mass spectrometric analysis of dna and rna: alternatives

1

Mass Spectrometric Analysis of DNA and RNA: Alternatives to Traditional

Sequencing

Mark Marzinke, PhD

Johns Hopkins University

School of Medicine

• Utility of DNA in the Clinical Lab– Cancer (heterogeneous)

– Pathogen Identification

– Personalized Medicine (PGx; germline)

• Mass Spectrometric Platforms– Ibis

– Sequenom

– High Resolution Accurate Mass

• Considerations– MALDI v. ESI

• New Frontier

Outline

drains bile from liver to intestine with storage in gallbladder

*

*

**

Mohseni and Park. J Clin Invest. 2010; 120(8):2655–2658

• Signaling pathway mutations are observed in various cancers

– Lung adenocarcinoma

– Colorectal carcinoma

– Breast carcinoma

• Mutations are seen with varying frequencies

• Heterogeneous: cancer cells may have the mutation, normal cells may not

• Mutation detection can direct/predict drug therapeutic responses

– EGFR mAbs (panitumumab, cetuximab)

– TKIs (erlotinib, gefitinib)

– Herceptin (mAb targeting HER2/neu)

– Downstream Inhibitors (everolimus)

Molecular Indicators of Cancer

2

Role of Molecular Techniques in Predicting Treatment Responses

Molecular Testing

Targeted Therapy

Oncology Patient Surgical Resection Histopathology

Role of Molecular Techniques in Predicting Treatment Responses

Disease Control Rate Progression-Free Survival (months) Overall Survival (months)

ReferenceMutant Wild Type

No. % No. % MutantWild Type P Mutant

Wild Type P

15 of 17 88 33 of 73

45 21.7 1.8 < .001 30.5 6.6 .001 Han

9 of 15 60 24 of 50

48 9.9 2.6 .02 20.8 8.4 .09 Cappuzzo

29 of 33 88 8 of 21 38 7.6 1.7 .011 14.7 4.7 .046 Chou

10 of 10 100 40 of 73

55 12.3 3.6 .002 13 4.9 .02 Cortes-Funes

12 of 12 100 9 of 18 50 10.0 3.0 .0454 Not reached 7 .0022 Zhang

36 of 39 92 8 of 27 29 12.6 1.7 < .0001 20.4 6.9 .0001 Takano

EGFR Mutations As Predictors of Disease Control and Survival in TKI-Treated NSCLC

• Linkage between EGFR mutations and tyrosine kinase inhibitor treatment – Gefitinib and erlotinib-responsiveness in patients with EGFR

mutations (L858R, exon19del) in non-small cell lung carcinoma

Sequist et al. J Clin Oncol. 2007; 25(5):587–595

Methicillin-resistant Staphylococcus aureus (MRSA)

• Bacterial pathogen that is resistant to β-lactam antibiotics and cephalosporins

• Hospital- and community-associated MRSA strains

– Strains have different genetic lineages

– Common strain in US (CA-MRSA300)

• Need to identify rapidly because infection can cause:

– Sepsis

– Toxic shock syndrome

– Necrotizing pneumonia

• Lab Diagnosis of MRSA

– Microbiology cultures (~48 h)

– Antibiotic Sensitivity

– Mass Spectrometry

– Molecular Analysis/PCR www.google.com

3

Pharmacogenetics (PGx) Testing: Impact and Targets

Drug Response

Dose Management

Clinical Diagnosis

Drug Interactions

Adherence

Genetic Variation

• Identification of DNA variants that correlate with differential phenotypic expression

– Gene insertions/deletions

– Duplications

– Single nucleotide polymorphisms (SNPs)

– Haplotypes

• Genetic variation can influence Pharmacokinetics (body effect on drug) and Pharmacodynamics (drug effect on body)

– Absorption

– Transport

– Metabolism

– Elimination


• Identification of DNA variants that correlate with differential phenotypic expression

– Gene insertions/deletions

– Duplications

– Single nucleotide polymorphisms (SNPs)

– Haplotypes

• Genetic variation can influence Pharmacokinetics (body effect on drug) and Pharmacodynamics (drug effect on body)

– Absorption

– Transport

– Metabolism

– Elimination


PGx Targets Used Clinically

Gene Target Drugs

TPMT Azathioprine

UGT1A1 Irinotecan

CYPs (2D6, 2C9, 2C19)

SSRIs,analgesics,

antiarryhtmics, etc.

VKORC1CYP2C9

Warfarin

4

Genotype-Phenotype Relationship: Drug Metabolism

Meyer. Nat Rev Genetics. 2004; 5:669‐676

• Phenotypic assessment of cytochrome P450 (CYP2D6) ability

– Ratio of urinary debrisoquine (parent) to 4-OH-debrisoquine (metabolite) as an indicator of CYP2D6 activity

• CYP polymorphism frequency is influenced by ethnicity and gender

– CYP2D6 is non-functional in 7% of Caucasians (Meyer, Lancet. 2000; 356)

– CYP2D6 increased activity in ~ 30% East African populations

• CYPs are involved in the metabolism of >75% of drugs

– Antidepressants (62% efficacy; Spear et al.,

Trends Mol Med. 2001; 7: 201-206)

– Schizophrenia (60% efficacy)

– Antiarrhythmics (60% efficacy)

– Analgesics (80% efficacy)

Genotype-Phenotype Relationship: Drug Metabolism

Meyer. Nat Rev Genetics. 2004; 5:669‐676

• Phenotypic assessment of cytochrome P450 (CYP2D6) ability

– Ratio of urinary debrisoquine (parent) to 4-OH-debrisoquine (metabolite) as an indicator of CYP2D6 activity

• CYP polymorphism frequency is influenced by ethnicity and gender

– CYP2D6 is non-functional in 7% of Caucasians (Meyer, Lancet. 2000; 356)

– CYP2D6 increased activity in ~ 30% East African populations

• CYPs are involved in the metabolism of >75% of drugs

– Antidepressants (62% efficacy; Spear et al.,

Trends Mol Med. 2001; 7: 201-206)

– Schizophrenia (60% efficacy)

– Antiarrhythmics (60% efficacy)

– Analgesics (80% efficacy)

Phenotype-Genotype Relationship: A Real World Application

CYP2D6 Characterized Polymorphisms

Allele NT MutationFunction/Activity

Metabolizer

*1 WT normal Extensive

*2A1584 C>G2850 C>T

normal Extensive

*2 2850 C>T normal Extensive

*3 2549 A>del non-functional Poor

*41846 G>A100 C>T

non-functional Poor

*5 Gene Deletion non-functional Poor

*6 1707 T>del non-functional Poor

*7 2935 A>C non-functional Poor

*8 1758 G>T non-functional Poor

*9 2613-2615 del AAG decreased Intermediate

*10 100 C>T decreased Intermediate

*12 124 G>T non-functional Poor

*14 1758 G>A non-functional Poor

*172580 C>T 1023 C>T

decreased Intermediate

*412850 C>T2988 G>A

decreased Intermediate

Jordan Nature Reviews Cancer 2007; 7, 46–53

• Tamoxifen is an Estrogen Receptor (ER) antagonist to suppress breast cancer cell proliferation

– CYP2D6 mediates the hepatic biotransformation of tamoxifen to more potent metabolites (direct: 4OH-tamoxifen; indirect: endoxifene; Desta et al., J Pharmacol Exp Ther 2004;310:1062–75).

5

Pharmacogenetic (PGx) Screening: Molecular Approaches

LuminexTM GeneChip Array Sanger Sequencing

qPCR Pyrosequencing

Pharmacogenetic (PGx) Screening: Molecular Approaches

LuminexTM GeneChip Array Sanger Sequencing

qPCR Pyrosequencing

• Caveats of molecular mutation approaches– Sensitivity

• Sanger sequencing can discriminate mutations with a sensitivity of ~25%

• Pyrosequencing has a limit of discrimination of ~ 10%

– Accuracy • Compressions of GC-rich DNA regions

• Detection of homopolymeric DNA regions

• Fluorophore interference adjacent to the priming site

– Measurement• Indirect; probes/fluorescent labels; no assessment of the amplicon

– Speed• Gel-based electrophoretic separation is time-consuming (hours)

• qPCR (PCR + detection: ~ 1 hour)

• Singe nucleotide extension (ie. Pyrosequencing; seconds)

– Multiplexing Capabilities (Platform-specific)• Sanger sequencing: no multiplexing

• qPCR: 4-6/reaction

• Bead-based systems: 50-100/reaction

Molecular Mutation Detection: Areas for Improvement?

6

• Benefits of mass spectrometry– Sensitivity (platform, amplicon-specific)

• Discrimination between heterogeneous alleles: 1-10% (Arcila et al., J. Mol. Diagn. 2011; 13 (1): 64-73; Fan et al., Clin. Chem. Lab. Med. 2008; 46 (3): 299-305)

– Accuracy • Discrete masses are associated with the four base nucleotides (A,C,G,T)

• Smallest difference between nucleotides is 9 Da (adenosine/thymidine polymorphism)

– Measurement• Direct measurement of the amplicon

– Speed• Following amplification, ionization and detection can occur within seconds

– Multiplexing Capabilities (Platform-specific)• Established multiplexed capabilities for detection of small molecules (i.e.. pain

management panels, drug screens)

Mass Spectrometric Mutation Detection: Improvements on Existing Technology

• Up-front PCR amplification

• Ibis T5000 (pathogen identification)

• Sequenom

• High resolution accurate mass instrumentation

– MALDI v. ESI

– Considerations

– The New Frontier?

Mass Spectrometric Mutation Detection

Mass Spectrometry + DNA: 13,319 PubMed articles (Lawson et al., 1971)

Mass Spectrometry + polymorphisms: 1,360 PubMed articles (Theret et al., 1987)

DNA nucleotide structure

www.adtbio.comwww.pubchem.ncbi.nlm.nih.gov

DNA Base Molecular Weight

Base MW (Da)

deoxyadenosinephosphate

313.209

deoxyguanosinephosphate

329.208

Deoxycytidinephosphate

289.184

Deoxythymidinephosphate

304.196

Deoxycytidine phosphate

7

DNA Allelic Identification: It Still Starts with PCR

• Denaturation: disruption on H bonding between complementary bases and production of ssDNA

• Annealing: Temperature-specific annealing of DNA-specific primers to ssDNA template (formation of stable DNA-DNA H bonds)

• Extension: DNA polymerase synthesizes a new complementary strand (requires polymerase and dNTPs)

http://www.kirbyresearch.com/images/etc/textbook/mae76.jpg

The Ibis T5000 Biosensor: Global Pathogenic Identification

• Global nucleic acid extraction from a biological specimen (ie. Blood, sputum)• PCR amplification using broad-range primers • Online desalting of PCR mixtures (which contain Mg2+ and EDTA)• Electrospray ionization of all amplicons• Identification of amplicon (i.e. pathogen) through database matching

Ecker et al. JALA. 2006; 341‐351

The Ibis T5000 Biosensor: Global Pathogenic Identification


8

The Ibis T5000 Biosensor: Exploitation of Mass Accuracy

Ecker et al. Nature Reviews Microbiol. 2008; 6: 553‐558

The Ibis T5000 Biosensor: Exploitation of Mass Accuracy


• Mass accuracy limits the base composition possibilities of each DNA strand

• Exploitation of complementarity between strands to further limit possibilities for identification

The Ibis T5000 Biosensor: Limitations

• Lack of detection of amplicons with compensating SNPs (CT and TC in the same amplicon)

• Sensitivity– Baseline noise of mass spectrometric analyzer may prevent identification of low

abundant pathogens/mutations

• Limited PCR amplicon size– Mass measurement deviations is proportional to analyte mass – Increase in spectral patterns multiple charge states– Larger the mass, the increased frequency for misclassifications

• Large-scale multiplexing – 1-2 PCR reactions/sample well

• Database requirement– Amplicon/pathogen identification is only as good as your library

• Translation to the Clinical Lab– Research Use Only

9

Sequenom: MALDI-TOF based identification of allelic mutations

Gabriel et al., Current Protocols in Human Genetics. 2009

Sequenom: The MALDI-TOF Principle

Ed. Clarke, Contemporary Practice in Clinical Chemistry, 2nd

Edition; AACC Press

Sequenom: Detection Schema

Fumagali et al. BMC Cancer. 2010; 10 (1)

10

Sequenom: EGFR L858R SNP Analysis

Brevet et al. J Mol Diagn. 2009; 12 (2): 169‐176

• Identified from FFPE lung tissue– Mutation positive via mutation-

specific IHC

– Negative via PCR fragment analysis

Sequenom: Limit of Discrimination (Sensitivity)

Arcila et al. J Mol Diagn. 2011; 13 (1): 64‐73

• KRAS G37T sensitivity studies

• Can identify a mutation at dilutions as low as 2.5%

• Starting material: 20 ngDNA isolated from FFPE colorectal tissue

• Analyzed using mutation-specific primers (single nucleotide extension)

Sequenom Further Applications: MassARRAY

www.sequenom.com

11

Sequenom Further Applications: MassARRAY

Ed: J.B. Rampal. Method Mol Biol. 2001; 170: 103‐116

• Somatic Mutation Analysis

• SNP Genotyping

• Molecular Analysis

• DNA Modification Analysis (Methylation)

Sequenom: Limitations

• Sensitivity– Baseline noise of mass spectrometric analyzer may prevent identification of low

abundant pathogens/mutations

• Specificity– Presence of adducts can cause mass shift overlaps with SNP mutations– Increase in spectral patterns multiple charge states– Larger the mass, the increased frequency for misclassifications

• Approach– Single base pair extension – Prior knowledge of mutation at onset

• Multiplexing – Increased mass signals– Trade-off between throughput and sensitivity

• Translation to the Clinical Lab– Research Use Only

High-Resolution Mass Accurate Identification of DNA Mutations

www.thermoscientific.com

• Ions are detected via mass-to charge-specific oscillations around two electrodes within an electric field

• Can take PCR products and run on mass-spec (following desalting)

12

LTQ-Orbitrap Analysis of PCR products

Manduzio et al. Rap. CommMass Spec. 2010; 10: 3501‐3509

Orbitrap Detection of a 20-mer primer

z MI: freeDNA

‐1 6031.020275

‐2 3015.510138

‐3 2010.340092

‐4 1507.755069

‐5 1206.204055

‐6 1005.170046

• PIK3Ca Forward Primer: ACTTTAGTGACTCGTCCTCA

• Identification of oligonucleotide primers at -4 and -5 charge states

High Resolution Mass Spectrometry: Limitations

• Sensitivity– No consistent data re: limit of discrimination (~5-10%?)

• Specificity– Presence of adducts can cause mass shift overlaps with SNP mutations

– Increase in spectral patterns multiple charge states

• Approach– PCR product desalting is a requirement

• Reversed phase, ion pairing HPLC shown success (Manduzio et al., Anal Biochem2010; 398: 272-278)

• Interpretation– Not software-directed; need to calculate monoisotopic masses for

amplicons/oligonucleotides of interest

13

Ionization Source: MALDI v. ESI

Hail et al. Am Biotech Lab. 2004; 22: 12‐14

• Sensitivity (Hop and Bakhtiar, Biospectroscopy. 1997; 3: 259-280)– MALDI-TOF: 100 fmol– ESI: 250 fmol

• Interferences– Presence of salts, buffers additives are an issue for ESI, less so for MALDI

• Amplicon size– ESI offers increased accuracy at lower and higher nucleotide ranges (<20 bases,

>50 bases)

Mass Spectrometry and DNA: The New Frontier?

• Mass spectrometry methods are already used clinically– Immunosuppressants

– Vitamin D/hormones

• Molecular Testing utilizes genetic/PCR-based approaches– KRAS/BRAF/EGFR/Bcr-Abl

– Issue: Discrimination thresholds, turn around time

• Can mass spectrometry bridge this gap?– Technology is there (MALDI-TOF/ ESI/HRAM)

– Can we translate the technology/interpretations for clinical use this is the new frontier

Questions?

[email protected]

mass spectrometric analysis of dna and rna: alternatives

Documents