mapping the functional domain of the prion protein
TRANSCRIPT
Mapping the functional domain of the prion protein
Taian Cui1, Maki Daniels2, Boon Seng Wong3, Ruliang Li3, Man-Sun Sy3, Judyth Sassoon1
and David R. Brown1,2
1Department of Biology and Biochemistry, University of Bath, UK; 2Department of Biochemistry, Cambridge University, UK;3Institute of Pathology, Case Western Reserve University School of Medicine, Cleveland, Ohio, USA
Prion diseases such as Creutzfeldt–Jakob disease are pos-sibly caused by the conversion of a normal cellular glyco-protein, the prion protein (PrPc) into an abnormal isoform(PrPSc). The process that causes this conversion is unknown,but to understand it requires a detailed insight into thenormal activity of PrPc. It has become accepted from resultsof numerous studies that PrPc is a Cu-binding protein andthat its normal function requires Cu. Further work hassuggested that PrPc is an antioxidant with an activity likethat of a superoxide dismutase. We have shown in thisinvestigation that this activity is optimal for the whole
protein and that deletion of parts of the protein reduce orabolish this activity. The protein therefore contains an activedomain requiring certain regions such as the Cu-bindingoctameric repeat region and the hydrophobic core. Theseregions show high evolutionary conservation fitting withthe idea that they are important to the active domain ofthe protein.
Keywords: copper; Creutzfeldt–Jakob disease; oxidativestress; scrapie; superoxide dismutase.
Neurodegenerative diseases are a major threat to humanhealth. One group of disease termed prion diseases [1,2]make up a small percentage of all human neurodegenerativediseases. Prion diseases have become a major concernbecause of the possibility that one particular from, variantCreutzfeldt–Jacob disease (vCJD), might arise throughtransmission of an animal disease, such as bovine spongi-form encephalopathy [3], to humans [4]. Other priondiseases include the sheep disease scrapie [5] and inheritedforms such as Gerstmann–Straussler–Scheinker syndrome[6]. All of these disease are linked together because of thedeposition of an abnormal, protease-resistant isoform of theprion protein in brains of individuals with these diseases.This abnormal form of the protein (PrPSc) is also suggestedto be the infectious agent in the disease on the basis ofinfection studies [2].
PrPSc is generated from the normal cellular isoform of theprion protein (PrPc) which is present in the brain as a cellsurface glycoprotein [7]. Each form has distinct properties[8]. Therefore understanding the basis of prion diseaserevolves around understanding how the normal protein isconverted to the abnormal isoform. This conversioninvolves a switch in conformation from a structure rich ina helices to one rich in b-sheet [9]. Although there have beenmany studies with PrPSc the study of PrPc has been limited
until recently. As an evolutionarily conserved glycoprotein[10] it has been postulated that PrPc has an importantfunction. Nevertheless, knockout mice for PrPc show nogross changes in terms of development or behaviour [11]but cannot be infected with mouse-passaged scrapie [12]. Incontrast to this biochemical and cell biological studies havesuggest that PrP-knockout mice have compromised cellularresistance to oxidative stress [13,14].
The first clue to the molecular function of PrPc came fromstudies that show PrPc to be a Cu-binding protein [15–20].The main Cu-binding site of the protein was shown to bewithin a conserved octameric repeat region, rich in histidine,located in the N terminus [10]. PrPc binds up to four atomsof Cu at these sites with a possible fifth binding site locatedelsewhere in the molecule [16,18,21]. Cellular expression ofPrPc also facilitates Cu uptake by neurones [22] andincreased extracellular Cu causes an increased turnover ofPrPc [23]. Binding of Cu to the protein influences its abilityto interact with other proteins such as plasminogen [24] andglycosaminoglycans [25].
Knockout of PrPc causes a decrease in cellular resistanceof neurones to oxidative stress [13,14,26]. This has lead tosuggestions that PrPc might be an antioxidant. Immuno-depletion of PrPc from the brain extracts leads to areduction in superoxide dismutase (SOD) activity withinthe extract [27]. Studies with both recombinant protein andnative protein purified from the brains of mice suggest thatPrPc can act as a SOD [17,28]. This activity is high andrequires specific binding of Cu to the octameric repeats.Binding of Cu elsewhere in the protein, or Cu simply to apeptide based on the octameric repeats does not result inthis activity [28]. Cellular resistance to oxidative stress isinfluenced by the PrPc protein and the amount of Cu boundto it [17]. Allelic differences in mouse PrPc have also beenshown to influence the level of the activity of the protein, asprotein with the sequence of the mouse �b� allele is more
Correspondence to D. R. Brown, Department of Biology and Bio-
chemistry, University of Bath, Calverton Down, Bath, BA2 7AY, UK.
Fax: +441225 826779, Tel.:+441225 323133,
E-mail: [email protected]
Abbreviations: CJD, Creutzfeldt–Jacob disease; vCJD, variant
Creutzfeldt–Jacob disease; PrPc, prion protein; PrPSc, abnormal
isoform of prion protein; rPrP, recombinant mouse prion protein;
SOD, superoxide dismutase.
(Received 28 April 2003, revised 5 June 2003, accepted 11 June 2003)
Eur. J. Biochem. 270, 3368–3376 (2003) � FEBS 2003 doi:10.1046/j.1432-1033.2003.03717.x
active than that based of the sequence of the �a� allele [29]. Incontrast, PrPSc, which binds almost no Cu has no detectableSOD activity [30,31].
Proteins that are enzymes normally have active sites thatare essential for the enzymatic activity. In this study we usedboth a panel of highly specific antibodies and a series ofdeletion mutants of recombinant PrP to determine whichregions of the protein are necessary for the SOD activity.We determined that the active site consists of two domains.The first includes the Cu-binding domain and the secondincludes the conserved hydrophobic domain in the middleof the protein. Additionally, the C terminus of the protein isimportant for this activity.
Experimental methods
Production of recombinant protein
Production of recombinant mouse prion protein (rPrP) hasbeen described previously [28]. Briefly, PCR amplifiedproduct was cloned in the expression vector, pET-23(Novagen) and transformed into Escherichia coliAD494(DE3). The expressed proteins were recovered fromurea solubilized, sonicated bacterial lysate after using immo-bilized nickel-based affinity chromatography (Invitrogen).Theelutedmaterialwas refoldedbyseveral successive roundsof dilution in either deionized water or 1 mM CuSO4 fol-lowed by ultrafiltration and dialysis to remove unbound Cu.The final protein was typically >95% pure and was concen-trated to �1–2 mgÆmL)1. Its identity was confirmed byN-terminal sequencing and Western blotting using the poly-clonal antibody to mouse PrP (DR1). Protein concentrationwas determined using the Sigma BCA protein assay reagent.
Mutagenesis
Deletion mutants of the rPrP were prepared using a PCRbased mutagenesis procedure involving paired oligonucleo-tides to either insert an additional restriction site or to deletea proportion of the gene sequence. Mutagenesis wasconfirmed by DNA sequencing. The mouse PrP ORF wasinserted between theNde1 site (5¢) and theXho1 site (3¢). Anadditional Xho1 site was inserted either after codon 171, orcodon 112. Removal of an Xho1 fragment by enzymaticdigestion and subsequent ligation created the deletionmutants PrP23–112 and PrP23–171. A similar procedurewas used to produce PrP45–231, PrP90–231, PrP105–231and PrP113–231. In this case an Nde1 site was insertedbefore codon, 45, 90, 105 and 113, respectively. Pairedprimers were also used in mutagenesis experiments togenerate deletions of codons 35–45 (PrPD34–45), 112 to136(PrPD112–136) and 135–150 (PrPD135–150). The oligo-nucleotides used in these mutagenesis experiments are listedin Table 1. Other prion protein mutations generated in asimilar way were as described previously [28,32,33]. Proteinfor these deletion mutants was expressed, purified andrefolded as described above for wild-type protein.
SOD assays
SOD-like activity of recombinant PrP (1 lgÆmL)1) wasdetermined using the xanthine/xanthine oxidase/nitro-blue
tetrazolium (NBT) assay as described before [28]. Thisassay uses superoxide production from xanthine oxidaseand xanthine and detection of a coloured formazanproduct formed from nitro-blue tetrazolium at 560 nm.The SOD-like activity was expressed as percentage inhibi-tion of formazan produced where 100% formazan productformation is the amount of nitro-blue tetrazolium reducedby xanthine oxidase-formed radicals in control reactionswithout brain extracts or affinity-purified PrP. All assayswere performed in triplicate. The proteins used were testedfor their ability to reduce nitro-blue tetrazolium in theabsence of xanthine oxidase. None of the proteins showedany reduction of nitro-blue tetrazolium to form formazanas measured spectrophotometrically for 5 min. Also,xanthine oxidase was driven to reduce nitro-blue tetra-zolium aerobically by the addition of 50 lM xanthine to thereaction mixture. A second gel-based assay was also usedto detect SOD activity. Proteins (5–20 lg) were electro-phoresed on a 7% polyacrylamide gel without SDS orreducing agents. After electrophoresis, the gel was soakedin a solution of 5 mM nitro-blue tetrazolium at roomtemperature with rocking for 20 min The gel was thenrinsed briefly with distilled water and a developing solution(30 lM riboflavin, 30 mM tetramethylethylenediamine,40 mM potassium phosphate pH 7.8) for 15 min. At thispoint the gel was exposed to the light until a uniform bluecolour covered the gel. Protein with SOD reactivity leavesthe gel transparent. However, if the reaction was allowedto proceed indefinitely the contrast between these regionswould be lost.
Western blotting
Purified proteins were electrophoresed on a 15% polyacryl-amide gel in the presence of SDS and reducing agents.Proteins were blotted onto polyvinylidene fluoride (PVDF)membrane and protein detected by a specific polyclonal(DR1) or monoclonal (DM3) antibody as described previ-ously [32]. This allowed verification of the size and identityof these proteins.
Table 1. Mutagenesis oligonucleotides. Only forward oligonucleotides
are listed. The reverse oligonucleotide of the splint pair had the com-
plementary sequence.
Prion protein
generated Oligonucleotide
PrP23–112 GCATGTGGCAGGGCTCGAGGCAGCTGGGGCPrP23–171 GCAACCAGCTCGAGTTCGTGCACGPrP45–231 GGGAAGCCATATGGGCAACCGPrP90–231 GCCCCATGGCGGTGGATGGCATATGGGAGG
GGGTACCCPrP105–231 GGAACAAGCCCAGCCATATGAAAACCAACC
TCAAGCPrP113–231 CCAACCTCAAGCATATGGCAGGGPrPD35–45 GGGTGGAACACCGGTGGCAACCGTTACCCPrP112–119 CCTCAAGCATGTGGTAGTGGGGGGCCPrPD112–136 CCAACCTCAAGCATGTGATGATCCATTTTGGCPrPD135–150 GCGCCGTGAGCGAAAACATGTACCGC
� FEBS 2003 PrP functional domains (Eur. J. Biochem. 270) 3369
CD spectroscopy
CD spectra were recorded for prion proteins and peptidesusing a Jasco J-810 spectropolarimeter, calibrated withammonium d-camphor-10-sulfonate by a method similar tothat described previously [27]. Protein solutions wereprepared to contain 2 mgÆmL)1 in 10 mM sodium phos-phate pH 7.4. These samples were measured in cuvettes of1 mm or 0.5 mm pathlength (Hellma). The spectrum from190 nm to 250 nm was analysed with step resolution of0.5 nm at a temperature of 23 �C. Five scans were averagedand the buffer background was subtracted. Spectra arepresented as molar ellipticity (h).
Results
Antibody inhibition of PrP SOD-like activity
A panel of highly specific monoclonal antibodies andpolyclonal antisera were generated against mouse PrP andhave been described previously [32,34–36]. The epitopes ofthese antibodies have been mapped and are listed inTable 2. The activity of wild-type PrP is like that of a SODand this activity can be measured by a number of assays.The most robust and accessible method for such a studyuses spectrophotometric analysis. We used an assay basedon formazan production from nitro-blue tetrazolium bysuperoxide generated by xanthine oxidase and xanthine.SOD activity inhibits formazan production in the assay bybreaking down superoxide. This assay was used to measurethe activity of wild-type PrP. A concentration of0.5 lgÆmL)1 PrP was found to inhibit �70% of theformazan production in the assay. This concentration was
used in further experiments in which antibodies or antiserawere added in conjunction with PrP to the SOD assay. Theresults of these experiments are shown in Fig. 1. Several ofthe antibodies and antisera caused a concentration-dependent inhibition of the SOD-like activity of PrP. Theability of the antibodies and antiserum to inhibit the SOD-like activity of PrP is sumarized in Table 2. Antibodies andantisera are listed according to the epitope to which theybind. It can be clearly seen that the antibodies and antiserathat inhibit PrP’s activity are clustered around two parts ofthe protein. The first cluster is in the N terminus. Thesecond cluster is focused on the hydrophobic domain,residues 112–145. Two antibodies that bind to the Cterminus also had a minor inhibitory effect on the SOD-like activity of PrP.
Production of deletion mutants of PrP
On the basis of the results with antibodies, a series of PrPmutants were made to assess whether deletions of certaindomains of the protein decrease the SOD-like activity of theprotein. The domains deleted were based on the epitopes ofthe antibodies that had a clear effect on SOD-like activity ofPrP. The mutants used in the study include the completeN- and C-terminal fragments (PrP23–112 and PrP113–231),deletions of the octameric repeat region (PrPD51–89,PrPD67–89), deletions of the hydrophobic domain(PrPD112–119, PrP112–136, PrP135–150), deletions of partsof the N terminus (PrP90–231, PrP45–231, PrPD35–45, PrP)and deletions of the C-terminal domain (PrP23–171). Theseproteins are illustrated in Fig. 2. A number of these proteinshave been studied [28,32]. The identity of the proteins wasverified by Western blot with specific antibodies (Fig. 3).
SOD-like activity of PrP deletion mutants
The activity of the PrP mutant proteins were compared tothat of the wild-type recombinant PrP using two assays thathave been widely used to detect SOD activity. An in-gelassay (Fig. 4) and a spectrophotometric assay (Fig. 5)detected high levels of activity in wild-type protein. How-ever, most of the mutations tested showed either no activityor reduced activity. A summary of these findings is shown inTable 3. Some results from previously published work areincluded for completeness. The in-gel assay showed visuallythat wild-type PrP has strong activity while the mutantsPrPD35–45, PrP23–171, PrPD112–119 and PrP45-231 hadreduced activity. PrPD112–136 had no activity. The spec-trophotemetric assay was performed (Fig. 5) with increasingconcentrations of protein from all the mutants. It should bekept in mind that for mutants with large deletions theconcentration of 5 lgÆmL)1 represents a higher molarconcentration than wild-type protein. However, theseproteins except for PrP23–171 were inactive in the assay.All mutants lacking the octameric repeat region wereinactive. Most of the mutants with small deletions showedsome activity except PrPD112–136. This mutant wascompletely inactive. Of considerable interest was the mutantPrP23–171 which despite a lack of a large amount of the Cterminus did show some activity. To test the stability of thisactivity a time-course study was carried out to compare theactivity of this protein to wild-type PrP. The proteins were
Table 2. Epitopes of antibodies and antisera used in the investigation of
PrP activity. Numbers relate to the amino acid residue sequence of
mouse prion protein. �Conformational� implies antibodies that bind to
the C terminus of the protein (145–231). The affinity of these anti-
bodies is sensitive to the conformation adopted by the protein.
Antibody
name Epitope
Ability to
Inhibit Activity
5B2 35–52 + +
8B4 34–45 + +
DR3 37–53 + +
DM1 68–84 + + +
DR1 89–103 + +
DR2 94–109 –
5C3 90–145 –
11G5 115–130 + + +
DM2 121–136 + +
7H6 130–140 + +
DM3 142–160 +
2G8 149–165 –
2C2 153–165 –
8H4 175–185 –
6H3 Conformational –
9H7 Conformational –
7A9 Conformational +
1C10 Conformational +
3370 T. Cui et al. (Eur. J. Biochem. 270) � FEBS 2003
added to the assay mixture at time zero and the activitymeasured for 60 s. After this time the activity of the proteinwas measured repeatedly at regular intervals for the nexthour (Fig. 5D). Where as wild-type PrP maintained itsactivity over the hour, PrP23–171 lost the majority of itsactivity over the same time period.
CD analysis of PrP mutants
In order to determine if deletion of critical regions of PrPcaused loss of activity because of structural alterations, thedeletion mutants were studied using CD spectroscopy. Thespectra produced are shown in Fig. 6. Of key interest werethose with minimal deletions of protein sequence whichcaused significant reduction in activity of the protein. Themajority of the deletion mutations did not cause significantchanges in the structure of PrP. As suggested from previouspublications the N terminus (PrP23–112) showed a spec-trum typical of a random coil (Fig. 6E). All other spectrademonstrated predominantly helical content. Interestingly,PrP23–171, which has deletions of two of the helicaldomains of the PrP protein, also possessed a high content ofhelical structure.
Activity domains of PrP
This body of research has provided two sets of resultsconcerning regions of the prion sequence necessary for its
10001001 00
20
40
60
80
100
120
5B28B4DM1
5C311G5
DM2DM3
C
[Antibody] in ng/ml
% C
on
tro
l S
OD
-lik
e A
ctiv
ity
10001001 00
20
40
60
80
100
7H62G8
2C28H46H3
9H77A9
1C10
B
[Antibody] in ng/ml
% C
on
tro
l S
OD
-lik
e A
ctiv
ity
10001001 00
20
40
60
80
100
DR3
DR1DR2
A
Antiserum Dilution
% C
on
tro
l S
OD
-lik
e A
ctiv
ity
Fig. 1. Antibodies. The activity of wild-type recombinant mouse PrP
was tested using a spectrophotometric assay based on the conversion
of nitro-blue tetrazolium to a coloured formazan product by super-
oxide generated from xanthine oxidase. PrP (0.5 lgÆmL)1) was used in
the assay which inhibited the reaction by �70% (see Fig. 5). Anti-
bodies and antisera were then tested for ability to block the effect of
PrP. PrP activity in the presence of the antibodies was expressed as a
percentage of the activity of PrP alone. Thus, decreased percentage of
control activity indicates inhibition of PrP. (Top) Effect of three
antisera of equivalent titre. Middle and bottom graphs show effects of
15 monoclonal antibodies. Shown are the mean and SEM of at least
three experiments.
PrP23-231
PrP23-112
PrP23-171
PrP45-231
PrP90-231
PrP105-231
PrP113-231
PrP∆35-45
PrP∆51-89
PrP∆51-67
PrP∆112-119
PrP∆112-136
PrP∆135-151
23 231
23 112
171
45
90
105
113
35
51 89
67
119
136
135 150
231
231
231
231
231
231
231
231
231
231
112
112
51
45
23
23
23
23
23
23
Fig. 2. Mutant proteins. Mutants of PrP were prepared using PCR-
based mutatagenesis and restriction digestion/ligation. The mutations
were deleted in parts of the protein that would possibly reduce the
activity of PrP based on results shown in Fig. 1 and Table 2. Schematic
locations of the deletions as compared with the wild-type protein are
shown by a space within the grey bar next to the name of the protein.
Numbers refer to the amino acid residues in the mouse PrP sequence.
� FEBS 2003 PrP functional domains (Eur. J. Biochem. 270) 3371
function. Results of the use of antibodies on wild-typeprotein and deletion mutants indicate the relativeimportance of these domains to PrP’s SOD-like activity.Comparison of data presented in Tables 2 and 3indicates that there are principally two domains thatare necessary for this activity. The first is the Cu-bindingdomain otherwise known as the octameric repeat region.The second is the hydrophobic domain in the centre ofthe molecule. A third domain in the N-terminal regionbefore the Cu-binding domain also has a strong influenceon activity. Further analysis indicates that the C terminusinfluences the activity to some extent but is not essential.Collectively, these results suggest that the activity of PrPc
requires N- and C-terminal domains which might interactto form the active site. These results are summarized inFig. 7.
Fig. 3. Western blotting.Wild-type mouse PrP and nine of the deletion
mutants described were electrophoresed on a 15% polyacrylamide gel
and transferred to a membrane. PrP was detected by using the antisera
DR1 which detects all of the mutants shown. 1, Wild-type PrP;
2, PrP23–231; 3, PrP23–171, 4; PrPD35–45; 5, PrPD135–150;
6, PrPD112–119; 7, PrP90–231; 8, PrPD51–89; 9, PrP45–231;
10, PrPD112–136.
Fig. 4. In-gel assay. An in-gel assay was used to provide a visual
demonstration of the SOD-like activity of wild-type PrP and some of
the active mutants. Five lg protein was electrophoresed on a native
polyacrylamide gel and stained for SOD-like activity. 1, Wild type PrP
protein; 2, PrPD35–45; 3, PrPD112–136; 4, PrP23–171; 5 PrPD112–119;
6, PrP45–231.
7 06 05 04 03 02 01 000
20
40
60
80
100D
Time in minutes
% Z
ero
Tim
e V
alu
e
1001 01.1.010
20
40
60
80
100B
[Protein] in µg
% I
nh
ibit
ion
of
Fo
rmaz
an
Pro
du
ctio
n
1001 01.1.010
20
40
60
80
100A
[Protein] in µg
% I
nh
ibit
ion
of
Fo
rma
zan
P
rod
uc
tio
n
1001 01.1.010
20
40
60
80
100C
[Protein] in µg
% I
nhib
itio
n of
Fo
rmaz
an
Pro
du
ctio
n
Fig. 5. Activity of deletion mutants. The nitro-blue tetrazolium/xan-
thine/xanthine oxidase assay for SOD activity was used to assess the
affect of deletions on the activity of recombinant PrP. (A) Wild-type
PrP (d), PrP23–171 (s), PrP45–231 (h), PrP90–231 (j) PrP23–112 (s)
and PrP105–231 (n). (B) Wild-type PrP (d), PrP113–231 (s),
PrPD35–45 (h), PrPD51–89 (j) PrPD67–89 (s). (C) Wild-type PrP (d),
PrPD112–119 (s), PrPD135–150 (h), PrPD112–136 (j). Shown are
the mean and and standard errors for at least three separate experi-
ments. (D) The activity of wild-type PrP (d) and PrP23-171 (s) were
recorded over time. One lg protein was added to the nitro-blue tetra-
zolium/xanthine oxidase assay mixture and measured for SOD-like
activity in terms of inhibition of formazan production. From this zero
time point the SOD-like activity was remeasured 5, 15, 30, 45 and
60 min later. Results are expressed as a percentage of the time zero
value at 560 nm. Shown are the mean and SEM for at least three
separate experiments.
Table 3. Relative activity of PrP deletion mutants. Activity relative to
the wild-type PrP is indicated by the number of + signs: +++++,
activity equivalent to wild type; –, no activity. Recombinant protein is
not glycosylated but native protein has equivalent activity to recom-
binant protein [17]. Reactive cleavage of the disulfide bond has been
shown to decrease the activity of PrP [48].
PrP deletion mutant Relative activity
PrP23-112 –
PrP23-171 + +
PrP45-231 + + +
PrP90-231 –
PrP105-231 –
PrP113-231 –
PrPD35–45 + +
PrPD51–89 –
PrPD67–89 –
PrPD112–119 + +
PrPD112–136 –
PrPD135–150 + + + +
No disulfide bridge + + +
Glycosylation + + + + +
3372 T. Cui et al. (Eur. J. Biochem. 270) � FEBS 2003
Discussion
The prion protein is a Cu-binding protein. Early estimatesof the affinity of Cu for PrPc suggested that binding of Cuwas within the micromolar range [15,16]. Assessment ofPrPc-mediated Cu uptake suggested that PrPc influences Cudistribution within the nanomolar range [22]. The implica-tion of this is an affinity between Cu and PrPc in thenanomolar range or lower. Recent studies have alsosuggested that the affinity of Cu for PrPc could be in thefemtomolar range [18]. Despite these inconsistencies, theconclusion that PrPc is a Cu-binding protein is widelyaccepted. The implication of this is that PrPc is somehowinvolved in Cu metabolism. Cu in the body is tightly linkedto redox chemistry and regulation of the balance betweenthe use of oxygen in respiration and possible oxidativedamage. Thus, without further consideration PrPc isimplicated in regulation of cellular resistance to oxidative
stress. However, there is also considerable evidence thatPrPc is an antioxidant [14]. This was first suggested in 1995[13]. Much of this evidence comes from studies of PrPknockout mice. Changes including electrophysiologicalparameters [37] and altered sleeping patterns [38] in PrPknockout mice have been linked to loss of antioxidantprotection [39,40]. PrP knockout mice are also moresusceptible to kindling agents [41]. The effect of such agentsis related to the induction of oxidative stress [14]. Culturedcells are also more susceptible to oxidative stress when theylack PrPc expression [13,24,42,43]. PC12 cells expressingincreased levels of PrPc are more resistant to oxidative stress[44]. These findings were further clarified when it was shownthat recombinant and native PrPc can act as superoxidedismutase [17,28]. Subsequently it has been shown that thisactivity is dependent of the Cu binding of the protein [45].Transfection of cells to express PrPc increases their ability toreduce intracellular levels of oxidants [43]. Depletion of PrPc
from cells reduces their total superoxide dismutase activity[27]. Loss of PrPc expression by cells is compensated for byspecific up-regulation of other SODs including manganeseSOD [46] and extracellular SOD [14]. Therefore there is astrong body of evidence linking PrPc to SOD-like activity.Although some scepticism about the antioxidant function ofPrPc remains [47,48], there are sufficient data to considerthis as a potentially important enzymatic function of thisprotein.
Data presented in this work verifies the previous findingsthat PrPc is a SOD. Two separate assays confirm thissuggestion. That the recombinant protein was effective inthe in-gel assay also verifies that the protein is not a weakSOD-like protein but one with equivalent catalytic ability tothat of cytoplasmic Cu/Zn SOD. The specific activity of PrPhas been shown previously to be about 10-fold less than thatof Cu/Zn SOD [28]. However, this Cu/Zn SOD is widelyrecognized as a very potent catalyst given its ability tocatalyse a reaction that would spontaneously occur inminutes or less, in the presence of sufficient concentration ofsuperoxide, in the absence of the enzyme [49].
Analyses of domains in this protein necessary for theSOD-like activity used both deletion mutants and antibod-ies that recognized known epitopes. In particular antibodiesDM1 and 11G5 showed the strongest inhibition of the
250245240235230225220215210205200195190-14
-12
-10
-8
-6
-4
-2
0
2E
Wavelength in nm
Mo
lar
Elip
tici
ty (
)
θθθθ
250245240235230225220215210205200195190-6
-4
-2
0
2
4
6
8
G
Wavelength in nm
Mo
lar
Ele
pti
city
(
) θθθθ
250245240235230225220215210205200195190-3
-2
-1
0
1
2
3H
Wavelength in nm
250245240235230225220215210205200195190-8
-6
-4
-2
0
2
4
6
8B
Wavelength in nm
250245240235230225220215210205200195190-8
-6
-4
-2
0
2
4
6
8D
Wavelength in nm
250245240235230225220215210205200195190-6
-4
-2
0
2
4
6
8
F
Wavelength in nm
250245240235230225220215210205200195190-6
-4
-2
0
2
4
6
8C
Wavelength in nm
Mo
lar
Eli
pti
city
(
)θθθθ
250245240235230225220215210205200195190-8
-6
-4
-2
0
2
4
6
8
A
Wavelength in nm
Mo
lar
Eli
pti
city
(
) θθθθM
ola
r E
llip
tici
ty (
θθθθ )M
ola
r E
llip
tici
ty (
θθθθ )M
ola
r E
llip
tici
ty (
θθθθ )M
ola
r E
llip
tici
ty (
θθθθ )
Fig. 6. CD of PrP mutants.Wild-type and mutant PrPs were studied
by CD spectroscopy. (A) Wild-type PrP. (B) PrPD35–45. (C)
PrPD112–119. (D) PrP51–89. (E) PrP23–112. (F) PrPD135–150. (G)
PrPD112–136. (H) PrP23–171. Spectra are shown as molar ellipticity
(h).
s s
Necessary Domains
1 23 231 25251 90 112 145 178 213
N N
35
Minor Domain
Important Domain Important Domain
Signal Sequence Octameric Repeats Hydrophobic Domain GPI Anchor Signal
Fig. 7. Summary. This schematic diagram, based on the results from
all experiments, shows those regions of the PrP protein necessary for
the SOD-like activity with Cu bound. Black bars are essential for
activity; grey bars show those regions that also play a role but are not
essential; hatched bar indicates that the C-terminal part of PrP cor-
responding to the last two helices can also influence the activity of the
protein but are not essential.
� FEBS 2003 PrP functional domains (Eur. J. Biochem. 270) 3373
protein’s activity of suggesting that both the octamericrepeat region and the hydrophobic domain were critical forthe activity of the protein. This was confirmed by deletionmutations that showed lack of SOD-like activity whenthese regions were deleted. Experiments using three otherantibodies binding near the residues 35–45 also suggestedthat this region was important. Deletion of these residuesconfirmed this finding. Assays using the antibodies 7H6and DM3 also indicated that residues 130–160 might alsoplay a role in the activity. However deletion of residues135–150 had no affect at all on the activity suggesting thisdomain is not involved in the activity of the protein. Thisdeletion also served as a good negative control showingthat deletion of part of PrP need not inhibit the SOD-likeactivity if it is made outside the domains essential for thisactivity.
Inhibition of activity by two antibodies that were sensitiveto the conformation of the C terminus indicated that theconformation of the C terminus is important to the activityof the protein. Deletion of the whole C terminus renderedthe protein inactive but surprisingly deletion of only the lasttwo helices (PrP23–171) did not lead to inactive protein.Further analysis indicated that this mutant was labile in itsactivity and rapidly lost activity when continually exposedto superoxide. This mutant was highly soluble and con-tained surprisingly high helical content. One possibility isthat the N terminus of the protein does not contain a totallyunordered structure when associated with at least one helixof the C terminus. This would contradict findings fromNMR studies suggesting there is no structure in the Nterminus [50]. We have also observed the lack of regularsecondary structure along the N terminus with CD analysisbut again this might be different when associated with otherdomains of the protein. Our findings concerning theC-terminal domain support what was shown previously.Preventing the formation of the disulfide bridge in the lasttwo helices reduces the activity of PrP [51]. Thus, althoughthese regions are not essential for the manifestation of theactivity they are important to maintaining that activity.Further evidence for this comes from work with thedifferent mouse alleles of the protein. It was found thatprotein generated from the mouse �b� allele has higheractivity from that of the �a� allele [29]. These alleles differonly in two amino residues one of which is residue 189 in thesecond helix.
That the octameric repeat region of the protein isnecessary for SOD function is clear from the fact that thisis the main Cu-binding region of the protein. Although ithas been suggested that Cu binds elsewhere in themolecule [18,21] it is not clear if this occurs in vivo andmay only occur under nonphysiological conditions orwhen the N-terminal region has been cleaved off. How-ever, PrP90–231 which is equivalent to the protein studiedby Jackson et al. [18] also lacked SOD activity. Thus, ifCu does bind elsewhere in the protein this is not relevantto the protein’s antioxidant activity. Deletion of only partof the octameric repeat region renders the protein inactive.This confirms previous suggestions that binding only oneatom of Cu is not sufficient for significant SOD-likeactivity of the protein [17]. The importance of residues35–45 is currently unknown. However, it might be thatthis region of the protein interacts with other regions of
the protein, possibly to bring the Cu-binding domain intoproximity with the hydrophobic domain or the C-terminalglobular domain. This interpretation is supported by ourearlier findings that there are interactions between theN terminus and the C terminus of PrP. Binding of amonocolonal antibody to an epitope located betweenresidues 35 and 45 prevented the binding of anothermonoclonal antibody that reacts with a conformationalepitope in the C terminus [52].
Analysis of the evolutionary conservation of the prionprotein among mammals clearly shows that all three criticaldomains (residues 35–45, 51–89, 112–136) are extremelyhighly conserved. Indeed, the region 112–126 is identical inall mammals, birds and reptiles so far sequenced [10,53,54].Therefore this report indicating that residues 112–136constitute part of the functional domain of the proteinprovides a plausible explanation for the high evolutionaryconservation of this region. Other research has shown theimportance of this region in PrP neurotoxicity [55,56] as abinding site for PrP ligands [57,58].
There are already several reports that link oxidativestress to prion disease [59–63]. Also, changes in theessential metalloelements in the brains of patients withCJD and experimental mouse scrapie have also been noted[28,29]. These findings suggest that changes in Cu meta-bolism and redox balance occur in prion diseases. Theexact nature of these changes is far from clear. However,there is evidence that loss of Cu binding to PrP andconsequently, loss of PrP’s antioxidant activity occur earlyin the course of prion disease [31]. The relevance of thefindings presented here are therefore quite important indetermining the changes that PrP undergoes during thecourse of prion disease and the possible role of the loss ofits function to the disease. It is known that the hydropho-bic domain spanning amino acids 112–136 form a criticalsite in the protein at which the protein gains b-sheetcontent [64]. This region also spans the site at whichnormal metabolic cleavage occurs [65]. Deletion of thisregion inhibits conversion of the protein to PrPSc ininfected cells [66]. The importance of this region to thefunction of the protein explains its evolutionary conserva-tion. Conversion of this site to one that forms b-sheet andfacilitates aggregation of the protein is known to preventcleavage of the protein [67] and abolish antioxidant activity[31]. Furthermore, interaction between this site on PrPc
and PrPSc or the neurotoxic peptides such as PrP106–126also inhibits the antioxidant activity of PrPc [31] or causethe protein to change conformation [67].
In summary we have provided an insight into regions ofPrPc critical to its normal antioxidant activity. We haveshown that regions outside the octameric repeat region arenecessary for this activity. These data suggest that a keydomain in PrPc that is involved in structural conversion ofthe protein to PrPSc may be conserved in evolution becauseof its importance to this function.
Acknowledgements
Thanks to Dr Laurie Irons for assistance with CD measurements. This
work was supported by a fellowship from the BBSRC of the UK to
DRB.
3374 T. Cui et al. (Eur. J. Biochem. 270) � FEBS 2003
References
1. Prusiner, S.B. (1982) Novel proteinaceous infectious particles
cause scrapie. Science 216, 136–144.
2. Prusiner, S.B. (1998) Prions. Proc. Natl Acad. Sci. USA 95,
13363–13383.
3. Hope, J., Reekie, L.J., Hunter, N., Multhaup, G., Beyreuther, K.,
White, H., Scott, A.C., Stack, M.J., Dawson, M. & Wells, G.A.
(1988) Fibrils from brains of cows with new cattle disease contain
scrapie-associated protein. Nature 336, 390–392.
4. Will, R.G., Ironside, J.W., Zeidler, M., Cousens, S.N., Estibeiro,
K., Alperovitch, A., Poser, S., Pocchiari, M., Hofman, A. &
Smith, P.G. (1996) A new variant of Creutzfeldt-Jakob disease in
the UK. Lancet 347, 921–925.
5. Rubenstein, R., Merz, P.A., Kascsak, R.J., Carp, R.I., Scalici,
C.L., Fama, C.L. & Wisniewski, H.M. (1987) Detection of scra-
pie-associated fibrils (SAF) and SAF proteins from scrapie-
affected sheep. J. Infect. Dis. 156, 36–42.
6. Hsiao, K. & Prusiner, S.B. (1990) Inherited human prion diseases.
Neurology 40, 1820–1827.
7. Stahl, N., Borchelt, D.R., Hsiao, K. & Prusiner, S.B. (1987)
Scrapie prion protein contains a phosphatidylinositol glycolipid.
Cell 51, 229–240.
8. Meyer, R.K., McKinley, M.P., Bowman, K.A., Braunfeld, M.B.,
Barry, R.A. & Prusiner, S.B. (1986) Separation and properties of
cellular and scrapie prion proteins. Proc. Natl Acad. Sci. USA 83,
2310–2314.
9. Pan, K.M., Baldwin, M., Nguyen, J., Gasset, M., Serban, A.,
Groth, D., Mehlhorn, I., Huang, Z., Fletterick, R.J., Cohen, F.E.
& Prusiner, S.B. (1993) Conversion of alpha-helices into beta-
sheets features in the formation of the scrapie prion proteins.Proc.
Natl Acad. Sci. USA 90, 10962–10966.
10. Wopfner, F., Wiedenhofer, G., Schneider, R., von Bunn, A.,
Gilch, S., Schwarz, T.F., Werner, T. & Schatzl, H.M. (1999)
Analysis of 27 mammalian and 9 avian PrPs reveals high con-
servation of flexible regions of the prion protein. J. Mol. Biol. 289,
1163–1178.
11. Bueler, H., Fischer, M., Lang, Y., Bluethmann, H., Lipp, H.-P.,
DeArmond, S.J., Prusiner, S.B., Aguet, M. & Weissmann, C.
(1992) Normal development and behaviour of mice lacking the
neuronal cell-surface PrP protein. Nature 356, 577–582.
12. Bueler, H., Aguzzi, A., Sailer, A., Greiner, R.A., Autenried, P.,
Aguet, M. & Weissmann, C. (1993) Mice devoid of PrP are
resistant to scrapie. Cell 73, 1339–1347.
13. Brown, D.R., Schmidt, B. & Kretzschmar, H.A. (1996) Role of
microglia and host prion protein in neurotoxicity of a prion pro-
tein fragment. Nature 380, 345–347.
14. Brown, D.R., St. Nicholas, R., J. & Canevari, L. (2002) Lack of
prion protein expression results in a neuronal phenotype sensitive
to stress. J. Neurosci. Res. 67, 211–224.
15. Hornshaw, M.P., McDermott, J.R., Candy, J.M. & Lakey, J.H.,
(1995) Copper binding to the N-terminal repeat region of
mammalian and avian prion protein: structural studies
using synthetic peptides. Biochem. Biophys. Res. Comm. 214,
993–999.
16. Brown, D.R., Qin, K., Herms, J.W., Madlung, A., Manson, J.,
Strome, R., Fraser, P.E., Kruck, T., von Bohlen, A., Schulz-
Schaeffer, W., Giese, A., Westaway, D. & Kretzschmar, H.
(1997a) The cellular prion protein binds copper in vivo. Nature
390, 684–687.
17. Brown, D.R., Clive, C. & Haswell, S.J. (2001) Anti-oxidant
activity related to copper binding of native prion protein.
J. Neurochem. 76, 69–76.
18. Jackson, G.S., Murray, I., Hosszu, L.L., Gibbs, N., Waltho, J.P.,
Clarke, A.R. & Collinge, J. (2001) Location and properties of
metal-binding sites on the human prion protein. Proc. Natl Acad.
Sci. USA 98, 8531–8535.
19. Viles, J.H., Cohen, F.E., Prusiner, S.B., Goodin, D.B., Wright,
P.E. & Dyson, H.J. (1999) Copper binding to the prion protein:
Structural implications of four identical cooperative binding sites.
Proc. Natl Acad. Sci. USA 96, 2042–2047.
20. Aronoff-Spencer, E., Burns, C.S., Avdievich, N.I., Gerfen, G.J.,
Peisach, J., Antholine, W.E., Ball, H.L., Cohen, F.E., Prusiner,
S.B. & Millhauser, G.L. (2000) Identification of the Cu2+ binding
sites in the N-terminal domain of the prion protein by EPR and
CD spectroscopy. Biochemistry 39, 13760–13771.
21. Cereghetti, G.M., Schweiger, A., Glockshuber, R. & Van Door-
slaer, S. (2001) Electron Paramagnetic Resonance Evidence for
Binding of Cu2+ to the C-terminal Domain of the Murine Prion
Protein. Biophys. J. 81, 516–525.
22. Brown, D.R. (1999) Prion protein expression aids cellular uptake
and veratridine-induced release of copper. J. Neurosci. Res. 58,
717–725.
23. Pauly, P.C. & Harris, D.A. (1998) Copper stimulates endocytosis
of the prion protein. J. Biol. Chem. 273, 33107–33110.
24. Ellis, V., Daniels, M., Misra, R. & Brown, D.R. (2002)
Plasminogen activation is stimulated by prion protein and
regulated in a copper-dependent manner. Biochemistry 41, 6891–
6896.
25. Pan, T., Wong, B.S., Liu, T., Li, R., Petersen, R.B. & Sy, M.S.
(2002) Cell surface prion protein interacts with glycosamino-
glycans. Biochem. J. 368, 81–90.
26. Brown, D.R., Schultz-Schaeffer, W.J., Schmidt, B. & Kretzsch-
mar, H.A. (1997) Prion protein-deficient cells show altered
response to oxidative stress due to decreased SOD-1 activity. Exp.
Neurol. 146, 104–112.
27. Wong, B.S., Pan, T., Liu, T., Li, R.L., Gambetti, P. & Sy, M.S.
(2000) Differential contribution of superoxide dismutase activity
by prion protein in vivo. Biochem. Biophys. Res. Commun 273,
136–139.
28. Brown, D.R., Wong, B.S., Hafiz, F., Clive, C., Haswell, S. &
Jones, I.M. (1999) Normal prion protein has an activity like that of
superoxide dismutase. Biochem. J. 344, 1–5.
29. Brown, D.R., Iordanova, I.M., Wong, B.-S., Venien-Bryan, C.,
Hafiz, F., Glasssmith, L.L., Sy, M.-S., Gambetti, P., Jones, I.M.,
Clive, C. & Haswell, S.J. (2000) Functional and structural differ-
ences between the prion protein from two alleles prnpa and prnpb
of mouse. Eur. J. Biochem. 267, 2452–2459.
30. Wong, B.-S., Chen, S.G., Colucci, M., Xie, Z., Pan, T., Liu, T.,
Li, R., Gambetti, P., Sy, M.-S. & Brown, D.R. (2001a) Aberrant
metal binding by prion protein in human prion disease. J. Neuro-
chem. 78, 1400–1408.
31. Thackray, A.M., Knight, R., Haswell, S.J., Bujdoso, R. & Brown,
D.R. (2002) Metal imbalance and compromised antioxidant
function are early changes in prion disease. Biochem. J. 362,
253–258.
32. Brown, D.R. (2000) PrPSc-like prion protein peptide inhibits the
function of cellular prion protein. Biochem. J. 352, 511–518.
33. Daniels, M., Cereghetti, G.M. & Brown, D.R. (2001) Toxicity of
novel C-terminal prion protein fragments and peptides harbouring
disease-related C-terminal mutations. Eur. J. Biochem. 268,
6155–6164.
34. Pan, T., Li, R., Wong, B.S., Liu, T., Gambetti, P. & Sy, M.-S.
(2002) Heterogeneity of normal prion protein in two-dimensional
immunoblot: presence of various glycosylated and truncated
forms. J. Neurochem. 81, 1092–1101.
35. Liu, T., Zwingman, T., Li, R., Pan, T., Wong, B.S., Petersen, R.B.,
Gambetti, P., Herrup, K. & Sy, M.S. (2001) Differential expres-
sion of cellular prion protein in mouse brain as detected with
multiple anti-PrP monoclonal antibodies.Brain Res. 896, 118–129.
� FEBS 2003 PrP functional domains (Eur. J. Biochem. 270) 3375
36. Zanusso, G., Liu, D., Ferrari, S., Hegyi, I., Yin, X., Aguzzi, A.,
Hornemann, S., Liemann, S., Glockshuber, R., Manson, J.C.,
Brown, P., Petersen, R.B., Gambetti, P. & Sy, M.S. (1998) Prion
protein expression in different species: analysis with a panel of new
mAbs. Proc. Natl Acad. Sci. USA 95, 8812–8816.
37. Collinge, J., Whittington, M.A., Sidle, K.C., Smith, C.J., Palmer,
M.S., Clarke, A.R. & Jefferys, J.G. (1994) Prion protein is
necessary for normal synaptic function. Nature 370, 295–297.
38. Tobler, I., Gaus, S.E., Deboer, T., Achermann, P., Fischer, M.,
Rulicke, T., Moser, M., Oesch, B., McBride, P.A. & Manson, J.C.
(1996) Altered circadian activity rhythms and sleep in mice devoid
of prion protein. Nature 380, 639–642.
39. Huber, R., Deboer, T. & Tobler, I. (2002) Sleep deprivation in
prion protein deficient mice sleep deprivation in prion protein
deficient mice and control mice: genotype dependent regional
rebound. Neuroreport 13, 1–4.
40. Curtis, J., Errington, M., Bliss, T., Voss, K. & Macleod, N. (2003)
Age-Dependent Loss of PTP and LTP in the hippocampus of PrP-
null Mice. Neurobiol. Dis. 13, 55–62.
41. Walz, R., Amaral, O.B., Rockenbach, I.C., Roesler, R., Izquierdo,
I., Cavalheiro, E.A., Martins, V.R. & Brentani, R.R. (1999)
Increased sensitivity to seizures in mice lacking cellular prion
protein. Epilepsia 40, 1679–1682.
42. White, A.R., Collins, S.J., Maher, F., Jobling, M.F., Stewart,
L.R., Thyer, J.M., Beyreuther, K., Masters, C.L. & Cappai, R.
(1999a) Prion protein-deficient neurons reveal lower glutathione
reductase activity and increased susceptibility to hydrogen per-
oxide toxicity. Am. J. Pathol. 155, 1723–1730.
43. Zeng, F., Watt, N.T., Walmsley, A.R. & Hooper, N.M. (2003)
Tethering the N-terminus of the prion protein compromises the
cellular response to oxidative stress. J. Neurochem. 84, 480–490.
44. Brown, D.R., Schmidt, B. & Kretzschmar, H.A. (1997c) Effects of
oxidative stress on prion protein expression in PC12 cells. Int. J.
Dev Neurosci. 15, 961–972.
45. Brown, D.R., Hafiz, F., Glasssmith, L.L., Wong, B.-S., Jones,
I.M., Clive, C. & Haswell, S.J. (2000) Consequences of manganese
replacement of copper for prion protein function and proteinase
resistance. EMBO J. 19, 1180–1186.
46. Miele, G., Jeffrey, M., Turnbull, D., Manson, J. & Clinton, M.
(2002) Ablation of cellular prion protein expression affects mito-
chondrial numbers and morphology. Biochem. Biophys. Res.
Commun. 291, 372–377.
47. Behrens, A. & Aguzzi, A. (2002) Small is not beautiful: antag-
onizing functions for the prion protein PrPc and its homologue
Dpl. Trends Neurosci. 25, 150–154.
48. Sorenson, J.R. (2001) Prion diseases: copper deficiency states
associated with impaired nitrogen monoxide or carbon monoxide
transduction and translocation. J. Inorg. Biochem. 87, 125–127.
49. Fridovich, I. (1975) Superoxide dismutases. Ann. Rev. Biochem.
44, 146–159.
50. Riek, R., Hornemann, S., Wider, G., Glockshuber, R. &
Wuthrich, K. (1997) NMR characterization of the full-length
recombinant murine prion protein mPrP (23–231). FEBS Lett.
413, 282–288.
51. Wong, B.S., Venien-Bryan, C., Williamson, R.A., Burton, D.R.,
Gambetti, P., Sy, M.S., Brown, D.R. & Jones, I.M. (2000) Copper
refolding of prion protein. Biochem. Biophys. Res. Commun. 276,
1217–1224.
52. Li, R., Liu, T., Wong, B.S., Pan, T., Morillas, M., Swietnicki, W.,
O’Rourke, K., Gambetti, P., Surewicz, W.K. & Sy, M.S. (2000)
Identification of an epitope in the C terminus of normal prion
protein whose expression is modulated by binding events in the N
terminus. J. Mol. Biol. 301, 567–573.
53. Schatzl, H.M., Da Costa, M., Taylor, M., Cohen, F.E. & Prusiner,
S.B. (1995) Prion protein gene variation among primates. J. Mol.
Biol. 245, 362–374.
54. Simonic, T., Duga, S., Strumbo, B., Asselta, R., Ceciliani, F. &
Ronchi, S. (2000) cDNA cloning of turtle prion protein. FEBS
Lett. 469, 33–38.
55. Forloni, G., Angeretti, N., Chiesa, R., Monzani, E., Salmona, M.,
Bugiani, O. & Tagliavini, F. (1993) Neurotoxicity of a prion
protein fragment. Nature 362, 543–546.
56. Brown, D.R. (2000) Prion protein peptides: Optimal toxicity and
peptide blockade of toxicity. Mol. Cell Neurosci. 15, 66–78.
57. Martins, V.R., Graner, E., Garcia-Abreu, J., de Souza, S.J.,
Mercadante, A.F., Veiga, S.S., Zanata, S.M., Neto, V.M. &
Brentani, R.R. (1997) Complementary hydropathy identifies a
cellular prion protein receptor. Nature Med. 3, 1376–1382.
58. Zanata, S.M., Lopes, M.H., Mercadante, A.F., Hajj, G.N., Chi-
arini, L.B., Nomizo, R., Freitas, A.R., Cabral, A.L., Lee, K.S.,
Juliano, M.A., de Oliveira, E., Jachieri, S.G., Burlingame, A.,
Huang, L., Linden, R., Brentani, R.R. & Martins, V.R. (2002)
Stress-inducible protein 1 is a cell surface ligand for cellular prion
that triggers neuroprotection. EMBO J. 21, 3307–3316.
59. Kim, N.H., Park, S., Jin, J., Kwon, M., Choi, E., Carp, R.I. &
Kim, Y. (2000) Increased ferric iron content and iron-induced
oxidative stress in the brains of scrapie-infected mice. Brain Res.
884, 98–103.
60. Milhavet, O., McMahon, H.E., Rachidi, W., Nishida, N., Kata-
mine, S., Mange, A., Arlotto, M., Casanova, D., Riondel, J.,
Favier, A. & Lehmann, S. (2000) Prion infection impairs the cel-
lular response to oxidative stress. Proc. Natl Acad. Sci. USA 97,
13937–13942.
61. Guentchev, M., Voigtlander, T., Haberler, C., Groschup, M.H. &
Budka, H. (2000) Evidence for oxidative stress in experimental
prion disease. Neurobiol. Dis. 7, 270–273.
62. Guentchev, M., Siedlak, S.L., Jarius, C., Tagliavini, F., Castellani,
R.J., Perry, G., Smith, M.A. & Budka, H. (2002) Oxidative
damage to nucleic acids in human prion disease.Neurobiol. Dis. 9,
275–281.
63. Wong, B.-S., Brown, D.R., Pan, T., Whiteman, M., Liu, T., Bu,
X., Li, R., Gambetti, P., Olesik, J., Rubinstein, R. & Sy, M.-S.
(2001b) Oxidative impairment in scrapie-infected mice is asso-
ciated with brain metal perturbations and altered ani-oxidantion
activities. J. Neurochem. 79, 689–698.
64. Viles, J., Donne, D., Kroon, G., Prusiner, S.B., Cohen, F.E.,
Dyson, H.J. & Wright, P.E. (2001) Local structural plasticity of
the prion protein. Analysis of NMR relaxation dynamics.
Biochemistry 40, 2743–2753.
65. Chen, S.G., Teplow, D.B., Parchi, P., Teller, J.K., Gambetti, P. &
Autilio-Gambetti, L. (1995) Truncated forms of the human prion
protein in normal brain and in prion diseases. J. Biol. Chem. 270,
19137–19180.
66. Holscher, C., Delius, H. & Burkle, A. (1998) Overexpression of
non-convertable PrPcD114–121 in scrapie-infected mouse neuro-
blastoma cells leads to trans-dominant inhibition of wild-type
PrPSc accumulation. J. Virol. 72, 1153–1159.
67. Nguyen, J., Baldwin, M.A., CohE.N., F.E. & Prusiner, S.B. (1995)
Prion protein peptide induces a-helix to b-sheet conformation
transitions. Biochemistry 34, 4186–4192.
3376 T. Cui et al. (Eur. J. Biochem. 270) � FEBS 2003