4 by

two nucleotides each but only one nucleotide differences from R3. Halymenia

malaysiana populations in the Philippines were characterized by haplotypes R3, R6, R7

and R8. Haplotype R6 was comprised of samples from Grande Island and Subic Bay

Univers

ity of

Mala

ya

98

while two haplotypes (R7 and R8) were detected from Busuanga Island. Samples from

Gam Island, Indonesia were made up of haplotype R1 and R4. Haplotype R5 connected

to haplotype R1 by three nucleotides, R6 and R7 each by one nucleotide, and R8 by two

nucleotides.

Figure 4.19: Statistical parsimony network for rbcL haplotypes of Halymenia

malaysiana. Each circle represents a rbcL haplotype. The size of circles corresponds to

the haplotype frequency. Each line between haplotypes, bars and/ or branch points

indicates one mutation step. Missing haplotype indicated by small crosses. Haplotypes

shaded according to the geographic origin.

Univers

ity of

Mala

ya

99

Table 4.5: A summary of the rbcL haplotype diversity of Halymenia malaysiana with

number of individuals (N) and number of haplotypes (Nh) from each location.

Populations N Nh Haplotype

Peninsular Malaysia

Pulau Merambong 23 1 R1

Pulau Tinggi 3 1 R1

Pulau Besar 1 1 R1

East Malaysia

Tun Mustapha Park 3 3 R1, R2, R5

Pulau Karindingan 1 1 R5

Philippines

Siargao Island 2 1 R3

Subic Bay 1 1 R6

Grande Island 1 1 R6

Busuanga Island 5 2 R7,R8

Indonesia

Gam Island 2 2 R1, R4

Total 42 8 R1-R8

4.2.5.2 Haplotype network analysis of Halymenia malaysiana for COI-5P marker

A total of 41 specimens with 610 characters of the COI-5P region were employed for

haplotype analysis. Nine COI-5P haplotypes were recognized in H. malaysiana (Figure

4.20) with nucleotide divergences of 0-1.64% (0-10 bp). Three haplotypes were

observed in Tun Mustapha Park, two haplotypes were observed in Siargao Island and

only one haplotype was found in other eight localities. Haplotype C1 was the most

frequent (27/41 individuals), found in the populations in Peninsular Malaysia (Pulau

Merambong, Pulau Tinggi and Pulau Besar). On the other hand, populations in East

Malaysia were represented by four haplotypes where three haplotypes (C2, C4 and C7)

were identified from Tun Mustapha Park (TMP) and one haplotype C6 exclusive to

Pulau Karindingan. Haplotype C4 connected to haplotypes C2 and C3 by three

nucleotides, C1 and C6 each by two nucleotides, and C5 by one nucleotide. The sample

from Gam Island, Indonesia corresponded to haplotype C7. Halymenia malaysiana

Univers

ity of

Mala

ya

100

populations in the Philippines were characterized by haplotypes C3, C5, C8 and C9.

Haplotype C5 was exclusive to the populations in Busuanga Island while haplotype C3

was identified from Grande Island and Subic Bay. Haplotype C8 differed from

haplotype C9 by four nucleotides, both were exclusive to Siargao Island.

Figure 4.20: Statistical parsimony network for COI-5P haplotypes of Halymenia

malaysiana. Each circle represents a COI-5P haplotype. The size of circles corresponds

to the haplotype frequency. Each line between haplotypes, bars and/ or branch points

indicates one mutation step. Missing haplotype indicated by small crosses. Haplotypes

shaded according to the geographic origin.

Univers

ity of

Mala

ya

101

Table 4.6: A summary of the COI-5P haplotype diversity of Halymenia malaysiana

with number of individuals (N) and number of haplotypes (Nh) from each location.

Populations N Nh Haplotype

Peninsular Malaysia

Pulau Merambong 23 1 C1

Pulau Tinggi 3 1 C1

Pulau Besar 1 1 C1

East Malaysia

Tun Mustapha Park 3 3 C2, C4, C7

Pulau Karindingan 1 1 C6

Philippines

Subic Bay 1 1 C3

Grande Island 1 1 C3

Busuanga Island 5 1 C5

Siargao Island 2 2 C8, C9

Indonesia

South Gam 1 1 C7

Total 41 9 C1-C9

Univers

ity of

Mala

ya

102

CHAPTER 5: DISCUSSION

5.1 Morphological and anatomical studies

Generic concepts of Halymenia are based largely on the structure of auxiliary cell

ampullae (Chiang, 1970) and the presence of anticlinal medullary filaments (Abbott,

1967). Chiang (1970) proposed five types of auxiliary cell ampullae structure in order to

define the genera of the Halymeniaceae. Among the five types of auxiliary cell

ampullae, Halymenia-type auxiliary cell ampulla is flattish, expanded when mature and

generally regarded as having a primary ampullar filament bearing several branched

secondary filaments (Chiang, 1970). However, the development of the auxiliary cell

ampullae in many species of Halymenia is poorly known and calls for further study. In

addition, it is practically difficult to interpret the degree of branching of the auxiliary

ampullary structure and the extent of development of the pericarpial filaments (Maggs

and Guiry, 1982). According to Guimarães and Fujii (1998), the auxiliary cell ampullae

of the Brazilian species do not always conform with the scheme proposed by Chiang

(1970) for the genus. For instance, intermediate forms between the Halymenia-type and

Cryptonemia-type have been found by different authors (e.g. H. assymetrica Gargiulo,

de Masi & Tripodi by Gargiulo et al., 1986; H. maculata J. Agardh by Kawaguchi et al.,

2002). Moreover, collection of fertile specimens is often by chance, not all reproductive

stages were found in the collections. Some of the reproductive stages such as

carpogonial branches are rarely seen and difficult to interpret. Therefore, we agreed that

vegetative features should be emphasized rather than reproductive characters in genus-

level taxonomy (Kylin, 1956; Guiry and Irvine, 1974; Kraft, 1977).

Univers

ity of

Mala

ya

103

Presence of anticlinal filament is the most reliable taxonomic character of Halymenia

although it is not exclusive to Halymenia and can be found in other genera such as

Cryptonemia and Kallymenia (Abbott, 1967; Guimarães and Fujii, 1998). The presence

of stellate cells in the inner cortex and refractive ganglionic cells in the medulla are also

useful characteristic in recognition of Halymenia (Womersley and Lewis, 1994; De

Smedt et al., 2001; Guimarães and Fujii, 1998). However, stellate cells and refractive

ganglionic cells also present in the genera Weeksia and Kallymenia which are placed

under order Gigartinales (Abbott, 1967). Thus, a combination of features such as

presence of anticlinal filaments and refractive ganglionic cells in the medulla, stellate

cells in the inner cortex is important in the characterization of Halymenia.

The species identification of Halymenia is difficult due to its immense morphological

plasticity and few distinctive morphological features. Additionally, comparative studies

of Halymenia species are disconcerted by variations in features used for species

delimitation and insufficient information of taxonomically accepted species. A number

of morphological and anatomical features have been used as taxonomic characters for

species delineation of Halymenia but not all of them are equally reliable as diagnostic

characters. For instance, colour is not a good character for species identification of

Halymenia since the thalli colour become darker when dried and differentiated from the

colour observed in the field. We agree with Guimarães and Fujii (1998) who stated that

the degree of cystocarp protrusion, colour, the diameter and the number of medullary

filaments are highly variable features, and thus not useful in delineating Halymenia

species.

Our result agreed with previous studies that vegetative features are more diagnostic

than reproductive characters for species discrimination within Halymenia (Abbott, 1967;

Guimarães and Fujii, 1998; Hernández-Kantún et al., 2012). The present study showed

Univers

ity of

Mala

ya

104

that the combination of the following vegetative features is crucial for species

delineation in Halymenia: habit, thallus size, blade margins, order of branching,

branching pattern, presence or absence of a stipe, presence or absence of marginal

proliferations, presence or absence of surface proliferations or spines, blade thickness,

cortex thickness, shape of inner cortical cells, inner cortical cells size, and presence or

absence of refractive ganglionic cells. These vegetative features have been recognized

as taxonomically informative characters for species discrimination of Halymenia by

prior studies (Gargiulo et al., 1986; Guimarães and Fujii, 1998; De Smedt et al., 2001;

Ballantine and Ruiz, 2004; Hernández-Kantún et al., 2012; Tan et al., 2015; Azevedo et

al., 2016a; 2016b; Tan et al., 2017). The result of present study also suggested that the

size and shape of outer cortical cells may serve as taxonomic characters for

differentiating a few Halymenia species.

5.1.1 Morphological and anatomical distinction among Halymenia species

The specimens examined in this study were clearly assignable to the genus

Halymenia since these taxa agreed well with anatomical characters circumscribed for

Halymenia, including the presence of stellate cells in the inner cortex, anticlinal

filaments and refractive ganglionic cells in the medulla, and a medulla lax in young

parts and becoming denser in older parts (Balakrishnan, 1961; Abbott, 1967;

Womersley and Lewis, 1994).

Morphological evidence corroborated with our molecular findings in which seven

distinct species of Halymenia were present in our collections. Among the seven

Halymenia, four were previously described (H. durvillei, H. tondoana, H. cf. dilatata, H.

maculata), two were new species described from the current study (H. malaysiana, H.

johorensis) and one putative new species to be described (Halymenia sp. A). The

Univers

ity of

Mala

ya

105

highest number of Halymenia being examined is Halymenia malaysiana with 33

specimens, H. durvillei (32), H. johorensis (9), H. maculata (6), H. tondoana (3), H. cf.

dilatata (1), and the unidentified Halymenia sp. A (2). A few minor morphological

variations were observed between H. durvillei specimens. For instance, secondary axes

are arising as proliferations on the surface of the primary axes in some specimens and

surface spines present in some specimens but absent in other specimens. These

morphological variations were also reported by previous studies (De Smedt et al., 2001;

Hernández-Kantún et al., 2012). These results may suggest that H. durvillei consists of a

few cryptic species. Although molecular results in present study have supported the

existence of at least three species in H. durvillei complex, detailed data on morphology

and distribution were not yet available (Figures 4.10-4.11). Further examination of more

samples from different geographical regions and type specimen based on both

morphological and molecular analyses is needed to verify this finding. The

morphological and anatomical features of a fertile specimen collected from the

Phillippines conformed to the descriptions of H. dilatata in the literature (Hernández-

Kantún et al., 2012). However, its identity cannot be ensured since a detailed

examination on H. dilatata was not possible as the type specimen was unavailable for

the present study. Therefore, it was indicated here as H. cf. dilatata.

Tetrasporophytes and female gametophytes were found in all species examined in

this study except H. cf. dilatata and Halymenia sp. A in which only female

gametophytes were observed. Spermatangial gametophytes were not found and thus

remain to be described. Collection of fertile specimens is often by chance, thus not all

reproductive stages were found in collection. The developmental stages of the

carposporophyte were studied in detail in H. johorensis but not found in other species

examined in this study. The carpogonial branches, auxiliary cell ampullae and cystocarp

Univers

ity of

Mala

ya

106

development in many species of Halymenia are still poorly known and calls for further

study.

Among the seven Halymenia species studied in this study, three were branched

Halymenia (H. durvillei, H. tondoana, Halymenia sp. A) and four were foliose

Halymenia (H. cf. dilatata, H. maculata, H. malaysiana and H. johorensis). The

identification of branched and foliose Halymenia is fairly easy since they can

differentiated by observing their gross morphology. Thalli of branched Halymenia

branched up to several orders with different branching pattern and with abundant

marginal branchlets while thalli of foliose Halymenia are arising from a small discoid

holdfast with or without a stipe, abruptly expanding into broad blades. Branched

Halymenia in this study can be distinguished from one another based on five main

criteria, namely branching pattern, order of branching, cortex thickness, shape of inner

cortical cells and presence or absence of surface proliferations or spines. On the other

hand, foliose-type Halymenia are differentiated based on blade shape, blade margins,

presence or absence of surface proliferations or spines, cortex thickness, size and shape

of outer cortical cells and presence or absence of a stipe. All species of Halymenia in

this study can also be differentiated with following criteria: habit, thallus size, presence

or absence of marginal proliferations, blade thickness, size and shape of outer cortical

cells, size and shape of inner cortical cells, and presence or absence of refractive

ganglionic cells. Comparison of morphological and anatomical characters among

closely related branched and foliose Halymenia species in this study were summarized

in Table 5.1 and Table 5.2.

Morphological observations and molecular data both confirmed the presence of two

new species recognized from this study (H. malaysiana, H. johorensis) and one putative

new species, namely Halymenia sp. A. H. malaysiana, can be distinguished from other

Univers

ity of

Mala

ya

10

7

Table 5.1: Comparison of morphological and anatomical characters among closely related foliose Halymenia species in this study.

Characters H. malaysiana H. dilatata H. maculata H. porphyraeformis H. plana H. johorensis

Thallus size 6–25 cm high by 9–

33 cm wide

Up to 80 cm long and

50 cm wide

Up to 21 cm long and

38 cm wide

Up to 80 cm long, 50 cm

wide

10–30 cm high by 2–10

cm wide

22–40 cm high by 10–30

cm wide

Blade shape Oblong or

suborbicular

Irregular in outline Circular to irregularly

lobed

Irregularly circular to

elliptical

Irregularly divided into

broad lobed

Elliptical, oblong or

irregularly shaped

Blade margins Sinusoidal undulated,

sometimes minutely

dentate or deeply

cleft

Smooth or minutely

dentate

Irregularly to regularly

lobed (like jig-saw

pieces) or denticulate

Sinusoidal undulated Smooth to slightly

irregular

Irregularly dentate, cleft,

sometimes smooth

Blade surface Smooth, rarely with

orbicular

proliferations

Smooth, with small

orbicular proliferations

Rough, mottled, often

with proliferations,

spines or small

bladelets

Smooth, rarely with

orbicular proliferation

Smooth, mottled with

darker red, irregularly

shaped patches

Smooth or rugose with

perforations and

proliferations

Stipe Absent Present Present Present Present Present

Blade thickness 150–700 µm 285–400 µm 270–450 µm 65–410 µm 250–600 µm 120–400 µm

Cortex layers 6–7 layers 4–7 layers 5–7 layers 4–6 layers 3–6 layers 2–6 layers

Cortex thickness 20–70 µm

35–50 µm 50–100 µm 15–85 µm ND 15–45 µm

Shape of outer

cortical cells

Elongated Subspherical Elongated Subspherical to

elongated

Isodiametric Isodiametric

Outer cortical

cells size

8–13 µm long, 5–8

µm wide

6.5–11 µm long 7.5–35 µm long 6–10.5 µm across 3–7 µm across 3–6 µm long, 2–4 µm

wbide

Univers

ity of

Mala

ya

10

8

Table 5.1, continued

Characters H. malaysiana H. dilatata H. maculata H. porphyraeformis H. plana H. johorensis

Shape of inner

cortical cells

Rounded to

ellipsoidal

Irregularly stellate and

somewhat tangentially

flattened

Rounded to stellate Irregularly stellate Mostly not stellate Rounded to stellate

Inner cortical

cells size

5–13 µm in diameter 9.5–15 µm in diameter 11–33 µm in diameter 9.5–17.5 µm in diameter 15–22 µm across 4–12 µm in diameter

Refractive

ganglionic cells

(numbers of arm)

Present (4–6 arms) Common but not

abundant (mostly with

6 arms)

Present (5–9 arms) Present (5–8 arms) Prominent (ND) Few but present (3–5

arms)

References Tan et al., 2015; this

study

De Smedt et al., 2001 De Smedt et al. , 2001 De Smedt et al., 2001 Womersley and Lewis,

1994

Tan et al., 2017; this study

ND indicated non-available data

Univers

ity of

Mala

ya

10

9

Table 5.2: Comparison of morphological and anatomical characters among closely related branched Halymenia species in this study.

Characters H. durvillei H. tondoana H. hawaiiana Halymenia sp. A

Thallus size Up to 42 cm high Up to 22 cm high by 1.6–7cm

wide

10–30 cm high 16–26.5 cm long by 11–41 cm

wide

Branching pattern Subdichotomously,

trichotomously or irregularly

branched

Resembling dichotomous

bifurcations

Irregularly branched Irregularly branched, branches

and branchlets abruptly

constricted at bases

Order of branching Up to 7 Up to 7 Up to 3 Up to 4

Blade margins Rarely smooth, generally

dentate or laciniate

Lacerate, with proliferations Dentate and lacerate (not

laciniate)

Smooth with proliferations

Blade surface Smooth in young plants,

covered with spiny

proliferations in older thalli

Smooth with spots as granules

or macula but rare spiny

proliferations

Smooth with abundant spines

and macula

Smooth without spines

Stipe Present Present Present Present

Blade thickness 370–1625 µm 300–700 µm 250–800 µm 130–600 µm

Cortex layers 4–8 layers 4–5 layers 3–7 layers 4–6 layers

Cortex thickness 50–150 µm 25–60 µm 40–90 µm 25–65 µm

Shape of outer

cortical cells

Subspherical to elongated Elongated Elongated Subspherical to elongated

Univers

ity of

Mala

ya

11

0

Table 5.2, continued

Characters H. durvillei H. tondoana H. hawaiiana Halymenia sp. A

Outer cortical cells

size

8–19 µm long 5–7.5 µm long, 2.5–5 µm wide 5–15 µm long, 5–7.5 µm wide 5–9 µm long, 2–3 µm wide

Shape of inner

cortical cells

Rounded to stellate or

elongated parallel

Spherical Elongated parallel Rounded to stellate

Inner cortical cells

size

11–50 µm in diameter 7.5–20 µm in diameter 15–37.5 µm in diameter 5–15 µm in diameter

Refractive

ganglionic cells

(numbers of arm)

Abundant (6–9 arms) Common (5–6 arms) Common (4–5 arms) Present (-)

References De Smedt et al., 2001;

Kawaguchi et al., 2006

Hernández-Kantún et al., 2012 Hernández-Kantún et al., 2012 This study

Univers

ity of

Mala

ya

111

similar foliose Halymenia species in Southeast Asia, such as H. dilatata, H. maculata,

H. porphyraeformis and H. johorensis, by a combination of morphological and

anatomical characters (see Table 5.1). Morphologically, H. malaysiana resembles H.

dilatata and H. porphyraeformis, which display a smooth thallus surface and rarely

possess orbicular proliferations. However, H. malaysiana can be separated from H.

porphyraeformis and H. dilatata by its relatively small size (6-25 cm high by 9-33 cm

wide; H. dilatata and H. porphyraeformis: up to 80 cm long and 50 cm wide), relatively

thicker thallus (150-700 μm; H. dilatata: 285-400 µm; H. porphyraeformis: 65-410 µm),

oblong or suborbicular blade, and the lack of a stipe. Although H. malaysiana is similar

to H. maculata in terms of thallus size, the latter can be distinguished from the former

by having circular to irregularly lobed blades with jigsaw-like margin, rough mottled

surface with proliferations, spines or small bladelets, relatively thinner thallus but

thicker cortex (H. maculata: thallus 270-450 μm, cortex 50-100 µm; H. malaysiana:

thallus 150-700 μm, cortex 20-70 µm), longer elongated outer cortical cells (H.

maculata: 7.5-35 µm long; H. malaysiana: 8-13 µm long) and the presence of a firm

stipe. Halymenia johorensis is similar to H. malaysiana in thallus size (in regard to

blade width) and size of inner cortical cells, however these lineages differ by (1)

relatively thicker thallus in H. malaysiana (150-700 µm) than in H. johorensis (120-400

µm), (2) relatively thicker cortex in H. malaysiana (20-70 µm) than in H. johorensis

(15-45 µm), (3) elongated outer cortical cells in H. malaysiana (8-13 µm long, 5-8 µm

wide) in comparison to isodiametric outer cortical cells in H. johorensis (3-6 µm long,

2-4 µm wide) and (4) stipe absent in H. malaysiana but present in H. johorensis.

Halymenia malaysiana lacks a stipe, which is prominent in all other foliose Halymenia

species, including H. porphyraeformis, H. maculata, H. dilatata and H. johorensis.

Halymenia porphyraeformis has an unbranched stipe and H. maculata has a firm stipe

(De Smedt et al., 2001), H. johorensis has a narrow-cuneate stipe (Tan et al., 2017)

Univers

ity of

Mala

ya

112

while H. dilatata is characterized by the presence of a short but thick stipe (Zanardini,

1851; Zanardini, 1858). De Smedt et al. (2001) proposed the use of the stipe anatomy in

the genus Halymenia and suggested it might be a useful character in species

discrimination.

On the other hand, H. johorensis is similar to H. plana in having narrow-cuneate

stipe and one to two layers of isodiametric outer cortical cells. However, H. johorensis

can be differentiated from H. plana in having a relatively larger but thinner thallus (H.

johorensis: 22-40 cm high by 10-30 cm wide, 120-400 µm thick; H. plana: 10-30 cm

high by 2-10 cm wide, 250-600 µm thick), irregularly dentate and cleft margins, and

smaller inner cortical cells (H. johorensis: 4-12 µm in diameter; H. plana: 15-22 µm in

diameter). Furthermore, the blades of H. plana are irregularly divided into broad lobes

with surfaces mottled with dark red irregularly shaped patches. In contrast, the blades of

H. johorensis are elliptical, oblong or irregularly shaped with perforations and

proliferations. In addition, inner cortical cells of H. plana are mostly not stellate and the

species has prominent refractive ganglionic cells (Womersley and Lewis 1994: Figure

57B); whereas, H. johorensis has rounded to stellate inner cortical cells and few

refractive ganglionic cells.

Although H. johorensis resembles H. dilatata and H. porphyraeformis, it is

distinguished from the two by its relatively smaller thallus (H. johorensis: 22-40 cm

high by 10-30 cm wide; H. dilatata and H. porphyraeformis: up to 80 cm long and 50

cm wide), perforated blade, smaller isodiametric outer cortical cells (H. johorensis: 3-6

µm long; H. dilatata: 6.5-11 µm long, H. porphyraeformis: 6–10.5 µm long) and

smaller rounded to stellate inner cortical cells (H. johorensis: 4-12 µm in diameter; H.

dilatata: 9-15 µm in diameter; H. porphyraeformis: 9.5–17.5 µm in diameter).

Halymenia porphyraeformis is also differed from H. johorensis in displaying sinusoidal

Univers

ity of

Mala

ya

113

undulated margins and a thicker cortex (15–85 µm; 15–45 µm in H. johorensis).

Another foliose species, H. maculata, is readily distinguished from H. johorensis by its

circular to irregularly lobed margins, rough surface with proliferations, spines or small

bladelets, thicker cortex (50-100 µm; 15-45 µm in H. johorensis), longer elongated

outer cortical cells (7.5-35 µm; 3-6 µm in H. johorensis), and larger inner cortical cells

(11-33 µm in diameter; H. johorensis: 4-12 µm in diameter) despite their similarity in

terms of blade thickness and inner cortical cell shape.

Halymenia sp. A is similar to H. durvillei in having elongated outer cortical cells and

rounded to stellate inner cortical cells (see Table 5.2), however both lineages can be

differentiated by examining branching pattern and order of branching. Halymenia sp. A

irregularly branched up to 4 orders in which its branch and branchlets abruptly

constricted at bases; whereas, H. durvillei subdichotomously, trichotomously or

irregularly branched up to 7 orders in which its branch and branchlets with no

constricted at bases. Both lineages also differ by (1) relatively thinner thallus in

Halymenia sp. A (130-600 µm) than in H. durvillei (370-1625 µm), relatively thinner

cortex in Halymenia sp. A (25-65 µm) than in H. durvillei (50-150 µm), smaller outer

cortical cells in Halymenia sp. A (5-9 µm long) than in H. durvillei (8-19 µm long) and

relatively smaller inner cortical cells in Halymenia sp. A (5-15 µm in diameter) than in

H. durvillei (11-50 µm in diameter).

Although Halymenia sp. A resembles H. tondoana and H. hawaiiana, it is

distinguished from the two by its branching pattern and order of branching (Halymenia

sp. A: irregularly branched up to 4 orders in which its branch and branchlets abruptly

constricted at bases; H. tondoana: branching resembling dichotomous bifurcations and

branched up to 7 orders; H. hawaiiana: irregularly branched up to 3 orders).

Furtherrmore, Halymenia sp. A and H. hawaiiana differ by (1) spine absent on blade

Univers

ity of

Mala

ya

114

surface of Halymenia sp. A but present and abundant in H. hawaiiana, (2) relatively

thinner cortex in Halymenia sp. A (25-65 µm) than in H. hawaiiana (40-90 µm), (3)

smaller outer cortical cells in Halymenia sp. A (5-9 µm long, 2-3 µm wide) than H.

hawaiiana (5-15 µm long, 5-7.5 µm wide) and (4) smaller rounded to stellate inner

cortical cells in Halymenia sp. A (5-15 µm in diameter) in comparison to elongated

parallel inner cortical cells in H. hawaiiana (15-37.5 µm in diameter).

Despite above studies on Halymenia species, we believe that the diversity of

Halymenia species in Southeast Asia has not been fully explored. Additional sampling

from different localities, especially in the Coral Triangle which is well known as the

most biodiverse marine habitat, with detailed morphological and molecular

investigation is required to study the species richness of Halymenia in this region.

5.2 Molecular analyses

5.2.1 DNA extraction

Good quality DNA is indispensable for PCR amplification to gain reproducible

results. The choice of starting material used for DNA extraction is crucial in order to

obtain a good quality DNA. Silica gel-dried specimens are preferable starting material

for DNA extraction compared to herbarium specimens. Staats et al. (2011) reported that

DNA retrieval from aged herbarium specimens may be hindered due to natural DNA

degradation over time. Our studies concurred with the findings of Saunders (1993) that

dried specimens of red algae produced greater results for molecular analyses.

The amount of starting material used for DNA isolation is also one of the important

criteria in getting high quality DNA. Halymenia is rich in carrageenan (Freile-Pelegrin

et al., 2011; Kho et al., 2016). Isolation of DNA from Halymenia species is difficult due

Univers

ity of

Mala

ya

115

to the carrageenan gelation. In order to decrease the amount of gel formation during

isolation, only little starting material was used. In addition, constant vortexing during

incubation interval at 65˚C will promote homogenization and decrease gel formation.

Furthermore, longer durations for incubation on ice will reduce the co-isolation of

polysaccharides (Hu et al., 2004). In this study, the extraction of DNA using

commercially available kit proved beneficial since only small amount of starting

material was needed to gain high quality DNA.

5.2.2 PCR amplification

Based on the result of present study, the concentration of DNA isolated from

herbarium specimen was lower than the DNA isolated from silica gel-dried specimen.

Therefore, higher volume of DNA template from herbarium specimen was needed in

each PCR reaction. Most samples were successfully producing amplicons over one PCR

run. In contrast, a subsequent nested PCR was performed using primers with binding

sites internal to the primers used for the first PCR run to produce two smaller

overlapping fragments. This method worked well for the amplification of rbcL and

COI-5P sequences with extreme low concentration of DNA extracts. According to

Ekman (1999), nested PCR increased the yield and specificity of the amplification of

target DNA albeit time-consuming.

Present study preliminary test has found that COI-5P primers developed specifically

for red algae in Saunders (2005) did not work for specimens of Halymenia. This was

supported by Saunders (2008) which mentioned that red algal primers (Saunders, 2005)

scarcely work in some groups, for instance Halymeniales. In order to solve poor

amplification using abovementioned red algal primers and overcome contamination

problems, a lot of primer pairs were designed, tested and different combination of

Univers

ity of

Mala

ya

116

primers were used for DNA barcoding studies of different red algal species (e.g. Dilsea-

Neodilsea complex and Weeksia by Saunders, 2008; Gracilaria by Saunders, 2009;

Euthora by Clarkston and Saunders, 2010). The lack of universal amplification primers

is the major drawback of COI-5P (Clarkston and Saunders, 2010). In this study, two

degenerated primers (COI1F and COI1R) were designed based on the sequences

available in GenBank. The results showed that COI-5P sequences were easily amplified

and sequenced for most of the samples examined in this study using our newly designed

COI-5P primers. Both newly designed primers were also useful in sequencing COI-5P

sequences of red algal species in Halymeniaceae such as Cryptonemia and Grateloupia

(results not shown). Likewise, other COI-5P primers listed in Table 3.2 worked well for

Halymenia too.

5.2.3 Sequence analyses and molecular phylogenies

Both phylogenetic analyses ML and BI resulted in trees with near identical topology

for all well-supported nodes for the four genetic markers. Therefore, only ML trees

were presented (Figures 4.15-4.18). The rbcL phylogeny (Figure 4.15) agreed with

previous studies that demonstrated the polyphyly of Halymenia (Hernández-Kantún et

al., 2012; Tan et al., 2015; Azevedo et al., 2016a; 2016b; Tan et al., 2017), however a

taxonomic reassessment of the genera Gelinaria and Epiphloea is deferred until more

authentic materials are available for analysis. The rbcL results also indicated the

presence of seven distinct species of Halymenia in our collections. Among the seven

Halymenia, four were previously described (H. durvillei, H. tondoana, H. cf. dilatata, H.

maculata), two were new species described from the current study (H. malaysiana, H.

johorensis) and one putative new species to be described (Halymenia sp. A). Our result

corroborated with the findings by Hernández-Kantún et al. (2012) in which H. durvillei

Univers

ity of

Mala

ya

117

represent a complex of at least three distinct species. This was further supported by the

higher intraspecific rbcL sequence variation (0-2.56%) between H. durvillei populations

compared to other populations such as H. tondoana, 0.08-0.16%; H. maculata, 0.08-

0.48%; H. malaysiana, 0-0.58%; H. johorensis, 0% and Halymenia sp. A (see Table

4.1). However, we agreed with Hernández-Kantún et al. (2012) that referred these taxa

as the H. durvillei complex until more information is available and more detailed

reassessments of the species are possible using a broad range of samples from different

localities and type specimen.

Both rbcL analysis and pairwise distance (Figure 4.15; Table 4.1) clearly showed

that Halymenia sp. A are genetically distinct from other described Halymenia species.

The genetic variation between Halymenia sp. A and H. tondoana (2.24-2.34%) was

sufficiently high to warrant recognition as distinct species since the values were well

within the range of 0.7–10.6 % rbcL interspecific divergences observed in

Halymeniaceae (Wang et al., 2001; Gavio and Fredericq, 2002; Hernández-Kantún et al.,

2012; Tan et al., 2015; Azevedo et al., 2016a; 2016b). We have collected a fertile

individual that morphologically resembled with H. dilatata. However, its identity

cannot be ensured since no genetic records of authentic material are available within

GenBank for comparison. Therefore, it was indicated here as H. cf. dilatata. The record

of H. dilatata from Japan as shown by Wang et al. (2000) and its final disposition

require a further study as no detailed morphological description of this record has been

presented.

COI-5P, UPA and LSU (28S rDNA) sequences could not be successfully amplified

from the H. cf. dilatata sample identified in the present study so its phylogenetic

position cannot be established until sequence become available. Missing H. cf. dilatata

sequences in the COI-5P, UPA and LSU (28S rDNA) datasets did not affect the overall

Univers

ity of

Mala

ya

118

phylogeny. The phylogenetic reconstruction based on COI-5P and UPA markers

(Figures 4.16-4.17) showed that six distinct species of Halymenia were present in our

collections. Among the six Halymenia, three were previously described species (H.

durvillei, H. tondoana, H. maculata), two were new species described from the current

study (H. malaysiana, H. johorensis) and one unknown species (Halymenia sp. A).

UPA marker had lower resolution than COI-5P marker since the taxonomic status of

some branched Halymenia (H. durvillei and H. formosa) were not well resolved in UPA

phylogeny. The higher intraspecific divergence within H. durvillei (COI-5P: 0-5.70%;

UPA: 0-2.70%) compared to values formerly reported for Halymeniaceae (COI-5P: 0-

1.60%; UPA: 0-0.90%) (Yang and Kim, 2014; Manghisi et al., 2015) seemed to warrant

its recognition as a cryptic species complex. This assumption was also supported by the

findings of Saunders (2008) that COI-5P values higher than ca. 4% correspond to

distinct species. The interspecific divergence of Halymenia species (COI: 4.11-12.46%;

UPA: 1.08-5.14%) were comparable to values provided in previous studies (COI: 3.7-

14.0%; UPA: 0.6-4.6%) (Yang and Kim, 2014; Manghisi et al., 2015). The taxonomic

position and relationship of most species of Halymenia were not resolved in LSU (28S

rDNA) phylogeny (Figure 4.18), which can be attributed to the lack of available

GenBank sequences, in addition to the resolution limit of this marker. The drawback of

the LSU (28S rDNA) in phylogenetic reconstruction is noted and will not be discussed

in this context.

In general, the rbcL marker gave better resolution and clade support than other

markers. This is likely due to its large size which provides more characters for

phylogenetic analysis and greater number of available rbcL GenBank sequences

compared to other markers. Meanwhile, the other three markers gave lower resolution in

the order of COI-5P > UPA > LSU (28S rDNA) which is likely due to the scarcity of

GenBank sequences for taxonomically accepted species of Halymenia and the

Univers

ity of

Mala

ya

119

resolution limit of each marker. The pairwise distance of rbcL, COI-5P and UPA

markers (Table 4.1-4.3) were sufficiently high to discriminate species. Despite these

studies having improved our understanding of the phylogenetic relationship between

these red algae, many previously described Halymenia taxa are yet to be sequenced. In

order to better understand the species relationships, an effort to sequence the type

specimens is crucial.

5.2.4 Markers performance and potential DNA barcodes

In this study, four genetic markers were selected: the plastid rbcL and UPA, the

mitochondrial COI-5P and the nuclear partial LSU (28S rDNA). The aim of the marker

selection was to utilize DNA from different origin (i.e. plastid, mitochondrial and

nuclear) to study species diversity of Halymenia and elucidate the relationships between

Halymenia species in Malaysia, Thailand, Indonesia and the Philippines.

Accurate species identification is the utmost element in both molecular phylogenetics

and DNA barcoding. DNA barcoding has been proved useful for detection of cryptic

species, assignment of unknown samples to well-characterized taxa and delimitation of

species complexes (Hebert et al., 2003; Hebert et al., 2004; Newmaster and Ragupathy,

2009). An ideal DNA barcode should fulfil the criteria as follows: universality, short

length, ease of amplification and good species-resolving power (Hollingsworth et al.,

2009; Kucera and Saunders, 2012). The utility of each marker for molecular

phylogenetics and its potential as DNA barcode for Halymenia were assessed in this

study.

As mentioned before, the relationship of most species of Halymenia were not

resolved in LSU (28S rDNA) phylogeny. The same goes for Ceramium species in

Univers

ity of

Mala

ya

120

which LSU (28S rDNA) marker could not discriminate at the species level (Du et al.,

2014). Sherwood et al. (2010a) also demonstrated similar finding in which LSU (28S

rDNA) marker was not recommended for future red algal biodiversity surveys since it

could not resolved some members of the genera in Nemaliales. Among the four genetic

markers utilized in this study, LSU (28S rDNA) was the most conserved, followed by

UPA, rbcL and COI-5P. Despite partial LSU (28S rDNA) sequences were easily

amplified, this marker was too conserved for reliable species recognition. Since LSU

(28S rDNA) was not a reliable marker for both molecular systematics and DNA

barcoding studies in Halymenia, we did not pursue it further in this study.

The UPA marker has been proved useful for species level resolution (Sherwood and

Presting, 2007; Conklin et al., 2009; Clarkston and Saunders, 2010). It has also been

proposed as DNA barcoding marker for red algal species due to its primer universality

and the ease of data acquisition (Sherwood et al., 2010a; 2010b; Costa et al., 2012).

However, UPA was not sufficiently variable to differentiate species especially closely

related species (Sherwood et al., 2010b; Kucera and Saunders, 2012). This finding

concurred with our results in which UPA could not resolved some closely related

branched Halymenia, which most likely due to its low genetic variability (Kucera and

Saunders, 2012). As revealed by Ekrem et al. (2007), accuracy of species identification

is only noticeable and assessable in extensive datasets with reliable barcode libraries.

Thus, the limited number of reference UPA sequences for Halymeniaceae available in

GenBank might also impeded its application for species identification and DNA

barcoding. Our preliminary investigation did not support UPA as a suitable

phylogenetic marker or DNA barcode for Halymenia. Further studies are needed to

assess the feasibility of UPA marker for species delineation of Halymenia or as DNA

barcode when more GenBank reference sequences become available.

Univers

ity of

Mala

ya

121

The robustness of rbcL in resolving the phylogenetic relationships within

Halymeniaceae was consistent with previous studies (Wang et al., 2001; Kawaguchi et

al., 2004; Hernández-Kantún et al. 2012; Azevedo et al. 2016a; 2016b). The rbcL has

also been proposed as DNA barcode for land plants (Chase et al., 2005), green

macroalgae (Caulerpa by Kazi et al., 2013); green microalgae (Hadi et al., 2016). In this

study, the rbcL was shown to be less conserved (compared to 28S LSU and UPA) with

high species-resolving power which make it useful for species level phylogenetic

elucidation and thus recommended as a potential DNA barcode for Halymenia.

Additionally, the abundant and readily available rbcL sequences within the GenBank

(compared to COI-5P, UPA and 28S LSU sequences) uphold its potential as DNA

barcode.

On the other hand, the COI marker is widely recognized as the DNA barcode for red

algae (Robba et al., 2006; Saunders, 2008; Saunders, 2009; Clarkston and Saunders,

2010; Le Gall and Saunders, 2010). In this study, COI-5P was the most variable marker

among the four markers tested due to its high mutation rate. Its high genetic variability

(especially variable in the third codon position), make it useful in distinguishing

between even closely related species (Herbert et al., 2003). Our results agreed with the

findings of Azevedo et al. (2016a) on the use of COI-5P as a DNA barcode for

Halymenia.

Although COI-5P is recommended as a potential DNA barcode for Halymenia, its

relatively higher intraspecific variation and the limited number of reference COI-5P

sequences for Halymeniaceae available in GenBank may reduce the accuracy for

species identification. Likewise, the reduced genetic variation of rbcL may imply its

incapability to detect cryptic species and thus underestimate species richness of seaweed

(Hollingsworth et al., 2011; van Velzen et al., 2012). Therefore, two or more molecular

Univers

ity of

Mala

ya

122

markers are indeed essential to confirm the results. It is expected that the combined use

of rbcL and COI-5P would be better for species identification, discovery of cryptic

species, and phylogenetic reconstruction of Halymenia (Kucera and Saunders, 2012;

Yang and Kim, 2014).

In summary, we have illustrated that both rbcL and COI-5P markers are effective for

species identification in the genus Halymenia and also potential DNA barcodes for

Halymenia. On the contrary, both UPA and LSU (28S rDNA) markers are not suitable

markers for molecular phylogenetics and DNA barcoding studies in Halymenia.

5.2.5 Genetic diversity of Halymenia malaysiana

Little is known about the genetic diversity and phylogeographic structure of marine

seaweed in Southeast Asia despite their high biodiversity in the region. Several genetic

diversity studies of red algae have been undertaken (e.g. Gracilaria changii by Yow et

al., 2011 and Yow et al., 2013; Kappaphycus and Eucheuma by Lim et al., 2013;

Gracilaria salicornia and Gracilaria babae by Ng et al., 2015; Kappaphycus by

Dumilag et al., 2016; Pyropia acanthophora by Dumilag and Aguinaldo, 2017). Even

though molecular analyses have been employed to elucidate the taxonomic position of

Halymenia (Kawaguchi et al., 2006; Hernández-Kantún et al., 2012; Tan et al., 2015;

Azevedo et al., 2016a; 2016b; Tan et al., 2017), no study on intraspecific genetic

diversity and phylogeography of Halymenia has been implemented. This study has been

the first attempt in assessing the intraspecific genetic variation and phylogeographic

distribution of Halymenia focusing on H. malaysiana from three countries of Southeast

Asia, namely Malaysia, Indonesia and the Philippines. Halymenia malaysiana was

chosen for genetic diversity study due to its greater number of specimens available.

Both UPA and LSU (28S rDNA) markers are excluded in haplotype network analyses

Univers

ity of

Mala

ya

123

since they are not suitable for molecular phylogenetics of Halymenia as shown in results.

Only rbcL and COI-5P genetic markers were selected for haplotype network analyses.

The usefulness of plastid marker, rbcL (McIvor et al., 2001; Yang et al., 2008;

Destombe et al., 2010; Dumilag and Aguinaldo, 2017) and mitochondrial marker, COI-

5P (Yang et al., 2013a; Xie et al., 2015; Dumilag and Aguinaldo, 2017) in the studies of

genetic diversity on seaweeds have been addressed. In present study, the feasibility of

the rbcL and COI-5P as potential markers to infer intraspecific genetic variation of the

Halymenia malaysiana was assessed. Our results corroborated with the findings of

aforementioned studies that both rbcL and COI-5P are suitable markers for unravelling

intraspecies relationship and revealing patterns of genetic diversity in H. malaysiana.

However, COI-5P was more variable than rbcL, giving higher genetic variation (nine

COI-5P haplotypes compared to eight rbcL haplotypes; intraspecific pairwise

divergence of 0-1.64%, 0-10 bp for the COI-5P compared to 0-0.50%, 0-7 bp for the

rbcL).

All populations of H. malaysiana in Peninsular Malaysia (Pulau Besar, Pulau Tinggi

and Pulau Merambong) recovered the identical rbcL and COI-5P haplotypes (R1-C1),

showing no genetic divergence. Haplotypes R1 was the most common rbcL haplotypes

and accounted for 64% of the 42 samples examined. Meanwhile, haplotype C1 was the

most common COI-5P haplotypes and accounted for 66% of the 41 samples examined.

Diversity was highest in the Tun Mustapha Park in East Malaysia since three rbcL

haplotypes (R1, R2, and R5) and three COI-5P haplotypes (C2, C4 and C7) were

detected in the populations. These observations suggest that the populations of H.

malaysiana may have originated in Tun Mustapha Park. However, the origin of H.

malaysiana can only be ascertained with extensive sampling from a wider geographic

Univers

ity of

Mala

ya

124

range, especially in the Coral Triangle and also additional taxon sampling in each

locality.

An individual from Tun Mustapha Park, East Malaysia and another individual from

Gam Island, Indonesia were found to have rbcL haplotype R1 which prevailing in

Peninsular Malaysia. This genetic homogeneity could be due to the complex

oceanographic currents within this region. Current circulation has been proven as one of

the important characters in influencing the community structure of seaweeds (Uwai et

al., 2006a; Cheang et al., 2010; Buchanan and Zuccarello, 2012). The Southeast Asian

waters are mainly affected by monsoon seasons which will influence sea surface

currents circulation. During the Southwest Monsoon, the surface currents flow

northward in a clockwise direction, facilitating the dispersal of floating thalli or

fragments from Peninsular Malaysia to East Malaysia. In addition, genetic connectivity

between populations from Sabah, East Malaysia and Peninsular Malaysia is readily

since Borneo Island was part of the Sunda Shelf which connected to the Malay

Peninsula as a single landmass during the Pleistocene (Voris, 2000). Likewise, during

the Northeast Monsoon, the surface currents flow southward in an anticlockwise

direction (Wyrtki, 1961). Such surface current circulation patterns coupled with

directional current flows (e.g. Indonesian Thoughflow), could have promoted genetic

connectivity in Peninsular Malaysia and Indonesia.

On the other hand, the genetic connectivity that occurred among the different

lineages may also be a result of ship traffic (Broom et al., 2002; Xie et al., 2015). The

low level of genetic divergence observed in the haplotypes from Peninsular Malaysia

(R1-C1) and East Malaysia (R5-C4 and R2-C7) is likely since Borneo Island was

separated from the mainland peninsula by the South China Sea following the

submergence of Sundaland during the late Pleistocene (Voris, 2000).

Univers

ity of

Mala

ya

125

The results showed that the populations of H. malaysiana in the Philippines were

distinct from Malaysia and Indonesia. All four rbcL haplotypes (R3, R6, R7, R8) and

four COI-5P haplotypes (C3, C5, C8, C9) detected were endemic to the Philippines,

thus implying limited gene flow. This could be a result of the large geographical

separation and influenced by physical oceanographic processes. Genetic differentiation

was also evident in the Philippines populations of H. malaysiana where almost every

locality composed of unique haplotype except for Subic Bay and Grande Island shared

identical haplotypes (R6-C3) due to their relatively close proximity. Similar genetic

differentiation was also reported in red algae (Dumilag et al., 2017), where most of the

Philippine Pyropia acanthophora populations appeared specific to particular site. Deep

open ocean channels and variable currents among islands (Baums et al., 2005) are likely

to cause diversification in this region. Further studies involved more sampling sites in

this region may provide more evidence to elucidate the geographic pattern of the

Philippines populations of H. malaysiana.

The small sample size in this study did not allow us to infer the ancestral haplotypes

and elucidate phylogeographic pattern of H. malaysiana in detail. Additional sampling

from different geographic region is crucial as this will improve the distribution pattern

of the species (Zuccarello et al., 2006). The findings in the present study augmented our

understanding of the genetic diversity of H. malaysiana and offered a preliminary

outline of H. malaysiana distributions in Southeast Asia for future studies. This

information is also important for conservation and provides further insights into origin

and evolutionary relationships of H. malaysiana from Malaysia, Indonesia and the

Philippines.

Univers

ity of

Mala

ya

126

CHAPTER 6: CONCLUSION

6.1 General conclusion and appraisal of this study

Present study represents the first attempt to study the taxonomy of Halymenia

species from four countries of Southeast Asia, namely Malaysia, Thailand, Indonesia

and the Philippines, combining morphological features as well as molecular analyses.

This is also the first study in accessing the utility of UPA and LSU (28S rDNA) markers

in species delineation of Halymenia. Even though it is rather preliminary, it showed the

presence of seven species of Halymenia including H. durvillei, H. maculata, H.

tondoana, H. cf. dilatata with the description of two new species, H. malaysiana and H.

johorensis, and a potential new species, Halymenia sp. A. The findings in this study

augmented our understanding of species diversity of Halymenia in this warm water

region. It also provided new genetic records for species that had not previously been

analysed in a genetic context, for instance H. malaysiana and H. johorensis. The

following summarizes the significant results throughout the course of the study:

1) The genus Halymenia was shown to be polyphyletic, thus requiring more

detailed studies.

2) Both newly designed COI-5P primers (COI1F and COI1R) were useful in

sequencing COI-5P sequences of Halymenia and some red algal species in

Halymeniaceae.

3) The nuclear LSU (28S rDNA) genetic marker was shown to be the most

conserved in terms of genetic variations. Despite it was easy to acquire sequence data

for LSU (28S rDNA) marker, this marker was too conserved for reliable species

Univers

ity of

Mala

ya

127

recognition. It is not a reliable marker for both molecular phylogenetics and DNA

barcoding studies in Halymenia.

4) The plastid UPA genetic marker was not sufficiently variable to resolve some

closely related branched Halymenia, thus it is not a suitable phylogenetic marker or

DNA barcode for Halymenia. Further studies are needed to assess the feasibility of

UPA marker for species delineation of Halymenia or as DNA barcode when more

GenBank reference sequences become available.

5) The plastid-encoded rbcL gene was shown to be the best in terms of

phylogenetic resolution, less conserved (compared to 28S LSU and UPA) and has

abundant readily available rbcL sequences within the GenBank (compared to COI-5P,

UPA and 28S LSU sequences), thus a good marker for the systematics of Halymenia

and recommended as a potential DNA barcode for Halymenia.

6) The COI-5P genetic marker was shown to be the most variable in terms of

genetic variation, useful in distinguishing between even closely related species, thus a

promising DNA barcode for Halymenia.

7) The use of the molecular analyses in combination with morphological studies is

crucial for species identification.

8) Molecular results have supported the existence of at least three species in H.

durvillei complex but detailed data on morphology and distribution were not yet

available. Further examination of more samples from different geographical regions and

type specimen based on both morphological and molecular analyses is needed to verify

this finding.

9) Combination of the following vegetative features is crucial for species

delineation in Halymenia: habit, thallus size, blade margins, order of branching,

Univers

ity of

Mala

ya

128

branching pattern, presence or absence of a stipe, presence or absence of marginal

proliferations, presence or absence of surface proliferations or spines, blade thickness,

cortex thickness, shape and size of outer cortical cells, shape and size of inner cortical

cells, and presence or absence of refractive ganglionic cells.

10) Both morphological evidence and molecular findings led to the description of

two new species of Halymenia, namely H. malaysiana (Tan et al., 2015) and H.

johorensis (Tan et al., 2017); a potential new species of Halymenia, Halymenia sp. A.

This revealed that species of Halymenia in Southeast Asia is far richer than previously

recognized.

11) Both rbcL and COI-5P genetic markers were shown to be suitable for resolving

intraspecific genetic variation and are reliable markers for the study of genetic diversity

and phylogeographic distribution in Halymenia species i.e. H. malaysiana.

12) A statistical parsimony network of H. malaysiana yielded eight rbcL haplotypes

(R1-R8) and nine COI-5P haplotypes (C1-C9) which were closely related. COI-5P was

more variable than rbcL, giving higher genetic variation (nine COI-5P haplotypes

compared to eight rbcL haplotypes; intraspecific pairwise divergence of 0-1.64%, 0-10

bp for the COI-5P compared to 0-0.50%, 0-7 bp for the rbcL).

13) Haplotype R1 and C1 were the most common rbcL and COI-5P haplotypes of H.

malaysiana found in Peninsular Malaysia. The populations of H. malaysiana may have

originated in Tun Mustapha Park as contributing the highest intra-population diversity.

However, the origin of H. malaysiana can only be ascertained with extensive sampling

from a wider geographic range, especially in the Coral Triangle and also additional

taxon sampling in each locality.

Univers

ity of

Mala

ya

129

14) Current circulation, Pleistocene events, anthropogenic activities and natural

distributions have been postulated to affect the dispersal, in turn the genetic population

structure of H. malaysiana.

First and third alternative hypotheses and second null hypothesis are accepted

whereby a) not all morphological features were equally reliable as diagnostic characters,

b) identification based on molecular phylogenies were coherent with morphological

characters and c) phylogenies of different molecular genetic markers were not

congruent and do not have similar levels of resolution.

6.2 Future studies on Halymenia

We believe that the species diversity of Halymenia in this region is still

underestimated. Additional sampling from different geographic regions with detailed

morphological and molecular investigation is required to provide a greater

understanding of the phylogenetic relationships and species richness in this genus. The

putative new species discovered in this study will be described formally when more

specimens become available.

The sampling, morphological and genetic data of all taxonomically accepted species

will greatly assist in the systematics of Halymenia. Sequencing of type specimens in

particular H. dilatata, H. durvillei, Gelinaria ulvoidea and Epiphloea bullosa is crucial

to clarify their ambiguous taxonomic position. If there is lack of authentic materials,

sampling in type locality with the designation of neotype may be a feasible solution.

Further taxonomic study on the branched Halymenia is imperative in particular to reveal

the cryptic species found in H. durvillei complex.

Univers

ity of

Mala

ya

130

The development of the auxiliary cell ampullae in many species of Halymenia is

poorly known. Hence, subsequent taxonomic research should be more focused on the

study of female reproductive structures such as the developmental stages of the

carposporophyte when well-preserved specimens are available.

Univers

ity of

Mala

ya

131

REFERENCES

Abbott, I. A. (1967). Studies in some foliose red algae of the Pacific Coast I.

Cryptonemiaceae. Journal of Phycology, 3(3), 139-149.

Agardh, C. A. (1817). Synopsis algarum Scandinaviae: adjecta dispositione universali

algarum. Lundae: Ex officina Berlingiana.

Agardh, J. G. (1842). Algae maris Mediterranei et Adriatici, observationes in diagnosin

specierum et dispositionem generum. Paris: Apud Fortin, Masson et Cie.

Alberto, F., Santos, R., & Leitão, J. M. (1997). DNA extraction and RAPD markers to

assess the genetic similarity among Gelidium sesquipedale (Rhodophyta)

populations. Journal of Phycology, 33(4), 706-710.

Alberto, F., Santos, R., & Leitão, J. M. (1999). Assessing patterns of geographic

dispersal of Gelidium sesquipedale (Rhodophyta) through RAPD differentiation

of populations. Marine Ecology Progress Series, 191, 101-108.

Andreakis, N., Procaccini, G., Maggs, C., & Kooistra, W. H. C. F. (2007).

Phylogeography of the invasive seaweed Asparagopsis (Bonnemaisoniales,

Rhodophyta) reveals cryptic diversity. Molecular Ecology, 16(11), 2285-2299.

Atmadja, W. S., & Prud’homme van Reine, W. F. (2012). Checklist of the seaweed

species biodiversity of Indonesia with their distribution and classification:

Rhodophyceae (pp. 1-72). Jakarta: Coral Reef Information and Training Centre.

Coral Reef Rehabilitation and Management Programme. Indonesian Institute of

Sciences (LIPI).

Avise, J. C. (1994). Molecular markers, natural history and evolution. New York:

Chapman & Hall.

Azevedo, C. A. A., Cassano, V., & Oliveira, M. C. (2016a). Diversity of branched

Halymenia (Halymeniales, Rhodophyta) species on the Brazilian coast:

molecular and morphological analyses reveal three new species. Phycologia,

55(4), 431-444.

Azevedo, C. A. A., Cassano, V., & Oliveira, M. C. (2016b). Phylogenetic relationships

among Halymenia (Halymeniaceae, Rhodophyta) species on the Brazilian coast

with description of Halymenia cearensis sp. nov. Phytotaxa, 280(3), 241-258.

Univers

ity of

Mala

ya

132

Bagley, M J., Franson, S. E., Christ, S. A., Waits, E. R., & Toth, G. P. (2002). Genetic

diversity as an indicator of ecosystem condition and sustainability: utility for

regional assessments of stream condition in the eastern United States.

Cincinnati, Ohio: U.S. Environmental Protection Agency.

Balakrishnan, M. S. (1960). Reproduction in some Indian red algae and their taxonomy.

In P. Kachroo (Ed.), Proceedings of the Symposium on Algology (pp. 85-98).

New Delhi: Indian Council of Agricultural Research.

Balakhrishnan, M. S. (1961). Studies on Indian Cryptonemiales—III. Halymenia C. A.

Ag. Journal of the Madras University, Section B, 31(2), 183-217.

Baldwin, B. G., Sanderson, M. J., Porter, J. M., Wojciechowski, M. F., Campbell, C. S.,

& Donoghue, M. J. (1995). The ITS region of nuclear ribosomal DNA: a

valuable source of evidence on angiosperm phylogeny. Annals of the Missouri

Botanical Garden, 82, 247-277.

Ballantine, D. L., & Ruiz, H. (2004). Halymenia mirabilis sp. nov. (Cryptonemiales,

Rhodophyta), a spectacular alga from Grenada, Caribbean Sea. Phycologia,

43(1), 75-78.

Bardakci, F. (2001). Random amplified polymorphic DNA (RAPD) markers. Turkish

Journal of Biology, 25(2), 185-196.

Baums, I. B., Miller, M. W., & Hellberg, M. E. (2005). Regionally isolated populations

of an imperiled Caribbean coral, Acropora palmata. Molecular Ecology, 14(5),

1377-1390.

Bellorin, A. M., Oliveira, M. C., & Oliveira, E. C. (2002). Phylogeny and systematics of

the marine algal family Gracilariaceae (Gracilariales, Rhodophyta) based on

SSU rDNA and ITS sequences of Atlantic and Pacific species. Journal of

Phycology, 38(3), 551-563.

Bermejo Román, R., Alvarez-Pez, J. M., Acién Fernández, F. G., & Molina Grima, E.

(2002). Recovery of pure B-phycoerythrin from the microalga Porphyridium

cruentum. Journal of Biotechnology, 93(1), 73-85.

Bhattacharya, D., & Medlin, L. (1998). Algal phylogeny and the origin of land plants.

Plant Physiology, 116(1), 9-15.

Univers

ity of

Mala

ya

133

Bird, C. J., & Rice, E. L. (1990). Recent approaches to the taxonomy of the

Gracilariaceae (Gracilariales, Rhodophyta) and the Gracilaria verrucosa

problem. Hydrobiologia, 204(1), 111-118.

Boney, A. D., & Corner, E. D. S. (1960). A possible function of phycoerythrin in

intertidal red algae. Nature, 188(4755), 1042-1043.

Boudouresque, C. F., & Verlaque, M. (2002). Biological pollution in the Mediterranean

Sea: invasive versus introduced macrophytes. Marine Pollution Bulletin, 44(1),

32-38.

Bown, P., Plumb, J., Sánchez-Baracaldo, P., Hayes, P. K., & Brodie, J. (2003).

Sequence heterogeneity of green (Chlorophyta) endophytic algae associated with

a population of Chondrus crispus (Gigartinaceae, Rhodophyta). European

Journal of Phycology, 38(2), 153-163.

Brodie, J. A., & Irvine, L. M. (2003). Seaweeds of the British Isles Volume 1

Rhodophyta part 3B. Bangiophycidae. London: Intercept, Andover.

Broom, J. E., Nelson, W. A., Yarish, C., Jones, W. A., Aguilar Rosas, R., & Aguilar

Rosas, L. E. (2002). A reassessment of the taxonomic status of Porphyra

suborbiculata, Porphyra carolinensis and Porphyra lilliputiana (Bangiales,

Rhodophyta) based on molecular and morphological data. European Journal of

Phycology, 37(2), 227-235.

Brown, T. A. (2016). Gene cloning and DNA analysis: an introduction (6th ed.). United

Kingdom: John Wiley & Sons.

Bruns, T. D., White, T. J., & Taylor, J. W. (1991). Fungal molecular systematics.

Annual Review of Ecology and Systematics, 22(1), 525-564.

Buchanan, J., & Zuccarello, G. C. (2012). Decoupling of short- and long- distance

dispersal pathways in the endemic New Zealand seaweed Carpophyllum

maschalocarpum (Phaeophyceae, Fucales). Journal of Phycology, 48(3), 518-

529.

Campo, V. L., Kawano, D. F., da Silva, D. B., & Carvalho, I. (2009). Carrageenans:

Biological properties, chemical modifications and structural analysis–A review.

Carbohydrate Polymers, 77(2), 167-180.

Univers

ity of

Mala

ya

134

Candia, A., González, M. A., Montoya, R., Gómez, P., & Nelson, W. (1999).

Comparison of ITS RFLP patterns of Gracilaria (Rhodophyceae, Gracilariales)

populations from Chile and New Zealand and an examination of interfertility of

Chilean morphotypes. Journal of Applied Phycology, 11(2), 185-193.

Cardinale, B. J., Duffy, J. E., Gonzalez, A., Hooper, D. U., Perrings, C., Venail, P., . . .

Wardle, D. A. (2012). Biodiversity loss and its impact on humanity. Nature,

486(7401), 59-67.

Carlile, A. L., & Sherwood, A. R. (2013). Phylogenetic affinities and distribution of the

Hawaiian freshwater red algae (Rhodophyta). Phycologia, 52(3), 309-319.

Chan, C. X., Ho, C. L., & Phang, S. M. (2006). Trends in seaweed research. Trends in

Plant Science, 11(4), 165-166.

Chase, M. W., Salamin, N., Wilkinson, M., Dunwell, J. M., Kesanakurthi, R. P., Haidar,

N., & Savolainen, V. (2005). Land plants and DNA barcodes: short-term and

long-term goals. Philosophical Transactions of the Royal Society B: Biological

Sciences, 360(1462), 1889-1895.

Cheang, C. C., Chu, K. H., Fujita, D., Yoshida, G., Hiraoka, M., Critchley, A., . . . Ang,

P. O. (2010). Low genetic variability of Sargassum muticum (Phaeophyceae)

revealed by a global analysis of native and introduced populations. Journal of

Phycology, 46(6), 1063-1074.

Chen, C. S., & Chen, C. Y. (1996). Using red alga Halymema microcarpa as a biofilter

in an integrated aquarium system. Acta Oceanographica Taiwanica, 35, 357-367.

Chiang, Y. M. (1970). Morphological studies of red algae of the family

Cryptonemiaceae. Berkeley: University of California Press.

Cho, G. Y., Kogame, K., Kawai, H., & Boo, S. M. (2007). Genetic diversity of

Scytosiphon lomentaria (Scytosiphonaceae, Phaeophyceae) from the Pacific and

Europe based on RuBisCO large subunit and spacer, and ITS nrDNA sequences.

Phycologia, 46(6), 657-665.

Clarkston, B. E., & Saunders, G. W. (2010). A comparison of two DNA barcode

markers for species discrimination in the red algal family Kallymeniaceae

(Gigartinales, Florideophyceae), with a description of Euthora timburtonii sp.

nov. Botany, 88(2), 119-131.

Univers

ity of

Mala

ya

135

Clayden, S. L., & Saunders, G. W. (2010). Recognition of Rubrointrusa membranacea

gen. et comb. nov., Rhodonematella subimmersa gen. et comb. nov.(with a

reinterpretation of the life history) and the Meiodiscaceae fam. nov. within the

Palmariales (Rhodophyta). Phycologia, 49(3), 283-300.

Clement, M., Posada, D., & Crandall, K. A. (2000). TCS: a computer program to

estimate gene genealogies. Molecular Ecology, 9(10), 1657-1659.

Collins, F. S., & Howe, M. A. (1916). Notes on species of Halymenia. Bulletin of the

Torrey Botanical Club, 43(4), 169-182.

Conklin, K. Y., Kurihara, A., & Sherwood, A. R. (2009). A molecular method for

identification of the morphologically plastic invasive algal genera Eucheuma

and Kappaphycus (Rhodophyta, Gigartinales) in Hawaii. Journal of Applied

Phycology, 21(6), 691-699.

Costa, F. O., & Antunes, P. M. (2012). The contribution of the Barcode of Life initiative

to the discovery and monitoring of Biodiversity. In A. Mendonca, A. Cunha & R.

Chakrabarti (Eds.), Natural Resources, Sustainability and Humanity (pp. 37-68).

Netherlands: Springer.

Costello, M. J., & Wilson, S. P. (2011). Predicting the number of known and unknown

species in European seas using rates of description. Global Ecology and

Biogeography, 20(2), 319-330.

Coyer, J. A., Hoarau, G., Stam, W. T., & Olsen, J. L. (2004). Geographically specific

heteroplasmy of mitochondrial DNA in the seaweed, Fucus serratus

(Heterokontophyta: Phaeophyceae, Fucales). Molecular Ecology, 13(5), 1323-

1326.

Curiel, D., Bellemo, G., Marzocchi, M., Scattolin, M., & Parisi, G. (1998). Distribution

of introduced Japanese macroalgae Undaria pinnatifida, Sargassum muticum

(Phaeophyta) and Antithamnion pectinatum (Rhodophyta) in the Lagoon of

Venice. Hydrobiologia, 385(1), 17-22.

D’Archino, R., Nelson, W. A., & Zuccarello, G. C. (2014). Amalthea and Galene, two

new genera of Halymeniaceae (Rhodophyta) from New Zealand. Botanica

Marina, 57(3), 185-201.

Dawes, C. J. (1998). Marine Botany (2nd ed.). New York: John Wiley & Sons Inc.

Univers

ity of

Mala

ya

136

Daly, D. C., Cameron, K. M., & Stevenson, D. W. (2001). Plant systematics in the age

of genomics. Plant Physiology, 127(4), 1328-1333. De Clerck, O., Bogaert, K. A., & Leliaert, F. (2012). Diversity and evolution of algae:

primary endosymbiosis. Advances in Botanical Research, 64, 55-86.

De Clerck, O., Gavio, B., Fredericq, S., Barbara, I., & Coppejans, E. (2005).

Systematics of Grateloupia filicina (Halymeniaceae, Rhodophyta), based on

rbcL sequence analyses and morphological evidence, including the

reinstatement of G. minima and the description of G. capensis sp. nov. Journal

of Phycology, 41(2), 391-410.

De Clerck, O., Guiry, M. D., Leliaert, F., Samyn, Y., & Verbruggen, H. (2013). Algal

taxonomy: a road to nowhere? Journal of Phycology, 49(2), 215-225.

de Senerpont Domis, L. N., Famà, P., Bartlett, A. J., Prud'homme van reine, W. F.,

Espinosa, C. A., & Trono Jr., G. C. (2003). Defining taxon boundaries in

members of the morphologically and genetically plastic genes Caulerpa

(Caulerpales, Chlorophyta). Journal of Phycology, 39(6), 1019-1037.

De Smedt, G., De Clerck, O., Leliaert, F., Coppejans, E., & Liao, L. (2001).

Morphology and systematics of the genus Halymenia C. Agardh (Halymeniales,

Rhodophyta) in the Philippines. Nova Hedwigia, 73(3-4), 293-322.

Destombe, C., & Douglas, S. E. (1991). RuBisCO spacer sequence divergence in the

rhodophyte alga Gracilaria verrucosa and closely related species. Current

Genetics, 19(5), 395-398.

Destombe, C., Valero, M., & Guillemin, M. L. (2010). Delineation of two sibling red

algal species, Gracilaria gracilis and Gracilaria dura (Gracilariales,

Rhodophyta), using multiple DNA markers: resurrection of the species G. dura

previously described in the Northern Atlantic 200 years ago. Journal of

Phycology, 46(4), 720-727.

Dhargalkar, V. K., & Kavlekar, D. P. (2004). Seaweeds- a field manual. Dona Paula,

Goa: National Institute of Oceanography.

Dixon, P. S. (1973). Biology of the Rhodophyta. Edinburgh: Oliver and Boyd.

Dowell, K. (2008). Molecular Phylogenetics: An introduction to computational methods

and tools for analyzing evolutionary relationships. Math, 500, 18.

Univers

ity of

Mala

ya

137

Doyle, J. J., & Luckow, M. A. (2003). The rest of the iceberg. Legume diversity and

evolution in a phylogenetic context. Plant Physiology, 131(3), 900-910.

Du, G., Wu, F., Guo, H., Xue, H., & Mao, Y. (2015). DNA barcode assessment of

Ceramiales (Rhodophyta) in the intertidal zone of the northwestern Yellow Sea.

Chinese Journal of Oceanology and Limnology, 33(3), 685.

Dumilag, R. V., & Aguinaldo, Z.-Z. A. (2017). Genetic differentiation and distribution

of Pyropia acanthophora (Bangiales, Rhodophyta) in the Philippines. European

Journal of Phycology, 52(1), 104-115.

Dumilag, R. V., Orosco, F. L., & Lluisma, A. O. (2016). Genetic diversity of

Kappaphycus species (Gigartinales, Rhodophyta) in the Philippines. Systematics

and Biodiversity, 14(5), 441-451.

Ekman, S. (1999). PCR optimization and troubleshooting, with special reference to the

amplification of ribosomal DNA in lichenized fungi. Lichenologist, 31(5), 517-

531.

Ekrem, T., Willassen, E., & Stur, E. (2007). A comprehensive DNA sequence library is

essential for identification with DNA barcodes. Molecular Phylogenetics and

Evolution, 43(2), 530-542.

Famà, P., Jousson, O., Zaninetti, L., Meinesz, A., Dini, F., Di Giuseppe, G., . . .

Pawlowski, J. (2002). Genetic polymorphism in Caulerpa taxifolia

(Ulvophyceae) chloroplast DNA revealed by a PCR‐based assay of the invasive

Mediterranean strain. Journal of Evolutionary Biology, 15(4), 618-624.

Fenoradosoa, T. A., Delattre, C., Laroche, C., Wadouachi, A., Dulong, V., Picton,

L., . . . Michaud, P. (2009). Highly sulphated galactan from Halymenia durvillei

(Halymeniales, Rhodophyta), a red seaweed of Madagascar marine coasts.

International Journal of Biological Macromolecules, 45(2), 140-145

Féral, J.-P. (2002). How useful are the genetic markers in attempts to understand and

manage marine biodiversity? Journal of Experimental Marine Biology and

Ecology, 268(2), 121-145.

Figueroa, F. L., Korbee, N., Clerck, O. d., Bárbara, I., & Gall, E. A. (2007).

Characterization of Grateloupia lanceola (Halymeniales, Rhodophyta), an

obscure foliose Grateloupia from the Iberian Peninsula, based on morphology,

comparative sequence analysis and mycosporine-like amino acid composition.

European Journal of Phycology, 42(3), 231-242.

Univers

ity of

Mala

ya

138

Fisher, R. A. (1930). The genetical theory of natural selection. Oxford: The Clarendon

Press.

Fletcher, R. L., & Farrell, P. (1999). Introduced brown algae in the North East Atlantic,

with particular respect to Undaria pinnatifida (Harvey) Suringar. Helgoländer

Meeresuntersuchungen, 52, 259-275.

Frankham, R., Ballou, J. D., & Briscoe, D. A. (2004). A primer of conservation genetics.

Cambridge, UK: Cambridge University Press.

Freeman, S., & Herron, J. C. (1998). Evolutionary analysis. Upper Saddle River, New

Jersey: Prentice-Hall.

Freile-Pelegrin, Y., Azamar, J. A, & Robledo, D. (2011). Preliminary characterization

of carrageenan from the red seaweed Halymenia floresii. Journal of Aquatic

Food Product Technology, 20(1), 73-83.

Freshwater, D. W., Fredericq, S., & Bailey, J. C. (1999). Characteristics and utility of

nuclear-encoded large-subunit ribosomal gene sequences in phylogenetic studies

of red algae. Phycological Research, 47(1), 33-38.

Freshwater, D. W., Fredericq, S., Butler, B. S., Hommersand, M. H., & Chase, M. W.

(1994). A gene phylogeny of the red algae (Rhodophyta) based on plastid rbcL.

Proceedings of the National Academy of Sciences, 91(15), 7281-7285.

Freshwater, D. W., & Rueness, J. (1994). Phylogenetic relationships of some European

Gelidium (Gelidiales, Rhodophyta) species, based on rbcL nucleotide sequence

analysis. Phycologia, 33(3), 187-194.

Garcia, J. S., Palacios, V., & Roldán, A. (2016). Nutritional potential of four seaweed

species collected in the Barbate Estuary (Gulf of Cadiz, Spain). Journal of

Nutrition & Food Sciences, 6(3), 505.

Gargiulo, G. M., De Masi, F., & Tripodi, G. (1986). Structure and reproduction of

Halymenia asymmetrica sp. nov.(Rhodophyta) from the Mediterranean Sea.

Phycologia, 25(2), 144-151.

Gargiulo, G. M., Morabito, M., & Manghisi, A. (2013). A re-assessment of reproductive

anatomy and postfertilization development in the systematics of Grateloupia

(Halymeniales, Rhodophyta). Cryptogamie, Algologie, 34(1), 3-35.

Univers

ity of

Mala

ya

139

Gavio, B., & Fredericq, S. (2002). Grateloupia turuturu (Halymeniaceae, Rhodophyta)

is the correct name of the non-native species in the Atlantic known as

Grateloupia doryphora. European Journal of Phycology, 37(3), 349-359.

Geraldino, P. J. L., Yang, E.-C., & Bu, S.-M. (2006). Morphology and molecular

phylogeny of Hypnea flexicaulis (Gigartinales, Rhodophyta) from Korea. Algae,

21(4), 417-423.

Godínez-Ortega, J. L., Snoeijs, P., Robledo, D., Freile-Pelegrín, Y., & Pedersén, M.

(2008). Growth and pigment composition in the red alga Halymenia floresii

cultured under different light qualities. Journal of Applied Phycology, 20(3),

253-260.

Goff, L. J., Moon, D. A., & Coleman, A. W. (1994). Molecular delineation of species

and species relationships in the red algal agarophytes Gracilariopsis and

Gracilaria (Gracilariales). Journal of Phycology, 30(3), 521-537.

Guerra-García, J. M., Espinosa Torre, F., & García Gómez, J. C. (2008). Trends in

taxonomy today: an overview about the main topics in taxonomy. Zoológica

Baetica, 19, 15-49.

Guillemin, M.-L., Akki, S. A., Givernaud, T., Mouradi, A., Valero, M., & Destombe, C.

(2008). Molecular characterisation and development of rapid molecular methods

to identify species of Gracilariaceae from the Atlantic coast of Morocco. Aquatic

Botany, 89(3), 324-330.

Guimarães, S. M. P. B., & Fujii, M. T. (1998). Two species of foliose Halymenia

(Halymeniaceae, Rhodophyta) from Brazil. Botanica Marina, 41(1-6), 495-504.

Guiry, M. D., & Irvine, L. M. (1974). A species of Cryptonemia new to Europe. British

Phycological Journal, 9(3), 225-237.

Guiry, M. D., & Guiry, G. M. (2017). AlgaeBase. World-wide electronic publication,

National University of Ireland, Galway. Retrieved from http://www.algaebase.org.

Gulbransen, D. J., McGlathery, K. J., Marklund, M., Norris, J. N., & Gurgel, C. F. D.

(2012). Gracilaria vermiculophylla (Rhodophyta, Gracilariales) in the Virginia

coastal bays, USA: cox1 analysis reveals high genetic richness of an introduced

macroalga. Journal of Phycology, 48(5), 1278-1283.

Univers

ity of

Mala

ya

140

Hadi, S. I. I. A., Santana, H., Brunale, P. P. M., Gomes, T. G., Oliveira, M. D.,

Matthiensen, A., . . . Brasil, B. S. A. F. (2016). DNA barcoding green

microalgae isolated from neotropical inland waters. PLoS One, 11(2), e0149284.

Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor and

analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41,

95-98.

Harper, J. T., & Saunders, G. W. (2001). The application of sequences of the ribosomal

cistron to the systematics and classification of the florideophyte red algae

(Florideophyceae, Rhodophyta). Cahiers de Biologie Marine, 42(1-2), 25-38.

Hashimo, T., Nakamura, Y., Kamaishi, T., & Hasegawa, M. (1997). Early evolution of

eukaryotes inferred from protein phylogenies of translation elongation factors 1α

and 2. Archiv für Protistenkunde, 148(3), 287-295.

Hebert, P. D. N., Cywinska, A., Ball, S. L., & De Waard, J. R. (2003). Biological

identifications through DNA barcodes. Proceedings of the Royal Society B:

Biological Sciences, 270(1512), 313-321.

Hebert, P. D. N., & Gregory, T. R. (2005). The promise of DNA barcoding for

taxonomy. Systematic Biology, 54(5), 852-859.

Hebert, P. D. N., Penton, E. H., Burns, J. M., Janzen, D. H., & Hallwachs, W. (2004a).

Ten species in one: DNA barcoding reveals cryptic species in the neotropical

skipper butterfly Astraptes fulgerator. Proceedings of the National Academy of

Sciences of the United States of America, 101(41), 14812-14817.

Hebert, P. D. N., Stoeckle, M. Y., Zemlak, T. S., & Francis, C. M. (2004b).

Identification of birds through DNA barcodes. PLoS Biology, 2(10), e312.

Hernández-Kantún, J. J., Riosmena-Rodriguez, R., Adey, W. H., & Rindi, F. (2014).

Analysis of the cox2-3 spacer region for population diversity and taxonomic

implications in rhodolith-forming species (Rhodophyta: Corallinales). Phytotaxa,

190(1), 331-354.

Hernández-Kantun, J. J., Riosmena-Rodriguez, R., & León-Cisneros, K. (2009).

Morphology and anatomy of Halymenia actinophysa (Halymeniales,

Rhodophyta) from the southwestern Gulf of California, Mexico. Botanica

Marina, 52(3), 248-255.

Univers

ity of

Mala

ya

141

Hernández-Kantún, J. J., Sherwood, A. R., Riosmena-Rodriguez, R., Huisman, J. M., &

De Clerck, O. (2012). Branched Halymenia species (Halymeniaceae,

Rhodophyta) in the Indo-Pacific region, including descriptions of Halymenia

hawaiiana sp. nov. and H. tondoana sp. nov. European Journal of Phycology,

47(4), 421-432.

Hillis, D. M., & Bull, J. J. (1993). An empirical test of bootstrapping as a method for

assessing confidence in phylogenetic analysis. Systematic Biology, 42(2), 182-

192.

Hillis, D. M., & Dixon, M. T. (1991). Ribosomal DNA: molecular evolution and

phylogenetic inference. The Quarterly Review of Biology, 66(4), 411-453.

Hind, K. R., & Saunders, G. W. (2013). Molecular markers from three organellar

genomes unravel complex taxonomic relationships within the coralline algal

genus Chiharaea (Corallinales, Rhodophyta). Molecular Phylogenetics and

Evolution, 67(2), 529-540.

Hollingsworth, P. M., Forrest, L. L., Spouge, J. L., Hajibabaei, M., Ratnasingham, S.,

van der Bank, M., . . . Little, D. P. (2009). A DNA barcode for land plants.

Proceedings of the National Academy of Sciences, 106(31), 12794-12797.

Hollingsworth, P. M., Graham, S. W., & Little, D. P. (2011). Choosing and using a

plant DNA barcode. PLoS One, 6(5), e19254.

Hommersand, M. H., & Fredericq, S. (1990). Sexual reproduction and cystocarp

development. In K. M. Cole & R. G. Sheath (Eds.), Biology of the red algae (pp.

305-345). New York: Cambridge University Press.

Hommersand, M. H., & Fredericq, S. (2003). Biogeography of the marine red algae of

the South African West Coast: a molecular approach. In A. R. O. Chapman, R. J.

Anderson, V. J. Vreeland & I. R. Davison (Eds.), Proceedings of the 17th

International Seaweed Symposium (pp. 325-336). Cape Town: Oxford

University Press.

Hommersand, M. H., Fredericq, S., Wilson Freshwater, D., & Hughey, J. (1999).

Recent developments in the systematics of the Gigartinaceae (Gigartinales,

Rhodophyta) based on rbcL sequence analysis and morphological evidence.

Phycological Research, 47(3), 139-151.

Hu, Z., Zeng, X., Wang, A., Shi, C., & Duan, D. (2004). An efficient method for DNA

isolation from red algae. Journal of Applied Phycology, 16(3), 161-166.

Univers

ity of

Mala

ya

142

Hu, Z. M., Guiry, M. D., & Duan, D. L. (2009). Using the ribosomal internal

transcribed spacer (ITS) as a complement marker for species identification of

red macroalgae. Hydrobiologia, 635(1), 279.

Huelsenbeck, J. P., & Ronquist, F. (2001). MRBAYES: Bayesian inference of

phylogenetic trees. Bioinformatics, 17(8), 754-755.

Hughes, A. R., Inouye, B. D., Johnson, M. T., Underwood, N., & Vellend, M. (2008).

Ecological consequences of genetic diversity. Ecology Letters, 11(6), 609-623.

Hwang, I. K., Kim, H. S., & Lee, W. J. (2004). Evidence for taxonomic status of

Pachydictyon coriaceum (Holmes) Okamura (Dictyotales, Phaeophyceae) based

on morphology and plastid protein coding rbcL, psaA, and psbA gene sequences.

Algae, 19(3), 175-190.

Jobb, G., Haeseler, A., & Strimmer, K. (2004). TREEFINDER: a powerful graphical

analysis environment for molecular phylogenetics. BMC Evolutionary Biology,

4(1), 18-26.

John, D. M., & Maggs, C. A. (1997). Species problems in eukaryotic algae: a modern

perspective. In M. F. Claridge, H. A. Dawah & M. R. Wilson (Eds.), The Units

of Biodiversity: Species in Practice (Vol. 54, pp. 83-107). London: Chapman

and Hall.

Joppa, L. N., Roberts, D. L., & Pimm, S. L. (2011). The population ecology and social

behavior of taxonomists. Trends in Ecology and Evolution, 26(11), 551-553.

Kawabata, S. (1962). A contribution to the systematic study of Grateloupiaceae from

Japan (2). Journal of Hokkaido Gakugei University, 13(2), 190-210.

Kawaguchi, S. (2004). Morphological observations of the type and some authentic

material of Halymenia floresia (Clemente y Rubio) C. Agardh, with notes on

previous reports of this alga. In I. A. Abbott & K. J. McDermid (Eds.),

Taxonomy of economic seaweeds with reference to the Pacific and other

locations (Vol. 9, pp. 143-156). Honolulu, Hawaii: Hawaii Sea Grant College

Program.

Kawaguchi, S., Kato, A., Masuda, M., Kogame, K., & Phang, S. M. (2002a).

Taxonomic notes on marine algae from Malaysia. VII. Five species of

Rhodophyceae, with the description of Lomentaria gracillima sp. nov. Botanica

Marina, 45(6), 536-547.

Univers

ity of

Mala

ya

143

Kawaguchi, S., & Lewmanomont, K. (1999). Morphology and culture study of a red

alga, Halymenia dilatata Zanardini, from Vietnam and Japan. In I. A. Abbott

(Ed.), Taxonomy of economic seaweeds with reference to some Pacific species

(Vol. 7, pp. 147-161). La Jolla, California: California Sea Grant College

Program.

Kawaguchi, S., Lewmanomont, K., & McDermid, K. J. (2002b). Morphology of

Halymenia maculata J. Agardh from Vietnam. In I. A. Abbott & K. J. Mcdermid

(Eds.), Taxonomy of economic seaweeds with reference to some Pacific species

(Vol. 8, pp. 259-266). La Jolla, California: California Sea Grant College

Program.

Kawaguchi, S., Shimada, S., Wang, H. W., & Masuda, M. (2004). The new genus

Yonagunia Kawaguchi et Masuda (Halymeniaceae, Rhodophyta), based on Y.

tenuifolia Kawaguchi et Masuda sp. nov. from Southern Japan and including Y.

formosana (Okamura) Kawaguchi et Masuda comb. nov. from Southeast Asia

Journal of Phycology, 40(1), 180-192.

Kawaguchi, S., Shimada, S., Wang, H. W., Faye, E. J., & Masuda, M. (2003). Polyopes

tosaensis Kawaguchi & Masuda, sp. nov. (Halymeniaceae, Rhodophyta) from

Japan. European Journal of Phycology, 38(4), 315-324.

Kawaguchi, S., Shimida, S., Abe, T., & Terada, R. (2006). Morphological and

molecular phylogenetic studies of a red alga, Halymenia durvillei,

(Halymeniaceae, Halymeniales) from Indo-Pacific. Coastal Marine Science,

30(1), 201-208.

Kawaguchi, S., Wang, H. W., Horiguchi, T., Sartoni, G., & Masuda, M. (2001). A

comparative study of the red alga Grateloupia filicina (Halymeniaceae) from the

northwestern Pacific and Mediterranean with the description of Grateloupia

asiatica, sp. nov. Journal of Phycology, 37(3), 433-442.

Kawai, H., & Sasaki, H. (2004). Morphology, life history, and molecular phylogeny of

Stschapovia flagellaris (Tilopteridales, Phaephyceae) and the erection of the

Stschapoviaceae fam. nov. Journal of Phycology, 40(6), 1156-1169.

Kazi, M. A., Reddy, C. R. K., & Jha, B. (2013). Molecular phylogeny and barcoding of

Caulerpa (Bryopsidales) based on the tufA, rbcL, 18S rDNA and ITS rDNA

genes. PLoS One, 8(12), e82438.

Kho, F. (2014). Biochemical composition of three red algae (Halymenia durvillaea

Bory de Saint-Vincent, Halymenia dilatata J. Agardh and Halymenia maculata

Zanardini) in Barangay Tubigan, Initao, Misamis Oriental. (Unpublished

Undergraduate's thesis). Mindanao State University, Philippines.

Univers

ity of

Mala

ya

144

Kho, F. B., Orbita, M. L. S., Manting, M. M. E., & Orbita, R. R. (2016). Carrageenan

and biochemical composition of three species of Halymenia (Halymenia

durvillaea Bory de Saint-Vincent, Halymenia maculata J. Agardh and

Halymenia dilatata Zanardini) in Initao, Misamis Oriental, Mindanao,

Philippines. International Journal of Biosciences, 8(5), 182-189.

Kim, S. Y., Manghisi, A., Morabito, M., Yang, E. C., Yoon, H. S., Miller, K. A., & Boo,

S. M. (2014). Genetic diversity and haplotype distribution of Pachymeniopsis

gargiuli sp. nov. and P. lanceolata (Halymeniales, Rhodophyta) in Korea, with

notes on their non-native distributions. Journal of Phycology, 50(5), 885-896.

Kim, S. Y., Seo, T. H., Park, J. K., Boo, G. H., Kim, K. M., & Boo, S. M. (2012).

Cryptonemia rotunda (Halymeniales) and Schizymenia apoda

(Nemastomatales), two new records of red algae from Korea. Algae, 27(1), 1-8.

Kraft, G. T., Liao, L. M., Millar, A. J. K., Coppejans, E. G. G., Hommersand, M. H., &

Freshwater, D. W. (1999). Marine benthic red algae (Rhodophyta) from Bulusan,

Sorsogon Province, Southern Luzon, Philippines. The Philippine Scientist, 36, 1-

50.

Kraft, G. T. (1977). The morphology of Grateloupia intestinalis from New Zealand,

with some thoughts on generic criteria within the family Cryptonemiaceae

(Rhodophyta). Phycologia, 16(1), 43-51.

Kraft, G. T., Liao, L. M., Millar, A. J. K., Coppejans, E. G. G., Hommersand, M. H., &

Freshwater, D. W. (1999). Marine benthic red algae (Rhodophyta) from

Bulusan, Sorsogon Province, Southern Luzon, Philippines. The Philippine

Scientist, 36, 1-50.

Kranz, H., Jürgens, K., Pinier, M., & Siepmann, J. (2009). Drug release from MCC-and

carrageenan-based pellets: experiment and theory. European Journal of

Pharmaceutics and Biopharmaceutics, 73(2), 302-309.

Kucera, H., & Saunders, G. W. (2008). Assigning morphological variants of Fucus

(Fucales, Phaeophyceae) in Canadian waters to recognized species using DNA

barcoding. Botany, 86(9), 1065-1079.

Kucera, H., & Saunders, G. W. (2012). A survey of Bangiales (Rhodophyta) based on

multiple molecular markers reveals cryptic diversity. Journal of Phycology,

48(4), 869-882.

Kumari, N., & Thakur, S. K. (2014). Randomly amplified polymorphic DNA-a brief

review. American Journal of Animal and Veterinary Sciences, 9(1), 6-13.

Univers

ity of

Mala

ya

145

Kützing, F. T. (1843). Phycologia generalis oder Anatomie, Physiologie und

Systemkunde der Tange. Mit 80 farbig gedruckten Tafeln, gezeichnet und gravirt

vom Verfasser. Leipzig: F.A. Brockhaus.

Kylin, H. (1956). Die Gattungen der Rhodophyceen. Lund: C. W. K. Gleerup.

Lai, M. F., Li, C. F., & Li, C. Y. (1994). Characterization and thermal behavior of six

sulphated polysaccharides from seaweeds. Food Hydrocolloids, 8(3-4), 215-232.

Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan, P. A.,

McWilliam, H., . . . Higgins, D. G. (2007). Clustal W and Clustal X version 2.0.

Bioinformatics, 23(21), 2947-2948.

Le Gall, L., & Saunders, G. W. (2007). A nuclear phylogeny of the Florideophyceae

(Rhodophyta) inferred from combined EF2, small subunit and large subunit

ribosomal DNA: establishing the new red algal subclass Corallinophycidae.

Molecular Phylogenetics and Evolution, 43(3), 1118-1130.

Le Gall, L., & Saunders, G. W. (2010). DNA barcoding is a powerful tool to uncover

algal diversity: a case study of the Phyllophoraceae (Gigartinales, Rhodophyta)

in the Canadian flora. Journal of Phycology, 46(2), 374-389.

Lee, H. W., Yang, M. Y., & Kim, M. S. (2016). Verifying a new distribution of the

genus Amalthea (Halymeniales, Rhodophyta) with description of A. rubida sp.

nov. from Korea. Algae, 31(4), 341-349.

Leitch, I. J., Greilhuber, J., Dolezel, J., & Wendel, J. (2013). Plant Genome Diversity

Volume 2: Physical Structure, Behaviour and Evolution of Plant Genomes.

Vienna: Springer-Verlag Wien.

Lewis, L. A., & Flechtner, V. R. (2004). Cryptic species of Scenedesmus (Chlorophyta)

from desert soil communities of Western North America. Journal of Phycology,

40(6), 1127-1137.

Leliaert, F., Smith, D. R., Moreau, H., Herron, M. D., Verbruggen, H., Delwiche, C. F.,

& De Clerck, O. (2012). Phylogeny and molecular evolution of the green algae.

Critical Reviews in Plant Sciences, 31(1), 1-46.

Univers

ity of

Mala

ya

146

Lewmanomont, K., & Kawaguchi, S. (2002). Foliose Halymenia (Halymeniaceae,

Cryptonemiales, Rhodophyta) from Thailand. In I. A. Abbott & K. J. McDermid

(Eds.), Taxonomy of economic seaweeds with reference to some Pacific species

(Vol. 8, pp. 267-277). La Jolla, California: California Sea Grant College

Program.

Li, S., Qiao, K., Shan, T., Pang, S., & Hou, H. (2013). Genetic diversity and

relationships of the brown alga Undaria pinnatifida cultivated along the Dalian

Coast as revealed by amplified fragment length polymorphism markers. Journal

of Applied Phycology, 25(4), 1255-1263.

Lim, P. E., Tan, J., Phang, S. M., Nikmatullah, A., Hong, D. D., Sunarpi, H., & Hurtado,

A. Q. (2013). Genetic diversity of Kappaphycus Doty and Eucheuma J. Agardh

(Solieriaceae, Rhodophyta) in Southeast Asia. Journal of Applied Phycology,

26(2), 1253-1272.

Lim, P. E., Thong, K. L., & Phang, S. M. (2001). Molecular differentiation of two

morphological variants of Gracilaria salicornia. Journal of Applied Phycology,

13(4), 335-342.

Lin, S. M., Liang, H. Y., & Hommersand, M. H. (2008). Two types of auxiliary cell

ampullae in Grateloupia (Halymeniaceae, Rhodophyta), including G.

taiwanensis sp. nov. and G. orientalis sp. nov. from Taiwan based on rbcL gene

sequences analysis and cystocarp development. Journal of Phycology, 44(1),

196-214.

Lincoln, R., Boxshall, G., & Clark, P. (1998). A dictionary of ecology, evolution and

systematics. Cambridge, UK: Cambridge University Press.

Lüning, K. (1990). Seaweeds: their environment, biogeography, and ecophysiology.

New York: John Wiley & Sons.

Mace, G. M., Gittleman, J. L., & Purvis, A. (2003). Preserving the tree of life. Science,

300(5626), 1707-1709.

Maggs, C. A., & Guiry, M. D. (1982). Morphology, phenology and photoperiodism in

Halymenia latifolia Kütz.(Rhodophyta) from Ireland. Botanica Marina, 25(12),

589-600.

Maggs, C. A., Verbruggen, H., & De Clerck, O. (2007). Molecular systematics of red

algae: building future structures on firm foundations. In J. Brodie & J. Lewis

(Eds.), Unravelling the algae: the past, present, and future of algal systematics

(Vol. 75, pp. 103-121). London: CRC Press.

Univers

ity of

Mala

ya

147

Malairaj, S., Muthu, S., Gopal, V. B., Perumal, P., & Ramasamy, R. (2016). Qualitative

and quantitative determination of R-phycoerythrin from Halymenia floresia

(Clemente) C. Agardh by polyacrylamide gel using electrophoretic elution

technique. Journal of Chromatography A, 1454, 120-126.

Manghisi, A., Morabito, M., Boo, G. H., Boo, S. M., Bonillo, C., De Clerck, O., & Le

Gall, L. (2015). Two novel species of Yonagunia (Halymeniales, Rhodophyta)

were uncovered in the South of Madagascar during the Atimo-Vatae Expedition.

Cryptogamie, Algologie, 36(2), 199-217.

Manhart, J. R., & McCourt, R. M. (1992). Molecular data and species concepts in the

algae. Journal of Phycology, 28(6), 730-737.

Mann, K. H. (1973). Seaweeds: their productivity and strategy for growth. Science,

182(4116), 975-981.

Marston, M., & Villalard-Bohnsack, M. (2002). Genetic variability and potential

sources of Grateloupia doryphora (Halymeniaceae, Rhodophyta), an invasive

species in Rhode Island waters (USA). Journal of Phycology, 38(4), 649-658.

Mateo-Cid, L. E., Mendoza-González, A. C., Gavio, B., & Fredericq, S. (2005).

Grateloupia huertana sp. nov.(Halymeniaceae, Rhodophyta), a peculiar new

prostrate species from tropical Pacific Mexico. Phycologia, 44(1), 4-16.

McHugh, D. J. (2003). Carrageenan. In A guide to the seaweed industry (pp. 61-72).

Retrieved from http://www.fao.org/3/a-y4765e.pdf

McIvor, L., Maggs, C. A., Provan, J., & Stanhope, M. J. (2001). RbcL sequences reveal

multiple cryptic introductions of the Japanese red alga Polysiphonia harveyi.

Molecular Ecology, 10(4), 911-919.

Meudt, H. M., & Clarke, A. C. (2007). Almost forgotten or latest practice? AFLP

applications, analyses and advances. Trends in Plant Science, 12(3), 106-117.

Milstein, D., & Saunders, G. W. (2012). DNA barcoding of Canadian Ahnfeltiales

(Rhodophyta) reveals a new species–Ahnfeltia borealis sp. nov. Phycologia,

51(3), 247-259.

Moniz, M. B. J., & Kaczmarska, I. (2010). Barcoding of diatoms: nuclear encoded ITS

revisited. Protist, 161(1), 7-34.

Univers

ity of

Mala

ya

148

Moreira, D., Le Guyader, H., & Philippe, H. (2000). The origin of red algae and the

evolution of chloroplasts. Nature, 405(6782), 69-72.

Müller, K. M., Oliveira, M. C., Sheath, R. G., & Bhattacharya, D. (2001). Ribosomal

DNA phylogeny of the Bangiophycidae (Rhodophyta) and the origin of

secondary plastids. American Journal of Botany, 88(8), 1390-1400.

Myers, N., Mittermeier, R. A., Mittermeier, C. G., Da Fonseca, G. A. B., & Kent, J.

(2000). Biodiversity hotspots for conservation priorities. Nature, 403(6772),

853-858.

Nam, K. W., Maggs, C. A., McIvor, L., & Stanhope, M. J. (2000). Taxonomy and

phylogeny of Osmundea (Rhodomelaceae, Rhodophyta) in Atlantic Europe.

Journal of Phycology, 36(4), 759-772.

Narendran, T. C. (2000). The importance of systematics. Resonance, 5(6), 60-68.

Nature (2002). Genomics and taxonomy for all. Nature, 417(6889), 573.

Newmaster, S. G., Fazekas, A. J., Steeves, R. A. D., & Janovec, J. (2008). Testing

candidate plant barcode regions in the Myristicaceae. Molecular Ecology

Resources, 8(3), 480-490.

Newmaster, S. G., & Ragupathy, S. (2009). Testing plant barcoding in a sister species

complex of pantropical Acacia (Mimosoideae, Fabaceae). Molecular Ecology

Resources, 9(s1), 172-180.

Ng, P. K., Lim, P. E., & Phang, S. M. (2015). Small-scale genetic structure of

Gracilaria salicornia and its red algal parasite, G. babae (Gracilariaceae,

Rhodophyta), in Malaysia. Botanica Marina, 58(3), 175-187.

Norris, J. N. (2014). Marine algae of the northern Gulf of California II: Rhodophyta.

Smithsonian Contributions to Botany, 96, 1-555.

Pang, Q., Sui, Z., Kang, K. H., Kong, F., & Zhang, X. (2010). Application of SSR and

AFLP to the analysis of genetic diversity in Gracilariopsis lemaneiformis

(Rhodophyta). Journal of Applied Phycology, 22(5), 607-612.

Parekh, R. G., Doshi, Y. A., & Chauhan, V. D. (1989). Polysaccharides from marine red

algae Acanthophora spicifera, Grateloupia indica and Halymenia porphyroides.

Indian Journal of Marine Sciences, 18, 139-140.

Univers

ity of

Mala

ya

149

Parekh, R. G., Doshi, Y. A., Rao, A. V., & Chauhan, V. D. (1987). Studies on a

phycocolloid from red alga Halymenia venusta Boergesen. Indian Journal of

Marine Sciences, 16, 274-276.

Patwardhan, A., Ray, S., & Roy, A. (2014). Molecular markers in phylogenetic studies-

a review. Journal of Phylogenetics & Evolutionary Biology, 2, 131.

Patwary, M. U., MacKay, R. M., & Meer, J. P. (1993). Revealing genetic markers in

Gelidium vagum (Rhodophyta) through the random amplified polymorphic

DNA (RAPD) technique. Journal of Phycology, 29(2), 216-222.

Patwary, M. U., Sensen, C. W., MacKay, R. M., & van der Meer, J. P. (1998).

Nucleotide sequences of small-subunit and internal transcribed spacer regions of

nuclear rRNA genes support the autonomy of some genera of the Gelidiales

(Rhodophyta). Journal of Phycology, 34(2), 299-305.

Pereira, L., van de Velde, F., & Mesquita, J. F. (2007). Cytochemical studies on

underutilized carrageenophytes (Gigartinales, Rhodophyta). International

Journal of Biology and Biomedical Engineering, 1(1), 1-5.

Phang, S. M. (2006). Seaweed resources in Malaysia: current status and future prospects.

Aquatic Ecosystem Health & Management Society, 9(2), 185-202

Phang, S. M., Yeong, H. Y., Ganzon-Fortes, E. T., Lewmanomont, K., Prathep, A., Hau,

L. N., . . . Tan, K. S. (2016). Marine algae of the South China Sea bordered by

Indonesia, Malaysia, Philippines, Singapore, Thailand and Vietnam. Raffles

Bulletin of Zoology Supplement, 34, 13-59.

Pierce, J. C., Tan, G., & Gaffney, P. M. (2000). Delaware Bay and Chesapeake Bay

populations of the horseshoe crab Limulus polyphemus are genetically distinct.

Estuaries, 23(5), 690-698.

Presting, G. G. (2006). Identification of conserved regions in the plastid genome:

implications for DNA barcoding and biological function. Botany, 84(9), 1434-

1443.

Pueschel, C. M. (1990). Cell structure. In K. M. Cole & R. G. Sheath (Eds.), Biology of

the red algae (pp. 7-41). New York: Cambridge University Press.

Pueschel, C. M., & Cole, K. M. (1982). Rhodophycean pit plugs: an ultrastructural

survey with taxonomic implications. American Journal of Botany, 69(5), 703-

720.

Univers

ity of

Mala

ya

150

Ragan, M. A., Bird, C. J., Rice, E. L., Gutell, R. R., Murphy, C. A., & Singh, R. K.

(1994). A molecular phylogeny of the marine red algae (Rhodophyta) based on

the nuclear small-subunit rRNA gene. Proceedings of the National Academy of

Sciences, 91(15), 7276-7280.

Rambaut, A., & Drummond, A. J. (2009a). FigTree (Version 1.3.1). Retrieved from

http://tree.bio.ed.ac.uk /software/figtree

Rambaut, A., & Drummond, A. J. (2009b). Tracer (Version 1.5). Retrieved from

http://beast.bio.ed.ac.uk/Tracer

Robba, L., Russell, S. J., Barker, G. L., & Brodie, J. (2006). Assessing the use of the

mitochondrial cox1 marker for use in DNA barcoding of red algae (Rhodophyta).

American Journal of Botany, 93(8), 1101-1108.

Rojas, M. (1992). The species problem and conservation: what are we protecting?

Conservation Biology, 6(2), 170-178.

Ronquist, F., & Huelsenbeck, J. P. (2003). MrBayes 3: Bayesian phylogenetic inference

under mixed models. Bioinformatics, 19(12), 1572-1574.

Roy, S. S., Dasgupta, R., & Bagchi, A. (2014). A review on phylogenetic analysis: a

journey through modern era. Computational Molecular Bioscience, 4(3), 39-45.

Rueness, J. (1989). Sargassum muticum and other introduced Japanese macroalgae:

biological pollution of European coasts. Marine Pollution Bulletin, 20(4), 173-

176.

Rueness, J. (2010). DNA barcoding of select freshwater and marine red algae

(Rhodophyta). Cryptogamie, Algologie, 31(4), 377.

Rueness, J., & Rueness, E. K. (2000). Caulacanthus ustulatus (Gigartinales,

Rhodophyta) from Brittany (France) is an introduction from the Pacific Ocean.

Cryptogamie, Algologie, 21(4), 355-363.

Russell, L. K., Hurd, C. L., Nelson, W. A., & Broom, J. E. (2009). An examination of

Pachymenia and Aeodes (Halymeniaceae, Rhodophyta) in New Zealand and the

transfer of two species of Aeodes in South Africa to Pachymenia. Journal of

Phycology, 45(6), 1389-1399.

Univers

ity of

Mala

ya

151

Samper, C. (2004). Taxonomy and environmental policy. Philosophical Transactions of

the Royal Society of London B: Biological Sciences, 359(1444), 721-728.

Saunders, G. W. (1993). Gel purification of red algal genomic DNA: an inexpensive

and rapid method for the isolation of polymerase chain reaction- friendly DNA.

Journal of Phycology, 29(2), 251-254.

Saunders, G. W. (2005). Applying DNA barcoding to red macroalgae: a preliminary

appraisal holds promise for future applications. Philosophical Transactions of

the Royal Society B: Biological Sciences, 360(1462), 1879-1888.

Saunders, G.W. (2008). A DNA barcode examination of the red algal family

Dumontiaceae in Canadian waters reveals substantial cryptic species diversity. 1.

The foliose Dilsea-Neodilsea complex and Weeksia. Botany, 86(7), 773-789.

Saunders, G. W. (2009). Routine DNA barcoding of Canadian Gracilariales

(Rhodophyta) reveals the invasive species Gracilaria vermiculophylla in British

Columbia. Molecular Ecology Resources, 9(s1), 140-150.

Saunders, G. W. (2014). Long distance kelp rafting impacts seaweed biogeography in

the Northeast Pacific: the kelp conveyor hypothesis. Journal of Phycology, 50(6),

968-974.

Saunders, G. W., & Hommersand, M. H. (2004). Assessing red algal supraordinal

diversity and taxonomy in the context of contemporary systematic data.

American Journal of Botany, 91(10), 1494-1507.

Saunders, G. W., & Kraft, G. T. (1996). Small-subunit rRNA gene sequences from

representatives of selected families of the Gigartinales and Rhodymeniales

(Rhodophyta). 2. Recognition of the Halymeniales ord. nov. Canadian Journal

of Botany, 74(5), 694-707.

Saunders, G. W., & Kucera, H. (2010). An evaluation of rbcL, tufA, UPA, LSU and ITS

as DNA barcode markers for the marine green macroalgae. Cryptogamie,

Algologie, 31(4), 487-528.

Saunders, G. W., & McDevit, D. C. (2013). DNA barcoding unmasks overlooked

diversity improving knowledge on the composition and origins of the Churchill

algal flora. BMC Ecology, 13(1), 9.

Univers

ity of

Mala

ya

152

Saunders, G. W., & McDonald, B. (2010). DNA barcoding reveals multiple overlooked

Australian species of the red algal order Rhodymeniales (Florideophyceae), with

resurrection of Halopeltis J. Agardh and description of Pseudohalopeltis gen.

nov. Botany, 88(7), 639-667.

Saunders, G. W., & Moore, T. E. (2013). Refinements for the amplification and

sequencing of red algal DNA barcode and RedToL phylogenetic markers: a

summary of current primers, profiles and strategies. Algae, 28(1), 31-43.

Savolainen, V., Cowan, R. S., Vogler, A. P., Roderick, G. K., & Lane, R. (2005).

Towards writing the encyclopaedia of life: an introduction to DNA barcoding.

Philosophical Transactions of the Royal Society B: Biological Sciences,

360(1462), 1805-1811.

Schaffelke, B., Smith, J. E., & Hewitt, C. L. (2006). Introduced macroalgae- a growing

concern. Journal of Applied Phycology, 18, 529-541.

Schneider, C. W., Lane, C. E., & Saunders, G. W. (2010). Notes on the marine algae of

the Bermudas. 11. More additions to the benthic flora and a phylogenetic

assessment of Halymenia pseudofloresii (Halymeniales, Rhodophyta) from its

type locality. Phycologia, 49(2), 154-168.

Searles, R. B. (1980). The strategy of the red algal life history. The American Naturalist,

115(1), 113-120.

Semesi, A. K., & Mshigeni, K. E. (1977). Contributions on the content and nature of the

phycocolloid from Halymenia venusta Boergesen (Rhodophyta,

Cryptonemiales). Botanica Marina, 20(4), 233-238.

Shan, T. F., Pang, S. J., Zhang, Y. R., Yakovleva, I. M., & Skriptsova, A. V. (2011). An

AFLP-based survey of genetic diversity and relationships of major farmed

cultivars and geographically isolated wild populations of Saccharina japonica

(Phaeophyta) along the northwest coasts of the Pacific. Journal of Applied

Phycology, 23(1), 35-45.

Sherwood, A. R. (2008). Phylogeography of Asparagopsis taxiformis

(Bonnemaisoniales, Rhodophyta) in the Hawaiian Islands: two mtDNA markers

support three separate introductions. Phycologia, 47(1), 79-88.

Sherwood, A. R., Kurihara, A., Conklin, K. Y., Sauvage, T., & Presting, G. G. (2010a).

The Hawaiian Rhodophyta Biodiversity Survey (2006-2010): a summary of

principal findings. BMC Plant Biology, 10, 258.

Univers

ity of

Mala

ya

153

Sherwood, A. R., & Presting, G. G. (2007). Universal primers amplify a 23S rDNA

plastid marker in eukaryotic algae and cyanobacteria. Journal of Phycology,

43(3), 605-608.

Sherwood, A. R., Sauvage, T., Kurihara, A., Conklin, K. Y., & Presting, G. G. (2010b).

A comparative analysis of COI, LSU and UPA marker data for the Hawaiian

florideophyte Rhodophyta: implications for DNA barcoding of red algae.

Cryptogamie, Algologie, 31(4), 451-465.

Sherwood, A. R., Vis, M. L., Entwisle, T. J., Necchi, O. Jr., & Presting, G. G. (2008).

Contrasting intra versus interspecies DNA sequence variation for representatives

of the Batrachospermales (Rhodophyta): insights from a DNA barcoding

approach. Phycological Research, 56(4), 269-279.

Silva, P. C., Meñez, E. G., & Moe, R. L. (1987). Catalog of the benthic marine algae of

the Philippines. Smithsonian Contributions to Marine Sciences, 27, 1-179.

Singh, A. K. (2012). Molecular taxonomy: use of modern methods in the identification

of a species. Indian Journal of Life Science, 2(1), 143-147.

Smith, J. E., Hunter, C. L., & Smith, C. M. (2002). Distribution and reproductive

characteristics of nonindigenous and invasive marine algae in the Hawaiian

Islands. Pacific Science, 56(3), 299-315.

Sodhi, N. S., Koh, L. P., Brook, B. W., & Ng, P. K. L. (2004). Southeast Asian

biodiversity: an impending disaster. Trends in Ecology & Evolution, 19(12),

654-660.

Soltis, D. E., & Soltis, P. S. (2003). The role of phylogenetics in comparative genetics.

Plant Physiology, 132(4), 1790-1800.

Spolaore, P., Joannis-Cassan, C., Duran, E., & Isambert, A. (2006). Commercial

applications of microalgae. Journal of Bioscience and Bioengineering, 101(2),

87-96.

Staats, M., Cuenca, A., Richardson, J. E., Vrielink-van Ginkel, R., Petersen, G., Seberg,

O., & Bakker, F. T. (2011). DNA damage in plant herbarium tissue. PLoS One,

6(12), e28448.

Swofford, D. L. (2003). PAUP*. Phylogenetic analysis using parsimony (* and other

methods) (Version 4). Sunderland, Massachusetts: Sinauer Associates.

Univers

ity of

Mala

ya

154

Swofford, D. L., Olsen, G. J., Waddell, P. J., Hillis, D. M., & Hillis, D. M. (1996).

Phylogenetic Inference. In D. M. Hiillis, D. Moritz & B. K. Mable (Eds.),

Molecular Systematics (pp. 407-514). Sunderland, Massachusetts: Sinauer

Associates.

Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6:

Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and

Evolution, 30(12), 2725-2729.

Tan, J., Lim, P. E., & Phang, S. M. (2013). Phylogenetic relationship of Kappaphycus

Doty and Eucheuma J. Agardh (Solieriaceae, Rhodophyta) in Malaysia. Journal

of Applied Phycology, 25(1), 13-29

Tan, J., Lim, P. E., Phang, S. M., Hong, D. D., Sunarpi, H., & Hurtado, A. Q. (2012).

Assessment of four molecular markers as potential DNA barcodes for red algae

Kappaphycus Doty and Eucheuma J. Agardh (Solieriaceae, Rhodophyta). PLoS

One, 7(12), e52905.

Tan, P. L., Lim, P. E., Lin, S. M., Phang, S. M., Draisma, S. G. A., & Liao, L. M.

(2015). Foliose Halymenia species (Halymeniaceae, Rhodophyta) from

Southeast Asia, including a new species, Halymenia malaysiana sp. nov.

Botanica Marina, 58(3), 203-217.

Tan, P. L., Lim, P. E., Lin, S. M., & Phang, S. M. (2017). Halymenia johorensis sp. nov.

(Halymeniaceae, Rhodophyta), a new foliose red algal species from Malaysia.

Journal of Applied Phycology. doi:10.1007/s10811-017-1104-8

Tanabe, A. S. (2007). Kakusan: a computer program to automate the selection of a

nucleotide substitution model and the configuration of a mixed model on

multilocus data. Molecular Ecology Notes, 7(6), 962-964.

Taylor, W. R. (1960). Marine algae of the eastern tropical and subtropical coasts of the

Americas. Ann Arbor: University of Michigan Press.

Teasdale, B. W., & Klein, A. S. (2010). Genetic variation and biogeographical

boundaries within the red alga Porphyra umbilicalis (Bangiales, Rhodophyta).

Botanica Marina, 53(5), 417-431.

Tsutsui, I., Hamano, K., Aue-Umneoy, D., Songphatkaew, J., Srisapoome, P.,

Ruangsomboon, S., . . . Maeno, Y. (2012). Common underwater plants in

coastal areas of Thailand. Tsukuba: Japan International Research Center for

Agricultural Sciences.

Univers

ity of

Mala

ya

155

Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., Faircloth, B. C., Remm, M., &

Rozen, S. G. (2012). Primer3- new capabilities and interfaces. Nucleic Acids

Research, 40(15), e115.

Uwai, S., Nelson, W., Neill, K., Wang, W. D., Aguilar-Rosas, L. E., Boo, S. M., . . .

Kawai, H. (2006a). Genetic diversity in Undaria pinnatifida (Laminariales,

Phaeophyceae) deduced from mitochondria genes-origins and succession of

introduced populations. Phycologia, 45(6), 687-695.

Uwai, S., Yotsukura, N., Serisawa, Y., Muraoka, D., Hiraoka, M., & Kogame, K.

(2006b). Intraspecific genetic diversity of Undaria pinnatifida in Japan, based

on the mitochondrial cox3 gene and the ITS1 of nrDNA. Hydrobiologia, 553(1),

345-356.

Valentin, K., & Zetsche, K. (1989). The genes of both subunits of ribulose-1, 5-

bisphosphate carboxylase constitute an operon on the plastome of a red alga.

Current Genetics, 16(3), 203-209.

Valero, M., Engel, C., Billot, C., Kloareg, B., & Destombe, C. (2001). Concept and

issues of population genetics in seaweeds. Cahiers de Biologie Marine, 42(1-2),

53-62.

van den Hoek, C., & Cortel-Breeman, A. (1970). Life-history studies on Rhodophyceae

II. Halymenia floresia (Clem.) Ag. Acta Botanica Neerlandica, 19(3), 341-362.

van den Hoek, C., Mann, D. G., & Jahns, H. M. (1995). Algae: an introduction to

phycology. New York: Cambridge University Press.

van Oppen, M. J. H., Klerk, H., Olsen, J. L., & Stam, W. T. (1996). Hidden diversity in

marine algae: some examples of genetic variation below the species level.

Journal of the Marine Biological Association of the United Kingdom, 76(1),

239-242.

van Velzen, R., Weitschek, E., Felici, G., & Bakker, F. T. (2012). DNA barcoding of

recently diverged species: relative performance of matching methods. PLoS One,

7(1), e30490.

Verheij, E., & Prud’Homme van Reine, W. F. (1993). Seaweeds of the Spermonde

Archipelago, SW Sulawesi, Indonesia. Blumea, 37(2), 385-510.

Univers

ity of

Mala

ya

156

Verbruggen, H., Maggs, C. A., Saunders, G. W., Le Gall, L., Yoon, H. S., & De Clerck,

O. (2010). Data mining approach identifies research priorities and data

requirements for resolving the red algal tree of life. BMC Evolutionary Biology,

10(1), 16.

Vis, M. L., Hodge, J. C., & Necchi, O. Jr. (2008). Phylogeography of Batrachospermum

macrosporum (Batrachospermales, Rhodophyta) from North and South America.

Journal of Phycology, 44(4), 882-888.

Vogler, A. P., & Monaghan, M. T. (2007). Recent advances in DNA taxonomy. Journal

of Zoological Systematics and Evolutionary Research, 45(1), 1-10.

Voris, H. K. (2000). Maps of Pleistocene sea levels in Southeast Asia: shorelines, river

systems and time durations. Journal of Biogeography, 27(5), 1153-1167.

Vos, P., Hogers, R., Bleeker, M., Reijans, M., Van de Lee, T., Hornes, M., . . . Kuiper,

M. (1995). AFLP: a new technique for DNA fingerprinting. Nucleic Acids

Research, 23(21), 4407-4414.

Wägele, J. W. (2005). Foundations of phylogenetic systematics. München, Germany:

Verlag Dr. Friedrich Pfeil

Wang, H. W., Kawaguchi, S., Horiguchi, T., & Masuda, M. (2000). Reinstatement of

Grateloupia catenata (Rhodophyta, Halymeniaceae) on the basis of morphology

and rbcL sequences. Phycologia, 39(3), 228-237.

Wang, H. W., Kawaguchi, S., Horiguchi, T., & Masuda, M. (2001). A morphological

and molecular assessment of the genus Prionitis J. Agardh (Halymeniaceae,

Rhodophyta). Phycological Research, 49(3), 251-261.

Weber-Van Bosse, A. (1921). Liste des algues du Siboga. II. Rhodophyceae. Premiere

partie. Protoflorideae, Nemalionales, Cryptonemiales. Siboga-Expeditie

Monograph, 59, 187-310.

Wilkes, R. J., McIvor, L. M., & Guiry, M. D. (2005). Using rbcL sequence data to

reassess the taxonomic position of some Grateloupia and Dermocorynus species

(Halymeniaceae, Rhodophyta) from the north-eastern Atlantic. European

Journal of Phycology, 40(1), 53-60.

Williams, J. G., Kubelik, A. R., Livak, K. J., Rafalski, J. A., & Tingey, S. V. (1990).

DNA polymorphisms amplified by arbitrary primers are useful as genetic

markers. Nucleic Acids Research, 18(22), 6531-6535.

Univers

ity of

Mala

ya

157

Wittmann, W. (1965). Aceto-iron-haematoxylin-chloral hydrate for chromosome

staining. Stain Technology, 40(3), 161-164.

Woelkerling, W. J. (1990). An introduction. In K. M. Cole & R. G. Sheath (Eds.),

Biology of the red algae (pp. 1-6). New York: Cambridge University Press.

Womersley, H. B. S., & Lewis, J. A. (1994). Family Halymeniaceae Bory 1828: 158. In

H. B. S. Womersley (Ed.), The Marine Benthic Flora of Southern Australia.

Part IIIA. (pp. 167-218). Canberra: Australian Biological Resources Study.

Wright, J. T., Zuccarello, G. C., & Steinberg, P. D. (2000). Genetic structure of the

subtidal red alga Delisea pulchra. Marine Biology, 136(3), 439-448.

Wright, S. (1920). The relative importance of heredity and environment in determining

the piebald pattern of guinea-pigs. Proceedings of the National Academy of

Sciences of the United States of America, 6(6), 320-332.

Wyrtki, K. (1961). Physical oceanography of the Southeast Asian waters. In Scientific

results of marine investigations of the South China Sea and the Gulf of Thailand

1959-1961 (Vol. 2, pp. 195). La Jolla, California: Scripps Institution of

Oceanography.

Xie, Z. Y., Lin, S. M., Liu, L. C., Ang, P. O., & Shyu, J. F. (2015). Genetic diversity

and taxonomy of foliose Bangiales (Rhodophyta) from Taiwan based on rbcL

and cox1 sequences. Botanica Marina, 58(3), 189-202.

Yang, E. C., Kim, M. S., Geraldino, P. J. L., Sahoo, D., Shin, J.-A., & Boo, S. M.

(2008). Mitochondrial cox1 and plastid rbcL genes of Gracilaria

vermiculophylla (Gracilariaceae, Rhodophyta). Journal of Applied Phycology,

20(2), 161-168.

Yang, M. Y., Geraldino, P. J. L., & Kim, M. S. (2013a). DNA barcode assessment of

Gracilaria salicornia (Gracilariaceae, Rhodophyta) from Southeast Asia.

Botanical Studies, 54(1), 27.

Yang, M. Y., Han, E. G., & Kim, M. S. (2013b). Molecular identification of

Grateloupia elliptica and G. lanceolata (Rhodophyta) inferred from plastid rbcL

and mitochondrial COI genes sequence data. Genes & Genomics, 35(2), 239-246.

Univers

ity of

Mala

ya

158

Yang, M. Y., & Kim, M. S. (2014). Taxonomy of Grateloupia (Halymeniales,

Rhodophyta) by DNA barcode marker analysis and a description of

Pachymeniopsis volvita sp. nov. Journal of Applied Phycology, 27(3), 1373-

1384.

Yang, Z., & Rannala, B. (2012). Molecular phylogenetics: principles and practice.

Nature Reviews Genetics, 13(5), 303-314.

Yi, H., Sui, Z., & Bao, Z. (2010). Preliminary analysis of population genetic diversity of

cultivated Laminaria japonica sporophyte via AFLP technique. Journal of

Ocean University of China, 9(1), 53-58.

Yoon, H. S., Müller, K. M., Sheath, R. G., Ott, F. D., & Bhattacharya, D. (2006).

Defining the major lineages of red algae (Rhodophyta). Journal of Phycology,

42(2), 482-492.

Yoon, H. S., Zuccarello, G. C., & Bhattacharya, D. (2010). Evolutionary history and

taxonomy of red algae. In J. Seckbach & D. J. Chapman (Eds.), Red algae in the

genomic age (Vol. 13, pp. 25-42). Netherlands: Springer Science.

Yoshida, T., Stiger, V., & Horiguchi, T. (2000). Sargassum boreale sp. nov.(Fucales,

Phaeophyceae) from Hokkaido, Japan. Phycological Research, 48(3), 125-131.

Yow, Y. Y., Lim, P. E., & Phang, S. M. (2011). Genetic diversity of Gracilaria changii

(Gracilariaceae, Rhodophyta) from west coast, Peninsular Malaysia based on

mitochondrial cox1 gene analysis. Journal of Applied Phycology, 23(2), 219-226.

Yow, Y. Y., Lim, P. E., & Phang, S. M. (2013). Assessing the use of mitochondrial

cox1 gene and cox2-3 spacer for genetic diversity study of Malaysian Gracilaria

changii (Gracilariaceae, Rhodophyta) from Peninsular Malaysia. Journal of

Applied Phycology, 25(3), 831-838.

Zanardini, G. (1851). Algae novae vel minus cognitae in mari Rubro a Portiero

collectae. Flora, 34, 33-38.

Zanardini, G. (1858). Plantarum in mari Rubro hucusque collectarum enumeratio

(juvante A. Figari). Memorie delle Reale istituto Veneto di scienze, lettere ed

arti, 7, 209-309.

Univers

ity of

Mala

ya

159

Zhang, D., Sui, Z. H., Yi, H., Tong, Z., & Bao, Z. M. (2009). The genetic diversity

analysis of the sporophyte s of Undaria pinnatifida (Phaeophyceae) for Qingdao

population by AFLP markers. Periodical of Ocean University of China, 39(4),

664-668.

Zuccarello, G. C., Buchanan, J., & West, J. A. (2006). Increased sampling for inferring

phylogeographic patterns in Bostrychia radicans/ B. moritziana

(Rhodomelaceae, Rhodophyta) in the eastern USA. Journal of Phycology, 42(6),

1349-1352.

Zuccarello, G. C., Sandercock, B., & West, J. (2002). Diversity within red algal species:

variation in world-wide samples of Spyridia filamentosa (Ceramiaceae) and

Murrayella periclados (Rhodomelaceae) using DNA markers and breeding

studies. European Journal of Phycology, 37(3), 403-417.

Zuccarello, G. C., & West, J. A. (2002). Phylogeography of the Bostrychia calliptera–

B. pinnata complex (Rhodomelaceae, Rhodophyta) and divergence rates based

on nuclear, mitochondrial and plastid DNA markers. Phycologia, 41(1), 49-60.

Zuccarello, G. C., & West, J. A. (2003). Multiple cryptic species: molecular diversity

and reproductive isolation in the Bostrychia radicans/B. moritziana complex

(Rhodomelaceae, Rhodophyta) with focus on North American isolates. Journal

of Phycology, 39(5), 948-959.

Zuccarello, G. C., & West, J. A. (2011). Insights into evolution and speciation in the red

alga Bostrychia: 15 years of research. Algae, 26(1), 21-32.

Zuccarello, G. C., West, J. A., Kamiya, M., & King, R. J. (1999). A rapid method to

score plastid haplotypes in red seaweeds and its use in determining parental

inheritance of plastids in the red alga Bostrychia (Ceramiales). Hydrobiologia,

401, 207-214.

Univers

ity of

Mala

ya

160

LIST OF PUBLICATIONS AND PAPERS PRESENTED

Publications

1. Tan, P.-L., Lim, P.-E., Lin, S.-M., Phang, S.-M., Draisma, S. G. A., & Liao, L. M.

(2015). Foliose Halymenia species (Halymeniaceae, Rhodophyta) from Southeast

Asia, including a new species, Halymenia malaysiana sp. nov. Botanica Marina,

58(3), 203-217.

2. Tan, P.-L., Lim, P.-E., Lin, S.-M., & Phang, S.-M. (2017). Halymenia johorensis sp.

nov. (Halymeniaceae, Rhodophyta), a new foliose red algal species from Malaysia.

Journal of Applied Phycology. doi:10.1007/s10811-017-1104-8

Conference and seminar presentations

1. Phylogeny Study of Halymenia from Parts of South East Asian Countries at the 3rd

World Conference on Marine Diversity, 12-16 October 2014, Qingdao, China

2. Phylogenetic relationships of Halymenia (Halymeniaceae, Rhodophyta) from

Southeast Asia based on rbcL sequences at the 19th

Biological Sciences Graduate

Congress (BSGC), 12-13 December 2014, National University of Singapore,

Singapore.

3. Introduction to foliose Halymenia (Halymeniaceae, Rhodophyta) from Southeast

Asia including the description of one new species, Halymenia malaysiana for the

Institute of Biological Sciences Postgraduate Seminar, University of Malaya, on the

22 April 2015.

Posters presented

1. Molecular delineation of species in Halymenia (Halymeniaceae, Rhodophyta) from

Southeast Asia at the 9th

Asia-Pacific Conference on Algal Biotechnology (APCAB),

15-18 November 2016, Bangkok, Thailand.

Univers

ity of

Mala

ya

Botanica Marina 2015; 58(3): 203–217

*Corresponding authors: Phaik-Eem Lim, Instititute of Ocean and Earth Sciences, University of Malaya, 50603 Kuala Lumpur, Malaysia; and Institute of Biological Sciences, University of Malaya, 50603 Kuala Lumpur, Malaysia, e-mail: phaikeem@um.edu.my; and Showe-Mei Lin, Institute of Marine Biology, National Taiwan Ocean University, Keelung 20224, Taiwan, R.O.C., e-mail: linsm@ntou.edu.twPui-Ling Tan and Siew-Moi Phang: Instititute of Ocean and Earth Sciences, University of Malaya, 50603 Kuala Lumpur, Malaysia; and Institute of Biological Sciences, University of Malaya, 50603 Kuala Lumpur, MalaysiaStefano G.A. Draisma: Instititute of Ocean and Earth Sciences, University of Malaya, 50603 Kuala Lumpur, Malaysia; and Faculty of Science, Department of Biology, Prince of Songkla University, Hatyai, Songkhla, 90112 ThailandLawrence M. Liao: Graduate School of Biosphere Science, Hiroshima University, 1-4-4 Kagamiyama, Higashi-Hiroshima 739-8528, Japan

Pui-Ling Tan, Phaik-Eem Lim*, Showe-Mei Lin*, Siew-Moi Phang, Stefano G.A. Draisma and Lawrence M. Liao

Foliose Halymenia species (Halymeniaceae, Rhodophyta) from Southeast Asia, including a new species, Halymenia malaysiana sp. nov.

Abstract: Despite the large number of species discov-ered in Halymenia, many remain poorly known due to the scarce information available. In order to facilitate species discrimination of foliose Halymenia species in Southeast Asia, molecular analysis and morphologi-cal studies were made on Halymenia collections from Malaysia, the Philippines, and Indonesia. The rbcL phy-logenetic analyses showed that there are at least six taxa of foliose Halymenia occurring in Southeast Asia. Among the six taxa, a new species, Halymenia malaysiana P.-L. Tan, P.-E. Lim, S.-M. Lin et S.-M. Phang, is proposed based on both rbcL sequence analyses and morphologi-cal observations. Halymenia malaysiana is characterized by thalli possessing oblong or suborbiculate blades with a supple cartilaginous structure and gelatinous (slimy) texture, arising from a small discoid holdfast without a stipe, abruptly expanding into a broad blade and having a smooth surface with sinusoidally undulated margins. The phylogenetic analyses also revealed that Halymenia is a polyphyletic genus, which requires further taxonomic studies.

Keywords: Halymenia malaysiana sp. nov.; red algae; Southeast Asia; taxonomy.

DOI 10.1515/bot-2015-0004Received 7 January, 2015; accepted 24 April, 2015

IntroductionThe red algal genus Halymenia C. Agardh, comprising 69 currently accepted species, is one of the largest genera in terms of species within the family Halymeniaceae (De Smedt et al. 2001, Guiry and Guiry 2014). It is mostly dis-tributed in tropical and subtropical regions (Gargiulo et al. 1986, Kawaguchi and Lewmanomont 1999, Hernán-dez-Kantun et  al. 2009). The genus is mainly character-ized by gelatinous thalli, presence of anticlinal filaments and refractive ganglionic cells in the medulla, stellate cells in the inner cortex, and auxiliary cell ampullae with branched secondary filaments (Balakrishnan 1961, Abbott 1967, Chiang 1970, De Smedt et al. 2001).

Halymenia was established by C. Agardh (1817) and the generitype is Halymenia floresii (Clemente) C. Agardh collected from Cádiz, Spain. Chiang (1970) used the archi-tecture of auxiliary cell ampullae as a primary feature to group species at the generic level in the Halymeniaceae. According to Chiang’s generic concept, simple or once or more branched secondary ampullar filaments may emerge from long and slender primary ampullary filaments in Halymenia-type auxiliary cell ampullae. The auxiliary cell ampulla of Halymenia is flattish, expanded when mature, and is intermediate between the Grateloupia-type and the Cryptonemia-type of ampulla based on its shape and the degree of branching (Chiang 1970). Several attempts have been made to study foliose Halymenia species in Southeast Asia. Kawaguchi and Lewmanomont (1999) made a detailed morphological study of Halyme-nia dilatata Zanardini by comparing the vegetative and reproductive features of the material from Vietnam and

Brought to you by | National Taiwan Ocean UniversityAuthenticated | cityupang@yahoo.com

Download Date | 6/23/15 2:16 AM

Univers

ity of

Mala

ya

9TH ASIA PACIFIC CONFERENCE ON ALGAL BIOTECHNOLOGY- BANGKOK

Halymenia johorensis sp. nov. (Halymeniaceae, Rhodophyta),a new foliose red algal species from Malaysia

Pui-Ling Tan1,2& Phaik -Eem Lim1

& Showe-Mei Lin3& Siew-Moi Phang1,2

Received: 5 December 2016 /Revised and accepted: 19 February 2017# Springer Science+Business Media Dordrecht 2017

Abstract A new Halymenia species, Halymenia johorensissp. nov., from southern Peninsular Malaysia is proposed basedon plastid-encoded large subunit of ribulose-1,5-bisphosphatecarboxylase/oxygenase (rbcL) gene analyses and detailedmorphological observations. The new species is characterizedby having (1) elliptical, oblong, or irregularly shaped blades,incised with some perforations, arising from a narrow-cuneatestipe attached to a discoid holdfast; (2) blades with a cartilag-inous and gelatinous texture, a smooth to rugose surface, andirregularly dentate and cleft margins; and (3) isodiametric out-er cortical cells and rounded to stellate inner cortical cells.RbcL sequence analyses have shown H. johorensis to be ge-netically distinct from other Halymenia species. AlthoughH. johorensis is sister to Halymenia plana, these two speciescan be distinguished both molecularly and morphologically.Further studies are necessary to investigate the phylogeneticrelationships and species diversity in this genus.

Keywords Halymenia johorensis . Malaysia . New species .

rbcL . Rhodophyta . Taxonomy

Introduction

The marine red algal genus Halymenia C. Agardh is one ofseveral species-rich red algal genera in the familyHalymeniaceae and includes 79 taxonomically accepted spe-cies (Guiry and Guiry 2016), widely distributed in tropical andsubtropical regions (Gargiulo et al. 1986; Hernández-Kantúnet al. 2012; Tan et al. 2015). Agardh (1817) established theHalymenia based on the generitype, Halymenia floresii(Clemente) C. Agardh, from Cádiz, Spain.

Generic concepts of Halymenia are based largely on thestructure of auxiliary cell ampullae, as proposed by Chiang(1970), and the presence of anticlinal medullary filaments(Abbott 1967). However, several authors believe that vegeta-tive features are more diagnostic than reproductive characters,which overlap greatly among genera of Halymeniaceae(Abbott 1967; Guimarães and Fujii 1998; Hernández-Kantún et al. 2012). Vegetative features used to delineate spe-cies of Halymenia include habit, thallus size, blade margin,order of branching, presence or absence of a midrib in thebasal region, presence or absence of a stipe, presence or ab-sence of marginal proliferations, presence or absence of papil-lae or spines on thallus surface, blade thickness, cortex thick-ness, shape of inner cortical cells, inner cortical cell size, andpresence or absence of refractive ganglionic cells (Guimarãesand Fujii 1998; De Smedt et al. 2001; Ballantine and Ruiz2004; Hernández-Kantún et al. 2012; Tan et al. 2015;Azevedo et al. 2016).

To date, six species of Halymenia have been reported fromMalaysia, including three foliose species, H. dilatataZanardini, H. maculata J. Agardh, and H. malaysiana P-LTan, P-E Lim, S-M Lin & S-M Phang (Kawaguchi et al.2002; Tan et al. 2015; Phang et al. 2016). Kawaguchi et al.(2002) confirmed the existence of two foliose species(H. dilatata and H. maculata) and one branched species

* Phaik -Eem Limphaikeem@um.edu.my

1 Institute of Ocean and Earth Sciences, University of Malaya,50603 Kuala Lumpur, Malaysia

2 Institute of Biological Sciences, University of Malaya, 50603 KualaLumpur, Malaysia

3 Institute of Marine Biology, National Taiwan Ocean University,Keelung 20224, Taiwan, Republic of China

J Appl PhycolDOI 10.1007/s10811-017-1104-8

Univers

ity of

Mala

ya

16

1

Appendix A: List of specimens examined in this study with information on herbarium number, locality, collector, date of collection and field number.

Taxa Herbarium

number

Locality and collector Date of collection Field number DNA sequences and GenBank accession

numbers where applicable rbcL/COI-

5P/UPA/LSU (28S rDNA)

Halymenia cf. dilatata

Zanardini

PSM12857 Camiguin Island, Philippines

S. Draisma

4 April 2014 SGAD1404050 + (KP202340) / - / -

Halymenia durvillei

Bory de Saint-

Vincent

PSM12899 Pulau Labuan, Sabah, Malaysia

S. Draisma

28 June 2012 1206070 + / + / - / -

H. durvillei PSM12986 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J15 + / + / + / -

H. durvillei PSM12989 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J19 + / + / + / -

H. durvillei PSM12903 Tun Mustapha Park (TMP),

Sabah, Malaysia

S. Draisma

17 September 2012 SGAD1209202 + / + / + / -

H. durvillei PSM12905 Tun Mustapha Park (TMP),

Sabah, Malaysia

S. Draisma

17 September 2012 SGAD1209204 + / + / + / +

H. durvillei PSM12901 Tun Mustapha Park (TMP),

Sabah, Malaysia

S. Draisma

7 September 2012 SGAD1209005 + / + / + / +

H. durvillei PSM12894 Pulau Babi Besar, Johor,

Malaysia

S. Draisma

30 May 2012 SGAD1205234 + / + / + / +

H. durvillei PSM12929 Busuanga Island, Calamian

Islands, Philippines

S. Draisma

1 March 2014 SGAD1403004 + / + / - / -

Univers

ity of

Mala

ya

16

2

Appendix A, continued

Taxa Herbarium

number

Locality and collector Date of collection Field number DNA sequences and GenBank accession

numbers where applicable rbcL/COI-

5P/UPA/LSU (28S rDNA)

H. durvillei PSM12939 Busuanga Island, Calamian

Islands, Philippines

S. Draisma

4 March 2014 SGAD1403091 + / + / - / -

H. durvillei PSM12942 Uson Island, Calamian Islands,

Philippines

S. Draisma

6 March 2014 SGAD1403116 + / + / - / -

H. durvillei PSM12925 Paglugaban Island, Palawan,

Philippines

S. Draisma

24 January 2014 SGAD1401050 + / + / + / -

H. durvillei PSM12884 Pulau Mata Pahi, Semporna,

Sabah, Malaysia

S. Draisma

17 December 2010 SGAD1012344 + / + / + / +

H. durvillei PSM12885 Pulau Mata Pahi, Semporna,

Sabah, Malaysia

S. Draisma

17 December 2010 SGAD1012346 + / + / + / +

H. durvillei PSM12836 Pulau Karindingan, Sabah,

Malaysia

PEL

23 June 2010 S6 + / - / + / -

H. durvillei PSM12837 Pulau Karindingan, Sabah,

Malaysia

PEL

23 June 2010 S7 + / + / - / -

H. durvillei PSM12968 Pulau Weh, Aceh, Indonesia

S. Draisma

29 April 2014 SGAD1405001 + / + / + / +

H. durvillei PSM12970 Pulau Weh, Aceh, Indonesia

S. Draisma

6 May 2014 SGAD1405014 + / + / + / -

H. durvillei SGAD0712160* Gam Island, Raja Ampat,

Indonesia

S. Draisma

25 November 2007 SGAD0712160 + / + / + / - Univ

ersity

of M

alaya

16

3

Appendix A, continued

Taxa Herbarium

number

Locality and collector Date of collection Field number DNA sequences and GenBank accession

numbers where applicable rbcL/COI-

5P/UPA/LSU (28S rDNA)

H. durvillei SGAD0712161* Gam Island, Raja Ampat,

Indonesia

S. Draisma

25 November 2007 SGAD0712161 + / + / + / -

H. durvillei SGAD0712476* Gam Island, Raja Ampat,

Indonesia

S. Draisma

4 December 2007 SGAD0712476 + / + / + / +

H. durvillei PSM12913 Ternate Island, Pantar Strait,

East Nusa Tenggara, Indonesia

S. Draisma

4 April 2013 SGAD1304049 + / + / - / -

H. durvillei PSM12954 Siargao Island, Philippines

S. Draisma

14 April 2014 SGAD1404200 + / + / - / -

H. durvillei PSM12911 Pulau Rote, East Nusa

Tenggara, Indonesia

S. Draisma

15 November 2012 SGAD1211004 + / + / + / +

H. durvillei PSM13015 Padang Bai, Bali, Indonesia

S. Draisma

24 June 2015 SGAD1506097 + / + / - / -

H. durvillei PSM13011 Amed, Bali, Indonesia

S. Draisma

20 June 2015 SGAD1506071 + / + / - / -

H. durvillei PSM12999 Ekas, Pulau Lombok, Indonesia

PEL

15 May 2015 C1 + / + / + / -

H. durvillei PSM13000 Ekas, Pulau Lombok, Indonesia

PEL

15 May 2015 C2 + / + / + / -

H. durvillei PSM13001 Ekas, Pulau Lombok, Indonesia

PEL

15 May 2015 C3 + / + / + / -

H. durvillei PSM13002 Ekas, Pulau Lombok, Indonesia

PEL

15 May 2015 C4 + / + / + / -

Univers

ity of

Mala

ya

16

4

Appendix A, continued

Taxa Herbarium

number

Locality and collector Date of collection Field number DNA sequences and GenBank accession

numbers where applicable rbcL/COI-

5P/UPA/LSU (28S rDNA)

H. durvillei PSM12947 Camiguin Island, Philippines

S. Draisma

4 April 2014 SGAD1404077 + / + / + / -

H. durvillei PSM12948 Camiguin Island, Philippines

S. Draisma

4 April 2014 SGAD1404081 + / + / + / +

H. durvillei PSM12951 Camiguin Island, Philippines

S. Draisma

6 April 20114 SGAD1404128 + / + / - / -

Halymenia johorensis P.-L. Tan, P.-E. Lim,

S.-M. Lin & S.-M.

Phang sp. nov.

PSM12870 Merambong Shoal, Johor,

Malaysia

PEL

23 August 2009 S8 + (KX958402) / + / + / +

H. johorensis PSM12871 Merambong Shoal, Johor,

Malaysia

PEL

23 August 2009 S1 + (KX958403) / + / + / +

H. johorensis PSM12875 Pulau Merambong, Johor,

Malaysia

PEL

23 August 2009 S2 + / + / + / +

H. johorensis PSM12872 Merambong Shoal, Johor,

Malaysia

PEL

23 August 2009 S12 + / + / - / -

H. johorensis PSM12873 Merambong Shoal, Johor,

Malaysia

PEL

23 August 2009 S13 + / + / + / -

H. johorensis PSM12874 Pulau Merambong, Johor,

Malaysia

PEL

23 August 2009 S14 + / - / - / -

H. johorensis PSM10663 Merambong Shoal, Johor,

Malaysia

PEL

10 March 2009 S11 + / + / + / - Univ

ersity

of M

alaya

16

5

Appendix A, continued

Taxa Herbarium

number

Locality and collector Date of collection Field number DNA sequences and GenBank accession

numbers where applicable rbcL/COI-

5P/UPA/LSU (28S rDNA)

H. johorensis PSM12832 Pulau Merambong, Johor,

Malaysia

PEL

28 February 2009 S15 + / + / - / -

H. johorensis PSM12882 Merambong Shoal, Johor,

Malaysia

PEL

13 July 2014 B1 + (KX958404) / + / + / +

Halymenia maculata J.

Agardh

PSM12833 Pulau Merambong, Johor,

Malaysia

PEL

24 August 2009 S3 + (KP202334) / - / + / +

H. maculata PSM12840 Tanjong Tigasamil, Tun

Mustapha Park (TMP), Sabah,

Malaysia

S. Draisma

16 September 2012 SGAD1209183 + (KP202335) / + / + / +

H. maculata PSM12841 Tun Mustapha Park (TMP),

Sabah, Malaysia

S. Draisma

17 September 2012 SGAD1209209 + (KP202336) / + / + / -

H. maculata PSM120906 Tun Mustapha Park (TMP),

Sabah, Malaysia

S. Draisma

17 September 2012 SGAD1209208 + / - / + / -

H. maculata PSM12902 Tun Mustapha Park (TMP),

Sabah, Malaysia

Bert Hoeksema

16 September 2012 SGAD1209190 + / - / + / -

H. maculata

PSM12897 Pulau Labuan, Sabah, Malaysia

S. Draisma

28 June 2012 SGAD1206066 + / - / - / -

Halymenia malaysiana

P.-L. Tan, P.-E. Lim,

S.-M. Lin et S.-M.

Phang sp. nov.

PSM12834 Pulau Merambong, Johor,

Malaysia

PEL

24 August 2009 S4 + (KP202322) / + / + / - Univers

ity of

Mala

ya

16

6

Appendix A, continued

Taxa Herbarium

number

Locality and collector Date of collection Field number DNA sequences and GenBank accession

numbers where applicable rbcL/COI-

5P/UPA/LSU (28S rDNA)

H. malaysiana PSM12835 Pulau Merambong, Johor,

Malaysia

PEL

24 August 2009 S5 + (KP202323) / + / + / -

H. malaysiana PSM12838 Pulau Besar, Malacca, Malaysia

S. Draisma

12 July 2010 SGAD1007001 + (KP202324) / + / + / -

H. malaysiana PSM12850 Pulau Karindingan, Sabah,

Malaysia

PEL

23 June 2010 S10 + (KP202325) / + / - / -

H. malaysiana PSM12845 Siargao Island, Philippines

S. Draisma

10 April 2014 SGAD1404132 + (KP202326) / + / - / -

H. malaysiana PSM12846 Siargao Island, Philippines

S. Draisma

12 April 2014 SGAD1404182 + (KP202327) / + / - / -

H. malaysiana PSM12847 Grande Island, Subic Bay,

Luzon, Philippines

S. Draisma

29 July 2014 SGAD1406043 + (KP202328) / + / - / -

H. malaysiana PSM12848 Subic Bay, Luzon, Philippines

S. Draisma

29 July 2014 SGAD1406045 + (KP202329) / + / - / -

H. malaysiana PSM12851 Busuanga Island, Calamian

Islands, Philippines

S. Draisma

1 March 2014 SGAD1403003 + (KP202330) / + / - / -

H. malaysiana PSM12853 Busuanga Island, Calamian

Islands, Philippines

S. Draisma

4 March 2014 SGAD1403055 + (KP202331) / + / - / -

H. malaysiana PSM12854 Busuanga Island, Calamian

Islands, Philippines

S. Draisma

4 March 2014 SGAD1403087 + (KP202332) / + / - / - Univers

ity of

Mala

ya

16

7

Appendix A, continued

Taxa Herbarium

number

Locality and collector Date of collection Field number DNA sequences and GenBank accession

numbers where applicable rbcL/COI-

5P/UPA/LSU (28S rDNA)

H. malaysiana SGAD0712156* Gam Island, Raja Ampat,

Indonesia

S. Draisma

25 November 2007 SGAD0712156 + (KP202333) / - / - / -

H. malaysiana SGAD0712471* Gam Island, Raja Ampat,

Indonesia

S. Draisma

3 December 2007 SGAD0712471 + / + / - / -

H. malaysiana PSM12890

Tanjung Gua Hujan, Pulau

Tinggi, Johor, Malaysia

S. Draisma

28 May 2012 SGAD1205185 + / + / + / -

H. malaysiana PSM12891 Tanjung Gua Hujan, Pulau

Tinggi, Johor, Malaysia

S. Draisma

28 May 2012 SGAD1205198 + / + / + / -

H. malaysiana PSM12893 Ibol, Pulau Tinggi, Johor

Malaysia

S. Draisma

29 May 2012 SGAD1205213 + / + / + / -

H. malaysiana PSM12900 Tun Mustapha Park (TMP),

Sabah, Malaysia

S. Draisma

7 September 2012 SGAD1209001 + / + / + / +

H. malaysiana PSM12904 Tun Mustapha Park (TMP),

Sabah, Malaysia

S. Draisma

17 September 2012 SGAD1209203 + / + / + / +

H. malaysiana PSM12909 Tun Mustapha Park (TMP),

Sabah, Malaysia

S. Draisma

23 September 2012 SGAD1209396 + / + / + / -

H. malaysiana PSM12927 Busuanga Island, Calamian

Islands, Philippines

S. Draisma

1 March 2014 SGAD1403001 + / + / - / -

Univers

ity of

Mala

ya

16

8

Appendix A, continued

Taxa Herbarium

number

Locality and collector Date of collection Field number DNA sequences and GenBank accession

numbers where applicable rbcL/COI-

5P/UPA/LSU (28S rDNA)

H. malaysiana PSM12935 Busuanga Island, Calamian

Islands, Philippines

S. Draisma

4 March 2014 SGAD1403056 + / + / - / -

H. malaysiana PSM12972 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J1 + / + / + / -

H. malaysiana PSM12973 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J2 + / + / + / -

H. malaysiana PSM12974 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J3 + / + / + / -

H. malaysiana PSM12975 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J4 + / + / + / -

H. malaysiana PSM12976 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J5 + / + / + / -

H. malaysiana PSM12977 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J6 + / + / + / -

H. malaysiana PSM12978 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J7 + / + / + / -

H. malaysiana PSM12980 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J9 + / + / + / - Univers

ity of

Mala

ya

16

9

Appendix A, continued

Taxa Herbarium

number

Locality and collector 17 December 2014 Field number DNA sequences and GenBank accession

numbers where applicable rbcL/COI-

5P/UPA/LSU (28 S rDNA)

H. malaysiana PSM12981 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J10 + / + / + / -

H. malaysiana PSM12983 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J12 + / + / + / -

H. malaysiana PSM12984 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J13 + / + / + / -

H. malaysiana PSM12985 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J14 + / + / + / -

H. malaysiana PSM12987 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J16 + / + / + / -

H. malaysiana PSM12990 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J20 + / + / + / -

H. malaysiana PSM12992 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J22 + / + / + / -

H. malaysiana PSM12993 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J24 + / + / + / -

H. malaysiana PSM12994 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J25 + / + / + / - Univers

ity of

Mala

ya

17

0

Appendix A, continued

Taxa Herbarium

number

Locality and collector 17 December 2014 Field number DNA sequences and GenBank accession

numbers where applicable rbcL/COI-

5P/UPA/LSU (28S rDNA)

H. malaysiana PSM12995 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J26 + / + / + / -

H. malaysiana PSM12996 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J30 + / + / + / -

H. malaysiana PSM12997 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J31 + / + / + / -

H. malaysiana PSM12998 Pulau Merambong, Johor,

Malaysia

PLT

17 December 2014 J33 + / + / + / -

Halymenia sp. A PSM12887 Koh Dok Mai, Thailand

S. Draisma

11 August 2012 SGAD1208001 + / + / + / +

Halymenia sp. A PSM12888 Koh Dok Mai, Thailand

S. Draisma

11 August 2012 SGAD1208002 + / + / + / +

Halymenia tondoana

O. DeClerck et J.J.

Hernández-Kantun

PSM12955 Siargao Island, Philippines

S. Draisma

15 April 2014 1404246 + / + / + / +

H. tondoana PSM12952 Siargao Island, Philippines

S. Draisma 10 April 2014 1404143 + / + / - / -

H. tondoana PSM12956 Siargao Island, Philippines

S. Draisma

15 April 2014 1404247 + / + / + / +

GenBank accession numbers were provided for taxa of which DNA sequences were published in Tan et al., 2014. Abbreviations for collector are: S. Draisma – Stefano G.A.

Draisma; PEL – Phaik Eem Lim; PLT – Pui Ling Tan. PSM indicate reference code of herbarium at the University of Malaya Seaweeds and Seagrasses Herbarium (KLU). The

herbaria deposited in Leiden Herbarium are denoted with ‘*’. Sequences obtained and included in phylogenetic analyses are denoted with ‘+’. Unavailable sequences or irrelevant

data are denoted with ‘- .́

Univers

ity of

Mala

ya

17

1

Appendix B: List of published sequences used for rbcL analyses with collection details and GenBank accession numbers.

Species Collection information GenBank accession

number

Carpopeltis phyllophora (J.D. Hooker et Harvey) F. Schmitz Black Island, Esperance Bay, Western Australia FN908147

Codiophyllum natalense J.E. Gray Protea Banks, Northern Pinnacle, Kwazulu-Natal,

South Africa

FN908160

Cryptonemia lomation (Bertoloni) J. Agardh Calvi, Cap de la Revellata FN908155

Cryptonemia luxurians (C. Agardh) J. Agardh Nagaiso, Namikata, Ehime Prefecture, Japan AB061374

Epiphloea bullosa (Harvey) De Toni Julien Bay, Escape Island, Western Australia FN908149

Galene meridionalis D'Archino et Zuccarello Port Pegasus, Stewart Island, New Zealand KJ606650

Galene profundae D'Archino et Zuccarello Hou Hou Point, Marlborough Sounds, South

Island, New Zealand

KJ606645

Gelinaria ulvoidea Sonder Julien Bay, Escape Island, Western Australia FN908154

Halymenia cearensis C.A.A.Azevedo, Cassano &

M.C.Oliveira

Ceara, Brazil KX586174

Halymenia dilatata Zanardini Debana, Hachijo Island, Tokyo, Japan AB038604

Halymenia durvillei Bory de Saint-Vincent Pulau Rebak Besar, Langkawi, Kedah, Malaysia AB038603

H. durvillei Beruwela, Sri Lanka AY772020

Halymenia floresii (Clemente) C. Agardh Illes Formigues, Palamos, Girona, Spain AY772019

H. floresii Armacao de Pere, Portugal KU382051

Halymenia harveyana J. Agardh Jurien Bay, Escape Island, Western Australia JQ976885

Univers

ity of

Mala

ya

17

2

Appendix B, continued

Species Collection information GenBank accession

number

H. harveyana Quarter Mile Reef, Sodwana Bay, South Africa JQ976886

Halymenia hawaiiana J.J. Hernández-Kantun et A.R.

Sherwood

Pupukea, Oahu, Hawaii, USA AM422899

Halymenia ignifera C.A.A.Azevedo, Cassano et

M.C.Oliveira

Rio do Fogo Beach, Rio do Fogo, RN, Brazil KT807829

Halymenia maculata J. Agardh Pulau Satang Besar, Santubong, Kuching,

Sarawak, Malaysia

AB061397

Halymenia pinnatifida C.A.A.Azevedo, Cassano et

M.C.Oliveira

Rio do Fogo Beach, Rio do Fogo, RN, Brazil KT807828

Halymenia plana Zanardini Reef west of Verona Sands boat launch, in mouth

of Huon River, Tasmania, Australia

KU726713

Halymenia silviae C.A.A.Azevedo, Cassano et M.C.Oliveira Rio do Fogo Beach, Rio do Fogo, RN, Brazil KT807827

Halymenia stipitata I.A. Abbott Kaalawai, Oahu, Hawaii JQ976891

Halymenia tondoana O. DeClerck et J.J. Hernández-Kantun Dancalan, N of Bulusan, SE Luzon, Philippines JQ976888

Spongophloea tissotii (Weber-van Bosse) Huisman, De

Clerck, Prud'homme van Reine et Borowitzka

Monkey Mia, Shark Bay, Western Australia FN908162

Thamnoclonium dichotomum (J.Agardh) J.Agardh North Twin Peaks Island, Esperance Bay, Western

Australia

FN908151

Thamnoclonium lemannianum Harvey Cottesloe, Western Australia FN908161

Univers

ity of

Mala

ya

17

3

Appendix C: List of published COI-5P, UPA and LSU (28S rDNA) sequences with collection details and GenBank accession numbers for analyses.

Species Collection information GenBank accession number

COI-5P UPA LSU

Grateloupia angusta (Okamura) S.Kawaguchi &

H.W.Wang

Jeju, South Korea - KJ648575 -

Grateloupia elliptica Holmes Jeju, South Korea JX475023 - -

Grateloupia lanceolata (Okamura) S.Kawaguchi Spain - - AM420418

Grateloupia subpectinata Holmes Jeju, South Korea - KF543073 -

Grateloupia turuturu Yamada Japan - - AM420447

Halymenia californica G.M.Smith & Hollenberg California, Lover's Point, Pacific Grove, USA KM254858 - -

Halymenia cearensis C.A.A.Azevedo, Cassano &

M.C.Oliveira

Ceara, Brazil KX586151 - -

H. cearensis Ceara, Brazil KX586166 KX586140 -

Halymenia floresii (Clemente) C.Agardh Armacao de Pere, Portugal GQ862071 - GQ471912

Halymenia formosa Harvey ex Kützing Oahu, Hawaii, USA - HQ421565 HQ422446

Halymenia ignifera C.A.A.Azevedo, Cassano &

M.C.Oliveira

Rio Grande do Norte, Brazil KT807817 KX586118 -

H. ignifera Espirito Santo, Brazil KT807819 KX586122 -

Halymenia maculata J. Agardh Lord Howe Island, New South Wales, Australia - - GQ471913

Halymenia pinnatifida C.A.A.Azevedo, Cassano

& M.C.Oliveira

Rio Grande do Norte, Brazil KT807811 KT586108 -

Halymenia plana Zanardini Point Lonsdale Lighthouse Reef, Victoria,

Australia

- - GQ471914 Univ

ersity

of M

alaya

17

4

Appendix D: Uncorrected pairwise distance matrix of the rbcL sequences.

S1 KU726713 0712160 1304049 C4 1404200 1211004 1404077 1404128 AB038603 JX000238 JX000244 J19 1209005 S1 N KU726713 0.02480 0712160 0.05680 0.05680 1304049 0.05765 0.05765 0.00080 C4 0.05520 0.05520 0.00160 0.00240 1404200 0.05840 0.05840 0.00320 0.00400 0.00320 1211004 0.05680 0.05680 0.00160 0.00240 0.00160 0.00320 1404077 0.06080 0.05920 0.01040 0.01121 0.01040 0.01200 0.01040 1404128 0.06160 0.05840 0.01120 0.01201 0.01120 0.01280 0.01120 0.00080 AB038603 0.05680 0.05680 0.01120 0.01201 0.01120 0.01280 0.01120 0.01360 0.01440 JX000238 0.05871 0.05479 0.00587 0.00686 0.00587 0.00783 0.00489 0.00978 0.00978 0.00978 JX000244 0.06164 0.05577 0.01272 0.01371 0.01272 0.01468 0.01174 0.02055 0.02055 0.01957 0.01468 J19 0.05873 0.05546 0.01631 0.01714 0.01631 0.01794 0.01631 0.02202 0.02284 0.02121 0.01566 0.00098 1209005 0.06058 0.05735 0.01616 0.01698 0.01616 0.01777 0.01616 0.02181 0.02262 0.02100 0.01566 0.00098 0.00163 J15 0.06080 0.05760 0.01520 0.01601 0.01520 0.01680 0.01520 0.02080 0.02160 0.02080 0.01468 0.00000 0.00082 0.00081 1206070 0.06175 0.05854 0.01604 0.01685 0.01604 0.01764 0.01604 0.02005 0.02085 0.02005 0.01566 0.00098 0.00163 0.00162 S7 0.06109 0.05949 0.01608 0.01689 0.01608 0.01768 0.01608 0.02010 0.02090 0.01929 0.01370 0.00489 0.00489 0.00485 AY772020 0.06480 0.06320 0.01840 0.01761 0.01840 0.01840 0.01840 0.02400 0.02480 0.02160 0.01566 0.01957 0.02284 0.02262 JQ976882 0.06240 0.06240 0.01840 0.01761 0.01840 0.01840 0.01840 0.02240 0.02320 0.02000 0.01566 0.02153 0.02284 0.02262 JQ976884 0.06019 0.05728 0.01650 0.01555 0.01650 0.01650 0.01553 0.02233 0.02233 0.01942 0.01576 0.02167 0.02233 0.02233 JQ976886 0.04960 0.04480 0.02720 0.02802 0.02720 0.02880 0.02720 0.03120 0.03200 0.02880 0.02348 0.02935 0.03100 0.03312 JQ976885 0.05040 0.04560 0.02640 0.02722 0.02640 0.02800 0.02640 0.03040 0.03120 0.02800 0.02153 0.02740 0.03018 0.03231 AM422899 0.05600 0.05120 0.03600 0.03683 0.03600 0.03760 0.03600 0.04000 0.04080 0.03600 0.03327 0.03816 0.03670 0.03796 1403091 0.06160 0.06000 0.01760 0.01841 0.01760 0.01920 0.01760 0.02160 0.02240 0.02160 0.01468 0.00587 0.00571 0.00565 1405001 0.06374 0.06209 0.01904 0.01821 0.01904 0.01904 0.01904 0.02483 0.02566 0.02070 0.01531 0.01939 0.02280 0.02258 GQ995519 0.05600 0.05120 0.03600 0.03683 0.03600 0.03760 0.03600 0.04000 0.04080 0.03600 0.03327 0.03816 0.03670 0.03796 1404143 0.05600 0.05360 0.05040 0.05124 0.05040 0.05200 0.05040 0.05360 0.05440 0.04880 0.04599 0.05186 0.05302 0.05493 1404246 0.05721 0.05479 0.05077 0.05161 0.05077 0.05238 0.05077 0.05399 0.05479 0.04996 0.04697 0.05284 0.05383 0.05574

Univers

ity of

Mala

ya

17

5

Appendix D, continued

S1 KU726713 0712160 1304049 C4 1404200 1211004 1404077 1404128 AB038603 JX000238 JX000244 J19 1209005 1404247 0.05604 0.05364 0.05044 0.05124 0.05044 0.05204 0.05044 0.05364 0.05444 0.04884 0.04701 0.05289 0.05306 0.05497 JQ976888 0.05583 0.05337 0.04926 0.05008 0.04926 0.05090 0.04926 0.05255 0.05337 0.04844 0.04706 0.05294 0.05337 0.05419 1208001 0.06000 0.05840 0.05600 0.05685 0.05600 0.05760 0.05600 0.05920 0.06000 0.05600 0.05382 0.05969 0.05873 0.06058 KT807828 0.05444 0.05685 0.05124 0.05204 0.05124 0.05284 0.05124 0.05364 0.05444 0.05444 0.05191 0.05485 0.05143 0.05335 KT807827 0.04800 0.05200 0.04560 0.04644 0.04560 0.04720 0.04400 0.04800 0.04880 0.04560 0.04501 0.04990 0.04649 0.04847 1406043 0.06581 0.06501 0.05859 0.05939 0.05859 0.06019 0.05859 0.05778 0.05859 0.05778 0.05796 0.05894 0.05646 0.05916 S10 0.06501 0.06421 0.05778 0.05859 0.05778 0.05939 0.05778 0.05698 0.05778 0.05698 0.05697 0.05796 0.05565 0.05835 1403055 0.06421 0.06340 0.05698 0.05778 0.05698 0.05859 0.05698 0.05618 0.05698 0.05618 0.05599 0.05697 0.05483 0.05754 0712471 0.06782 0.06700 0.05873 0.05955 0.05873 0.06038 0.05873 0.05790 0.05873 0.05873 0.05964 0.06163 0.05955 0.06038 1209396 0.06640 0.06560 0.05920 0.06005 0.05920 0.06080 0.05920 0.05840 0.05920 0.05840 0.05773 0.05871 0.05710 0.05977 1404132 0.06581 0.06501 0.05859 0.05939 0.05859 0.06019 0.05859 0.05778 0.05859 0.05778 0.05697 0.05796 0.05646 0.05916 J1 0.06720 0.06640 0.06000 0.06085 0.06000 0.06160 0.06000 0.05920 0.06000 0.05920 0.05871 0.05969 0.05791 0.06058 1403056 0.06480 0.06400 0.05760 0.05845 0.05760 0.05920 0.05760 0.05680 0.05760 0.05680 0.05675 0.05773 0.05546 0.05816 AB038604 0.06560 0.06320 0.06080 0.06165 0.06080 0.06240 0.06080 0.06000 0.06080 0.06160 0.05871 0.05871 0.05873 0.06058 1209183 0.06748 0.06829 0.06341 0.06428 0.06341 0.06504 0.06341 0.06585 0.06667 0.06585 0.06556 0.06556 0.06362 0.06341 1209190 0.06913 0.06994 0.06511 0.06597 0.06511 0.06672 0.06511 0.06752 0.06833 0.06752 0.06556 0.06556 0.06444 0.06462 1206066 0.06800 0.06880 0.06400 0.06485 0.06400 0.06560 0.06400 0.06640 0.06720 0.06560 0.06360 0.06360 0.06281 0.06300 AB061397 0.07360 0.07360 0.06480 0.06565 0.06480 0.06640 0.06480 0.06720 0.06800 0.06640 0.06458 0.06458 0.06362 0.06300 1404050 0.06452 0.06532 0.06290 0.06371 0.06290 0.06290 0.06290 0.06532 0.06613 0.06290 0.06225 0.06225 0.06003 0.06026 FN908149 0.07040 0.06480 0.06160 0.06245 0.06160 0.06320 0.06160 0.06400 0.06480 0.06240 0.05675 0.05773 0.06117 0.06220 JQ976891 0.07760 0.07200 0.07920 0.08006 0.07920 0.08080 0.07920 0.08160 0.08240 0.07920 0.07926 0.08219 0.07993 0.08078 FN908154 0.06000 0.05520 0.05840 0.05925 0.05680 0.06000 0.05840 0.06080 0.06160 0.06000 0.05871 0.06067 0.06036 0.06220 AY772019 0.04800 0.04560 0.04720 0.04804 0.04560 0.04880 0.04720 0.04800 0.04880 0.04880 0.04697 0.05186 0.04812 0.05008 KU382051 0.05200 0.04960 0.04960 0.05044 0.04960 0.05120 0.04960 0.05040 0.05120 0.05120 0.04795 0.05284 0.05057 0.05250 KX586174 0.05642 0.05315 0.05070 0.05155 0.05070 0.05233 0.05070 0.05315 0.05233 0.05233 0.05186 0.05675 0.05478 0.05560 KT807829 0.05120 0.05360 0.04960 0.05044 0.04960 0.05120 0.04960 0.05200 0.05280 0.05120 0.04892 0.05088 0.05057 0.05089 KJ606645 0.05887 0.05315 0.06132 0.06056 0.06132 0.06296 0.06132 0.06296 0.06378 0.06541 0.06556 0.06849 0.06460 0.06541 KJ606650 0.05887 0.05478 0.06623 0.06547 0.06623 0.06787 0.06623 0.06787 0.06868 0.06868 0.07045 0.07143 0.06787 0.06868

Univers

ity of

Mala

ya

17

6

Appendix D, continued

S1 KU726713 0712160 1304049 C4 1404200 1211004 1404077 1404128 AB038603 JX000238 JX000244 J19 1209005 FN908151 0.06520 0.06112 0.06601 0.06525 0.06601 0.06764 0.06601 0.06683 0.06764 0.06438 0.06067 0.06556 0.06688 0.06520 FN908161 0.07680 0.07280 0.07440 0.07366 0.07440 0.07600 0.07440 0.07600 0.07680 0.07840 0.08023 0.08611 0.07667 0.07680 FN908147 0.07699 0.07050 0.07536 0.07461 0.07536 0.07861 0.07699 0.08185 0.08104 0.07861 0.08023 0.07828 0.07504 0.07699 FN908155 0.06400 0.05680 0.05920 0.06005 0.05920 0.06080 0.05920 0.06000 0.06080 0.06080 0.05577 0.05871 0.05954 0.06400 AB061374 0.06160 0.05920 0.05200 0.05284 0.05200 0.05360 0.05200 0.05280 0.05360 0.05040 0.04990 0.05088 0.05220 0.06160 FN908160 0.06000 0.05600 0.05760 0.05845 0.05600 0.05920 0.05760 0.05840 0.05760 0.05760 0.05773 0.06262 0.05954 0.06000 FN908162 0.06710 0.07201 0.06301 0.06383 0.06301 0.06465 0.06137 0.06710 0.06792 0.06465 0.06968 0.06771 0.06056 0.06710

Univers

ity of

Mala

ya

17

7

Appendix D, continued

J15 1206070 S7 AY772020 JQ976882 JQ976884 JQ976886 JQ976885 AM422899 1403091 1405001 GQ995519 14004143 J15 N 1206070 0.00080 S7 0.00402 0.00482 AY772020 0.02160 0.02245 0.02251 JQ976882 0.02160 0.02245 0.02251 0.00480 JQ976884 0.02136 0.02233 0.02233 0.00583 0.00194 JQ976886 0.03200 0.03288 0.03296 0.03120 0.02960 0.02816 JQ976885 0.03120 0.03208 0.03215 0.03040 0.02880 0.02621 0.00400 AM422899 0.03840 0.03929 0.03859 0.03760 0.03680 0.03592 0.02960 0.03040 1403091 0.00560 0.00561 0.00080 0.02400 0.02400 0.02330 0.03440 0.03360 0.04080 1405001 0.02235 0.02324 0.02246 0.00083 0.00579 0.00607 0.03146 0.03063 0.03725 0.02483 AM422899 0.03840 0.03929 0.03859 0.03760 0.03680 0.03592 0.02960 0.03040 0.00000 0.04080 0.03725 1404143 0.05520 0.05613 0.05547 0.05920 0.05680 0.05243 0.04720 0.04800 0.04480 0.05760 0.05877 0.04480 1404246 0.05560 0.05641 0.05641 0.05963 0.05721 0.05340 0.04754 0.04835 0.04593 0.05721 0.06005 0.04593 0.00081 1404247 0.05524 0.05618 0.05551 0.05925 0.05685 0.05345 0.04724 0.04804 0.04484 0.05765 0.05877 0.04484 0.00160 JQ976888 0.05419 0.05501 0.05501 0.05829 0.05583 0.05350 0.04680 0.04762 0.04516 0.05583 0.05772 0.04516 0.00657 1208001 0.06080 0.06175 0.06109 0.06480 0.06240 0.05922 0.05040 0.05120 0.05280 0.06320 0.06457 0.05280 0.02240 KT807828 0.05364 0.05457 0.05310 0.05765 0.05685 0.05539 0.04884 0.04964 0.04804 0.05524 0.05712 0.04804 0.04964 KT807827 0.04960 0.05052 0.04904 0.05360 0.05120 0.04951 0.04160 0.04240 0.04080 0.05120 0.05215 0.04080 0.04720 1406043 0.05939 0.06034 0.05887 0.06501 0.06260 0.06140 0.06019 0.06260 0.05859 0.06100 0.06540 0.05859 0.06661 S10 0.05859 0.05953 0.05806 0.06421 0.06180 0.06043 0.05939 0.06180 0.05778 0.06019 0.06457 0.05778 0.06742 1403055 0.05778 0.05873 0.05726 0.06501 0.06260 0.06140 0.05859 0.06100 0.05698 0.05939 0.06540 0.05698 0.06661 0712471 0.06038 0.06121 0.06038 0.06534 0.06286 0.06410 0.06038 0.06286 0.06038 0.06121 0.06593 0.06038 0.06948 1209396 0.06000 0.06095 0.05949 0.06560 0.06320 0.06214 0.06080 0.06320 0.05920 0.06160 0.06623 0.05920 0.06880 1404132 0.05939 0.06034 0.05887 0.06501 0.06260 0.06140 0.06019 0.06260 0.05859 0.06100 0.06540 0.05859 0.06982 J1 0.06080 0.06175 0.06029 0.06640 0.06240 0.06117 0.06160 0.06400 0.05840 0.06240 0.06705 0.05840 0.06960 1403056 0.05840 0.05934 0.05788 0.06560 0.06320 0.06214 0.05920 0.06160 0.05760 0.06000 0.06623 0.05760 0.06720 AB038604 0.06080 0.06175 0.06109 0.06800 0.06560 0.06311 0.06000 0.06240 0.05680 0.06320 0.06871 0.05680 0.06640

Univers

ity of

Mala

ya

17

8

Appendix D, continued

J15 1206070 S7 AY772020 JQ976882 JQ976884 JQ976886 JQ976885 AM422899 1403091 1405001 GQ995519 14004143 1209183 0.06341 0.06423 0.06341 0.07073 0.06992 0.06990 0.06260 0.06504 0.06585 0.06423 0.07239 0.06585 0.06260 1209190 0.06913 0.06994 0.06511 0.06597 0.06511 0.06672 0.06511 0.06752 0.06833 0.06752 0.06556 0.06556 0.06444 1206066 0.06800 0.06880 0.06400 0.06485 0.06400 0.06560 0.06400 0.06640 0.06720 0.06560 0.06360 0.06360 0.06281 AB061397 0.07360 0.07360 0.06480 0.06565 0.06480 0.06640 0.06480 0.06720 0.06800 0.06640 0.06458 0.06458 0.06362 1404050 0.06452 0.06532 0.06290 0.06371 0.06290 0.06290 0.06290 0.06532 0.06613 0.06290 0.06225 0.06225 0.06003 FN908149 0.07040 0.06480 0.06160 0.06245 0.06160 0.06320 0.06160 0.06400 0.06480 0.06240 0.05675 0.05773 0.06117 JQ976891 0.07760 0.07200 0.07920 0.08006 0.07920 0.08080 0.07920 0.08160 0.08240 0.07920 0.07926 0.08219 0.07993 FN908154 0.06000 0.05520 0.05840 0.05925 0.05680 0.06000 0.05840 0.06080 0.06160 0.06000 0.05871 0.06067 0.06036 AY772019 0.04800 0.04560 0.04720 0.04804 0.04560 0.04880 0.04720 0.04800 0.04880 0.04880 0.04697 0.05186 0.04812 KU382051 0.05200 0.04960 0.04960 0.05044 0.04960 0.05120 0.04960 0.05040 0.05120 0.05120 0.04795 0.05284 0.05057 KX586174 0.05642 0.05315 0.05070 0.05155 0.05070 0.05233 0.05070 0.05315 0.05233 0.05233 0.05186 0.05675 0.05478 KT807829 0.05120 0.05360 0.04960 0.05044 0.04960 0.05120 0.04960 0.05200 0.05280 0.05120 0.04892 0.05088 0.05057 KJ606645 0.05887 0.05315 0.06132 0.06056 0.06132 0.06296 0.06132 0.06296 0.06378 0.06541 0.06556 0.06849 0.06460 KJ606650 0.05887 0.05478 0.06623 0.06547 0.06623 0.06787 0.06623 0.06787 0.06868 0.06868 0.07045 0.07143 0.06787 FN908151 0.06520 0.06112 0.06601 0.06525 0.06601 0.06764 0.06601 0.06683 0.06764 0.06438 0.06067 0.06556 0.06688 FN908161 0.07680 0.07280 0.07440 0.07366 0.07440 0.07600 0.07440 0.07600 0.07680 0.07840 0.08023 0.08611 0.07667 FN908147 0.07699 0.07050 0.07536 0.07461 0.07536 0.07861 0.07699 0.08185 0.08104 0.07861 0.08023 0.07828 0.07504 FN908155 0.06400 0.05680 0.05920 0.06005 0.05920 0.06080 0.05920 0.06000 0.06080 0.06080 0.05577 0.05871 0.05954 AB061374 0.06160 0.05920 0.05200 0.05284 0.05200 0.05360 0.05200 0.05280 0.05360 0.05040 0.04990 0.05088 0.05220 FN908160 0.06000 0.05600 0.05760 0.05845 0.05600 0.05920 0.05760 0.05840 0.05760 0.05760 0.05773 0.06262 0.05954 FN908162 0.06710 0.07201 0.06301 0.06383 0.06301 0.06465 0.06137 0.06710 0.06792 0.06465 0.06968 0.06771 0.06056

Univers

ity of

Mala

ya

17

9

Appendix D, continued

1404246 1404247 JQ976888 1208001 KT807828 KT807827 1406043 S10 1403005 0712471 1209396 1404132 J1 1403056 1404246 N 1404247 0.00081 JQ976888 0.00739 0.00657 1208001 0.02337 0.02242 0.02627 KT807828 0.05081 0.04964 0.05090 0.05604 KT807827 0.04835 0.04724 0.04762 0.05200 0.02802 1406043 0.06791 0.06661 0.06661 0.06982 0.06501 0.06180 S10 0.06871 0.06742 0.06743 0.07063 0.06421 0.06260 0.00080 1403055 0.06791 0.06661 0.06661 0.06982 0.06340 0.06180 0.00161 0.00080 0712471 0.07031 0.06948 0.07060 0.07279 0.06617 0.06286 0.00496 0.00414 0.00496 1209396 0.07010 0.06886 0.06897 0.07200 0.06405 0.06240 0.00321 0.00241 0.00321 0.00165 1404132 0.07114 0.06982 0.06990 0.07303 0.06501 0.06340 0.00401 0.00321 0.00401 0.00248 0.00080 J1 0.07091 0.06966 0.06979 0.07280 0.06485 0.06320 0.00321 0.00241 0.00321 0.00331 0.00160 0.00241 1403056 0.06849 0.06725 0.06732 0.07040 0.06405 0.06240 0.00241 0.00161 0.00080 0.00579 0.00400 0.00482 0.00400 AB038604 0.06769 0.06645 0.06732 0.06960 0.06325 0.06320 0.01445 0.01364 0.01445 0.01572 0.01440 0.01525 0.01440 0.01520 1209183 0.06341 0.06265 0.06240 0.06423 0.06672 0.06423 0.07096 0.07015 0.06933 0.07279 0.07154 0.07259 0.07236 0.06992 1209190 0.06366 0.06356 0.06322 0.06592 0.06919 0.06592 0.07258 0.07177 0.07097 0.07361 0.07315 0.07419 0.07395 0.07154 1206066 0.06205 0.06165 0.06158 0.06320 0.06725 0.06560 0.07063 0.06982 0.06902 0.07196 0.07120 0.07223 0.07200 0.06960 AB061397 0.06285 0.06325 0.06240 0.06400 0.07126 0.06960 0.07624 0.07544 0.07464 0.07610 0.07680 0.07785 0.07760 0.07520 1404050 0.05930 0.05887 0.05868 0.06129 0.06935 0.06290 0.06613 0.06532 0.06452 0.06782 0.06694 0.06774 0.06774 0.06532 FN908149 0.06608 0.06485 0.06486 0.07120 0.07046 0.06320 0.06581 0.06661 0.06581 0.06948 0.06800 0.06902 0.06880 0.06640 JQ976891 0.07977 0.07926 0.07964 0.08400 0.07926 0.07840 0.07705 0.07624 0.07544 0.08023 0.07760 0.07865 0.07840 0.07600 FN908154 0.06205 0.06085 0.06076 0.06640 0.05845 0.05920 0.06501 0.06421 0.06340 0.06534 0.06400 0.06501 0.06480 0.06400 AY772019 0.04835 0.04724 0.05008 0.05200 0.05204 0.04640 0.05377 0.05297 0.05217 0.05624 0.05440 0.05538 0.05520 0.05280 KU382051 0.05077 0.04964 0.05255 0.05440 0.05444 0.04720 0.05778 0.05698 0.05618 0.06038 0.05840 0.05939 0.05920 0.05680 KX586174 0.05151 0.05074 0.05090 0.05805 0.05728 0.05070 0.06727 0.06809 0.06727 0.06959 0.06787 0.06727 0.06868 0.06787 KT807829 0.05963 0.05845 0.05993 0.06240 0.05444 0.05040 0.06180 0.06100 0.06019 0.06369 0.06240 0.06180 0.06320 0.06080 KJ606645 0.06541 0.06465 0.06486 0.06705 0.06628 0.06214 0.07055 0.06973 0.06891 0.07291 0.07114 0.07219 0.07032 0.06950

Univers

ity of

Mala

ya

18

0

Appendix D, continued

1404246 1404247 JQ976888 1208001 KT807828 KT807827 1406043 S10 1403005 0712471 1209396 1404132 J1 1403056 KJ606650 0.06868 0.06792 0.06814 0.07195 0.06628 0.06214 0.07383 0.07465 0.07383 0.07788 0.07604 0.07547 0.07522 0.07441 FN908151 0.07498 0.07579 0.07504 0.07553 0.07661 0.06852 0.06927 0.07686 0.07604 0.07498 0.07579 0.07504 0.07553 0.07661 FN908161 0.08480 0.08622 0.08487 0.08539 0.08400 0.08086 0.07840 0.08347 0.08427 0.08480 0.08622 0.08487 0.08539 0.08400 FN908147 0.08185 0.08266 0.08191 0.08210 0.08509 0.08678 0.07942 0.08780 0.08699 0.08185 0.08266 0.08191 0.08210 0.08509 FN908155 0.06160 0.06285 0.06165 0.06322 0.06720 0.06245 0.05840 0.07865 0.07785 0.06160 0.06285 0.06165 0.06322 0.06720 AB061374 0.06000 0.06124 0.06085 0.06240 0.06560 0.06405 0.05760 0.07303 0.07223 0.06000 0.06124 0.06085 0.06240 0.06560 FN908160 0.06800 0.06930 0.06805 0.06979 0.06720 0.06085 0.05840 0.06982 0.06902 0.06800 0.06930 0.06805 0.06979 0.06720 FN908162 0.07938 0.08020 0.07938 0.07970 0.08183 0.07119 0.06792 0.07535 0.07453 0.07938 0.08020 0.07938 0.07970 0.08183

Appendix D, continued

KT807829 KJ606645 KJ606650 FN908151 FN908161 FN908147 FN908155 AB061374 FN908160 FN908162 KT807829 N KJ606645 0.05805 KJ606650 0.06214 0.01472 FN908151 0.07009 0.06132 0.06378 FN908161 0.08000 0.06868 0.07032 0.07009 FN908147 0.07536 0.07195 0.07441 0.08068 0.08509 FN908155 0.05920 0.05070 0.05233 0.06275 0.07120 0.07699 AB061374 0.05280 0.05478 0.05478 0.06194 0.07520 0.07455 0.02400 FN908160 0.05520 0.04988 0.05642 0.06194 0.06480 0.07212 0.04400 0.04480 FN908162 0.06792 0.05984 0.06475 0.07038 0.07692 0.07856 0.05728 0.05646 0.04173 N

Univers

ity of

Mala

ya

18

1

Appendix D, continued

AB038604 1209183 1209190 1206066 AB061397 1404050 FN908149 JQ976891 FN908154 AY772019 KU382051 KX586174 AB038604 N 1209183 0.06423 1209190 0.06511 0.00244 1206066 0.06320 0.00244 0.00482 AB061397 0.06880 0.00650 0.01206 0.00720 1404050 0.05887 0.01230 0.01459 0.01290 0.02016 FN908149 0.06400 0.04309 0.04502 0.04320 0.04880 0.04032 JQ976891 0.07520 0.06179 0.06270 0.05920 0.06640 0.05887 0.06240 FN908154 0.06320 0.06016 0.06350 0.05840 0.06400 0.05806 0.06560 0.06880 AY772019 0.05360 0.06423 0.06511 0.06560 0.06960 0.06290 0.06160 0.07760 0.05360 KU382051 0.05760 0.06829 0.06913 0.06960 0.07360 0.06694 0.06560 0.08160 0.05920 0.00560 KX586174 0.06623 0.06787 0.06868 0.06868 0.07114 0.06430 0.06705 0.07686 0.06296 0.04334 0.04742 KT807829 0.06160 0.06585 0.06672 0.06480 0.06880 0.06048 0.06160 0.07120 0.05520 0.04240 0.04480 0.04988 KJ606645 0.07114 0.07114 0.06950 0.07114 0.07359 0.06843 0.07359 0.08095 0.06214 0.05805 0.05887 0.06378 KJ606650 0.07604 0.07686 0.07686 0.07686 0.07931 0.07502 0.07441 0.08422 0.06950 0.06460 0.06378 0.06705 FN908151 0.07905 0.07905 0.08150 0.07661 0.07905 0.07560 0.07905 0.09046 0.07498 0.06275 0.06194 0.07441 FN908161 0.08160 0.08862 0.09084 0.08800 0.09040 0.08468 0.08480 0.09440 0.08240 0.07120 0.07200 0.08258 FN908147 0.08914 0.08130 0.08347 0.08023 0.08185 0.07598 0.08995 0.09643 0.08266 0.07455 0.07699 0.07686 FN908155 0.07520 0.07398 0.07556 0.07120 0.07520 0.06855 0.06560 0.08480 0.06640 0.06000 0.06080 0.06051 AB061374 0.07120 0.07154 0.07315 0.06880 0.07280 0.06613 0.06480 0.08480 0.06320 0.05760 0.05840 0.06051 FN908160 0.07120 0.07154 0.07315 0.07040 0.07440 0.06774 0.07120 0.08480 0.06640 0.05840 0.06240 0.06132 FN908162 0.07774 0.07365 0.07529 0.07283 0.07529 0.07078 0.07938 0.09165 0.07692 0.07038 0.07283 0.07459

Univ

ersity

of M

alaya

18

2

Appendix E: Uncorrected pairwise distance matrix of the COI-5P sequences.

1209183 1209209 1404246 1404247 1404143 1208002 KT807809 KT807814 KT807811 J15 1209204 1209202 1209005 1206070 1209183 N 1209209 0.00334 1404246 0.10909 0.10383 1404247 0.10909 0.10224 0.00316 1404143 0.10744 0.10224 0.00316 0.00316 1208002 0.11074 0.10543 0.04272 0.04272 0.04114 KT807809 0.12310 0.12266 0.08432 0.08432 0.08263 0.09106 KT807814 0.12648 0.12606 0.08769 0.08769 0.08600 0.09444 0.00337 KT807811 0.13752 0.13356 0.10866 0.10866 0.10696 0.09508 0.11036 0.11375 J15 0.10465 0.10433 0.08307 0.08147 0.08147 0.08466 0.09322 0.09661 0.09898 1209204 0.10579 0.10543 0.08386 0.08386 0.08228 0.08228 0.09106 0.09444 0.09847 0.00160 1209202 0.10744 0.10703 0.08544 0.08544 0.08386 0.08386 0.09275 0.09612 0.10017 0.00319 0.00158 1209005 0.10744 0.10703 0.08228 0.08228 0.08070 0.08386 0.08938 0.09275 0.10017 0.00319 0.00158 0.00316 1206070 0.10579 0.10543 0.08703 0.08703 0.08544 0.08228 0.08769 0.09106 0.09168 0.00799 0.00633 0.00791 0.00791 S7 0.10909 0.10863 0.09494 0.09494 0.09335 0.08386 0.08938 0.09275 0.09677 0.01597 0.01424 0.01582 0.01582 0.01741 C4 0.11371 0.11396 0.08668 0.08507 0.08507 0.07384 0.08703 0.09044 0.09949 0.04984 0.04815 0.04976 0.04976 0.05136 1506071 0.11333 0.11236 0.08494 0.08333 0.08333 0.07212 0.08844 0.09184 0.09915 0.04808 0.04647 0.04808 0.04808 0.04968 1211004 0.11240 0.11182 0.07911 0.07911 0.07753 0.07278 0.07926 0.08263 0.10187 0.04952 0.04747 0.04905 0.04589 0.05063 0712476 0.11405 0.11342 0.08386 0.08386 0.08228 0.07753 0.08769 0.09106 0.10526 0.05591 0.05380 0.05538 0.05222 0.05696 1404200 0.11901 0.11821 0.08861 0.08861 0.08703 0.07911 0.09106 0.09106 0.10526 0.05591 0.05380 0.05538 0.05222 0.05696 1404049 0.11500 0.11396 0.08654 0.08494 0.08494 0.07692 0.08844 0.09184 0.10256 0.05288 0.05128 0.05288 0.05288 0.05449 1405001 0.12397 0.12460 0.09335 0.09335 0.09177 0.08544 0.09275 0.09612 0.09677 0.04952 0.04747 0.04589 0.04905 0.05063 1404081 0.10744 0.10703 0.07911 0.07911 0.07753 0.07595 0.08432 0.08769 0.09168 0.04633 0.04430 0.04589 0.04589 0.04747 KT807819 0.10793 0.10733 0.09275 0.09275 0.09106 0.09949 0.10118 0.10455 0.10357 0.07966 0.08094 0.08263 0.07926 0.08094 KT807817 0.10793 0.10733 0.09275 0.09275 0.09106 0.09949 0.10118 0.10455 0.10696 0.07966 0.08094 0.08263 0.07926 0.08432 KX586166 0.10793 0.10733 0.08600 0.08600 0.08432 0.08600 0.08600 0.08938 0.10526 0.07119 0.06914 0.07083 0.06745 0.06914 KX586151 0.10624 0.10562 0.08432 0.08432 0.08263 0.08432 0.08432 0.08769 0.10357 0.06949 0.06745 0.06914 0.06577 0.06745 GQ862073 0.08430 0.08466 0.07595 0.07595 0.07437 0.08386 0.08769 0.09106 0.09677 0.05272 0.05380 0.05538 0.05222 0.05380

Univers

ity of

Mala

ya

18

3

Appendix E, continued

1209183 1209209 1404246 1404247 1404143 1208002 KT807809 KT807814 KT807811 J15 1209204 1209202 1209005 1206070 GQ862071 0.12066 0.11821 0.10443 0.10443 0.10285 0.10285 0.10961 0.11298 0.11205 0.09105 0.08861 0.08703 0.08703 0.08861 S13 0.09587 0.09265 0.08070 0.08070 0.07911 0.08070 0.08938 0.09275 0.09508 0.07508 0.07278 0.07437 0.07437 0.06962 1403055 0.10744 0.10703 0.10601 0.10601 0.10443 0.09968 0.11804 0.12142 0.10866 0.08307 0.08070 0.08228 0.08228 0.07753 1209203 0.10909 0.10863 0.10443 0.10443 0.10285 0.09810 0.11636 0.11973 0.10696 0.08466 0.08228 0.08386 0.08386 0.07911 1406043 0.11405 0.11342 0.10918 0.10918 0.10759 0.09968 0.11804 0.12142 0.10526 0.08946 0.08703 0.08861 0.08861 0.08386 S10 0.11240 0.11182 0.10759 0.10759 0.10601 0.10127 0.11973 0.12310 0.10696 0.08786 0.08544 0.08703 0.08703 0.08228 1209001 0.11405 0.11342 0.10285 0.10285 0.10127 0.09968 0.12142 0.12479 0.10526 0.08626 0.08386 0.08544 0.08544 0.08386 S5 0.10909 0.10863 0.10443 0.10443 0.10285 0.09810 0.11636 0.11973 0.10357 0.08466 0.08228 0.08386 0.08386 0.07911 1404182 0.10744 0.10703 0.10285 0.10285 0.10127 0.09968 0.11298 0.11636 0.10696 0.08626 0.08386 0.08544 0.08228 0.08070 1404132 0.10909 0.10863 0.10127 0.10127 0.09968 0.09810 0.11467 0.11804 0.10696 0.08626 0.08386 0.08544 0.08228 0.08070 1209396 0.10909 0.10863 0.10127 0.10127 0.09968 0.09810 0.11130 0.11467 0.10526 0.08466 0.08228 0.08386 0.08070 0.07911 KM254858 0.10744 0.10703 0.09652 0.09652 0.09652 0.09810 0.10287 0.10624 0.11885 0.09904 0.09652 0.09810 0.09494 0.09652 JX475023 0.12414 0.12191 0.10379 0.10214 0.10379 0.12521 0.12676 0.13028 0.13404 0.10430 0.10544 0.10379 0.10379 0.10379 KM254920 0.13884 0.13578 0.11076 0.11076 0.11076 0.10759 0.13153 0.13491 0.12903 0.10863 0.10918 0.11076 0.10759 0.10918

Univers

ity of

Mala

ya

18

4

Appendix E, continued

S7 C4 1506071 1211004 0712476 1404200 1404049 1405001 1404081 KT807819 KT807817 KX586166 KX586151 GQ862073 1209183 0.10909 0.10863 0.09494 0.09494 0.09335 0.08386 0.08938 0.09275 0.09677 0.01597 0.01424 0.01582 0.01582 0.01741 1209209 0.11371 0.11396 0.08668 0.08507 0.08507 0.07384 0.08703 0.09044 0.09949 0.04984 0.04815 0.04976 0.04976 0.05136 1404246 0.11333 0.11236 0.08494 0.08333 0.08333 0.07212 0.08844 0.09184 0.09915 0.04808 0.04647 0.04808 0.04808 0.04968 1404247 0.11240 0.11182 0.07911 0.07911 0.07753 0.07278 0.07926 0.08263 0.10187 0.04952 0.04747 0.04905 0.04589 0.05063 1404143 0.11405 0.11342 0.08386 0.08386 0.08228 0.07753 0.08769 0.09106 0.10526 0.05591 0.05380 0.05538 0.05222 0.05696 1208002 0.11901 0.11821 0.08861 0.08861 0.08703 0.07911 0.09106 0.09106 0.10526 0.05591 0.05380 0.05538 0.05222 0.05696 KT807809 0.11500 0.11396 0.08654 0.08494 0.08494 0.07692 0.08844 0.09184 0.10256 0.05288 0.05128 0.05288 0.05288 0.05449 KT807814 0.12397 0.12460 0.09335 0.09335 0.09177 0.08544 0.09275 0.09612 0.09677 0.04952 0.04747 0.04589 0.04905 0.05063 KT807811 0.10744 0.10703 0.07911 0.07911 0.07753 0.07595 0.08432 0.08769 0.09168 0.04633 0.04430 0.04589 0.04589 0.04747 J15 0.10793 0.10733 0.09275 0.09275 0.09106 0.09949 0.10118 0.10455 0.10357 0.07966 0.08094 0.08263 0.07926 0.08094 1209204 0.10793 0.10733 0.09275 0.09275 0.09106 0.09949 0.10118 0.10455 0.10696 0.07966 0.08094 0.08263 0.07926 0.08432 1209202 0.10793 0.10733 0.08600 0.08600 0.08432 0.08600 0.08600 0.08938 0.10526 0.07119 0.06914 0.07083 0.06745 0.06914 1209005 0.10624 0.10562 0.08432 0.08432 0.08263 0.08432 0.08432 0.08769 0.10357 0.06949 0.06745 0.06914 0.06577 0.06745 1206070 0.08430 0.08466 0.07595 0.07595 0.07437 0.08386 0.08769 0.09106 0.09677 0.05272 0.05380 0.05538 0.05222 0.05380 S7 0.10909 0.10863 0.09494 0.09494 0.09335 0.08386 0.08938 0.09275 0.09677 0.01597 0.01424 0.01582 0.01582 0.01741 C4 0.11371 0.11396 0.08668 0.08507 0.08507 0.07384 0.08703 0.09044 0.09949 0.04984 0.04815 0.04976 0.04976 0.05136 1506071 0.11333 0.11236 0.08494 0.08333 0.08333 0.07212 0.08844 0.09184 0.09915 0.04808 0.04647 0.04808 0.04808 0.04968 1211004 0.11240 0.11182 0.07911 0.07911 0.07753 0.07278 0.07926 0.08263 0.10187 0.04952 0.04747 0.04905 0.04589 0.05063 0712476 0.11405 0.11342 0.08386 0.08386 0.08228 0.07753 0.08769 0.09106 0.10526 0.05591 0.05380 0.05538 0.05222 0.05696 1404200 0.11901 0.11821 0.08861 0.08861 0.08703 0.07911 0.09106 0.09106 0.10526 0.05591 0.05380 0.05538 0.05222 0.05696 1404049 0.11500 0.11396 0.08654 0.08494 0.08494 0.07692 0.08844 0.09184 0.10256 0.05288 0.05128 0.05288 0.05288 0.05449 1405001 0.12397 0.12460 0.09335 0.09335 0.09177 0.08544 0.09275 0.09612 0.09677 0.04952 0.04747 0.04589 0.04905 0.05063 1404081 0.10744 0.10703 0.07911 0.07911 0.07753 0.07595 0.08432 0.08769 0.09168 0.04633 0.04430 0.04589 0.04589 0.04747 KT807819 0.10793 0.10733 0.09275 0.09275 0.09106 0.09949 0.10118 0.10455 0.10357 0.07966 0.08094 0.08263 0.07926 0.08094 KT807817 0.10793 0.10733 0.09275 0.09275 0.09106 0.09949 0.10118 0.10455 0.10696 0.07966 0.08094 0.08263 0.07926 0.08432 KX586166 0.10793 0.10733 0.08600 0.08600 0.08432 0.08600 0.08600 0.08938 0.10526 0.07119 0.06914 0.07083 0.06745 0.06914 KX586151 0.10624 0.10562 0.08432 0.08432 0.08263 0.08432 0.08432 0.08769 0.10357 0.06949 0.06745 0.06914 0.06577 0.06745 GQ862073 0.08430 0.08466 0.07595 0.07595 0.07437 0.08386 0.08769 0.09106 0.09677 0.05272 0.05380 0.05538 0.05222 0.05380

Univers

ity of

Mala

ya

18

5

Appendix E, continued

S7 C4 1506071 1211004 0712476 1404200 1404049 1405001 1404081 KT807819 KT807817 KX586166 KX586151 GQ862073 GQ862071 0.08703 0.08668 0.08814 0.08228 0.09177 0.09177 0.09295 0.08861 0.07437 0.08769 0.08769 0.09949 0.09781 0.07278

S13 0.07437 0.08026 0.07853 0.07753 0.08070 0.08228 0.07853 0.06962 0.06487 0.07757 0.08094 0.07926 0.07757 0.06329

1403055 0.08386 0.08668 0.08654 0.08544 0.08861 0.09177 0.08974 0.08544 0.07911 0.08769 0.09106 0.08600 0.08432 0.08070

1209203 0.08544 0.08507 0.08494 0.08386 0.08703 0.09019 0.08814 0.08386 0.07753 0.08600 0.08938 0.08432 0.08263 0.07911

1406043 0.09019 0.08668 0.08654 0.08861 0.09177 0.09494 0.09295 0.08861 0.08228 0.09106 0.09444 0.08938 0.08769 0.08386

S10 0.08861 0.08507 0.08494 0.08703 0.09019 0.09335 0.09135 0.08703 0.08070 0.08938 0.09275 0.08769 0.08600 0.08228

1209001 0.09019 0.08347 0.08333 0.08544 0.08861 0.09177 0.08974 0.08861 0.07911 0.09106 0.09444 0.08938 0.08769 0.08386

S5 0.08544 0.08186 0.08173 0.08386 0.08703 0.09019 0.08814 0.08386 0.07753 0.08600 0.08938 0.08432 0.08263 0.07911

1404182 0.08703 0.08347 0.08333 0.08228 0.08861 0.09177 0.09295 0.08544 0.08228 0.08263 0.08600 0.08432 0.08263 0.07753

1404132 0.08703 0.08668 0.08654 0.08544 0.08544 0.09177 0.09295 0.08544 0.08228 0.08938 0.09275 0.08432 0.08263 0.07753

1209396 0.08544 0.08186 0.08173 0.08070 0.08386 0.08703 0.08814 0.08386 0.08070 0.08432 0.08769 0.08263 0.08094 0.07595

KM254858 0.09968 0.10754 0.10897 0.10127 0.10127 0.10285 0.09936 0.10601 0.09019 0.09275 0.09275 0.09949 0.09781 0.08544

JX475023 0.11532 0.11901 0.11755 0.11862 0.12356 0.12356 0.12417 0.12356 0.11532 0.11972 0.12148 0.11268 0.11092 0.10049

KM254920 0.11076 0.11557 0.11699 0.11392 0.11551 0.11551 0.11699 0.11392 0.11392 0.12310 0.12142 0.11130 0.10961 0.10601

Univers

ity of

Mala

ya

18

6

Appendix E, continued

GQ862071 S13 1403055 1209203 1406043 S10 1209001 S5 1404182 1404132 1209396 KM254858 JX475023 KM254920 GQ862071 N S13 0.08386 1403055 0.10759 0.07753 1209203 0.10601 0.07595 0.00158 1406043 0.11076 0.07753 0.00633 0.00475 S10 0.10918 0.07911 0.00475 0.00316 0.00475 1209001 0.10759 0.08070 0.00633 0.00475 0.00633 0.00475 S5 0.10601 0.07595 0.00475 0.00316 0.00475 0.00316 0.00475 1404182 0.10443 0.07437 0.01266 0.01108 0.01266 0.01108 0.01266 0.01108 1404132 0.10759 0.07753 0.01582 0.01424 0.01582 0.01424 0.01582 0.01424 0.00633 1209396 0.10285 0.07595 0.01108 0.00949 0.01108 0.00949 0.01108 0.00949 0.00475 0.00791 KM254858 0.11867 0.08544 0.09810 0.09652 0.09810 0.09968 0.10127 0.09652 0.09494 0.09494 0.09652 JX475023 0.12850 0.11203 0.13509 0.13344 0.13839 0.13674 0.13344 0.13344 0.12850 0.13015 0.13015 0.12521 KM254920 0.12658 0.11709 0.13608 0.13449 0.13608 0.13449 0.13924 0.13449 0.13291 0.13291 0.13133 0.11392 0.09226 N

Univers

ity of

Mala

ya

18

7

Appendix F: Uncorrected pairwise distance matrix of the UPA sequences

1205213 S4 1209203 1209208 1209209 1209183 KX586118 KX586122 1208002 KX586103 1404247 KX586108 GQ471923 1205213 N S4 0.00811 1209203 0.00270 0.01081 1209208 0.04324 0.05135 0.04324 1209209 0.04054 0.04865 0.04054 0.00270 1209183 0.03784 0.04595 0.04054 0.00541 0.00270 KX586118 0.02703 0.03514 0.02973 0.02973 0.02703 0.02432 KX586122 0.02432 0.03243 0.02703 0.02973 0.02703 0.02432 0.00270 1208002 0.03514 0.04324 0.03784 0.03784 0.03514 0.03243 0.01351 0.01622 KX586103 0.03784 0.04595 0.04054 0.04054 0.03784 0.03514 0.01081 0.01351 0.01351 1404247 0.03514 0.04324 0.03784 0.03784 0.03514 0.03243 0.01351 0.01622 0.01081 0.01892 KX586108 0.03514 0.04324 0.03784 0.03784 0.03514 0.03243 0.00811 0.01081 0.01081 0.01351 0.01081 GQ471923 0.03243 0.04054 0.03514 0.03514 0.03243 0.02973 0.01622 0.01892 0.01892 0.02703 0.01892 0.01892 KX586140 0.03784 0.04595 0.04054 0.04054 0.03784 0.03514 0.02162 0.02432 0.01892 0.02703 0.01892 0.01351 0.01081 1209202 0.03784 0.04595 0.04054 0.04054 0.03784 0.03514 0.01351 0.01622 0.02162 0.02432 0.02162 0.01081 0.02162 1012344 0.03243 0.04054 0.03514 0.03784 0.03514 0.03243 0.01081 0.01351 0.01892 0.02162 0.01892 0.01351 0.01892 HQ421565 0.03784 0.04595 0.04054 0.04054 0.03784 0.03514 0.01351 0.01622 0.01622 0.02432 0.02162 0.01622 0.02162 1211004 0.02973 0.03784 0.03243 0.03243 0.02973 0.02703 0.01081 0.01351 0.01351 0.01622 0.01351 0.01351 0.01351 0712476 0.02703 0.03514 0.02973 0.03514 0.03243 0.02973 0.01351 0.01622 0.01622 0.01892 0.01622 0.01622 0.01622 1404077 0.04324 0.05135 0.04595 0.04595 0.04324 0.04054 0.02432 0.02703 0.02703 0.02432 0.02703 0.02703 0.02703 1405001 0.02432 0.03243 0.02703 0.03784 0.03514 0.03243 0.01622 0.01892 0.01892 0.02703 0.01892 0.01892 0.01892 HQ421574 0.02162 0.02973 0.02432 0.02432 0.02162 0.01892 0.00541 0.00811 0.01351 0.01622 0.01351 0.01351 0.01081 S1 0.03784 0.04595 0.04054 0.05135 0.04865 0.04595 0.02703 0.02973 0.03243 0.03243 0.03243 0.03243 0.02973 KJ648575 0.06486 0.07297 0.06757 0.07297 0.07027 0.06757 0.06216 0.06486 0.07027 0.07297 0.07027 0.07027 0.05946 KJ543073 0.06216 0.07027 0.06486 0.07297 0.07027 0.06757 0.06216 0.05946 0.07027 0.06757 0.07027 0.07027 0.06216

Univers

ity of

Mala

ya

18

8

Appendix F, continued

KX586140 1209202 1012344 HQ421565 1211004 0712476 1404077 1405001 HQ421574 S1 KJ648575 KJ543073 KX586140 N 1209202 0.02162 1012344 0.02432 0.00811 HQ421565 0.02703 0.01622 0.01351 1211004 0.01892 0.01351 0.01081 0.01351 0712476 0.02162 0.01622 0.01351 0.01622 0.00270 1404077 0.03243 0.02703 0.02432 0.02703 0.01351 0.01622 1405001 0.02432 0.01892 0.01351 0.01892 0.01081 0.01351 0.02432 HQ421574 0.01622 0.01622 0.01351 0.01622 0.00811 0.01081 0.02162 0.01351 S1 0.03514 0.03784 0.03514 0.03784 0.02973 0.03243 0.03784 0.03514 0.02703 KJ648575 0.06486 0.07027 0.06757 0.07027 0.06216 0.06486 0.07027 0.06486 0.05946 0.06216 KJ543073 0.06757 0.07568 0.07297 0.07568 0.06757 0.07027 0.07027 0.07027 0.06216 0.05676 0.02432

Univers

ity of

Mala

ya

18

9

Appendix G: Uncorrected pairwise distance matrix of the LSU (28S rDNA) sequences

S2 GQ471913 GQ471914 GQ471915 1404246 1209001 1211004 1209204 1208001 1405001 1209005 KJ594951 1209183 S2 N GQ471913 0.00162 GQ471914 0.00000 0.00162 GQ471915 0.00324 0.00485 0.00324 1404246 0.00485 0.00647 0.00485 0.00162 1209001 0.00487 0.00649 0.00487 0.00162 0.00325 1211004 0.00485 0.00647 0.00485 0.00162 0.00324 0.00162 1209204 0.00485 0.00646 0.00485 0.00000 0.00162 0.00162 0.00161 1208001 0.00485 0.00647 0.00485 0.00162 0.00324 0.00324 0.00323 0.00161 1405001 0.00324 0.00485 0.00324 0.00000 0.00162 0.00162 0.00162 0.00000 0.00162 1209005 0.00324 0.00485 0.00324 0.00000 0.00162 0.00162 0.00161 0.00000 0.00161 0.00000 KJ594951 0.00485 0.00647 0.00485 0.00162 0.00324 0.00325 0.00324 0.00162 0.00324 0.00162 0.00162 1209183 0.00808 0.00969 0.00808 0.00485 0.00647 0.00647 0.00645 0.00644 0.00645 0.00485 0.00484 0.00324 HQ422446 0.00334 0.00501 0.00334 0.00000 0.00000 0.00168 0.00167 0.00000 0.00167 0.00000 0.00000 0.00167 0.00501 AM420447 0.03859 0.04027 0.03859 0.04034 0.04034 0.04209 0.04195 0.04188 0.04195 0.04027 0.04027 0.03866 0.04181 AM42041 0.04027 0.04195 0.04027 0.04202 0.04202 0.04384 0.04370 0.04362 0.04370 0.04202 0.04202 0.04034 0.04355

Appendix G, continued

HQ422446 AM420447 AM420418 HQ422446 N AM420447 0.04089 AM420418 0.04259 0.00491 N

Univers

ity of

Mala

ya