50

CHAPTER – 3

MATERIALS AND METHODS

The details of materials and methods have been carried out under the following

headings:

3.1 Isolation and establishment of microalgae culture under optimum

laboratory condition

3.1.1 Field survey and collection of microalgae samples

The seven sister states of North Eastern Region of India, more particularly Assam is

very rich in biodiversity of freshwater microalgae. For the present study different

locations representing entire Kamrup district of Assam were selected for collection

of microalgae samples. Kamrup district has an area of 4345 square kilometers,

average rainfall of 1717.7 mm and an average humidity of 75%

(http://www.assaminfo.com). Microalgae samples were collected from Jalukbari,

North Guwahati, Sonapur and Chandrapur area of Kamrup district, Assam [Plate-1].

Aquatic sites like ponds, beels, rivers, wet lands, drainage systems, waste water

from factories, industries etc were randomly selected and algal samples were

collected [Plate-2]. In nature microalgae exist in mix forms, as there are number of

aquatic species of them grow together. So to have the desired and pure form of the

microalgae, there are several steps involved in this process. All microalgae do not

show same type of growth in nature, some exist in dominant forms than others, so it

is critical and need intense effort to culture all the collected samples and separate

them from each other. The pH of each aquatic systems were recorded from where

51

algal samples were collected and clean and sterile bottles were used to collect algae

samples so as to avoid any contamination.

3.1.2 Isolation of microalgae strains and pure culture

Collected sample were taken to the laboratory and isolation procedure was initiated

within 24 hours of sample collection because time is a crucial factor for microalgae

isolation procedure, as a few species are unable to grow in presence of some

dominating species and tend to disappear with time (Kaur 2011). The water samples

were gently filtered to remove unwanted aquatic plant species or other filamentous

macroalgae. Microscopic examination may be also carried out whenever necessary.

The collected natural water samples contained many microalgae species like

Chlorella sp., Haematococcus sp., Ankistrofalcatus falcatus, Selenastrum sp.,

Scenedesmus dimorphus, Euglena gracilis, Scenedesmus quadricauda,

Desmodesmus sp., Pediastrum sp., Nostoc sp. etc. which were observed under

optical microscope. Isolation procedure was carried out on the basis of keys

provided by Anderson and Kawachi (2005).

3.1.3 Enrichment of collected samples

Enrichment cultures are used as a preliminary step towards single-cell isolation.

This is performed by adding nutrients to collected samples, which enriches them, so

that algal growth may occur. There is existence of limiting factors in case of natural

algae samples, because they are often deficient in one or more nutrients; but due to

many factors, like bacterial action, grazing, and death of other organisms recycle

those nutrients and algae tend to survive in nature. But after collection, recycling

may be reduced or altered and nutrient stress can cause death of the target alga

species. Hence, minor enrichment can extend life of some algae species needed for

isolation (Anderson and Kawachi 2005).

52

In the present study, pond water containing microalgae samples were collected from

various aquatic sample collection sites; they were enriched and a fraction of pond

water was autoclaved separately for microalgae multiplication. Enrichment was

carried out by adding major nutrients to the naturally collected samples. Natural

pond water samples were enriched with major nutrients like nitrogen source (NO32-

salt) and carbon source (CO32-

salt) to promote growth. Use of soil extracts and pond

water also promotes microalgae growth. Photosynthesis plays the key role in algal

growth and multiplication, so samples were kept under constant illumination of

fluorescent light (2000-2500 lux) at 25oC under laboratory conditions.

3.1.4 Serial dilution and agar plating technique

The serial dilution and agar plating technique are the most widely used procedures,

when attempting to culture random algal species from field samples. Both these

techniques were carried out as per procedure out lined by Anderson and Kawachi

(2005). The enriched pond water with major nutrients were used in serial dilution

process. All the test tubes were placed under fluorescent lights having illumination

of 2000-2500 lux and 25oC of temperature. Samples were regularly observed under

microscope to avoid contamination. A slight change in color indicates algal growth

which can be observed within 12- 24 hours. Agar plating is followed after serial

dilution procedure.

Isolation and purity of microalgal growth was checked by streaking on agar plates

(Anderson and Kawachi 2005). They were prepared by mixing major nutrients

enriched natural pond water with agar (1%). An inoculation loop or micropipette can

be used for streaking the agar plates under laminar hood. Prior to streaking, the loop

was loaded with algal samples and normal streaking was carried out similar to

bacterial streaking. All the plates were kept under fluorescent lights for observation.

53

After 12-24 hours, green colonies appear which can be seen with necked eyes. Each

colony was observed under microscope and marked according to the presence of

microalgal strains. Lastly with the help of a sterile needle or micropipette, colonies

were transferred to suitable algae media for further growth (Kaur 2011; Anderson

and Kawachi 2005).

The steps involved in isolation of microalgae pure culture are as follows-

Collection of microalgae samples from its natural habitat (beels, ponds, wetlands,

waste water, paddy fields)

Microscopic examination of samples

Filter the water samples to remove unwanted biological matters, debris, macroalgae

or filamentous algae

Filtrate used as primary inoculums /Filtrate used as pond water enriched media

Serial dilution and agar plating done to isolate and purify the mixed microalgae

cultures

Microscopic examination carried out along with the color change in culture, if

occurs

Colonies were picked with sterile needle and transferred to fresh media

Culture flasks kept under constant illumination in optimum laboratory environments

for further study

54

3.1.5 Preparation of media

Media preparation for microalgae requires major and minor nutrients comprising of

several salts. BG11 (Stanier et al. 1971), Bold Basal (Kanz and Bold 1969); Chu13

(Chu 1942; Yamaguchi et al.1987) modified culture media were selected and

prepared for the growth of isolated microalgae strains. The composition of all the

three media containing major elements and micro/trace elements are shown in the

Table.3.1.

All the media ingredients (including major and minor nutrients) were added to

double distilled water and final volume was made up to 1 liter. The trace element

solution was prepared separately and 1ml was taken out and added to each 1 liter of

culture media. The pH of all the media were adjusted with the help of 1N HCl and

1N NaOH. Finally, the culture media was autoclaved at 121oC for 20 minutes before

inoculation with microalgal samples.

Table 3.1 : Table showing composition of various culture media used for isolation,

growing and maintenance of different microalgae strain in laboratory.

Stock solutions BG11 BBM CHU 13

NaNO3 1.5 g 0.25g -

KNO3 - 0.4g

KH2PO4 - 0.175g -

K2HPO4 0.04 g 0.075g 0.08g

MgSO4·7H2O 0.075 g 0.075g 0.2g

- - -

NaCl - 0.025g

CaCl2·2H2O 0.036 g 0.025g 0.107g

55

Citric acid 0.006 g - 0.1g

Ferric ammonium citrate 0.006 g - 0.02g

EDTA (disodium salt) 0.001 g 0.05g -

FeSO4.7H20 - 0.00498g -

KOH - 0.31g -

NaCO3 0.02 g - -

Water 1.0litre 1.0litre 1.0litre

Trace metal mix A5 1.0 ml 1.0 ml 1.0 Ml

3.1.a Trace elements (1L stock):

Stock solution BG11 BBM CHU 13

H3BO3 2.86 g 0.01142g 5.72g

MnCl2·4H2O 1.81 g 1.44g 3.62g

ZnSO4·7H2O 0.222 g 8.82g 0.44g

NaMoO4·2H2O 0.39 g - 0.084g

CuSO4·5H2O 0.079 g 1.57g 0.16g

Co(NO3)2·6H2O 0.0494 g 0.49g -

CoCl2

MoO3

-

-

-

0.71g

0.02g

-

pH 7.4 6.6 7.5

(www.cap.ac.uk/media/recipes.htm)

3.1.6 Culture process

All the glasswares employed for algal culture were immersed in chromic acid for 24

hours. Thereafter, glasswares were cleaned with laboline and washed thoroughly in

56

running tap water followed by rinsing in double distilled water. The cleaned glass

wares were then sterilized and dried in hot air oven at 110oC for 6 hours. Culture

tubes and flasks were plugged with non-absorbent cotton. All the isolates of the

microalgae were cultured in different types of media and their growth behaviours

were observed under suitable media.

3.1.7 Light condition

Light intensity is a very important factor for microalgae growth as light energy

drives photosynthesis process, which converts light energy to chemical energy.

Generally light requirement for microalgal growth is relatively lower than that of

higher plants. For the experiment, fluorescent lamps were used as a source of light

and intensity was adjusted to 2000~2500 lux for all the culture flasks and 16 hrs of

light and 8 hrs of dark cycles were repeated for growth of all the cultures (Paasche

1968). The temperature was adjusted to 25oC for all the culture flasks.

3.1.8 Characterization of isolated microalgae and identification

Out of 10 nos. of microalgae strains observed under microscope, among the natural

water samples collected from various sites of Kamrup district, four (Class:

Chlorophyceae) were selected and isolated for the study (Plate: 4 and 5). The

selected strains were-

Chlorella homosphaera,

Selenastrum gracile,

Scenedesmus dimorphus,

Scenedesmus quadricauda,

Identification of micoalgal forms were done with the help of keys provided by Vuuren

et al. 2006; Padovan 1992; Barsanti and Gualtieri 2006; Richmond 2004). In

addition to microscopic examination, SEM analysis, molecular analysis, growth pattern

57

of the algal isolates and up to date journals, published literatures and books provided

many information to identify the collected algal strains.

Microphotographs of the species were carried out from the prepared slides with

appropriate measurements following the accepted methods such as length, breadth,

diameter of cells, cellular arrangement, cell division pattern and cell wall

conformation etc.

Microphotographs and species descriptions available in the web databases also

helped to identify some forms of the isolates. (Such web databases includes, “Soken-

Taxa" project "Fundamental research and development for databasing and

networking culture collection information" at Japan Science and Technology

Corporation; Algae Base, National University of Ireland (Guiry and Guiry 2013))

and at Department of Biotechnology, Gauhati University, Guwahati, Assam.

3.1.9 Scanning electron microscopic (SEM) analysis

Scanning Electron Microscopic analysis provides valuable information about the

systemic studies of algae and their taxonomic positions. Taxonomic study of

microalgae is mainly based on their cell form, cell arrangement and cellular

ornamentations. All the morphological characteristics of microalgae are sometimes

difficult to differentiate using a simple optical microscope, because of their smaller

size. Therefore, electron microscopy is an essential procedure to distinguish and

study cellular features of microorganisms such as microalgae in higher

magnification ranges. All the four strains were studied at their cellular and

morphological level through SEM analysis. Photographs were taken at various

magnification ranges (5000-12000X) to distinguish them up to their species level.

SEM photographs revealed their morphology and cellular changes also during their

growth cycle. The algal isolates were processed and the photographs were taken at

58

Sophisticated Analytical Instrumentation Facility (SAIF), North East Hills

University, Shillong, Meghalaya.

3.1.10 Molecular characterization of microalgae isolates based on ITS4

amplification

3.1.10.1 Genomic DNA extraction

The extraction of genomic DNA from microalgae cell require cell lysis. The

genomic DNA isolation from microalgae samples were carried out using the

procedure reported by Fawley and Fawley (2004) with slight modifications. The

DNA extraction buffer was prepared by mixing 75mM Tris HCl (pH 8.0), 1M NaCl,

30mM EDTA and 0.3% CTAB. Fresh microalgae cultures at their exponential phase

of growth were collected (20ml) and centrifuged at 7000 rpm at 4oC for 20 minutes.

Supernatants were discarded and 3 ml of extraction buffer was added to the pellets

followed by mild vortexing. The suspensions were again centrifuged at 8000 rpm for

5 minutes (Eppendorf rotor F-45-30-11) and again supernatants were discarded.

200µl of extraction buffer along with 75µl of CTAB were then added to each tube

and vortexed using glass beads. 200µl of chloroform was added to the tubes,

followed by vortexing and centrifugation at 2000 rpm for 2 minutes. The aqueous

phases were transferred to fresh tubes and chloroform: isoamyl alcohol mixture

(24:1) were added and mixed by inverting the tubes. The aqueous phases were again

transferred to fresh tubes and sodium acetate (3M) was added till 1/10th

the volume

and mixed by inverting the tubes. The mixtures were then centrifuged at 6000 rpm

to collect the pellets, which were redissolved in 200µl low salt TE buffer (pH 8.0).

1µl of RNAse A (Himedia DS0003, 20mg/ml) was added to each tube and incubated

at 37oC for 1 hour. 200µl of chloroform: isoamyl alcohol mixture (24:1) was then

added followed by centrifuging at 6000 rpm for 10 minutes. The aqueous phases

59

were transferred to fresh tubes and equal volume of ice cold ethanol was added to

each tube followed by mixing by inverting the tubes. The tubes were again

centrifuged and pellets were washed with 70% ethanol. Finally they were allowed to

dry and 50µl of TE buffer added to each tube for future use and storage.

Spectrophotometric quatification and electrophoresis of extracted DNA samples

were carried out for further analysis.

3.1.10.2 Primer

The PCR primer used for molecular characterization of all the four microalgae

isolates is ITS4 region (5´TCCTCCGCTTATTGATATGC 3´) of 18s rRNA gene

sequence.

The sequencing of amplified products were outsourced and sequence analysis was

carried out locally using linux workstation.

3.1.10.3 Sequence analysis and Phylogenetic study

After PCR amplification of ITS4 region, the PCR products were sequenced and they

were obtained in chromate file format as well as in dotseq format. Sequences were

then trimmed, where ever necessary using “Bioedit” program. Multiple alignments

of the processed sequences were carried out using “ClustalX” program. The outputs

from ClustalX analysis were obtained in dotPHY format, which was again used as

input for “Phylip” program for phylogenetic analysis using maximum likelihood

method. ClustalX output in dotPHY format was analyzed by using “Seqboot”

module of Phylip package followed by “Dnaml” for maximum likelihood and

distance calculation. This was further analyzed by “Consense” to generate the map

and lastly the output was visualized by “Treeview” program.

60

The sequence results were also blast for homology search and results were compared

and checked by matching with the elctropherogram using BioEdit software. All the

sequences were submitted to NCBI using Bankit program and accession numbers

were obtained for each sequences.

3.1.11 CHNS analysis: elemental composition of the microalgae samples

Carbon, nitrogen, hydrogen and sulfur analysis was carried out on all the four

microalgae isolates to determine their chemical composition and to distinguish the

strains from each other. The analysis was performed with CHNS EuroVector, EA

3000 Elemental Analyzer. Cells from exponential phase of growth were harvested

and lyophilized. Dried biomass was collected and about 1 gm of the each powdered

samples were processed for the CHNS analysis.

3.1.12 ANALYTICAL METHODS

3.1.12.1 Cell count by haemocytometer

Direct microscopic cell count by Neubour haemocytometer was performed using

optical microscope. About 100µl of microalgae samples were taken out from culture

flasks with the help of a micropipette and cell counts were carried out on

haemocytometer slide using a light microscope (Labomed). Readings were taken at

the interval of 24 hrs, in multiple replicates and their average values were recorded

in increase of cells per milliliter per day.

3.1.12.2 Determining optical density (O.D.)

Optical densities of microalgae cultures were measured at a regular interval of time

(24Hrs) by taking absorbance at 680nm (A680) with the help of a spectrophotometer

(Systronics) in three replicates and average values were recorded. All experiments

were performed under semi continuous mode of cultures. About 10 ml of microalgae

61

culture were taken out from each culture flask, every after 24 hrs for O.D. readings

and again 10ml of fresh media were replaced to make the volume of culture

constant. The spectrophotometer was calibrated every time with blank containing

each medium respectively.

3.1.12.3 Determination of biomass

Biomass increase in milligram per day per milliliter for each of the strains was

recorded daily. Biomass of algae samples were collected by centrifuging the cultures

at 5000 rpm after a period of 24 hrs. For that 10ml of culture were taken out and

centrifuged; the pellets were collected, dried and weight was recorded using a digital

weigh balance.

At the end of the experiments all the culture flasks were harvested, centrifuged and

pellets were lyophilized. The dry weights of biomass were measured, recorded and

stored in freeze at 4oC for further analysis and use.

3.1.12.4 Determination of specific growth rate (µ)

Specific growth rate is calculated by measuring the number of generations or

doublings that occur per unit of time in an exponential phase of growth. The

exponential (straight line) phase of growth was anlyzed and specific growth rate was

calculated using following equation. (Guillard and Ryther 1962)

µ= ln (Nt/No)/Tt-To

Nt= Number of cells at the end of exponantial phase.

No= Number of cells at the start of exponantial phase

Tt= Last day of exponantial phase

To= Initial day of exponantial phase

62

The T is expressed in terms of days and from the specific growth rate (µ), further it

can be converted to obtain doublings or division per day (k) by dividing the specific

growth rate (µ) by the natural log of 2.(0.6931).

K=µ/0.6931

The time needed to attain doubling of the total number of cells which is refered as

doubling time (Tt) and it is calculated by the following formula.

Tt= 0.6931/µ

3.2 Media standardization and optimization for higher biomass production

3.2.1 Media standardization

The four microalgal isolates were grown under different media composition. The

media considered for the growth were BG11 (Stanier et al. 1971), Bold Basal (Kanz

and Bold 1969), Chu13 (Yamaguchi et al.1987; Chu 1942) media. A semi

continuous mode of culture was carried out for all the microalgae strains to evaluate

their growth characteristics in aforementioned three culture media (BG11, Chu13

and BBM media). Culture flasks having equal volume (100 ml each) of different

culture media were prepared and inoculated with constant volume (5 ml) of

inoculums. The inoculum cell density was recorded for each of the isolates using

haemocytometer. Growth study was conducted for 9-11 days of growth period

where O.D. (optical densities) were recorded at 680nm (A680) daily. For each

parameter, average values were considered from the data generated from three

replicates. Specific volume (3 ml each) of algal cells were removed for the study and

replacing it with same volume of fresh media. The specific growth rate, doubling

time, doubling per day were also calculated and recorded for each of the microalgal

63

strains growing in different culture media and finally a graph was plotted by putting

the daily O.D. (680 nm) readings.

3.2.2 Optimization of culture media

Media optimization is an important step in microalgal growth kinetic studies and it

is related to attaining maximum growth rate and biomass production of microalgae

in a short period of time. Microalgal growth depends on factors like light,

temperature, nutrient conditions and pH of media. Major elements which constitute

algal cells are carbon, nitrogen, sulfur and phosphorus (Wang et al. 2008). Only

carbon nutrient source, which may be in inorganic salt form (HCO3-) or in gaseous

form (CO2) do not support microalgal growth. Media must be optimized with a

suitable carbon dioxide concentration to promote maximum microalgal growth and

CO2 fixation rate. Many published literatures indicate that manipulations in the

media level may lead to the achievement of optimum growth and lipid production of

microalgae as the quality and quantity of lipid within the cells can vary with the

change in growing conditions (Mutlu et al. 2011). All these elements present in the

media promote the formation of microalgae biomass, which ultimately produce algal

oil. Therefore, microalgae cultivation holds a great promise in mitigation of green

house gases by generating biomass, which again can be converted to biofuel to

replace fossil fuels. (Illman et al. 2000; Liu et al. 2008; Mutlu et al. 2011; Sostaric

et al. 2009; Kirrolia et al. 2011; Wang et al. 2008).

3.2.2.1 Effect of initial pH on growth of microalgae

The initial pH of the culture media has a very important role in microalgae

cultivation. Every organism has its own pH optima for growth. For pH optimization,

culture flasks were taken in three replicates each having 100 ml normal BG11

media. A difference pH of 6, 7, 8, 9, 10 were adjusted to each of the flasks with

64

0.1N HCl and 0.1 N NaOH with the help of pH meter (L1 120 Elico), just before

inoculating with the microalgal isolates. After inoculation, the Optical Density

(O.D) of each culture flasks were measured at 680nm of wavelength at regular

interval of time (24Hrs) and average values of the three replicates were recorded.

The strains were checked for a growth period of 9 days and at the end of the

experiment, a growth curve was plotted.

3.2.2.2 Growth of microalgae isolates under different concentration of urea.

Among all the factors, nitrogen is known to have the strong influence on microalgae

metabolism and it is one of the major nutrients needed for microalgae growth. In

addition, nitrogen is easy to manipulate and is less expensive when compared to

other nutrients. Therefore, it plays a key role in growth, CO2 mitigation and

enhancing the lipid productivity for bio-fuel production (Takagi et al. 2000). Culture

flasks for all the four strains were prepared in BG11 media by replacing NaNO3 with

urea as nitrogen source. Urea can be used as a very efficient nitrogen source for

microalgae cultivation; as it is very cheap compared to other nitrogenous nutrients

available which ultimately make it economically advantageous for commercial

production of microalgae. (Zhila et al. 2005). Culture flasks each having different

concentrations of urea was prepared separately in three replicates for each of the

strains in semi continuous mode culture. For this purpose, urea at the range of 0.02

g/L, 0.04 g/L, 0.08 g/L, 0.1 g/L, 0.2 g/L were freshly weighed and added to each of

the flasks. Before inoculation, the pH of each flask was adjusted to 7.5 with 0.1N

HCl and 0.1 N NaOH. About 100 ml of media was distributed to each of the flasks

and all were inoculated with 5 ml of inoculums. (cell densities of inoculums for

performing all the experiments Scenedesmus dimorphus=2.25X107, Scenedesmus

quadricauda= 3.5X107,

Selenastrum gracile= 3.72X107 and Chlorella

65

homospheara= 4.1X107 no of cells). The Optical Density (O.D) of each of the

flasks was measured at 680nm of wavelength at regular interval of time (24Hrs) and

average value of three replicate was recorded. The strains were checked after 9 days

of growth period. At the end of the log phase of growth, the cells were harvested and

total lipid content was calculated.

3.2.2.3 Media optimization with carbon nutrient source

Many published literatures reported that carbon source effect growth and fatty acid

compositions of numerous microalgal species (Wood et al. 1999; Wen Chen 2003).

The two ways of providing carbon nutrient sources for microalgae cultivation

system are in salt (carbonate salts like Na2CO3/NaHCO3) and gaseous form (CO2

gas and flue gas), (Wang et al. 2008; Sostaric et al. 2009; Ho et al. 2011). Algae can

able to well utilize the bicarbonate salt because, its cell machinery has the enzyme

called carbonic anhydrase, which is responsible for converting bicarbonate salt into

carbon dioxide, as microalgae can only fix CO2 through their metabolic pathways,

which is carried out by another enzyme called RUBISCO ( ribulose 1,5- bis

phosphate). It is the only enzyme which is solely responsible for fixing CO2 to form

sugar molecules in plant cells through photosynthesis (Ho et al. 2011; Moroney and

Somanchi 1999).

3.2.2.3.1 Growth under different concentrations of bicarbonate salt

An alternative inorganic carbon source, which can be used for cultivation of

microalgae is sodium bicarbonate and sodium carbonate salts. There exists a high

extracellular carbonic anhydrase enzyme (CA) activity in many microalgae species

(EmmaHuertas et al. 2000), which can convert carbonate to free CO2 to initiate CO2

assimilation. In addition, direct uptake of bicarbonate salts by an active transport

system has also been reported in case of some species (Wang et al. 2008; Colman

66

and Rotatore 1995). It was observed previously that NaHCO3 is a better carbon

source than sodium carbonate (Na2CO3) in microalgae cultivation as sodium

bicarbonate (NaHCO3) yielded better growth response in case of various microalgae

strains like Chlorella vulgaris, Scenedesmus sp., Haematococcus sp., Chaetoceros

gracilis etc and found to produce more biomass than in case of using sodium

carbonate (Na2CO3) (Muralinarasimhan 2010; Wang et al. 2008, Yeh et al. 2010;

Devgoswami et al. 2011). Therefore, sodium bicarbonate salt was explored as a

source of carbon nutrient in present investigation. Carbonate salts have solubility of

19.4 g/100 g of H2O at 25oC (Kobe and sheety 1948, Kim and Lee 2009). Addition

of bicarbonate avoids power consumption for bubbling CO2 gas in the aqueous

medium and intends to minimize the carbon loss to the atmosphere by saturating the

bicarbonate concentration in an appropriate pH range for algae culture as well as can

be used for photosynthesis process by algae (Arizawa and Miyachi 1986). Culture

flasks were prepared with BG11 media in three replicates, each having different

concentration of bicarbonate salts, for each of the four strains. NaHCO3 salt at

concentration ranges of 15, 30, 45, 60 and 75 mg/L (1mg/L=1ppm) were freshly

weighed and added to each of the flasks. Prior to the experiment, the pH of all the

culture flasks were maintained at 7.4, because bicarbonate addition lowers the pH as

it leads to the formation of carbonic acid, with water, which is lethal to algae (Kim

and Lee. 2009). About 100 ml of media were distributed to each of the flasks and all

are inoculated with 5 ml of inoculums. (cell densities of inoculums for performing

all the experiments; Scenedesmus dimorphus=2.25X107, Scenedesmus

quadricauda= 3.5X107,

Selenastrum gracile= 3.72X107 and Chlorella

homospheara= 4.1X107no of cells). A 9 days culture period was observed and O.D.

at 680 nm with an average value of three replicate was recorded every after 24hours.

67

At the end of the log phase of growth, the cells were harvested and biomass

production and total lipid content were calculated.

3.2.2.3.2 Growth under different concentrations of CO2 gas

Carbon dioxide is one of the critical factors for photosynthesis in microalgae along

with light, water and nutrients. Culture medium was prepared using BG11 media

excluding the carbon nutrient source. Attempts were made to blow CO2 in the

media, but there is a major loss of CO2 in the air due to its poor solubility. CO2 has a

solubility of 1.45g/L at 25oC under 100 KPa (Weibe and Gaddy 1940, Kim and Lee

2009). This indicates the advantages of bicarbonate salts in media, which minimize

the loss of carbon in the atmosphere (Kim and Lee 2009). To overcome the problem

of CO2 loss, carbon dioxide gas is supplied periodically by maintaining a steady pH

of the cultures. Regular observation of pH is very important because the equilibrium

concentrations of the various carbonate ions in aqueous solution are controlled by

the pH of the solution. The amount of CO2 dissolved in water varies greatly with pH

and addition of CO2 results in a pH decrease (Figure 1). At higher pH values, e.g. at

pH greater than 9, most of the inorganic carbon is in form of carbonate (CO3 2–

)

which cannot be assimilated by the algae (Borowitzka 1998). More specifically, at a

pH below about 4.5, the carbonate ion will entirely in the form of carbonic acid

(H2CO3). As the pH is increased to a value of about 8.5, the carbonate ions will

consist entirely of bicarbonate (HCO3 -

) and as the pH is raised above 8.5, the

predominant carbonate species will be carbonate (CO32-

) (Huber et al. 1999; Kim

and Lee. 2009; Devgoswami et al. 2011). (Different concentration of CO2 gas

dissolved in aqueous medium is indicated by different pH values).

68

Figure 3.2.2 Graph showing relationship between pH and CO2 equilibrium

(source- http://ion.chem.usu.edu and Larsdotter 2006)

In the experiment, pure CO2 is supplied to culture flasks in the concentration range

of 7.93, 4.76 & 4.4 g/L in three replicates. In that case, initially the pH of all the

culture flasks were elevated to 10.5, then CO2 is supplied until the pH value falls to

5.5, 7 and 8, so that required amount of CO2 concentration as sited can be reached;

because addition of CO2 gas lowers the pH of culture due to formation of carbonic

acid. The formation of carbonic acid from CO2 is shown below:

CO2 (g) + H2O (aq) →H2CO3(aq)

It was calculated that when the pH of media was lowered from 10.5 to 5.5 by

adding CO2 gas, the amount of CO2 gas dissolved is 7929 mg/L, therefore a standard

curve can be plotted using pH and CO2 concentration with the help of titration

procedure (Devgoswami et al. 2011). Periodical (every after 6 hrs) addition of CO2

gas is maintained by checking and monitoring the pH of the cultures. A constant

supply of carbon dioxide at 100 ml/min was maintained by using a digital gas flow

meter (Digital Gas Flow Meter, Model: DFM-01/ 02 / 03). The O.D. values at

680nm (A680), biomass increased (mg/L/day) and no of cells increase/day were

69

monitored daily for growth kinetics of all the strains. The average values of each of

the replicates for aforementioned parameters were recorded. The strains were

checked for 9 days of growth period.

3.2.2.3.3 Growth of microalgae isolates under supply of CO2 gas with different

flow rate

Amount of CO2 supply in algae culture has a major role on microalgal growth.

Growth study was conducted while growing algae under BG11 media taking CO2 as

carbon source with different flow rates. An optimum flow rate is essential for

microalgae growth as a high flow rate of CO2 is always lethal to algae. The higher

the flow rate the higher CO2 is supplied to microalgae culture and a high CO2

concentration lowers the media pH forming carbonic acid. The study was conducted

to find out the effect of adding pure CO2 to the culture at different flow rates. Firstly

the media pH of all the culture flaks was increased to 10, prior to inoculum addition.

Carbon dioxide was bubbled continuously into the microalgae culture flasks at flow

rates of 10, 20, 50, 100 and 200 ml/min using a digital gas flow meter (Digital Gas

Flow Meter, Model: DFM-01 / 02 / 03), every after 12 hours to maintain a constant

pH of 6.5 as CO2 addition and pH has a direct relations in algal growth. Cultures

were carried out in three replicates in semi continuous mode and were kept under

fluorescent lights under 16 hrs of light and 8 hrs of dark period at 25oC temperature.

A 9 days culture period was observed and biomass increase (mg/L/day) and cell no

increase/day and O.D. readings at 680 nm were taken and average value of each

replicate recorded every after 24hours [Plate 6(B)].

70

3.2.2.3.4 Preparation of culture media utilizing modified Solvay process and

growth of microalgae isolates.

The ability of microalgae to utilize salt form of carbon nutrient more efficiently than

carbon dioxide gas lead to the exploration of the Solvay process. Sostaric et al.

(2009) reported the utilization of Solvay process in microalgae cultivation system.

Different concentration of enriched solutions were prepared by utilizing Solvay

process, where gaseous CO2 is converted into bicarbonate salt in presence of a

catalyst. Further, as mentioned earlier CO2 gas, upon bubbling through media, most

of it tend to lost in the air so it is convenient to convert CO2 gas into bicarbonate

form as microalgae cells have the machinery to convert bicarbonate salt into CO2.

The Solvay process leads to the formation of a bicarbonate salt from gaseous CO2.

Chemical reaction of a Solvay process is represented by the following equation

(Huang et al. 2009; Sostaric et al. 2009)

CO2(g) + NaCl + NH3 + H2O → NaHCO3 + NH4Cl

The ammonium chloride produced in the reaction is also serving as a nutrient for

microalgae cultivation (Sostaric et al. 2009).

For preparing the enriched media, 2 g sodium chloride salt was added to 1 liter of

distilled water, and to it ammonia solution (25%) was added drop wise until the pH

reaches to 10; pure carbon dioxide gas was blown in the alkaline solution using a

gas regulator at a slow flow rate (20ml/min) until the pH value of 6.5 is reached. The

enriched media was prepared by adding the above solution in different proportions

with normal BG11 media, excluding carbon nutrient source (Sostaric et al. 2009).

Culture flasks were prepared each having three replicates with dilutions made in the

ratios of 1:100, 2:100, 4:100, 10:100 and 1:1 with solution from Solvay process and

normal BG11 media keeping the final volume of about 100 ml. All flasks were

71

inoculated with 5 ml of inoculums. (Scenedesmus dimorphus=2.25X107,

Scenedesmus quadricauda= 3.5X107,

Selenastrum gracile= 3.72X107 and Chlorella

homospheara= 4.1X107

no of cell). Cultures were kept under fluorescent light with

16 hrs of light and 8 hrs of dark period at 25oC temperature. A 9 days culture period

was observed and biomass increase (mg/L/day) and cell no increase/day and O.D. at

680 nm were taken and average values of each replicate were recorded every after

24hours. At the end of the log phase of growth, the cells were harvested and biomass

production and total lipid content was calculated.

3.2.2.3.5 Media with only nitrogen and carbon dioxide

Growth study was conducted to check the growth of all the strains under the

influence of two major nutrients. Therefore, culture medium was prepared in three

replicates for each of the four strains with only urea as nitrogen nutrient source and

CO2 as carbon nutrient. About 100 ml of media was prepared by dissolving 0.1

gram of urea as nitrogen nutrient per liter and 4.76 gram/liter CO2. pH of the

cultures was raised to 10.5 prior to addition of CO2. CO2 was supplied periodically

with a flow rate of 100 ml/minute, maintained using a digital gas flow meter. The

pH change is monitored daily. The 9 days growth kinetics for all the microalgal

strains were studied taking O.D. at 680 nm and average value of three replicates was

recorded every after 24hours. A growth curve was plotted at the end of the

experiment.

3.2.2.4 Preparation and formulation of a cheap media with soil and cowdung

extract

The success of the CO2 mitigation technology with microalgae lies on the

formulation of a cheap cultivation media for growth of microalgae as CO2 addition

alone can not support growth of microalgae cells. Owing to the high cost of media

72

ingredients, an alternative of easily available cheap media is an urgent need for algal

technology. Microalgae cultivation, under normal growth medium requires almost

10-14 salts (both major and minor elements), making the culture process a bit

expensive, which is not economically suitable for mass scale culture but use of

waste water, animal manure etc can increase the cost effectiveness of the process

(Agwa et al. 2012; Mulbry and Wilkie 2001). The aim of the present experiment is

to formulate a media which is cost effective, by utilizing garden soil and animal

waste such as cowdung, which contains a considerable amount of nitrogen and

phosphorous which is suitable for algae growth. (Mulbry and Wilkie 2001).

Table 3.2 : Basic nutrients for cattle manure (Chen et al. 2003)

In the experiment 80 gram of garden soil and 40 gram of sun dried cowdung were

weighed separately and ground into fine powder with a mechanical grinder. They

were then mixed separately with 1 liter of tap water with the help of a magnetic

stirrer. After mixing both the extracts were filtered with whatman no1 filter paper

and autoclaved. The chemical composition of the soil sample used in microalgae

cultivation was tested at National Bureau of Soil Survey and Land Use Planning

(NBSS&LUP) under ICAR regional centre, Jorhat, Assam. Culture medium was

Parameter Content in

manure (%)

Elements Content in dry

manure (%)

Water 86.61 Nitrogen 2.90

Total solids 13.39 Phosphorus 0.48

Total volatile solids 11.21 Potassium 2.86

Total fixed solids 2.18 Carbon 45.37

Crude protein,

% DM

18.1 Total fiber,

% DM

52.6

73

prepared by mixing soil extract, cowdung extract with tap water in the ratio of

10:5:85, 20:8:72, 30:10:60, 40:15:45 and 50:18:32 respectively to make up the final

volume up to 100 ml. All flasks were prepared in three replicates. Before

inoculation, the pH of all the culture flasks were raised to 10.5 with the help of 0.1 N

NaOH and an external supply of CO2 gas was made up to 4.76 g/liter until the pH of

all the culture media were fell to 6 with a constant flow rate of 100 ml/minute was

also maintained using a gas flow meter. It was observed that the media pH raises

along with the CO2 consumption and growth of microalgal cells hence CO2 gas was

blown into media periodically to maintain a constant pH of 6. Fluorescent lamps

were used as a source of light and intensity was adjusted to 2500~3500 lux for all

the culture flasks and 16 hrs of light and 8 hrs of dark cycles were repeated for

growth of all the cultures at 25oC temperature. 9 days growth kinetics of all the

microalgal strains were studied taking O.D. at 680 nm and average value of each

replicate was recorded every after 24hours. A growth curve was plotted at the end of

the experiment.

3.2.2.5 Preparation of culture media having different concentrations of

salinity

Salinity plays an important role in growth and biochemical composition in many

algae species (Moisander et al. 2002; Lartigue et al. 2003; Rao et al. 2007). Many

published literatures suggest that salinity induces lipid production in microalgae;

hence growing microalgae in optimum level of salinity stress is beneficial in both

biomitigation and biofuel point of view (Rao et al. 2007; Kalita et al. 2011; Kirrolia

et al. 2011). Culture flasks each having different concentration of sodium chloride

were prepared separately for each of the strains. About 100 ml of autoclaved BG11

media was added separately in conical flasks having three replicates and sodium

74

chloride at the concentration range of 0.02, 0.04, 0.06, 0.08 and 0.17 M was added

individually. pH of all the flasks were set to 7.5 with 0.1N HCl and 0.1 N NaOH

with the help of L1 120 pH meter. A 9 days culture period was observed and O.D.

at 680 nm and average value of each replicate was recorded every after 24hours and

also cell no increase, biomass increase/day and total lipid content in percent (%) dry

cell weight were measured at the end of the experiment.

3.3 Screening of carbon dioxide mitigation potential of microalgal isolates

In the beginning of the study, the microalgal samples were collected from different

sites of Kamrup district, Assam. These were pure cultured and screened to assess

their potential for CO2 mitigation capabilities and production of biomass by

investigating their physiology, lipid production and biochemistry. Further,

optimization of laboratory culture conditions and growth under various nutrient

environments were helpful to enhance the growth and CO2 fixing capabilities. The

microalgae strains observed and collected from various sites represent the diversity

of algae in the environments and water types of Assam. The collection was

narrowed down to four most promising strains. In the present study, parameters like

growth rate and biomass production, carbon dioxide utilization rate, lipid

productivity and biofuel generation was considered to screen out the efficient

microalgal strains. Most of the strains were green algae under theclass:

Chlorophyceae and cultured in Environmental Biotechnology laboratory,

Department of Biotechnology, Gauahati Universty, Assam, India.

3.3.1. Growth rate and biomass production

The growth kinetics of the four microalgal isolates were explored under various

growing conditions. Their biomass productivity under media supplemented with two

75

forms of carbon nutrient source i.e. in salt form (bicarbonate salt), gaseous form

(CO2) and under the modified Solvay process, were used to convert CO2 gas into

bicarbonate salt were assessed. The efficient algal strains were screened based on

their performance in terms of growth rate and biomass production. The success of

CO2 mitigation strategy demands a fast growing as well as high biomass yielding

species.

3.3.2. Carbon dioxide utilization rate

Screening of the microalgae strains were carried out on the basis of their CO2

fixation performance under different cultivation conditions. The biomass

productivity of a microalgal strain depicts the CO2 fixation rate of that strain during

that growth environment, because a major portion of microalgal biomass comprises

of carbon (Chisti 2007), which was found, based on CHNS analysis. The CO2

fixation rate of each of the microalgae isolates were calculated at their optimum

growth conditions.

Carbon dioxide consumption rate was calculated from the biomass productivity

according to the equation:

CO2 fixation rate (PCO2) = 1.88 × biomass productivity (Poverall) (mg L−1

d−1

),

which is derived from the typical molecular formula of microalgal biomass,

CO0.48H1.83N0.11P0.01 (Chisti 2007; Ho et al. 2010)

3.3.3. Lipid productivity

The biomitigation of carbon dioxide through microalgal photosynthesis holds

enormous potential in near future, if the biomass produced because of carbon

dioxide fixation has an application in renewable fuel generation. It will also help to

increase the economy of the process (Wang et al. 2008). It was established from

76

published literatures that, CO2 concentration in media directly affects the internal

lipid content of a microalgae cell (Tsuzuki et al. 1990). The CO2 exposure during

growth of the microalgae may alter the fatty acid compositions too (Yusof et al.

2011). The total lipid content of the all strains after growing under different media

environments supplemented with various carbon sources including bicarbonates,

CO2 gas and salinity were estimated. Cells were harvested after attaining maximum

growth at the end of the experiments and their lipids were extracted by Bligh and

Dyer method.

3.3.3.1 Lipid extraction procedure

Microalgal lipid extraction was done by Bligh and Dyer (1959) method with slight

modifications. The microalgal biomass was collected by centrifuging the cells from

exponential phase of growth, at 5000Xg for 10 minutes. The cells were washed with

distilled water and further dried using lyophilizer (Spacvac) and weighed

accordingly. The weight of the biomass was then recorded and homogenized with

chloroform: methanol in the ratio 1:2 at 35oC. Extract was further centrifuged for 10

minutes at 5000Xg and a separating funnel was used to collect the supernatant. The

remains were further homogenized with chloroform and again centrifuged (5000Xg)

to collect the supernatant. 1% NaCl solution was used to wash the filtrate and lower

layer of chloroform was separated and finally, treated with anhydrous Na2SO4 to

remove the traces of water (Kumar et al. 2011).

The lipid content for all the microalgae strains were determined gravimetrically and

expressed as percent dry weight after evaporating the chloroform. The quality and

quantity of extracted lipid depicts the potentiality of a microalgae strain in

biomitigation and biofuel generation, as biomitigation of CO2 through microalgae

77

lead to formation of biomass, which delivers economic and commercial outputs such

as biofuels [Plate 8].

The steps involved in lipid extraction procedure are as follows-

Microalgal cells were harvested by centrifuging cells at 5000X rpm for 10 minutes

or by flocculation method

The collected biomass were then further dried by lyophilization

The weight of biomass was recorded and it was homogenized with chloroform and

methanol in the ratio of 1:2

The extract is then centrifuged at 5000X rpm for 7 minutes and supernatant was

collected in a separating funnel

The residue was further homogenized with chloroform and again centrifuged at

5000X rpm to collect the supernatant

Now 1% NaCl solution was added to the filtrate and washed

The lower layer of chloroform was separated and treated with anhydrous Na2SO4 to

remove any traces of water

The lipid content was determined gravimetrically and expressed as dry cell weight

% after evaporating the chloroform

3.3.3.2 Conversion of algal lipids to biodiesel

After lipid extraction procedure, the conversion of algal triglycerides to methyl

esters or biodiesel is obtained by a process called transesterification.

78

The high oil content of microalgae biomass is advantageous for its conversion to

biodiesel, which holds a great potential to displace petroleum derived transport fuel

(Chisti 2007). In the present study microalgal biodiesel, which is also known

Figure 3.3.3: The transesterification reaction generating biodiesel (Chisti 2007).

as fatty acid methyl esters (FAME), is produced by tranesterification reaction, using

an alkali metal (sodium) catalyst. Alkaline metal alkoxides (as CH3ONa for the

methanolysis) are the most active catalysts, and more reactive than acid catalysts

since they give very high yields (>98%) in short reaction times (Schuchardt et al.

1998; Fukuda et al.2001). The extracted microalgal oil was dissolved in methanol in

the ratio of 6:1 of methanol to oil because for each mole of triglyceride, 6 moles of

methanol are used industrially (Frac et al. 2010; Fukuda et al. 2001). Excess

addition of methanol shifts the direction towards formation of methyl esters. The

mixture was then heated for 1-2 hrs at 50-60oC performing regular gentle shaking

(Prommuak et al. 2012; Ma and Hanna 1999). The mixture was then cooled and

after cooling, 2% sodium methoxide solution was added. The methoxide was

prepared by mixing pure sodium metal with high grade (for HPLC) methanol as

procedure outlined by Ahmed et al. (2012). As the sodium metal is very much

reactive, the reaction is exergonic. Then the mixture is further heated at 62oC for 1-2

hr with regular gentle shaking. The transesterified methyl ester solution was then

finally cooled down to normal temperature and allowed to separate layers keeping it

undisturbed as transesterification reaction leads to formation of two layers. The

upper layer is the biodiesel layer and lower layer consists of glycerol, which is thick

79

and much heavier (Chisti 2007; Ma and Hanna 1999). The upper layer which

contains the biodiesel or fatty acid methyl esters (FAME); were collected, stored and

prepared for gas chromatography (GC-MS) analysis. According to European

Biofuels Technology Platform 2011, FAME should have Specific gravity of 0.88

kg/l, Density at 20 °C of 0.86-0.90 kg/m³, Lower heating value of 33.175 MJ/kg and

Kinematic viscosity at 40°C of 4-6 kPa s [Plate 9].

The steps involved in biodiesel preparation from microalgal oil samples through

transesterification process are as follows-

Microalgal lipid was extracted using Bligh and Dyer method

Total lipid content was estimated and transesterification reaction was carried out

using alkali metal catalyst for microalgae biodiesel preparation

Algal lipid were mixed with HPLC grade methanol in the ratio of 1:6 of oil and

methanol

Mixture was heated for 1-2 hrs at 60o C with gentle shaking

Sodium methoxide solution was prepared separately by mixing sodium metal with

high grade methanol

After cooling sodium methoxide solution was added to oil

Mixture was again heated at 62o C for 1-2 hrs with regular shaking

Transesterified oil was then cooled and allowed to separate layers

The reaction lead to formation of two layers, upper layer formed was fatty acid

methyl esters (FAME) or biodiesel and lower heavier layer formed was glycerol

FAME was collected, purified and finally analyzed using Gas chromatography and

Mass spectrophotometer (GC/MS)

80

3.3.3.3 GC/ MS analysis of microalgae biodiesel

The Fatty acid methyl esters produced as a result of transesterification of microalgal

oil, were analyzed with the help of PerkinElmer Clarus 680/600 PE Auto system

Gas Chromatography system with built-in Auto sampler and mass spectrometer. The

biodiesel samples were dissolved in n-hexane and µl of sample was injected.

Initially, the instrument oven temperature for the microalgal FAME analysis was

programmed from 50oC up to a maximum of 350

oC at a rate of 5

oC / min to 280°

with a detector temperature of 260oC. A hold for 20.00 min was maintained and the

channels were having a Sampling Rate of 1.5625 pts/second. The total run time for

the analysis was 67 minutes.

3.4. Detection of high carbon dioxide tolerant microalgae strains

3.4.1 Detection on the basis of growth kinetics

Efficient microalgae strains were detected on the basis of their growth behavior

under different culture environments. A fast growing, strain which have good

tolerance to bicarbonate as well as CO2 gas is considered suitable candidate for CO2

mitigation technology, and can be detected on the basis of its growth characteristics

and survivability at low pH and high temperature conditions. A microalga, which

can grow under high CO2 concentration and has high CO2 utilization, must show a

good growth rate and rapid multiplication with a lesser doubling time.

3.4.2 Detection on the basis of oil productivity

The algal strains used for CO2 fixation should also have high oil yielding potential.

Owing to the economy of the CO2 mitigation technology and to cope up with rising

demand to replace fossil fuels, a microalgae having potential to deliver good

quantity lipid as a result of CO2 utilization will always be the best choice for

commercial application of the technology. In the present study, lipid productivity of

81

all the four isolates was explored to detect a suitable strain for CO2 mitigation

technology. The extracted oil for all the isolates were transesterified to biodiesel and

GC/MS analysis was carried out for each samples. Blending practice in biofuel

industry is very common and particularly, B20 blend with petroleum diesel (20%

biodiesel and 80% petroleum diesel) is very widely used in countries like U.S and

many literatures supports the use of B20 biodiesel in agriculture tractors and

irrigation power units (Kulkarni et al. 2011; Al-lwayzy and Yusaf 2013). B20

biodiesel is prepared for the present study, against the microalgae strain with best

lipid accumulation behavior and biofuel properties.

3.4.3 Detection on the basis of physiological study

Microalgae physiology and growth characteristics changes along with the change in

their culture environments. Under high CO2 environment, some algal strains

undergo lag phase of growth and could not survive, because a low pH condition is

often encountered by microalgae growing in the CO2 dissolved culture media. An

efficient strain must show a good survival rate under the influence of extreme

conditions. A clear microscopic examination including SEM analysis was carried

out for all the four isolates under stress conditions. The strains which were able to

overcome the stress conditions and survive for further growth are considered as

suitable candidate for CO2 mitigation technology. The four isolates were studied on

basis of their morphological and physiological changes

.3.4.4 Detection on the basis of biomass productivity

The algal biomass produced as a result of biomitigation of CO2 depicts the CO2

fixation rate during the process (Chisti 2008). The amount of biomass produced per

day per liter of media is used to calculate the CO2 fixation rate. Hence, higher the

biomass productivity, higher is the CO2 consumption rate.

82

Biomass productivity = ΔX/ΔT;

ΔX= biomass production (mg L−1

)

ΔT=Time

CO2 fixation rate (PCO2) =1.88 × biomass productivity (P overall) (mg d−1

),

Which is derived from the typical molecular formula of microalgal biomass,

CO0.48H1.83N0.11P0.01 (Chisti 2007; Ho et al. 2010)

3.5 Optimization of in vitro mass culture technique

3.5.1 Mass culture of microalgae with normal culture media

In vitro mass cultivation of microalgae was carried out in light transparent plastic

culture tanks of 25 liter capacity. In the experiment, normal BG11 media was

prepared (20 liter), using tap water with urea as nitrogen source (0.1 g/L). The pH

of the tanks were adjusted to 7.4 with 0.1N HCl and 0.1 N NaOH with the help of

L1 120 pH meter. The culture tanks were inoculated with 20 ml of inoculums

having cell densities of Scenedesmus dimorphus=2.25X107, Scenedesmus

quadricauda=3.5X107,

Selenastrum gracile= 3.72X107 and Chlorella

homospheara= 4.1X107 cells/ml respectively. The tanks were kept under the

illumination of artificial light of 2000 lux intensity and temperature between 25-

35oC. Optical densities of microalgae cultures were measured at a regular interval of

time (24Hrs) by taking absorbance at 680nm (A680) with the help of

spectrophotometer (Systronics) in three replicates and average value was recorded.

About 10 ml of microalgae culture were taken out for O.D. and cell counts daily

from each culture flask and again 10ml of fresh media were replaced to make the

volume of culture constant. [Plate 8]

83

3.5.1.1 Mass culture of microalgae isolates with constant aeration under normal

culture media

In the experiment, mass culture was carried out in 20 liter tanks under the influence

of continuous aeration with air pumps having air flow rate of 50 ml/minute, under

normal BG11 media. O.D. and cell counts were taken daily. This procedure needs

electric energy to run air pump, but it has the advantages of cell agitation and

nutrition uniformity and light availability to the cells in the media. It prevents cells

from settling down at the bottom.

3.5.1.2 Mass culture with supply of CO2 gas and constant aeration

Mass cultivation of microalgae strains were carried out with BG11 media under

constant aeration and supply of carbon dioxide gas. Creswell (2010) mass cultured

phytoplanktons in 20 liter (carboys) tanks under continuous aeration with air

diffusers and he used to maintain the pH of cultures by addition of CO2 gas through

air delivery system. Similarly, in the present study, for CO2 addition, the pH of the

culture tanks were raised to 10.5 before inoculation, because bubbling CO2 gas

through the culture tanks tend to lower media pH by forming carbonic acid, which is

not suitable for algal growth. The supply of CO2 gas to the tanks was carried out till

the media pH falls to 6. A steady flow rate of 100 ml/minute was maintained using

a digital gas flow meter and during addition, media pH was constantly monitored by

a pH meter for CO2 utilization. CO2 gas was supplied every after 12 hours as the

media pH change along with CO2 utilization by microalgae cells for their growth.

Aeration was done through an air sparger with the help of an air pump. Aeration

improves growth and media availability to the microalgae cells and nutrient

uniformity during their growth. O.D. and cell counts were taken daily. [Plate 10(A)

&(C)].

84

Figure 3.5.1 In-vitro mass cultivation with supply of CO2 gas and constant

aeration with the help of air pump

3.5.2. Mass culture with soil and cattle manure extract under the supply of CO2

gas and constant aeration

In the mass culture experiment, there was utilization of garden soil and animal waste

such as cowdung for algae growth. Garden soil extract (8%) and sun dried cowdung

extract (4%) were prepared with tap water. Both the extracts were filtered with

whatman no1 filter paper and autoclaved. 20 liters of culture media were prepared

by mixing soil extract, cowdung extract and tap water at the ratio 30:10:60

respectively. Before inoculation pH of all the culture tanks were raised to 9 with the

help of 0.1 N NaOH and an external supply of CO2 gas was made until the pH of the

culture tanks were fell to 6. A constant flow rate of 100 ml/minute was also

maintained using a gas flow meter. It was observed that the media pH rises along

with the growth of algal cells. Therefore CO2 was blown into media every after 24

hrs to maintain a constant pH to 6. Natural light was used for growth of all the

cultures. O.D. and cell counts were taken daily at 680 nm. [Plate 10(K)]. The steps

involved in mass cultivation of the four microalgae isolates under cheap media

formulation are as follows-

85

Garden soil and cattle manure/cowdung were collected and sun dried

Soil and cow dung extracts were prepared by mixing 80 grams of garden soil and 40

grams of cowdung in 1 liter tap water separately.

Extracts were filtered with whatman no 1 filter paper to remove debris, biological

matters and sand particles

Filtered extracts were then autoclaved

Culture media was prepared in the ratio of 30:10:60 with soil extract, cowdung

extract and tap water respectively for mass cultivation of microalgae

20 liter culture tanks were prepared and media pH was raised to 10.5 with 1 N

NaOH before inoculation

After inoculation, CO2 gas was supplied at a flow rate of 100 ml/Minute and pH was

dropped to 6 to obtain CO2 concentration upto 4763mg/liter

Periodic addition of CO2 gas was done(every after 24Hrs) and O.D. readings

(A680), cell counts and biomass increase per day were recorded

3.5.3 Mass culture biomass harvesting and lipid extraction

The four microalgae isolates were mass cultured for a period of 15-20 days till the

cells attain their maximum growth and stationary phase. After attaining stationary

phase of growth, the biomass was harvested by introduction of a high pH of about

10 with the help of 1 N NaOH solution (Vandamme et al. 2011). Microalgae strains

can also be harvested by flocculation. In the present study, aluminum sulfate salt for

flocculation (0.3 g/L) was used, (Vandamme et al. 2011) [Plate 10(D)&(E)]. To

86

measure the effectiveness of the flocculent in the harvesting process, O.D. at 680 nm

every after 15 minutes of time interval, from the time of addition, was recorded

accordingly. After settlement of all the cells at the bottom, the clear media was

decanted and cells were sun dried and used further use and oil extraction. The dry

biomass was weighed out prior to lipid extraction process using chloroform and

methanol and total lipid content in terms of % dry cell weight were calculated for

each set of experiments.

3.5.4 Mass culture with recycled harvested media

After a fresh batch of mass culture under BG11 media, the cells were harvested,

separated and the cells free spent media was collected and recycled for growth of

next batch of culture. Only two major elements, nitrogen nutrient (urea) and carbon

nutrient in the form of CO2 gas were added in the used media and checked for

microalgal growth. Prior to inoculation the volume was adjusted to 20 liters by

adding deficit amount of water and pH was adjusted and lowered to a value of 6

with 0.1 N HCl. Optical densities of microalgae cultures were measured at a regular

interval of time (24Hrs) by taking absorbance at 680nm (A680) with the help of

spectrophotometer (Systronics) in three replicates and average values were recorded.

A growth curve was plotted to record the daily growth behavior of the strains.

3.5.5 Construction of a simple hypothetical experimental design for microalgae

culture

In the experimental design CO2 gas (100%) may be supplied to microalgae culture

tank using regulators of the CO2 cylinder for controlling the inflow and out flow of

gas. (Dianursanti et al. 2010). To maintain a steady and optimum flow rate, the CO2

gas input is controlled through a flow meter and when CO2 gas is bubbled through

87

the culture tank, there is noticeably change/fall of pH which inhibit microalgae

growth. Hence, prior to the addition of CO2 gas, the culture pH was increased to

10.5 initially, which become lowered, when CO2 gets dissolved in media forming

carbonic acid with media. Again, most of the CO2 gas tend to loss in air due to use

of open cultivation systems, but in the design the undissolved CO2 gas can again be

collected by providing an out let and closing the culture tank. The out let is

connected to a vessel containing NH3 solution and NaCl salt, which reacts with

escaped CO2 gas to form bicarbonate salt and ammonium chloride salt (Solvay

process), which are again good nutrients for microalgae (Sostaric et al. 2009). The

pH of this Solvay solution, which is formed by escaped CO2 is also monitored using

another pH meter. The Experimental design has the advantage of forming nutrient

salts from CO2 gas, which can again be used to feed microalgae.

Figure-3.5.5: A simple hypothetical experimental design for microalgae

cultivation in-vitro employing conversion of CO2 gas into

bicarbonate as reported by Sostaric et al. (2009).

88

3.6 STATISTICAL ANALYSIS

Statistical rules and methods must support any experimental findings so that it can not

be treated as invalid. Every biological finding has some practical importance in the field

of experimentation. The statistical analysis of the data of biological experimentation

has tremendous ecological importance and is accepted internationally in the field of

qualitative bio-ecology.

Following are the applied statistical methods for data analysis.

Analysis of variance (ANOVA)

The data that was obtained had been tested for the difference among the treatments

in the experiments. The data obtained for each character was analyzed by following

the randomized complete block design or factorial analysis. The analysis was based

on the linear model of Fisher (1958).

The total variation present in a set of observable quantities may, under certain

circumstances, be partitioned into a number of components associated with the

nature of classification of data. The systematic procedure of achieving this is called

analysis of variance. With the help of this technique it is possible for us to perform

certain tests of hypothesis and to provide estimates for components of variation.

Randomized complete block design

Suppose, the experimental material is divided into „r‟ blocks. Let there be „t‟

treatments. Each block is then divided into „t‟ units and the treatments are allocated

within a block at random. The resulting design is called randomized complete block

design or randomized block design (RBD). It is commonly used in laboratory

experiments where environmental effects are easily controlled.

The analysis of variance model for RBD is given by

Tij=+ti+rj+eij

89

where, = the overall mean, ti = the ith

treatment effect

rj = the jth

replication effect, and eij = the error term.

The total variance is thus divided into three sources of variation viz., between replications,

between treatments and error. The required sums of squares are obtained as follows :-

Correction factor, CF = rt

GR )( 2

, where GT = Grand total.

Total sums of squares, Tss = CFYij

2

Replication SS = CFRt j

2

1,

Treatment SS = CFTr i

2

1

Error SS = Total SS – Replication SS – Treatment SS

Hence, the ANOVA table is as follows:

ANOVA

Source of variance Df SS MS F

Replication r – 1 RSS RMS RMS/EMS

Treatment t – 1 TSS TMS TMS/EMS

Error (r – r) (t – 1) ESS RMS

Total Rt – 1 Total SS

Test of Significance

The method of calculating the probability of obtaining an observed result from some

hypothesis and regarding the hypothesis to be rejected or not, is known as test of

significance. The observed result is said to be statistically significant at a chosen

value of probability, if the calculated value is greater than some pre selected value.

90

If the calculated value is more than the tabulated value at 1% probability then it is

said to be highly significant and if the calculated value is lower than the tabular

value at 1% but higher than tabular value at 5% probability it is said to be

significant. In biological experiments, generally probability of 0.05 is also referred

to as 5% level of significance. From the calculations, the result is compared with the

standard values for different probability distributions from statistical tables.

Critical Difference (CD)

The analysis of variance table gives only a broad indication of performance of the

strains, culture conditions on growth rate. Biomass production of each isolate and

total lipid-content etc.

The CD is given by

CD (1%) = t.SE (d)

CD (5%) = t.SE (d)

Where, t = table value of „t‟ for a specified level of significance and error degrees of

freedom.

SE (d) = r

EMS2

Standard Deviation

Standard deviation was first suggested by Karl Pearson as a measure of dispersion in

1883. When means are compared, it is also important to know how much variability

there is in the original measurements (xi) from which those means were derived. The

standard deviation (S) is a measure of that variability about the mean and is

represented by the formula:

S = 1

)(x 2_

i

n

x or

1

)(x

2

2

i

n

n

xi

, for sample

91

And for population data:

=N

x 2_

i )(x or

N

N

xi

2

2

i

)(x

Standard deviation abbreviated as S.D. or s.d. is always taken as the positive square

root of the arithmetic mean of the squares of the deviation.

Standard Error

Standard errors of the means were calculated where the size or value of the sample

was small. Standard error was calculated by using the following formula:

SE for the mean =1)-N(N

d 2

Where, d2 = Sum of individual deviation from the mean squared.

N = The number of observations.

92

The materials and methods of the entire study can be

summarized via following flow chart.

Isolation and establishment of microalgae culture under

optimum laboratory condition.

Collection of microalgal samples

Identification and characterization through SEM analysis,

molecular analysis and CHNS analysis

Media standardization and optimization for higher

biomass production.

Optimization of culture media

Effect of initial pH on growth of microalgae

Growth of microalgae isolates under different concentration

of urea

Media optimization with carbon nutrient source

Growth under different concentrations of bicarbonate

salt

Growth under different concentrations of CO2 gas

Growth of microalgae isolates under supply of CO2

gas with different flow rate

Preparation of culture media utilizing modified Solvay

process and growth of microalgae isolates

Media with only nitrogen and carbon dioxide

Preparation and formulation of a cheap media with soil and

cowdung extract

Preparation of culture media having different concentrations

of salinity

93

Screening of carbon dioxide mitigation potential of various

microalgal strains.

Growth rate and biomass production

Carbon dioxide utilization rate

Lipid productivity

Conversion of algal lipids to biodiesel

GC/ MS analysis of microalgae biodiesel

Detection of high carbon dioxide tolerant microalgal strains.

Detection on the basis of growth kinetics

Detection on the basis of oil productivity

Detection on the basis of physiological study

Detection on the basis of biomass productivity

Optimization of in-vitro mass culture technique.

Mass culture of microalgae with normal culture media

Mass culture of microalgae isolates with constant aeration under

normal culture media

Mass culture with supply of CO2 gas and constant aeration

Mass culture with soil and cattle manure extract under the supply

of CO2 gas and constant aeration

Mass culture biomass harvesting and lipid extraction

Mass culture with recycled harvested media

Construction of a simple hypothetical experimental design for

microalgae culture