mapping the inhibitory determinants within of the · web viewmapping the inhibitory...

Mapping the inhibitory determinants within the cytoplasmic tail of CD6Ana Paula Teixeira da SilvaMestrado em Biologia Celular e Molecular

Departamento de Biologia

2013

Mafalda Pinto, PhD, Instituto de Biologia Molecular e Celular (IBMC)

Alexandre Carmo, PhD, Instituto de Biologia Molecular e Celular (IBMC)

Todas as correções determinadas pelo júri, e só essas, foram efetuadas.

O Presidente do Júri,

Porto, ______/______/_________

Faculdade de Ciências da Universidade do Porto

Mestrado em Biologia Celular e Molecular

Ana Paula Teixeira da Silva

Dissertação submetida à Faculdade de Ciências UP como requisito parcial para obtenção do grau de Mestre em Biologia Celular e Molecular.

FCUPMapping the inhibitory determinants within of the cytoplasmic tail of CD6

IV

I. Agradecimentos

Em primeiro lugar, gostaria de agradecer ao Prof. José Pissarra e ao corpo docente do

Mestrado de Biologia Celular e Molecular da Faculdade de Ciências da Universidade

do Porto pelo apoio e conselhos dados ao longo do mestrado.

Ao Prof. Doutor Alexandre Carmo, agradeço a oportunidade de trabalhar em

Imunologia no grupo de Cell Activation and Gene Expression do Instituto de Biologia

Molecular e Celular, ao longo do meu mestrado. Obrigada também pelos

ensinamentos científicos que partilhou comigo ao longo do tempo e pela atitude crítica.

À Doutora Mafalda Pinto, pela dedicação constante e por toda a ajuda proporcionada

diariamente. Obrigada também pelos conhecimentos científicos que me transmitiu.

A todos os membros do grupo Cell Activation and Gene Expression e do grupo Gene

Regulation, pelo companheirismo e pelo apoio que me proporcionaram durante o meu

trabalho. Obrigada a todos os outros que no IBMC contribuíram de algum modo para o

meu trabalho.

A todos os meus amigos que de uma forma ou de outra, me apoiaram durante o

percurso da minha tese. À Ana Margarida, à Mafs e ao Fidos, um obrigada pela

amizade e pela motivação.

Finalmente, aos meus pais, um agradecimento muito sentido, pelo apoio e paciência

permanentes.


V

II. Abstract

The adaptive immune response of a T cell is initiated upon recognition by the T cell

receptor of an antigenic peptide presented by the Major Histocompatibility Complex of

antigen presenting cells. Integrating this response there are other signals provided by

accessory and co-stimulatory molecules targeting at the immunological synapse (IS).

The engagement between APCs and T cells triggers several intracellular signaling

pathways, which induce early and late responses of the immune system, culminating

with the production/activation of transcription factors in the nucleus of T lymphocytes.

The CD6 glycoprotein is one of the molecules present at the IS upon T cell-APC

engagement. It binds its physiological ligand, CD166, present at the surface of APCs.

CD6 has been generally regarded as a co-stimulatory molecule over the years, but the

latest results identified its inhibitory potential upon T cell activation. CD6, in its full

length form (CD6FL), was reported to attenuate both early and late responses upon T

cell activation, while CD6Cy5, an isoform devoid of the cytoplasmic domain, featured

high levels of both calcium and IL-2. These results pointed to the cytoplasmic tail of

CD6 as responsible for the inhibitory role of the molecule. Following the latest lead on

CD6 involvement as a negative modulator in T cell activation, we aimed to map the

CD6 inhibitory determinants within its cytoplasmic tail. In the current project, several

isoforms of variable lengths of the cytoplasmic tail were created, having in mind the

existence of different tyrosines, which were reported to be phosphorylated during T cell

activation. We have performed several studies of early and late responses to

activation. Our results suggest that the middle part of the cytoplasmic tail of CD6 is

responsible for the inhibitory potential of the molecule, since deletion of this sequence

resulted in an increase of calcium fluxes and IL-2 production upon activation of cells

through the T cell receptor.

Key Words: CD6; inhibitory; cytoplasmic; tail; activation.


VI

III. Resumo

A resposta imunológica adquirida de um linfócito T inicia-se após reconhecimento, pelo

complexo do receptor dos linfócitos T/ CD3, de um antigénio sob a forma de péptido,

apresentado pelo Complexo Maior de Histocompatibilidade. Integrando esta resposta,

há sinais adicionais fornecidos por moléculas acessórias e co-estimulatórias que se

translocam para a sinapse imunológica (IS). A ligação entre células apresentadoras de

antigénio (APC) e os linfócitos T desencadeia diversas vias de sinalização, que

incluem respostas iniciais e tardias do sistema imunológico, e termina com a produção

de factores de transcrição no núcleo dos linfócitos T. A glicoproteína CD6 é uma das

moléculas presentes na IS, após ligação das APC com os linfócitos T. Liga-se ao seu

ligando fisiológico, CD166, presente na superfície das APCs. Ao longo dos anos, a

molécula CD6 tem sido abordada como uma molécula co-estimulatória, mas os

resultados mais recentes identificaram o seu potencial inibitório, após activação dos

linfócitos T. Foi observado que a CD6, em todo o seu tamanho integral (CD6FL),

atenuava quer as respostas iniciais, quer as tardias, após activação dos linfócitos T,

enquanto que a CD6Cy5, uma isoforma sem o domínio citoplasmático, apresentava

níveis elevados de cálcio e interleucina-2. Estes resultados apontam para que a cauda

citoplasmática da CD6 seja responsável pelo seu papel inibitório. Seguindo a última

pista relativamente ao envolvimento da CD6 como um regulador negativo na activação

dos linfócitos T, tencionamos mapear as sequências que determinam o papel inibitório

da cauda citoplasmática da CD6. Neste projecto, foram criadas várias isoformas com

comprimentos diferentes relativamente à cauda citoplasmática da CD6, tendo em

conta a existência de diferentes tirosinas fosforiladas por cinases durante a activação

dos linfócitos T. Realizamos vários estudos relativos à resposta inicial e tardia, perante

activação. Os nossos resultados sugerem que a parte média da cauda citoplasmática

é responsável pelo potencial inibitório da CD6, já que não foram induzidos aumentos

do fluxo do cálcio ou de produção de interleucina-2 após activação.

Palavras-Chave: CD6; inibitório; citoplasmática; cauda; activação.


VII

IV. Abbreviations

ALCAM Activated leucocyte cell adhesion molecule

Antigen Ag

AP-1 Activator protein 1

APC Antigen-presenting cell

BSA Bovine Serum albumin

CD Cluster of Differentiation

CLL Chronic lymphocytic leukemia

cSMAC Central Supramolecular Activation Cluster

CTL Cytotoxic T lymphocytes

CTLA-4 Cytotoxic T lymphocyte-associated antigen 4

DAG Diaglycerol

DC Dendritic cell

DMEM Dulbecco’s Modified Eagle Medium

dSMAC Distal Supramolecular Activation Cluster

ELISA Enzyme-linked immunoabsorbent assay

ER Endoplasmatic reticulum

FACS Fluorescence-activated cell sorting

FBS Fetal Bovine Serum

FL Full-length

IL-2 Interleukin-2

IP3 Inositol triphosphate

IS Immunological synapse

ITAM Immuno tyrosine-based activation motif

ITIM Immuno tyrosine-based inhibitory motif

Itk Interleukin-2-inducible T-cell kinase

LAT Linker for activation of T cell

LB Lysogeny broth

Lck Lymphocyte-specific tyrosine kinase

LPS Lipopolysaccharide

LTA Lypotheichoic acid

mAb Monoclonal antibody


VIII

MAPK Mitogen-activated protein kinase

MC Microcluster

MS Multiple Sclerosis

NFAT Nuclear factor of activated T-cells

NF-kβ Nuclear factor kappa B

Opti-MEM Optimal-Minimal Essential Medium

PAMP Pathogen-associated molecular patterns

PBS Phosphate Buffered Saline

PCR Polymerase chain reaction

PHA Phytohaemagglutinin

PIP2 Phosphatidylinositol 4,5 – biphosphate 2

PKC Protein Kinase C

PLC Phospholipase C

pMHC Peptide-complexed Major Histocompatibility Complex

PMSF Phenylmethylsulfonyl Fluoride

PRR Pattern recognition receptors

pSMAC Peripheral Supramolecular Activation Cluster

PTP Protein tyrosine phosphatase

RPMI Roswell Park Memorial Institute

SDS-PAGE Sodium dodecyl sulfate - polyacrylamide-gel-electrophoresis

SH2 Src Homology 2

SHP-1 Src homology phosphatase-1

SLP-76 SH2-domain containing leucocyte-76

SMAC Supramolecular Activation Cluster

SNP Single nucleotide polymorphism

SRCR-SF Scavenger receptor cysteine-rich superfamily

SS Sjögren’s Syndrome

Syk Spleen tyrosine kinase

TBS-T Tris-buffered saline 1%Tween

TCR T cell receptor

Th T helper

ZAP-70 Zeta associated chain -70


IX

V. Table of Contents

I. Agradecimentos....................................................................................................................... IV

II. Abstract....................................................................................................................................V

III. Resumo..................................................................................................................................VI

IV. Abbreviations........................................................................................................................VII

V. Table of Contents....................................................................................................................IX

VI. Figures List.............................................................................................................................XI

VII. Tables List..............................................................................................................................XI

1. Introduction.............................................................................................................................1

1.1. Introductory Notes............................................................................................................2

1.2. T cell surface receptors.....................................................................................................3

1.3. TCR/CD3 complex..............................................................................................................4

1.4. Balance between kinases and phosphatases.....................................................................5

1.5. Co-receptors CD4 and CD8................................................................................................6

1.6. CD28 and CTLA-4...............................................................................................................7

1.7. The Immunological Synapse..............................................................................................8

1.8. TCR triggering and T cell activation...................................................................................9

1.9. Scavenger Receptor Cysteine-Rich superfamily...............................................................11

1.9.1. CD5...........................................................................................................................12

1.9.2. CD6...........................................................................................................................13

2. Materials and Methods..........................................................................................................19

2.1. Cloning............................................................................................................................20

2.2. Transformation and miniprep.........................................................................................21

2.3. Cell lines..........................................................................................................................21

2.4. Stable cell line production...............................................................................................22

2.4.1. Virus assembly..........................................................................................................22

2.4.2. E6.1 infection............................................................................................................22

2.4.3. Assessing infection efficiency...................................................................................22

2.6. Sorting............................................................................................................................23

2.7. Western Blotting.............................................................................................................23


X

2.8. Activation Assays.............................................................................................................24

2.8.1. Calcium flux variation...............................................................................................24

2.8.2. Interleukin-2 production..........................................................................................24

3. Results....................................................................................................................................25

3.1. Stable cell line production...............................................................................................26

3.2. CD3, CD5 and CD6 expression.........................................................................................28

3.3. Sorting.............................................................................................................................29

3.4. Western-Blotting.............................................................................................................29

3.5. Activation assays.............................................................................................................30

3.5.1. Calcium flux assays...................................................................................................30

3.5.2. Interleukin-2 production..........................................................................................31

4. Discussion...............................................................................................................................34

5. Conclusion..............................................................................................................................39

6. References..............................................................................................................................41


XI

VI. Figures List

Figura 1 – The Immunological Synapse (Page 3)

Figura 2 – CD6-CD166 Interaction (Page 15)

Figura 3 - CD6 protein mutants (Page 20)

Figura 4 – CD6 expression levels, given by the amount of citrine fluorescence, in E6.1

cells infected with virus particles (Page 26)

Figura 5 - Flow cytometry analysis of sorted infected E6.1 cells (Page 27)

Figura 6 - Flow cytometry analysis: of CD3, CD5 and CD6 expression (Page 28)

Figura 7 - Flow cytometry analysis of cells labeled for CD3 and CD6 (Page 29)

Figura 8 – Western-Blot (Page 30)

Figura 9 – Calcium activation assays (Page 32)

Figura 10 – IL-2 activation assays (Page 33)

VII. Tables List

Table I - Sequences of the primers used to amplify CD6 cDNA for cloning (Page 21)


1

1. Introduction


2

1.1. Introductory Notes

The immune system is responsible for the host defense against disease. When

facing pathogens and other invaders, it is capable of protecting the host by

discriminating foreign organisms from endogenous cells, without causing any

damage of the host’s tissues and organs. The extremely complex molecular

machinery intrinsically involved in the process of defense is intensively studied in

order to figure out strategic therapies and to develop vaccines to avoid infectious

and inflammatory diseases, autoimmunity or even cancer, worldwide causes of

mortality.

In mammalians, there are two lines of defense, the innate and the adaptive. The

first line of defense to act upon invasion of a pathogen consists of the innate

response. It is mediated by the performance of a particular type of receptors, the

pattern recognition receptors (PRRs). These recognize broad groups of pathogens in

a non-specific manner and target the pathogen-associated molecular patterns

(PAMPs). Not only are PRRs able to stimulate tissue-resident macrophages to

produce cytokines, as they may kill viruses or act by phagocytosis of fungi.

Therefore, PAMPs recognition will trigger inflammation processes. PRR(s) also

assure the distinction between self and pathogens, thus avoiding auto-immune

diseases of infectious origin. However, in several cases, the innate response may

not be sufficient and the host must take advantage of the adaptive immune

response, also designated as acquired immune response, which is the second line

of defense. The adaptive immune system consists of a diverse network of cells

which recognize pathogens specifically. B and T lymphocytes are the cells per

excellence involved in this type of response. Antigens in the form of small peptides

are presented by the major histocompatibility complex (MHC) of antigen presenting

cells (APC) in the lymph nodes and spleen, where they are recognized by the B and

T cell receptors, respectively, in an antigen-specific manner, leading to the activation

of effector mechanisms. The adaptive cells are also gifted with immunological

memory. Although the innate and the adaptive response behave very differently,

they complement mutually.


3

A critical event at the beginning of the immune response is T cell activation,

mediated by the engagement of the T cell receptor (TCR) with the MHC. The

encounter of T cells and APCs triggers a series of signaling events that include

proliferation, differentiation and secretion of cytokines and growth factors. The

triggering of T cells occurs in a matter of seconds, when a cascade of tyrosine

phosphorylations is initiated, while T cell proliferation is a process that requires

several hours. T cell activation may result in either an activatory or inhibitory

downstream cascade of signaling events, thus maintaining the homeostasis in T

lymphocytes [1, 2, 3, 4].

1.2. T cell surface receptors

T lymphocytes expose a diverse group of surface molecules acting as receptors in

immune response. These receptors establish interactions with their ligands, located

on APCs membrane, through class I or class II MHC molecules (Figure 1), resulting

in the formation of the immunological synapse (IS). Yet, there are a number of other

molecules that are not directly involved in T cells-APC(s) engagement, but are

instead intrinsically involved in intracellular signaling cascades, thus participating in

signal transduction from the membrane to the nucleus of T cells.


4

Figure 1 – T lymphocytes receptors and their ligands. (Oliveira M. PhD Thesis, 2008)

It has become challenging to study all these molecules involved in the immune

response, simultaneously with their interactions. Both gene analysis, mainly by

sequencing, and the evolution in the field of microscopy have become major

contributors on finding the different T cell molecules and on unveiling their

interactions and their roles [5]. In this thesis, I approach the immune system by

describing how the surface receptor CD6 of T cells regulates T lymphocyte

responses. This chapter presents an overall view of the major constituents of T cells

including a brief description of their interactions with their ligands and an

understanding on how signaling cross-talk interferes with T cell responses and

behavior. I am focusing on several CD6 isoforms to map their inhibitory role on T cell

responses [6].

1.3. TCR/CD3 complex

The TCR complex is a multi-subunit receptor complex formed by an heterodimeric

structure of α and β chains, or γ and δ chains, coupled to a CD3 set of polypeptides

[7], that must recognize antigens and translate this recognition into intracellular

signal transduction events [8]. For that matter, two different subunits, able to

communicate with each other, can be discriminated: the antigen (Ag) binding subunit

and the signal transduction subunit. The Ag binding subunit comprises two

transmembrane dissulphide-linked chains, each containing a variable and a constant

immunoglobulin-like domain [9]. The constant domain is responsible to anchor the

TCR to the membrane. On the other hand, the variable domain is dedicated to the

Ag recognition, providing Ag specificity, since it is encoded in separate segments,

rearranged randomly [10].

Each TCR is constitutively associated with a CD3 complex, required for

membrane expression of the TCR and for signal transduction upon TCR-recognition

of Ag. CD3 is composed of four subunits that associate with the TCRαβ in the form

of three dimers. They include CD3ελ and CD3εδ heterodimers, and a CD3ζζ

homodimer [11]. The transmembrane region of CD3 is negatively charged due to the


5

presence of aspartate residues, allowing these chains to associate with the TCRαβ,

positively charged [7].

The cytoplasmic domains of CD3 molecules contain immunoreceptor tyrosine-

based activation motifs (ITAMs), which are fundamental to the signaling capacity of

the TCR, since no signaling motifs have been found regarding the TCR. Each ITAM

has its own role in signaling events. When the TCR engages the peptide/MHC

(pMHC) on the APC surface, alterations of the homeostasis occur, promoting the

phosphorylation of CD3 ITAMs by Src kinases, such as Lck and Fyn. Several

docking sites for Src-homology 2 (SH2) domain-containing proteins are created,

allowing the association of -associated chain-70 (ZAP-70). ZAP.70 is a tyrosine

kinase which behaves as a key effector on the initiation of the T cell intracellular

signaling cascade.

The TCR binds self or foreign peptide on class I or class II MHC molecules. It

remains unclear how can the TCR recognize a specific ligand and how it

discriminates between the highly similar pMHC(s) present on APC(s) surface [12].

However, the presentation and origin of the antigen were reported to clarify whether

the TCR should bind MHC class I or MHC class II, providing two different types of

response.

1.4. Balance between kinases and phosphatases

Van der Merwe et al. [8] suggested that there is a balance in resting T cells

created between the phosphorylation of ITAMs in the TCR/CD3 complex and the

dephosphorylation by phosphatases. However, TCR triggering is thought to occur in

favor of ITAM phosphorylation, allowing the initiation of intracellular signaling

cascades.

Accordingly, T-cell-APCs engagement leads to phosphorylation of the CD3 ITAMs

by Lck and Fyn. Lck and Fyn feature two key tyrosine residues: one at the kinase

domain that induces T cell activation and one other at the C-terminal region that,

when phosphorylated, inhibits activation since it reduces the kinase activity.

Phosphorylation is accompanied by protein tyrosine phosphatase (PTP) activity.

CD45, one of the most abundant cell surface glycoproteins, with a cell surface


6

occupancy of about 10%, is a PTP expressed by nucleated hematopoietic cells [13].

It features an extremely long and highly glycosylated extracellular region. One of its

main roles seems to be the dephosphorylation of the C-terminal inhibitory tyrosine of

Src kinases, which leads to an increase of these kinases’ activity allowing T cell

activation, and the dephosphorylation of the positive autocatalytic tyrosine at the

kinase domain, which establishes a threshold to the kinase activity during activation

[14, 15, 16].

In parallel, other accessory molecules play an important role in T-cell activation.

Among them, co-receptors CD4 and CD8, co-stimulatory molecules such as CD28,

and adhesion molecules such as CD2, can be identified [17].

1.5. Co-receptors CD4 and CD8

T lymphocytes can be divided into two subpopulations according to the expression

of CD4 and CD8 membrane molecules. These co-receptors are known to co-

recognize Ag when the TCR engages different class MHC molecules [7].

Developing thymocytes are double positive since they express both CD4 and

CD8, until they undergo positive and negative selection differentiating into CD4+ or

CD8+ T cells [18].

CD8+ T cells define cytotoxic T cells (CTLs) able to recognize Ags associated with

class I MHC molecules. CD8+ T cells recognize and induce the apoptosis of infected

cells, commonly containing viruses or other cytosolic pathogens [9]. CD4+ T cells

define helper T cells (Th) which recognize Ag associated with class II MHC

molecules [7]. CD4+ T cells are known to produce cytokines and growth factors,

involved in the adaptive immune response, defending the human body from bacterial

infections. A subset of Th cells, Th1, are known to release cytokines and

chemokines to recruit macrophages and other phagocytic cells to the site of

infection, activating them and leading to the fusion of lysosomes and vesicles

containing bacteria. Another subset of Th cells is Th2. These are responsible for the

destruction of extracellular bacteria, through activation of B cells. [9].

The different roles attributed to the CD4 and CD8 co-receptors may be explained

by the different binding of each one of them to the respective class of MHC


7

molecule. Although both have Ig-like extracellular domains, a single transmembrane

domain and a short cytoplasmic tail, they are structurally different, which may explain

the different roles they display in the immune response. [7].

These co-receptors present an important role on T cell responses. An effective

response depends not only on specific TCR/pMHC engagement but also on the

interaction of these receptors with class I or class II MHC molecules. Both co-

receptors recruit Lck to their cytoplasmic tail, becoming phosphorylated upon T cell

activation and mediating T cell signaling [19].

1.6. CD28 and CTLA-4

T cell activation requires, as previously referred, the engagement of TCR and

pMHC. However, the adaptive immune response does not occur in the absence of a

second signal provided by co-stimulatory and co-inhibitory molecules, such as CD28

and CTLA-4 (cytotoxic T lymphocyte-associated antigen 4), which allow sustained

activation. Blockage of these molecules may take cells to become anergic or even

apoptotic. CD28 and CTLA-4 are known as transmembrane glycoproteins, members

of the Ig superfamily. Their short cytoplasmic tails contain SH2- and SH3- binding

domains involved in signaling events. CD28 was also reported to be constitutively

expressed in T cells [20], opposite of what happens with the majority of molecules

known to participate in T cell responses.

These molecules share two ligands from B7 family, CD80 and CD86. CD28 and

CTLA-4 engagement with their ligands conjugates co-stimulatory and co-inhibitory

signals in order to maintain the homeostasis in T cells [21]. Whilst CD28 ligation

enhances T cell proliferation; cytokine production, mainly IL-2; transcription factor

activation; anti-apoptotic genes up-regulation; cell adhesion enhancement and cell

cycle regulation, among other roles, [20, 21, 22], CTLA-4 does the opposite,

reducing the IL-2 production and thereafter reducing T cell activation [21].

These co-stimulatory receptors are also essential for the IS formation. [23]. It has

been hypothesized that CD28 initiates T cell activation and that, upon T cell

stimulation, CTLA-4 is up-regulated and translocates to the cell surface where it

displays the inhibitory potential to end, attenuate and also to establish a threshold in T

cell responses. CTLA-4 can behave this way because it has a higher competitive


8

advantage for ligand engagement than CD28, due to the higher affinity it shares with

either CD80 and CD86 [21].

1.7. The Immunological Synapse

The adaptive immune response is initiated when T cells encounter Ag presented

on APCs to form a dynamic and organized interface. The nanometer scale interface

created between these two cells is called the immunological synapse (IS) [2]. The

immature synapse has its receptors and other membrane proteins rearranged in

order to conceive the mature IS [24]. The mature IS was early identified as a

supramolecular activation cluster (SMAC) [25], structurally discriminated into three

spatially distinct concentric rings. The central SMAC, c-SMAC, is localized at the

center of the interface, where the TCR/CD3 complex engages pMHC. The peripheral

region, p-SMAC, surrounds the c-SMAC, and was reported to be enriched with

adhesion molecules and integrin-associated cytoskeleton proteins [26]. More

recently, a more external layer, the distal SMAC, d-SMAC, was also defined as the

region of the SMAC where proteins with large ectodomains, such as CD45 PTP, are

thought to accumulate. This model, known as bull's-eye rearrangement, is not found

at all IS, being absent on those formed with dendritic cells [27]. According to this

model, the IS as a SMAC becomes the interface per excellence responsible for

antigen recognition and T-cell activation [23]

The accumulation and distribution of receptors in the IS probably occurs by

recruiting ligands to the contact site, generating the necessary driving forces to

recruit TCR/CD3-pMHC, adaptor proteins, as well as kinases, to the IS. Upon the

massive recruitment of receptors to the IS, they form a mature IS [28, 29]. A new

hypothesis emerged, based on imaging analyses, that detected small structures

present at all immune synapses, containing different receptors, adaptors and

kinases. According to this hypothesis, microclusters (MC) were reported to form the

moment after pMHC recognition by the TCR complex. TCR-MCs play a role either in

antigen recognition as well as in the initiation of T cell signaling events. After their

formation and assembly in the peripheric region of the IS, it seems that they tend to

migrate to the c-SMAC, where they accumulate. During the migration to the c-

SMAC, they were reported to lose their associations with phosphorylated kinases

and other adaptors proteins they are bound to, such as Lck and ZAP-70 [23, 30].


9

The mature IS forms in an order of minutes, upon T cell-APC contact, while TCR

triggering occurs in a matter of seconds [31]. The end of synapse formation was

suggested to happen when lack of antigens decreases the continuous production of

peripheral MCs, stopping their translocation to the c-SMAC and thereafter

weakening the T cell-APC interaction [23].

1.8. TCR triggering and T cell activation

The recognition of pMHC by the TCR is the key to the process of T cell activation

in adaptive immune responses [32]. However, a second signal integrates this

response. The engagement of other molecules is required for full T cell activation.

Among them, co-receptors CD4 and CD8 and co-stimulatory molecules, such as

CD28, have been identified.

It is important to consider the cellular environment surrounding T cell activation,

which can be regulated by the cytoskeleton and lipid rafts. The cytoskeleton

undergoes several conformational changes modulating its shape during T cell

activation, providing motility and dynamic to T cell surface molecules. IS formation,

TCR-pMHC engagement, receptor recruitment and signaling events are processes

associated with cytoskeleton remodelations. However, lipid rafts also seem to play a

role on T cell activation. Lipid rafts are a combination of glycosphingolipids and

protein receptors organized in glycolipoprotein microdomains, which

compartmentalize cellular processes. Their aggregation, promoted by TCR

engagement, makes them the favorite place for the translocation of signaling

proteins, such as Lck, ZAP-70 and LAT [33].

TCR triggering is the mechanism per excellence responsible for the initiation of T

cell signaling, upon TCR engagement with class I or class II pMHC molecules. Some

models emerged, aiming to explain T cell triggering. Aggregation models proposed

that the aggregation of TCR-CD3 complex results in the proximity of tyrosine

kinases, responsible for ITAMs phosphorylation, allowing triggering of intracellular

signaling cascades. Other models reported that this triggering was achieved by

conformational changes in the cytoplasmic tail of CD3 molecules, upon TCR-CD3


10

complex engagement with pMHC. These changes were driven by mechanical forces

(ref van der merwe).

A more recent view proposes a different model, the kinetic segregation model.

According to this model, T cell triggering occurs as result of the balance created

between phosphorylation and dephosphorylation mechanisms. When adhesion

molecules attempt to create close contact zones between T cells and APCs,

molecules with large extracellular domains, such as CD45, are excluded from the c-

SMAC, reducing the phosphatase activity in that region. Small proteins are recruited

to the interface, mainly the TCR/CD3 complex, and this change provided by the

phosphatase activity reduction will allow an increase in phosphorylation, resulting in

TCR triggering, which is the starting point of T cell activation [34]. However, it

remains unexplained whether the CD45 phosphatase exclusion is sufficient to

induce the TCR triggering [8].

T cell activation is a process that comprises several steps. The first one is called T

cell polarization (1), during which the migration of both T cells and APC(s) are

mediated by chemokines. This process is not only important to the IS formation but

also to provide Ag recognition. Following polarization, adhesion (2) between T cells

and APCs must occur in order to facilitate TCR engagement, by creating an optimal

distance between the two cells. Along with the contribution of adhesion molecules,

TCR engagement (3) is initiated, creating multiple second messengers and inducing

cytoskeleton changes to stop the migration of cells. It is important to sustain full

activation, which requires transcriptional activation, and to establish the IS. Early

signaling (4) is described through several responses, such as intracellular calcium

increase and metabolism changes. One of the earliest events in T cell activation is

the phosphorylation of ITAMs. Finally, the IS is disrupted (5), allowing T cell

activation to end [32].

In the sequence of events involved in T cell activation, from the membrane to the

nucleus, there is a balance created by two opposing processes of phosphorylation

and dephosphorylation, as previously referred. According to the kinetic segregation

model, when the contact zone between T cells and APCs is optimal, large

ectodomains proteins, such as CD45, are excluded, allowing small proteins to be

recruited and to accumulate at the IS. CD3 ITAMs become phosphorylated by Src


11

kinases; phosphorylation is reported to be enhanced by Lck associated with CD4.

Phosphorylated ITAMs become binding sites for SH2 domain-containing proteins,

such as ZAP-70. ZAP-70 is also phosphorylated by Src family kinases, becoming

activated and capable of phosphorylating other substrates, such as adaptor linker for

activation of T cell (LAT) or the SH2 domain-containing leucocyte (SLP-76). This

leads to the assembly of multiple adaptor proteins and scaffold enzymes and,

simultaneously, to the activation of multiple signaling pathways.

There is an enormous variety of substrates and molecules involved in T cell

signaling. Upon receptor stimulation, phospholipase C (PLC) is activated and

produces diacylglicerol (DAG) and inositol triphosphate (IP3), by cleaving

phophatidylinositol 4, 5-biphosphate (PIP2). IP3 is a second messenger that

releases calcium, an early event in the timeline of T cell responses. When calcium,

stored at the endoplasmatic reticulum (ER), is released, cytosolic Ca2+ concentration

increases and binds to calmodulin, which in turn activates the phosphatase

calcineurin. Calcineurin dephosphorylates NFAT, allowing it to migrate to the

nucleus and activate the expression of cytokines, such as IL-2, so that they promote

T cell proliferation. Also, DAG may stimulate protein kinase C (PKC) to promote the

initiation of transcription mechanisms. The activation of both NF-B and AP-1 is

mediated by PKC. G proteins, present in the lipid rafts, also mediate signal

transduction. In the context of T cell signaling, they participate in the MAPK pathway,

also promoting the activation of transcription factors at the nucleus [35]. The

activation of transcription factors is very important since it will determine the fate of T

lymphocytes.

1.9. Scavenger Receptor Cysteine-Rich superfamily

The Scavenger Receptor Cysteine-Rich superfamily (SRCR-SF) of proteins is a

highly conserved, stable and ancient family of cysteine-rich type scavenger

receptors [36]. This superfamily contains members that are structurally related but

share very few functions. Some members such as CD5 and CD6 act as receptors.

Moreover, SRCR domains are thought to be involved in different functions, like

pathogen recognition, modulation of the immune response, epithelial homeostasis,

stem cell biology, and tumor development [37].


12

The SRCR-SF contains more than 30 members, described mainly in mammals,

but also in vertebrates and algae [38]. Typically, SRCR-SF members are expressed

in cells belonging to the immune system: B cells, T cells, macrophages, among

others. However, some members are expressed in several tissues and organs, such

as the liver, kidney, placenta, stomach, brain and heart [37], and this epithelia and

mononuclear-phagocytic system expression suggests a potential role in mucosal

defense. SRCR-SF members are classified based on the exon organization and

localization and the number of cysteines in each SRCR domain. Accordingly, type A

domains are encoded by two exons and contain six cysteine residues, whereas type

B domains are encoded by a single exon and contain eight cysteine residues. CD5

constitutes an exception since it is a type B SRCR member containing six cysteine

residues [38].

Due to its diversity, the precise function of SRCR proteins is yet to be discovered.

Since these members seem to play an important role on both innate and adaptive

immune systems, it becomes of crucial importance to explore the role(s) of this SF

[39, 40].

1.9.1. CD5

CD5 is a surface receptor, member of the SRCR superfamily [41]. CD5 is

expressed on thymocytes, mature peripheral T cells, on B cells derived from B-CLL

[42] and also in a sub-population of B cells, B-1a cells [43]. It comprises an

extracellular region of three scavenger domains, a hydrophobic transmembrane

region and a highly conserved cytoplasmic domain [41]. The cytoplasmic domain

contains several threonine/serine and tyrosine residues, potential sites of

phosphorylation upon TCR/CD3 complex stimulation [44]. There are four tyrosine

residues in the CD5 cytoplasmic tail at positions Y378, Y429, Y441 and Y463. Y378

is within a tyrosine-based inhibitory motif (ITIM). The middle tyrosines, Y429 and

Y441, form an imperfect ITAM and they are the main targets of phosphorylation [45].

Upon tyrosine phosphorylation, binding sites for SH2 domain-containing molecules

are formed [46]. SHP-1 is a phosphatase able to bind SH2 domain-containing

proteins, thus being able to associate with the CD5 cytoplasmic tail. The sequence

involved in the binding of SHP-1 was mapped to Y378. It is known that, upon

TCR/CD3 stimulation, SHP-1 association with CD5 increases, thus cooperating with

the inhibitory role of CD5 in T cell signaling [47]. Also, CD5 was reported to interact


13

with molecules present on the APC surface, such as CD72 [48]; it has its SRCR-D3

domain binding to CD2, an adhesion molecule present on the T lymphocyte surface

[44]. CD5 associates through its extracellular region to CD6, also a member of the

SRCR-SF [49]. Although CD5 has its extracellular and cytoplasmic regions binding

other molecules, no physiological ligand at the APCs was independently confirmed

to bind CD5.

The CD5 signaling pathway involves the participation of Src family kinases, such

as Lck and Fyn, Ca2+/calmodulin-dependent kinases [50], RasGAP and Cbl [51, 52],

among others. These mediators down-modulate T cell activation helping to establish

the main role of CD5 [53]. CD5 was reported to accumulate at the IS, the place of

excellence where molecules are recruited to during T cell activation [54].

Early studies reported CD5 as a dual modulator involved in T cell activation since

it was thought to act both as a co-stimulatory and inhibitory receptor. Moreover,

initial studies describe CD5 as an enhancer of TCR-mediated cell proliferation [55].

However, CD5 is now considered an inhibitory molecule. Thymocytes from CD5

deficient mice showed a higher proliferation rate and increased free cytoplasmic Ca2+

concentration upon TCR/CD3 stimulation [56]. Also, other studies pointed CD5 as a

major down-modulator involved in T cell activation processes [53]. The inhibitory

function of CD5 was described to be dependent on the functional integrity of its

cytoplasmic tail [57]. It has been suggested that SHP-1 is involved in this function,

since it binds SH2 domains, upon phosphorylation,. Recently, Bamberger et al.

proposed an alternative pathway mediated by Src family kinases [53]. According to

this model, early T cell signaling comprising effectors such as ZAP-70, are inhibited

via a parallel pathway of CD5. CD5 is able to associate with Fyn in lipid rafts,

allowing Fyn phosphorylation in the C-terminal inhibitory tyrosine residue followed by

a reduction of Fyn activity. Thereafter, the activation of ZAP-70 is down-regulated

[53]. Lck has been considered as the main kinase interacting with CD5 although

others may complement its function.

1.9.2. CD6

CD6 is a type I membrane glycoprotein that participates in the fine-tuning of T cell

responses [37]. It was first discovered in T cell studies using mAb 12.1 by Kamoun

et al. [58]. CD6 is expressed on thymocytes, on a sub-population of B cells (B-1a), in


14

some brain cells and in cells derived from chronic lymphocytic leukemia (B-CLL) [51, 59, 60]. CD6 expression increases along the process of thymocyte maturation, being

higher on single positive CD4-CD8+ and CD4+CD8- thymocytes[61].

CD6 belongs to the SRCR-SF [37] like CD5 [41] and SSC5D [62]. As a surface

receptor and a member of SRCR-SF, CD6 comprises an extracellular region

composed of three SRCR domains, a small transmembrane domain and an

unusually long cytoplasmic tail [37, 63, 64, 65]. CD6 has a molecular weight of about

105-130kDa [65] due to heavy glycosylations and phosphorylations [66].

Human CD6 is encoded by 13 exons. First seven exons code for the extracellular

and transmembrane domains while the remaining exons code for its cytoplasmic tail

[69]. Several CD6 isoforms were reported as result of alternative splicing of the

exons coding for the extracellular and cytoplasmic domains [66, 49]. The

cytoplasmic tail strongly participates in T cell responses. Although it features no

intrinsic enzymatic activity, it is enriched with residues that are phosphorylated

during T cell activation and further interact with signaling and cytoskeletal proteins

[37, 70]. The cytoplasmic tail of CD6 has tyrosine [63], threonine and serine residues

which can be phosphorylated, as well as two proline-rich sequences established as

docking sites for SH3 domain-containing proteins [66, 69].

Lymphocytes have multiple accessory molecules on their surface, which have a

relevant role in T cell responses. CD6 and CD5 were reported to be closely related

accessory molecules [70]. In humans, the CD6 gene was reported to map at

chromosome 11q12.2, close to the gene coding for CD5 [67, 71]. While CD5

transcription regulation upon T cell activation has been intensively studied, CD6 has

only been reported to be transcriptionally regulated by RUNX1/3 and Ets-1,

transcription factors that bind the CD6 promoter region in T cells and appear to

regulate conserved mechanisms [72, 73].

When compared with other T cell receptors, the accessory molecules CD5 and

CD6 display a very similar structure and expression pattern [50, 74]. As they have

homologous extracellular regions, it seems understandable that they also share

similar roles on T cell activation and differentiation [51, 75, 76, 77]. Yet, their

cytoplasmic domain is very distinct [53]. CD6 presents an important role in the

regulation of CD5 tyrosine-phosphorylation. It is known that CD5 has the ability to

unusually associate with tyrosine kinases from different families, such as Src family

kinases Lck and Fyn, Syk family kinase ZAP-70, and Tec family kinase Itk, which

may be explaining its possible inhibitory role. CD6 may have an activatory role over


15

CD5 [49]. CD5 has also been reported to behave as a negative modulator in T cell

activation [78] and CD6 seems to induce CD5 tyrosine-residues phosphorylation

[37], thus increasing the CD5 inhibitory activity [79]. Moreover, the CD6 and CD5 co-

localization [37, 56, 24] at the IS reinforced the idea of an inhibitory role shared by

both scavenger receptors.

CD6-CD166 interaction

CD166 or ALCAM (Activated leukocyte cell adhesion molecule), is the counter

receptor for CD6. It is located on the APC membrane [80, 82], comprises five Ig

extracellular domains [69] and is expressed in hematopoietic (activated lymphocytes,

macrophages, dendritic cells, thymic epithelial cells) and non-hematopoietic

(epithelial, endothelia, neurons, fibroblasts, etc.) cells [69, 81]. CD166 is the first

described immunoglobulin-like receptor to bind to a cysteine-rich domain [56].

Binding of CD6 to CD166 is both unusual and specific, since T cell receptors are

known to bind their ligands in a “head to head” manner and CD166 binds CD6 on its

most membrane-proximal domain, the third domain (Figure 2). The first evidence

that the membrane-proximal SRCR domain of CD6 bound to CD166 was described

by Whitney et al. [65]. As result of studies using an alternative spliced isoform

without the exon 5, thus lacking the third extracellular domain of CD6, it was

discovered that the CD166 N-terminal region (D1) binds laterally to the third

extracellular SRCR domain (SRCR-D3) of CD6 [83, 60]. The CD6-CD166 interaction

targets CD6 to the center of the IS [49, 84], where it plays a dual role by improving

early and stable adhesion between lymphocytes and APCs, and by modulating the

later proliferative responses of lymphocytes [56, 85]. Accordingly, blocking this

interaction with specific antibodies reduces T cell-APC contacts and both molecules

no longer target to the IS. The other two SRCR domains of CD6, D1 and D2, may

also be responsible for yet non-described and unknown functions of CD6.


16

Figure 2 – CD6 and CD166 engagement

T cell signaling

Once TCR-pMHC engagement occurs, along with a second signal provided by

co-stimulatory molecules, T cell activation is initiated. At the beginning of this

process, tyrosine-residues of CD6 cytoplasmic tail become phosphorylated by Src

kinases, such as Fyn and Lck [6]. Upon phosphorylation, SH2 domain-containing

proteins such as ZAP-70, an important effector in T cell activation, are recruited as

well as the positive regulator SLP-76, which binds the CD6 tyrosine residue Y662

[86]. SLP-76 also interacts with molecules activating the PKC and MAPK pathways

[73]. Syntenin-1 is another adaptor protein able to bind signal transduction effectors

and cytoskeletal proteins. It seems to be a good candidate for binding to the CD6

cytoplasmic tail since it was reported to accumulate at the IS, similarly to CD6 [87].

Both adaptor proteins are controlled by phosphorylation of the CD6 C-terminal

region. Cross-linking CD6 with Abs or with its own physiological ligand CD166 was

reported to activate molecules involved in the MAPK pathway, and also the AP-1

and NF-B transcription factors [37, 79].

CD6 biological function

CD6 was regarded as co-stimulatory molecule able to deliver signals to cells [39,

61, 75, 77, 88] and as an adhesion molecule in thymocyte-thymic epithelial cells


17

interactions [69]. Accordingly, studies that consist of cross-linking CD6 with

monoclonal antibodies suggest a similar positive regulatory activity of CD6 in T cell

responses [64]. Other studies also suggested that CD6 participates on thymocyte

maturation [69] because during thymocyte development, CD6-depending signals

contribute to thymocytes survival and positive selection [40]. Moreover, CD6 long

term engagement with CD166 is crucial for T cell proliferation induced by dendritic

cells, since it recruits them to DC-T cell contact zones [85]. T cell proliferation is also

enhanced when CD6 acts as a co-stimulatory molecule capable of synergizing with

TCR and co-stimulatory CD28 [56].

On the other hand, in a study using mAbs OX126 and 3A6, which bind CD6-d3

and CD166 respectively, opposite results were obtained. In fact, when using OX126,

T cell proliferation was reduced; on the other hand, when using 3A6, the exact

opposite happened, suggesting that CD6 has, similarly to CD5, an inhibitory role in

T cell activation [6]. A work from 1997, described calcium flux studies using different

CD6 isoforms of variable cytoplasmic lengths [89]. It was suggested that the N-

terminal half of the cytoplasmic tail of CD6 was critical for calcium mobilization since

experiments with a full length isoform of CD6 (CD6 FL) presented no calcium flux

variations, and when using shorter isoforms, an increase on calcium flux was

observed. However, a work from 2012 that proved CD6 as an attenuator of early and

late signaling events on T cells activation, presented a different hypothesis. The CD6

cytoplasmic tail seems responsible for the inhibitory potential, since in its absence,

no inhibition occurs [6]. CD6 FL attenuated early and late T cell responses such as

intracellular calcium flux and IL-2 production, respectively, in accordance with

Kobarg et al. [89] point of view. But, on the other hand, CD6Cy5, an isoform with

only five aminoacids in the cytoplasmic tail of CD6, showed no signs of down-

modulating T cell activation. In fact, regarding this isoform, there was an increase on

intracellular calcium flux levels upon activation with OKT3 and anti-CD28 mAbs.

As an innate response element

CD6 is not only an intermediate of the adaptive immune response. It has been

also thought to play a role in the innate response. Since some members of the

SRCR-SF act as pattern recognition receptors (PRR) for microbial organisms, CD6

has been suggested to play a similar role in binding pathogen-associated patterns in

bacteria and fungi. The work of Sarrias et al. [39] reported that the extracellular part

of CD6 may have retained this innate immune ability from ancient member of the

SRCR-SF, thus being able to interact with lipopolysaccharide (LPS) from Gram


18

negative bacteria and with lipoteichoic acid (LTA) and peptidoglycan from Gram

positive bacteria, an interaction that triggers MAPK cascades, involved in T cell

signaling. CD6 was also reported to be able to aggregate bacteria [38]. These

characteristics give CD6 the potential of being regarded as a possible therapeutic

target. Not only cells of the innate immune responses, but also T cells, may use the

presence of bacterial components through CD6 to recognize PRR's, something

essential for the intervention of septic shock or other inflammatory diseases of

infectious origin (39, 40]. This has led to an increased survival rate and to the

reduction in pro-inflammatory cytokine levels in murine, opening doors to CD6

therapeutic use in human sepsis [37].

CD6 in disease

The determination of CD6’s main role and regulation, simultaneously with the

detailed study of the pathways regulated by this molecule, has achieved great

importance since CD6 has been associated with diseases, such as cancer and auto-

immune diseases. Similarly to CD5, a marker of chronic lymphocytic leukemia (B-

CLL) [60], the possibility that CD6 may be used with therapeutic potential or as a

diagnostic marker on diseases of significant matter has become real. Studies were

developed to explore the therapeutic potential of CD6 (75). It is already known that

CD6-CD166 induces synergistic co-stimulation enhancing the intrinsic activity of

TCR/CD3 activation pathways. Targeting CD6 without interfering with its ligand

reduced T cell activation, proliferation and pro-inflammatory responses, which would

allow us to think of CD6 as a possible target for the treatment of auto-immune

diseases [84]. In fact, CD6 has been linked to rheumatoid arthritis (RA), Sjögren's

syndrome (SS) and multiple sclerosis (MS) [83, 90, 91, 92]. A single nucleotide

polymorphism (SNP) in exon 1 of CD6 was reported to be associated with MS [75].

In SS, a soluble form of CD6 is present in high levels in 2/3 of the patients, although

there is no correlation between these findings and disease prognosis [92]. CD6 is

expressed at high levels in malignant B cells derived from B-CLL [42]. Knowing that

CD6 regulates Bcl-2/Bax ratio, protecting B-CLL cells from apoptosis [60], it would

be interesting to unveil the reason and role of CD6 expression in this disease. It thus

becomes mandatory to elaborate further studies to better understand CD6 as a

negative modulator.

The aim of my thesis is to map the inhibitory role of the CD6 within its cytoplasmic tail.


19

2. Materials and Methods


20

2. To map within the cytoplasmic tail of CD6 the region responsible for its inhibitory

properties, six CD6 mutants were created. These isoforms, containing cytoplasmic tails

of different lengths, were designated as Cy5, Cy37, Cy70, Cy135, Cy179 and FL

(Figure 3), being FL the isoform corresponding to the full length protein, and in all the

others the number corresponds to the number of cytoplasmic amino acid residues

present.

Figure 3 – Schematic representation of the six CD6 protein mutants generated by stably expressing the constructs in E6.1 Jurkat cells.

2.1. Cloning

Prior to my work, cDNA corresponding to each of the six isoforms was amplified

from genomic DNA by Polymerase Chain Reaction (PCR), using a forward primer

containing an AscI restriction site and a Kozac sequence. This primer spans the ATG

start site and was common to all isoforms. Reverse primers were specific to each of the

isoforms and contained a BamHI restriction site (Table I).


21

Primer name Sequence (5’-3’)

CD6_ATG(AscI) forward TAGTAGGGCGCGCCGCCACCATGTGGCTCTTCTTCGGGATCA

CD6Cy5(BamHI)Rev CTACTAGGATCCCTATTATTTCCTTTAATTCTCAAGAGGATGAA

CD6Cy37(BamHI)Rev CTACTAGGATCCTTTGGGGATGGTGATG

CD6Cy70(BamHI)Rev CTACTAGGATCCCTGGGCGCTGAAGTC

CD6Cy135(BamHI)Rev CTACTAGGATCCCCTCGGGTGATACTGA

CD6Cy179(BamHI)Rev CTACTAGGATCCCTCCAAGTTTGGGG

CD6FL(BamHI)Rev CTACTAGGATCCCTAGGCTGCGCTGATGTCATC

Amplified cDNA corresponding to each of the isoforms was cloned, after

purification, in a pHR vector containing an ampicillin resistant gene for selection, as

well as a citrine gene which is expressed as a fusion protein with our mutants. For

cloning, PCR products were digested with AscI (8 h, 37 ºC) and BamHI (2 h, 37 ºC)

restriction enzymes (BioLAbs) in NEBbuffer 4. pHR vector was digested with MluI and

BamHI enzymes (BioLAbs), for 3 h at 37 ºC. Digestion products were run on a 1%

agarose gel to check efficiency, and digested bands were cut and purified with the

QiaexII kit (Qiagen) according to the manufacturer’s instructions. Ligation was

performed overnight at room temperature, in a 20 µl total volume reaction containing

binding buffer and T4 DNA ligase enzyme (Fermentas).

2.2. Transformation and miniprep

TOP-10 competent cells were transformed with 8 µl of ligation product by a

heatshock method – 20 min on ice followed by 30 sec at 42 ºC and again 5 min on ice.

Cells were grown for 1 h at 37 ºC and then plated on LB plates with ampicillin and left

overnight at 37 ºC. After a colony PCR to confirm the insert size of few colonies

representing each construct, plasmids were isolated with the PureLink® Quick Plasmid

Miniprep Kit protocol (Invitrogen), following the manufacturer’s instructions.

2.3. Cell lines

The Jurkat cell line (clone E6.1) and the kidney adherent 293T cells were

maintained in complete Roswell Park Memorial Institute (RPMI) media (Gibco) and

Dulbecco's Modified Eagle Medium (DMEM) (Gibco), respectively, with 10% Fetal

Bovine Serum (FBS) (Gibco) and 1% penicillin and streptomycin (Invitrogen), at 37 ºC

Table I –Sequences of the primers used to amplify CD6 cDNA for cloning


22

and 5% CO2. Cells were passed every 3 days when approaching confluence.

2.4. Stable cell line production

Stable Jurkat cell lines (clone E6.1) expressing each of the CD6 mutants were

produced by lentiviral infection and expression.

2.4.1. Virus assembly293T cells were transfected with 0.5 µg of each of the three vectors necessary for

virus assembly: pMD-G, p8.91 Ex QV and pHR-citrine, the last one cloned with the

DNA coding for each of the mutants. In short, 24 h before transfection, 293T cells were

counted and plated on a 6-well plate at a concentration of 3 x 105 cells/ml in 2 ml of

DMEM media. The three vectors were transfected in a mix of 4.5 µl lipofectamine

(Invitrogen) and 100 µl of Minimal Essential Medium (Opti-MEM) (Gibco). After 30 min

of incubation at room temperature, the transfection mix was added to the 293T cells,

whose media had been replaced by complete RPMI. Cells were then incubated from 48

to 72 h at 37 ºC to allow virus assembly and production into the supernatant.

2.4.2. E6.1 infectionVirus particles coding for the different CD6 mutants were used to infect E6.1 cells.

The virus-containing supernatant of the transfected 293T cells was centrifuged for 5

min at 1200 rpm to remove any contaminating 293T cell, which was then added to 106

E6.1 cells in 4 ml of complete RPMI. Cells were left for 48 h at 37 ºC to allow infection.

2.4.3. Assessing infection efficiency CD6 is expressed as a fusion protein of CD6-citrine. We have used citrine

fluorescence to measure the amount of CD6 being expressed in the infected cells and

to assess transfection efficiency by flow cytometry analysis. Cells expressing CD6 were

sorted (Fluorescence-activated cell sorting Aria (FACS Aria)) to homogenize the CD6-

expression levels within all CD6 mutants.

2.5. CD3, CD5 and CD6 Expression ProfileAll CD6 mutant cell lines were analyzed for the expression of CD3, CD5 and CD6

membrane markers, by cytometry, using monoclonal antibodies (mAb) anti-CD3, anti-

CD5 and anti-CD6, respectively. In short, 3 x 106 cells of each isoform were used for

each labeling. Cells were collected by centrifugation (1200 rpm for 5 min) and washed

with Phosphate Buffered Saline (PBS) (Invitrogen). All samples were ressuspended in


23

50 µl of FACS buffer (0.2% Bovine serum albumin (BSA) and 0.1% Azide) containing 1

µg of each of the primary mAb - mouse anti-CD3 (OKT3), mouse anti-CD5 (IgG1

Y2/178 (Santa Cruz Biotechnology)) and mouse anti-CD6 (MEM98 (1 mg/ml) (Exbio));

as a negative control, we used 1 µg of OX-54 (anti-rat CD2). Cells with mAbs were

incubated for 30 min on ice and then washed twice to eliminate the excess of mAb.

Cells were then incubated for 15 min in 50 µl of FACS buffer containing 1 µg of the

secondary Ab labeled with Alexa Fluor® 647 (donkey anti-mouse IgG (H+L),

Invitrogen). Cells were washed again two times using FACS buffer to remove the

secondary Ab in excess and ressuspended in 200 µl of PBS and filtered. Results were

analyzed by Flow Jo software (version 8.8.7).

2.6. Sorting

To ensure that cells were expressing CD6 and CD3 at similar levels, all samples

were labeled for these two markers (as explained above) and sorted.

2.7. Western Blotting

The size of the proteins was confirmed by Western-Blotting. Cells lysates were

obtained by lysis of 3 x 106 cells with NP-40 lysis buffer (10 mM Tris-HCl pH 7.4; 150

mM NaCl; 1 mM EDTA; 1% (v/v) NP-40) containing PMSF (1 mM) (Sigma) for 30 min

on ice. Samples were centrifuged at high speed for 10 min at 4 ºC. The supernatant

was kept and mixed with 2x Laemmli Sample buffer (BioRad). Samples were

denaturated for 5 min at 95 ºC and kept at -20 ºC

Lysates were loaded on a 10% SDS-polyacrylamide gel (SDS-PAGE) and

separated for 1 h and 30 min at 150 V. Samples were transferred to a nitrocellulose

membrane in an iBlot equipment (Invitrogen), according to the manufacturer’s protocol,

which was then blocked in a solution of 5% non-fat dry milk in Tris-Buffered Saline and

1% Tween (TBS-T) (20 mM Tris-HCl; 137 mM NaCl; 0,1% (v/v) Tween 20 (10%); pH

7.6), for 1 h at room temperature. The membrane was incubated with the primary anti-

CD6 Ab (Anti-Human CD6 Purified 1 mg/ml clone MEM98 (Exbio)) in a solution of 3%

non-fat dry milk in TBS-T, overnight at 4 ºC. After a series of 5 min washes with TBS-T,

the membrane was incubated for 1 h at room temperature with the secondary Ab (goat

anti-mouse IgG-HRP 200 µg/0.5ml (Santa Cruz Biotechnology)) in a solution of 3%

non-fat dry milk in TBS-T. ECL solution (GE Healthcare) was used for developing, after

which the membrane was exposed to an X-ray film.


24

2.8. Activation Assays

Jurkat E6.1 cells expressing each of the different CD6 mutants were used to

perform activation studies. Analysis of intracellular calcium mobilization and interleukin

2 (IL-2) production, early and late activation responses respectively, were performed.

2.8.1. Calcium flux variationIntracellular calcium fluxes were measured on Jurkat E6.1 cells expressing the

different CD6 mutants, as well as CD6 full length. Samples were loaded with 5 µM of

Fluo-3 (Invitrogen), a molecular probe capable of binding free intracellular Ca2+, for 30

min at 37 ºC. Cells were washed with PBS and analyzed by flow cytometry which gives

the variation of fluorescence given by the Fluo-3/calcium interaction upon activation.

Cells were monitored for 5 min and activated with 1 µg/ml of mAb anti-CD3 (OKT3)

after the first minute. Results are analyzed with FlowJo software (version 8.8.7).

2.8.2. Interleukin-2 productionIL-2 production studies are relevant to monitor T cell activation as a late signaling

event. Evaluation of IL-2 production was performed using an Enzyme-linked

immunosorbent assay (ELISA assay) (Human IL-2 ELISA KIT II, BD OptEIA),

according to the manufacturer instructions. In short, the supernatant of resting and 24 h

phytohaemagglutinin (PHA)-activated cells (2 µg), along with the standards, was

loaded, in duplicate, into a plate coated with an IL-2 mAb. After a 2 h incubation period

and a series of washing steps, a detection solution was added producing an antibody-

antigen-antibody “sandwich” and, after another hour incubation and another series of

washing steps, a substrate reagent was added to each well and incubated for 30 min,

producing a blue color proportional to the amount of IL-2 present in the initial sample.

The reaction was stopped turning the blue color into a yellow color, whose absorbance

was read at 450 nm, using Biotek software Gen5 (version 1.06).


25

3. Results


26

Aiming to map within the cytoplasmic tail of CD6 the domain responsible for its

inhibitory potential in T cells, several CD6 constructs featuring variable cytoplasmic tail

lengths were previously created and designated as CD6Cy5, CD6Cy37, CD6Cy70,

CD6Cy135, CD6Cy179 and CD6FL.

3.1. Stable cell line production

In our constructs, CD6 is expressed as a fusion protein with citrine. We have used

citrine fluorescence to assess, by flow cytometry, the levels of CD6 expression in E6.1

transfected cells.

E6.1 cells were efficiently expressing the different CD6 isoforms, except for isoform

CD6Cy37 (Figure 4). CD6 expression levels were not uniform within all cell lines and

expression of isoforms CD6Cy37, CD6Cy135 and CD6FL was quite low or almost null.

Figure 4 – Flow cytometry analysis: CD6 expression levels (FL-1), given by the amount of citrine fluorescence, in E6.1 cells infected with virus particles containing CD6Cy5, CD6Cy37, CD6Cy70, CD6Cy135, CD6Cy179 and CD6 FL mutants (blue). Plots show that E6.1 cell lines express a low amount of CD6. Non-infected E6.1 cells were used as control (red).


27

In order to obtain a more homogeneous CD6-expressing population, these cells

were sorted for the same level of citrine expression and results are shown in Figure 5.

After sorting, all E6.1 cell lines were expressing CD6 isoforms at good levels when

compared with the control. E6.1 cells expressing CD6Cy5 expressed two different

populations, one of them with a low amount of CD6.

Figure 5 - Flow cytometry analysis of sorted infected E6.1 cells: CD6 expression (FL-1) of cell expressing CD6Cy5, CD6Cy37, CD6Cy70, CD6Cy135, CD6Cy179 and CD6FL isoforms. Plots show that CD6 mutants after sorting express higher levels of CD6. Non-infected E6.1 cells were used as control (red).


28

3.2. CD3, CD5 and CD6 expression

The expression of CD3, CD5 and CD6 of all cell lines, expressing CD6 mutants, was

compared (Figure 6).

Figure 6 - Flow cytometry analysis: of CD3, CD5 and CD6 expression in each of the cell lines; anti-rat OX-54 mAb was used as control. CD6Cy5 shows no CD6 expression. All the other cell lines were expressing CD6. All cell lines were also expressing CD5 and CD3. However, the largest CD6 positive population in cells expressing CD6Cy135, CD6Cy179 and CD6FL is not simultaneously expressing CD3. Cells expressing CD6Cy70 show a minimum expression of both CD6 and CD3.


29

All cell lines expressed high levels of CD3 and CD5 as expected. CD6 expression

levels, however, were not homogeneous among the mutants. Cells expressing

CD6Cy135, CD6Cy179 and CD6FL showed two populations expressing different levels

of CD6 expression. E6.1CD6Cy5 lost CD6 expression and virus particles with this

mutant were used to re-infect E6.1 cells.

3.3. Sorting

To select cells expressing simultaneously similar levels of CD6 and CD3, we sorted

CD6+/CD3+ cells that were efficiently obtained and cultured (Figure 7).

Figure 7 – Flow cytometry analysis of cells labeled for CD3 and CD6. A) CD6-citrine expressing cells B) E6.1 cells

express CD3, labeled with Alexa-Fluor 647. C) Gate of CD3 and CD6 positive cells to be sorted. D) A 99% pure double

positive CD6/CD3 population was obtained.

3.4. Western-Blotting

The relative size of the CD6 mutant proteins was confirmed by Western Blot, using

CD6 mutant cell lysates (Figure 8).

In Figure 8-A, one can see that, as expected, E6.1 Jurkat cells do not show any

band since in these cells the levels of CD6 are minute. All other cells have a band

corresponding to the approximate size of the protein of each transfected mutant. In


30

Figure 8-B, E6.1 cells transfected with pHR-citrine without CD6 also shows no band,

as all CD6 expressed is the endogenous, and as said before, the levels are minute. No

band could be detected for the mutant CD6Cy70 and this is probably due to a technical

problem since one can see in Figure 8-A that this isoform is being expressed. Western-

Blot analysis confirmed that each of the cell lines is expressing the CD6 mutant protein

with the expected size. In -B, some extra bands were detected concerning CD6Cy37

and CD6Cy179 isoforms probably corresponding to unspecific products. No bands

could be seen regarding CD6Cy5 isoform (Figure 8-B), which is not at all surprising

since, as said before for FACS analysis, E6.1 CD6Cy5 in culture loses CD6

expression.

Figure 8 - Western-Blot. A) Relative sizes CD6Cy37, CD6Cy70, CD6Cy135 and CD6FL proteins. B) Relative sizes of CD6Cy5, CD6Cy37, CD6Cy70, CD6Cy135, CD6Cy179 and CD6FL proteins.

3.5. Activation assays

Activation assays were performed to study the CD6 inhibitory role in early and late T

cell responses.

3.5.1. Calcium flux assaysEarly response assays were based on calcium immediate release into the T

lymphocyte cytoplasm upon TCR/CD3 complex activation. Due to some technical


31

problems, we were not able to perform calcium assays using all the isoforms

simultaneously.

Figure 9 shows calcium flux analysis of five CD6 isoforms: CD6Cy5, CD6Cy37,

CD6Cy70, CD6Cy179 and CD6FL. There was an increase on calcium levels upon

activation for cells expressing the CD6Cy5, CD6Cy70 (Figure 9-A) and CD6Cy37

(Figure 9-B) isoforms. On the other hand, cells expressing CD6Cy179 isoform and

CD6 FL have no variation on calcium levels upon activation (Figure 9-B).

Regarding the ratios between the basal and the highest calcium levels of cells upon

activation calcium variation was higher on cells expressing CD6Cy5, and CD6Cy70,

and lower for cells expressing CD6Cy37. CD6DCy179 and CD6FL isoforms presented

almost no variation on calcium flux for the last two (Figure 9-C).

3.5.2. Interleukin-2 productionLate response activation assays were based on the production of IL-2 responsible

for T cell proliferation. Due to technical problems, we were not able to perform IL-2

assays using all isoforms simultaneously.

Levels of IL-2 were similar between all mutant cells when in a resting state (Figure

10-A). After PHA activation, cells expressing CD6Cy5 were the ones with a higher rate

of IL-2 production, followed by CD6Cy37, CD6Cy70, CD6Cy135, CD6FL and

CD6Cy179 (Figure 10-A).

As expected, IL2 levels were higher upon activation for all cells, except for

CD6Cy179. Regarding variation on the production of IL-2 between all mutants, cells

expressing CD6Cy5 and CD6Cy37 have the highest levels of IL-2, followed by

CD6Cy135, CD6 FL and CD6Cy70. In Figure 10-B), it is possible to see IL-2 variation

results given by the ratio between activated and resting cells. The CD6Cy5 isoform

presents the highest variation, followed by CD6Cy37, CD6Cy70, CD6Cy135 and finally

CD6FL and CD6Cy179 isoforms.


32

Figure 9 – A) Calcium flux levels upon activation of cells expressing CD6Cy5, CD6Cy70 and CD6Cy179 isoforms. The CD6Cy5 isoform presents the highest levels on calcium flux followed by CD6Cy70 isoform. The CD6Cy179 isoform presents no calcium flux. B) Calcium flux variation upon activation of cells expressing CD6Cy37, CD6Cy179 and CD6FL isoforms. The CD6Cy37 isoform is the only isoform that presents significant calcium flux, since CD6Cy179 and CD6FL present none. C) Ratio of calcium variation upon activation of cells expressing CD6Cy5, CD6Cy37, CD6Cy70, CD6Cy179 and CD6FL isoforms.


33

Figure 10 – ELISA assay results. In the vertical axis are represented the values of concentration in pg/ml. A) Analysis of the IL-2 production on resting and PHA activated cells variation, concerning CD6Cy5, CD6Cy37, CD6Cy70, CD6Cy135, CD6Cy179 and CD6FL isoforms. B) Analysis of the IL-2 variation, calculated by the ratio between PHA activated cells and resting cells, concerning CD6Cy5, CD6Cy37, CD6Cy70, CD6Cy135, CD6Cy179 and CD6CFL isoforms.


34

4. Discussion


35

The inhibitory role of CD6 has been assigned to its cytoplasmic tail [6]. To map

within CD6 cytoplasmic tail the region/motif responsible for its inhibitory role in T cell

activation, we have created E6.1 cells lines stably expressing CD6 isoforms of

variable tail lengths to perform activation assays.

We have used a specific clone of Jurkat cells, E6.1, since the expression of CD6

in these cells is minute and thus there is no interference of endogenous CD6 in our

experiments. CD6 expression in these cells belongs solely to our constructs.

My work consisted of making E6.1 Jurkat cell lines expressing each of the

different CD6 isoforms alone by lentiviral infection. This method was chosen among

other techniques of transfection due to its high efficiency and because it allows the

production of stable cell lines rather than transient ones. Yet, obtaining stable cells

lines was not that straightforward since we had to deal with different technical

problems. Lentiviral infection was indeed efficient, but as not all the cells were

infected, and in order to avoid two different populations, sorting was necessary at all

times. This proved to be laborious and time consuming since few cells could be

recovered after sorting and for most of the isoforms, cells needed a long time to

recover. In spite of all these drawbacks, cells were expressing the correct protein

isoforms, as confirmed by western blot analysis.

After sorting, CD6 expression levels were higher, as intended. Despite that, some

of the cell lines were losing CD6 expression over time, a fact that we cannot explain.

Frequent alterations on the levels of CD6 expression brought the need to constantly

evaluate cell lines for CD6 expression, before performing activation experiments.

Cells expressing CD6Cy5 presented two different populations with different CD6

expression levels, and overtime they ended up losing all CD6 expression at the

surface. We suggest that this might be due to the very small size of the cytoplasmic

tail of this isoform - five amino acids -, that might prevent the protein from being

properly anchored to the membrane.

Not all cells lines were expressing the CD3 receptor at good levels, and this

could interfere with activation of the cells, since we have used an anti-CD3 mAb for

activation. In fact, at some point some cells showed no CD3 expression at all. To

overcome this problem, all cells were selected and sorted based on both CD6-citrine

and CD3 expression at similar levels.


36

Upon triggering of the CD3 molecule, which is coupled to the TCR, a

considerable amount of calcium is immediately released into the cytoplasm of T

lymphocytes. As an early response in T cell activation, calcium has been studied

over the years. First studies concerning the inhibitory role of CD6 suggest that the

N-terminal region of its cytoplasmic tail played a critical role on calcium flux.

According to Kobarg et al. [89], CD6 isoforms lacking the region close to the

transmembrane domain showed an increase on calcium flux when compared with

the FL form of CD6 [89]. In human cells, upon CD3 triggering with mAbs, CD6 has

reduced calcium release as well as IL-2 production, a late indicator of T cell

responses known to lead T lymphocytes to proliferate. This study compared

intracellular calcium levels and IL-2 production in E6.1 Jurkat cells expressing

CD6FL and CD6Cy5 [6]. While the CD6FL was shown to attenuate early and late

responses, the CD6Cy5 isoform, featuring a very short cytoplasmic tail, was shown

to recover calcium levels and IL-2 production, thus attributing the inhibitory role to

the cytoplasmic tail.

Following the leads of the previous work from Oliveira et al., we performed

calcium assays on different CD6 mutants having different cytoplasmic tails. Due to

the frequent changes in the CD3, CD5 and CD6 expression levels over the time, we

were not able to perform calcium assays using all isoforms simultaneously.

As expected, isoforms with shorter cytoplasmic tails showed a higher increase on

calcium levels. Cells expressing CD6Cy5 and CD6Cy37 showed an increase similar

to CD6 negative cells. Concerning the CD6Cy5 isoform, results corroborate those

obtained previously by Oliveira et al. [6]. Yet, we remain unsure of their viability

since at the time of the experiment cells could have lost CD6 at the surface due to

its quite small cytoplasmic tail, and thus these cells behave as CD6 negative cells.

Worth to mention that previous studies, using CD6Cy5, were performed with cells

transiently expressing this isoform. We concluded that it is not possible to produce a

stable cell line expressing this isoform since the protein with such a small tail does

not anchor to the membrane for long periods of time.

Cells expressing CD6Cy70 also showed a pick of calcium release but the levels

were lower, meaning that these cells were less activated. On the other hand, cells

expressing CD6Cy179 and CD6 FL showed no variations on calcium flux upon CD3

stimulation, suggesting that the region between amino acids 70 and 179 of the

cytoplasmic tail is most likely the part containing the motif responsible for the CD6

inhibitory role.


37

We have compared calcium variations between all isoforms. The variation was

the highest for cells expressing CD6Cy5, which, as explained above, were probably

behaving as CD6 negative, being considered as a negative control, and results were

thus expected; levels of calcium release were then lower concerning CD6Cy37 and

CD6Cy70 isoforms, and almost null in cells expressing CD6Cy179 and CD6FL. As

mentioned before, these results suggest that the region responsible for the CD6

inhibitory role lies within middle region of the CD6 cytoplasmic tail. In this specific

region there are three tyrosine residues that might have a fundamental role in the

signaling through CD6. However, these experiments should be repeated since cells

expressing CD6Cy37 feature low levels of CD5, and this could interfere in the

inhibitory potential of the cells. When cells present a lower expression of CD5, CD6

potential of phosphorylating CD5 may suffer some changes. Thus, it might influence

our results and CD6 modulating activity [78]

Since we were interested in studying the whole response of CD6 in T cell

activation, we took advantage of a different activation assay concerning late

responses in T cells activation. Therefore we have looked into the IL-2 production

upon activation with phytohaemagglutinin (PHA).

As expected, resting cells presented, in general, lower IL-2 levels than activated

cells. Cells expressing CD6Cy179 isoform constitute the only exception since the IL-

2 levels on resting and activated cells are similar, suggesting that upon activation no

IL-2 variation was registered and that these cells were barely activated. Again, this

might occur due to the presence of the motif responsible for the inhibitory potential

upstream of this residue.

Since IL-2 levels of activated cells might be influenced by the basal levels of IL-2

obtained in resting cells, we found it more useful to measure the IL-2 variation

between resting and activated cells. A gradation of IL-2 levels was observed from

the shortest isoform CD6Cy5, followed by CD6Cy37, CD6Cy70 and CD6Cy135, and

ending with the lowest value, concerning the longest isoform CD6Cy179. The

CD6FL isoform produced, as expected, low levels of IL-2, corroborating with the fact

that CD6 in its full-length form is an inhibitor of T cell responses [6]. Cells expressing

CD6Cy5 always present the higher variation values, but we remain unsure about

data concerning the CD6Cy5 isoform, as explained before. Thereafter, we cannot

suggest that there was a significant decrease between CD6Cy5 and CD6Cy37.

However, it looks like the CD6Cy179 isoform presents the lowest IL-2 variation,

which, and corroborating the calcium results, may suggest that the critical motif


38

responsible for the inhibitory function of CD6 relies N-terminal of this region. Also,

except for the CD6FL isoform, it seems that the IL-2 variation is decreasing as the

cytoplasmic tail length increases.

From our results, it seems that the CD6Cy179 is the isoform per excellence

featuring no changes on both early and late activation assays and thereafter, it may

be considered as having the major critical role in the inhibitory potential of the CD6

cytoplasmic tail. Despite this, experiments should be repeated to confirm that results

were not influenced by lower CD5 expression levels.


39

5. Conclusion


40

We have evaluated early and late responses to activation of T cells expressing

different CD6 isoforms of different length cytoplasmic tails. According to our results,

the sequence between amino acids 70 and 179 of the cytoplasmic tail contain the

motif responsible for CD6 inhibitory potential. CD6Cy179 isoform inhibits T cell

activation the most, since no variation has been detected concerning early calcium

release and late IL-2 production upon activation. Moreover, it seems that the longer

the cytoplasmic tail, the higher the inhibitory potential of the CD6 molecule,

indicating that perhaps other motifs with a role in inhibition are present within the

cytoplasmic tail.

Although the CD6 cytoplasmic is devoid of intrinsic kinase activity, it contains

several motifs related to signal transduction, such as tyrosine residues. These

residues are phosphorylated upon activation that triggers the whole signaling

cascade translating in numerous events. In the future we aim to identify those exact

motifs and to understand how Src kinases, such as Lck and Fyn, and other proteins,

such as SLP-76 and Syntenin-1, might regulate CD6 function and further interfere

with CD6 negative modulation of T cell responses.


41

6. References


42

1. Shaw A. S., Dustin M. L.. “Making the T cell receptor go the distance: a topological

view of T cell activation”. Immunity 6, 361–369 (1997).

2. Grakoui A, Bromley SK, Sumen C, Davis MM, Shaw AS, Allen PM, Dustin ML. "The

immunological synapse: a molecular machine controlling T cell activation". Science 285

(5425): 221–227 (1999).

3. Medzhitov R. “Recognition of microorganisms and activation of the immune

response.” Nature.;449:819–826 (2007)

4. Pancer Z, Cooper MD. "The evolution of adaptive immunity". Annual Review of

Immunology 24 (1): 497–518 (2006).

5. Evans E. J., Hene L., Sparks L. M., Dong T., Retiere C., Fennelly J. A., Manso-

Sancho R., Powell J., Braud V. M., Rowland-Jones S. L., McMichael A. J., Davis S. J.

Immunity 19, 213–223. (2003).

6. Oliveira MI, Gonçalves CM, Pinto M, Fabre S, Santos AM, et al. “CD6 attenuates

early and late signaling events, setting thresholds for T-cell activation.” Eur J Immunol

(42) 195–205 (2012).

7. Thomas J. Kindt, Richard A. Goldsby, Barbara A. Osborne, Janis. “Kuby

Immunology.” W. H. Freeman, 5th edition, chapter 1 (2007)

8. van der Merwe PA, Dushek O “Mechanisms for T cell receptor triggering.” Nat Rev

Immunol 11: 47–55. (2011).

9. Janeway CA Jr, Travers P, Walport M, et al. Immunobiology: The Immune System in

Health and Disease. 5th edition. Glossary: Garland Science (2001).

10. Davis M.M., Bjorkman P.J. “T-cell antigen receptor genes and T-cell recognition.”

Nature. 334:395–402 (1988).

11. Guy CS, Vignali DA. “Organization of proximal signal initiation at the TCR:CD3

complex”. Immunol Rev.; 232:7–21 (2009).

12. Wucherpfennig, K. W., Gagnon, E., Call, M. J., Huseby, E. S. & Call, M. E.

“Structural biology of the T-cell receptor: insights into receptor assembly, ligand

recognition, and initiation of signaling.” Cold Spring Harbor perspectives in biology 2,

a005140 (2010).

13. Altin, J. G. & Sloan, E. K. “The role of CD45 and CD45-associated molecules in T

cell activation”. Immunology and cell biology 75, 430–45 (1997).

14. Holmes, N. “CD45: all is not yet crystal clear”. Immunology 117, 145–55 (2006).


43

15. Zamoyska, R. “Why is there so much CD45 on T cells?” Immunity 27, 421–3 (2007).

16. Grochowy, G., Hermiston, M. L., Kuhny, M., Weiss, A. & Huber, M. “Requirement for

CD45 in fine-tuning mast cell responses mediated by different ligand-receptor

systems”. Cellular signalling 21, 1277–86 (2009).

17. Bridgeman, J. S., Sewell, A. K., Miles, J. J., Price, D. a & Cole, D. K. “Structural and

biophysical determinants of αβ T-cell antigen recognition.” Immunology 135, 9–18

(2012).

18. Singer A, Adoro S, Park JH. “Lineage fate and intense debate: myths, models and

mechanisms of CD4− versus CD8-lineage choice”. Nat Rev Immunol.; 8:788–801

(2008).

19. Barber EK, Dasgupta JD, Schlossman SF, et al. “The CD4 and CD8 antigens are

coupled to a protein-tyrosine kinase (p56lck) that phosphorylates the CD3 complex.”

Proc Natl Acad Sci U S A. 86:3277–3281 (1989).

20. Riha, P. & Rudd, C. E. CD28 co-signaling in the adaptive immune response.

Self/nonself 1, 231–240 (2010).

21. Egen, J. G. & Allison, J. P. “Cytotoxic T lymphocyte antigen-4 accumulation in the

immunological synapse is regulated by TCR signal strength”. Immunity 16, 23–35

(2002).

22. Chambers, C. “The expanding world of co-stimulation: the two-signal model

revisited”. Trends in immunology 22, 217–23 (2001).

23. Saito, T. & Yokosuka, T. “Immunological synapse and microclusters: the site for

recognition and activation of T cells”. Current opinion in immunology 18, 305–13

(2006).

24. Davis S. J., van der Merwe P. A. “Lck and the nature of the T cell receptor trigger.”

Trends Immunol. 32, 1–5 (2011).

25. Monks CR, Freiberg BA, Kupfer H, Sciaky N, Kupfer A “Three-dimensional

segregation of supramolecular activation clusters in T cells”. Nature 395: 82–86 (1998).

26. Bromley SK, Burack WR, Johnson KG, Somersalo K, Sims TN, et al. “The

immunological synapse”. Annu Rev Immunol 19: 375–396 (2001).

27. Alarcón, B., Mestre, D. & Martínez-Martín, N. “The immunological synapse: a cause

or consequence of T-cell receptor triggering?” Immunology 133, 420–5 (2011).

28. van der Merwe, P. A. & Davis, S. J. Immunology. “The immunological synapse - a

multitasking system”. Science (New York, N.Y.) 295, 1479–80 (2002).


44

29. González, P. a, Carreño, L. J., Figueroa, C. a & Kalergis, A. M. “Modulation of

immunological synapse by membrane-bound and soluble ligands”. Cytokine & growth

factor reviews 18, 19–31 (2007).

30.Varma R, Campi G, Yokosuka T, Saito T, Dustin ML. “T cell receptor-proximal signals

are sustained in peripheral microclusters and terminated in the central supramolecular

activation cluster”. Immunity;25:117–127 (2006).

31. Cochran, J. R., Aivazian, D., Cameron, T. O. & Stern, L. J. “Receptor clustering and

transmembrane signaling in T cells”. Trends in biochemical sciences 26, 304–10

(2001).

32. Dustin, M. L. & Chan, a C. “Signaling takes shape in the immune system”. Cell 103,

283–94 (2000).

33. Huang, J., Meyer, C. & Zhu, C. “T cell antigen recognition at the cell membrane”.

Molecular immunology 52, 155–64 (2012).

34. Choudhuri, K.; Kearney, A.; Bakker, T.R.; van der Merwe, P.A. “Immunology: How

do T cells recognize antigen?” Current biology: CB 15, R379–82 (2005).

35. Azevedo, Carlos, Livro de Biologia Celular: Chapter Alexandre M.Carmo. 4th

edittion LIDEL (2005)

36. Vilà JM, Padilla O, Arman M, Gimferrer I, Lozano F. “The scavenger receptor

cysteine-rich superfamily (SRCR-SF) Structure and function of group B members”.

Inmunologia 19:105–121

37. Martínez, V. G., Moestrup, S. K., Holmskov, U., Mollenhauer, J. & Lozano, F. “The

conserved scavenger receptor cysteine-rich superfamily in therapy and diagnosis”.

Pharmacological reviews 63, 967–1000 (2011).

38. Sarrias MR, Gronlund J, Padilla O, Madsen J, Holmskov U, Lozano F. “The

Scavenger Receptor Cysteine-Rich (SRCR) domain: an ancient and highly conserved

protein module of the innate immune system”. Crit Rev Immunol.24(1):1–37 (2004).

39. Sarrias MR, Farnós M, Mota R, Sánchez-Barbero F, Ibáñez A, et al. “CD6 binds to

pathogen-associated molecular patterns and protects from LPS-induced septic shock”.

Proc Natl Acad Sci USA 104: 11724–11729 (2007).

40. Vera, J.; Fenutría, R.; Canadas, O.; Figueras, M.; Mota, R.; Sarrias, M.R.; Williams,

D.L.; Casals, C.; Yelamos, J.; Lozano, F. “The CD5 ectodomain interacts with

conserved fungal cell wall components and protects from zymosan-induced septic

shock-like syndrome”. Proceedings of the National Academy of Sciences of the United


45

States of America 106, 1506–11 (2009).

41. Jones N. H., Clabby M. L., Dialynas D. P., Huang H. J., Herzenberg L. A.,

Strominger J. L. “Isolation of complementary DNA clones encoding the human

lymphocyte glycoprotein T1/Leu-1” Nature 323, 346–349. (1986).

42. Osorio, L. M., Garcia, C. A., Jondal, M. and Chow, S. C., “The anti-CD6 mAb, IOR-

T1, defined a new epitope on the human CD6 molecule that induces greater

responsiveness in T cell receptor/CD3-mediated T cell proliferation.” Cell.

Immunol.154: 123–133 (1994)

43. Casali P, Burastero SE, Nakamura M, Inghirami G, Notkins AL. Human lymphocytes

making rheumatoid factor and antibody to ssDNA belong to Leu-1+ B-cell subset.

Science. 236:77–81 (1997).

44. Carmo, A. M., Castro, M. A. A. and Arosa, F. A. “CD2 and CD3 associate

independently with CD5 and differentially regulate signaling through CD5 in Jurkat T

cells.” J. Immunol 163: 4238–4245 (1999).

45. Dennehy K. M., Ferris W. F., Veenstra H., Zuckerman L. A., Killeen N., Beyers A. D

“Determination of the tyrosine phosphorylation sites in the T cell transmembrane

glycoprotein CD5.” Int. Immunol. 13, 149–156. (2001).

46. Raab M., Yamamoto M., Rudd C. E. “The T-cell antigen CD5 acts as a receptor and

substrate for the protein-tyrosine kinase p56lck”.Mol. Cell. Biol. 14, 2862–2870 (1994).

47. Perez-Villar J. J., Whitney G. S., Bowen M. A., Hewgill D. H., Aruffo A. A., Kanner S.

B. “CD5 Negatively Regulates the T-Cell Antigen Receptor Signal Transduction

Pathway: Involvement of SH2-Containing Phosphotyrosine Phosphatase SHP-1” Mol.

Cell. Biol. 19, 2903–2912. (1999).

48. Van de Velde H., von Hoegen I., Luo W., Parnes J. R., Thielemans K. “The B-cell

surface protein CD72/Lyb-2 is the ligand for CD5.” Nature 351, 662–665 (1991).

49. Castro, M. A. A., Oliveira, M. I., Nunes, R. J., Fabre, S., Barbosa, R., Peixoto, A.,

Brown, M. H. et al. “Extracellular isoforms of CD6 generated by alternative splicing

regulate targeting of CD6 to the immunological synapse”. J. Immunol 178: 4351–4361

(2007).

50. Arman, M.; Calvo, J.; Trojanowska, M.E.; Cockerill, P.N.; Santana, M.; López-

Cabrera, M.; Vives, J.; Lozano, F. “Transcriptional regulation of human CD5: important

role of Ets transcription factors in CD5 expression in T cells”. Journal of immunology

(Baltimore, Md. : 1950) 172, 7519–29 (2004).


46

51. Dennehy K. M., Broszeit R., Garnett D., Durrheim G. A., Spruyt L. L., Beyers A. D.

“Thymocyte activation induces the association of phosphatidylinositol 3-kinase and

pp120 with CD5.” Eur. J. Immunol. 27, 679–686. (1997).

52. Dennehy, K. M., Broszeit, R., Ferris, W. F. & Beyers, a D. “Thymocyte activation

induces the association of the proto-oncoprotein c-cbl and ras GTPase-activating

protein with CD5”. European journal of immunology 28, 1617–25 (1998).

53. Bamberger, M., Santos, A. M., Gonçalves, C. M., Oliveira, M. I., James, J. R.,

Moreira, A., Lozano, F. et al. “A new pathway of CD5 glycoprotein-mediated T cell

inhibition dependent on inhibitory phosphorylation of Fyn kinase. J. Biol. Chem. 286:

30324–303368 (2011).

54. Gimferrer, I., Calvo, M., Mittelbrunn, M., Farnos, M., Sarrias, M. R., Enrich, C.,

Vives, J. et al., “Relevance of CD6-mediated interactions in T cell activation and

proliferation.” J. Immunol. 173: 2262–2270 (2004).

55. June C. H., Rabinovitch P. S., Ledbetter J. A. “CD5 antibodies increase intracellular

ionized calcium concentration in T cells.” J. Immunol. 138, 2782–2792. (1987).

56. Tarakhovsky A., Kanner S. B., Hombach J., Ledbetter J. A., Müller W., Killeen N.,

Rajewsky K. “A role for CD5 in TCR-mediated signal transduction and thymocyte

selection.” Science 269, 535\u2013537. (1995).

57. Azzam H. S., Grinberg A., Lui K., Shen H., Shores E. W., Love P. E. “CD5

expression is developmentally regulated by T cell receptor (TCR) signals and TCR

avidity.” J. Exp. Med. 188, 2301–2311 (1998).

58. Kamoun M, Kadin ME, Martin PJ, Nettleton J, Hansen JA. “A novel human T cell

antigen preferentially expressed on mature T cells and shared by both well and poorly

differentiated B cell leukemias and lymphomas”. J Immunol. Sep;127(3):987–991

(1981).

59. Aruffo, A., Bowen, M. A., Patel, D. D., Haynes, B. F., Starling, G. C., Gebe, J. A. and

Bajorath, J., “CD6-ligand interactions: a paradigm for SRCR domain function?”

Immunol. Today 18: 498–504. (1997).

60. Osorio, L. M., De Santiago, a, Aguilar-Santelises, M., Mellstedt, H. & Jondal, M.

“CD6 ligation modulates the Bcl-2/Bax ratio and protects chronic lymphocytic leukemia

B cells from apoptosis induced by anti-IgM”. Blood 89, 2833–41 (1997).

61. Singer NG, Fox DA, Haqqi TM, Beretta L, Endres JS, et al. “CD6: expression during

development, apoptosis and selection of human and mouse thymocytes”. Int Immunol.

14: 585–597 (2002).


47

62. Gonçalves C. M., Castro M. A., Henriques T., Oliveira M. I., Pinheiro H. C., Oliveira

C., Sreenu V. B., Evans E. J., Davis S. J., Moreira A., Carmo A. M. “Molecular cloning

and analysis of SSc5D, a new member of the scavenger receptor cysteine-rich

superfamily”. Molecular immunology 46, 2585–96 (2009).

63. Aruffo, A., Melnick, M. B., Linsley, P. S. and Seed, B., “The lymphocyte glycoprotein

CD6 contains a repeated domain structure characteristic of a new family of cell surface

and secreted proteins.” J. Exp. Med. 174 :949–952 (1991).

64. Robinson, W. H., Neuman de Vegvar, H. E., Prohaska, S. S., Rhee, J. W. & Parnes,

J. R. Human “CD6 possesses a large, alternatively spliced cytoplasmic domain”.

European journal of immunology 25, 2765–9 (1995).

65. Whitney GS, Starling GC, Bowen MA, Modrell B, Siadak AW, et al. “The membrane-

proximal scavenger receptor cysteine-rich domain of CD6 contains the activated

leukocyte cell adhesion molecule binding site.” J Biol Chem.270:18187–18190. (1995).

66. Swack JA, Mier JW, Romain PL, Hull SR, Rudd CE. “Biosynthesis and post-

translational modification of CD6, a T cell signal-transducing molecule”. J Biol Chem

Apr 15;266(11):7137–7143 (1991).

67. Bowen MA, Bajorath J, D’Egidio M, et al. “Characterization of mouse ALCAM

(CD166): the CD6-binding domain is conserved in different homologs and mediates

cross-species binding”. European journal of immunology 27, 1469–78 (1997).

68. Martinez2011 Wee, S., Schieven, G. L., Kirihara, J. M., Tsu, T. T., Ledbetter, J. A.;

Aruffo, A., “Tyrosine phosphorylation of CD6 by stimulation of CD3: augmentation by

the CD4 and CD2 coreceptors.” J. Exp. Med. 177 :219–223 (1993).

69. Bowen, M. A., Patel, D. D., Li, X., Modrell, B., Malacko, A. R., Wang, W. C.,

Marquardt, H. et al. “Cloning, mapping, and characterization of activated leukocyte-cell

adhesion molecule (ALCAM), a CD6 ligand.” J. Exp. Med. 181: 2213–2220 (1995).

70. Gimferrer, I., Farnós, M., Calvo, M., Mittelbrunn, M., Enrich, C., Sanchez-Madrid, F.,

Vives, J. and Lozano, F “The accessory molecules CD5 and CD6 associate on the

membrane of lymphoid T cells”. The Journal of biological chemistry 278, 8564–71

(2003).

71. Padilla O, Calvo J, Vilà JM, et al. “Genomic organization of the human CD5 gene”.

Immunogenetics. 51(12):993–1001. (2000).

72. Arman M, Aguilera-Montilla N, Mas V, Puig-Kröger A, Pignatelli M, Guigó R, Corbí


48

AL, Lozano F. “The human CD6 gene is transcriptionally regulated by RUNX and Ets

transcription factors in T cells”. Molecular immunology 46, 2226–35 (2009).

73. Alonso-Ramirez, R. Loisel S, Buors C, Pers JO, Montero E, Youinou P,

Renaudineau Y. “Rationale for Targeting CD6 as a Treatment for Autoimmune

Diseases”. Arthritis 2010, 130646 (2010).

74. Tung, J. W., Kunnavatana, S. S. & Herzenberg, L. A. “The regulation of CD5

expression in murine T cells”. BMC molecular biology 2, 5 (2001).

75. Bott, C. M., Doshi, J. B., Morimoto, C., Romain, P. L. & Fox, D. A. “Activation of

human T cells through CD6: functional effects of a novel anti-CD6 monoclonal antibody

and definition of four epitopes of the CD6 glycoprotein”. International immunology 5,

783–92 (1993).

76. Osorio, L. M., Rottenberg, M., Jondal, M. & Chow, S. C. “Simultaneous cross-linking

of CD6 and CD28 induces cell proliferation in resting T cells”. Immunology 93, 358–65

(1998).

77. Ibáñez A, Sarrias MR, Farnós M, Gimferrer I, Serra-Pagès C, Vives J, Lozano F.

“Mitogen-activated protein kinase pathway activation by the CD6 lymphocyte surface

receptor”. Journal of immunology 177, 1152–9 (2006).

78. Castro, M. A. A., Nunes, R. J., Oliveira, M. I., Tavares, P. A., Simões, C.,Parnes, J.

R., Moreira, A. and Carmo, A.M. “OX52 is the rat homologue of CD6: evidence for an

effector function in the regulation of CD5 phosphorylation”. Journal of leukocyte biology

73, 183–90 (2003).

79. Hassan, N. J., Barclay, a N. & Brown, M. H. “Optimal T cell activation requires the

engagement of CD6 and CD166”. European journal of immunology 34, 930–40 (2004)

80. Bowen, M. A. & Aruffo, A. A. “Cell Surface Receptors and Their Ligands: In Vitro

Analysis of CD6-CD166 Interactions”. 428, 420–428 (2000).

81. Bowen MA, Whitney GS, Neubauer M, Starling GC, Palmer D, Zhang J, Nowak NJ,

Shows TB, Aruffo A. “Structure and chromosomal location of the human CD6 gene:

detection of five human CD6 isoforms.” Journal of Immunology. 158(3):1149–1156

(1997).

82 Patel, D.; Wee, S-F; Whichard, L.P.; Bowen, M.A.; Pesando, J.M.; Aruffo, A.;

Haynes, B.F. “Identification and characterization of a 100-kD ligand for CD6 on human

thymic epithelial cells”. Journal of Experimental Medicine. 181(4):1563–1568. (1995).

83. Bowen, M.A. & Aruffo, A. “Adhesion molecules, their receptors, and their regulation:


49

analysis of CD6-activated leukocyte cell adhesion molecule (ALCAM/CD166)

interactions”. Transplantation proceedings 31, 795–6 (1999).

84. Nair, P.; Melarkode, R.; Rajkumar, D.; Montero, E. “CD6 synergistic co-stimulation

promoting proinflammatory response is modulated without interfering with the activated

leucocyte cell adhesion molecule interaction”. Clinical and experimental immunology

162, 116–30 (2010).

85. Zimmerman A.W.; Joosten B.; Torensma R.; Parnes J.R.; van Leeuwen F.N.; Figdor

C.G.. “Long-term engagement of CD6 and ALCAM is essential for T-cell proliferation

induced by dendritic cells”. Blood 107, 3212–20 (2006).

86. Hassan N.J., Simmonds S.J., Clarkson N.G., Hanrahan S., Puklavec MJ, Bomb M,

Barclay AN, Brown M.H. “CD6 regulates T-cell responses through activation-dependent

recruitment of the positive regulator SLP-76.” Molecular and cellular biology 26, 6727–

38 (2006).

87. Starling G.C.; Whitney G.S.; Siadak A.W.; Llewellyn M.B.; Bowen M.A.; Farr A.G.;

Aruffo A.A. “Characterization of mouse CD6 with novel monoclonal antibodies which

enhance the allogeneic mixed leukocyte reaction”. European journal of immunology 26,

738–46 (1995).

88. Gangemi, R.M.; Swack, J.A.; Gaviria, D.M.; Romain, P.L. “Anti-t12, an anti-cd6

monoclonal antibody, can activate human T lymphocytes”. J. Immunology 143: 2439–

2447 (1989).

89. Kobarg, J; Whitney, G.S.; Palmer, D.; Aruffo, A.; Bowen, M.A. Analysis of the

tyrosine phosphorylation and calcium fluxing of human CD6 isoforms with different

cytoplasmatic domains. European Journal of Immunology. 27(11):2971–2980 (1997).

90. Pawlik, A.; Ostanek, L.; Brzosko, I.; Brzosko, M.; Masiuk, M. et al. The expansion of

CD4+CD28- T cells in patients with rheumatoid arthritis. Arthritis research & therapy 5,

R210–3 (2003).

91. Levesque, M.C.; Heinly, C.S.; Whichard, L.P.; Patel, D.D. “Cytokine-regulated

expression of activated leukocyte cell adhesion molecule (CD166) on monocyte-

lineage cells and in rheumatoid arthritis synovium”. Arthritis and Rheumatism.

1998;41(12):2221–2229.

92. Ramos-Casals M, Cervera Segura R. Sjögren syndrome and hepatitis C virus: casual or etiopathogenic relationship. Rev Clin Esp 2001;201:515-7 (2001).

93. Kung PC, Goldstein G, Reinherz EL, Schlossman SF. Monoclonal antibodies

defining distinctive human T cell surface antigens. Science 206: 347-9 (1979)


50

94. Clark SJ, Law DA, Paterson DJ, Puklavec M, Williams AF. Activation of rat T

lymphocytes by anti-CD2 monoclonal antibodies. J Exp Med. 167:1861–1872 (1998)

mapping the inhibitory determinants within of the · web viewmapping the inhibitory...

Documents