measles virus: early infection, progression and pathogenesis in a

UNIVERSIDADE DE LISBOA

FACULDADE DE FARMÁCIA

DEPARTAMENTO DE MICROBIOLOGIA

Measles virus: early infection, progression and pathogenesis in a transgenic mouse model

Cláudia Sofia Antunes Ferreira

Tese orientada pelo Prof. Doutor João Gonçalves e

pelo Prof. Doctor Roberto Cattaneo

DOUTORAMENTO EM FARMÁCIA

MICROBIOLOGIA

2010

As opiniões expressas neste trabalho são de exclusiva responsabilidade do

seu autor.

Cláudia Sofia Antunes Ferreira was financially supported by a PhD

scholarship (SFRH / BD / 19785 / 2004) from Programa SFRH, Fundação

para a Ciência e a Tecnologia, Portugal.

To

My Family

For their support, for their understanding and for their love

To

My Grandmother

For teaching me to love life

Preface

v

Preface

The research described in the present thesis was performed under

the supervision of Prof. Roberto Cattaneo and Prof. João Gonçalves.

The studies described in this thesis were performed at the

Department of Molecular Medicine of the Mayo Clinic College of Medicine,

Rochester, USA. The results shown in the third chapter of this thesis were

included in a manuscript already published:

Ferreira CS, Marie Frenzke, Vincent H.J. Leonard, G. Grant Welstead,

Christopher D. Richardson, Roberto Cattaneo. 2010. Measles virus

infection of alveolar macrophages and dendritic cells precedes spread to

lymphatic organs in transgenic mice expressing human signaling

lymphocytic activation molecule (SLAM, CD150). J. Virol. 84:3033-3042.

According with the “Decreto-Lei 388/70”, article 8 point nº 2, the

data presented in this dissertation is the result of the authors work and it is

clearly acknowledge in the text whenever data or reagents produced by

others were used. The author participated in planning and execution of the

experimental procedures such as in results interpretation and manuscript

preparation. The opinions expressed in this publication are from the

exclusive responsibility of the author and have not been previously

submitted for any degree at this or any University.

Acknowledgments

vii

Acknowledgments

First, I want to thank my supervisors Prof. Doutor João Gonçalves

and Prof. Doctor Roberto Cattaneo for their time and effort invested in this

project, for the ideas, scientific input and discussions. Prof. Doutor João

Gonçalves, I for always will thank for supporting all my decisions

concerning this PhD. Prof. Doctor Roberto Cattaneo, I deeply appreciate all

your dedication and commitment.

I also thank Prof. Doutor José Pereira Moniz for receiving me as a

PhD student at the Faculdade de Farmácia da Universidade de Lisboa.

Also I want to acknowledge the Fundação para a Ciência e a

Tecnologia for the funding of my PhD scholarship.

From the Centro de Patologia Molecular/Unidade de Retrovírus e

Infecções Associadas, I would like to thank Ana, Sofia, Andreia, Fred,

Mariana, Iris, Rita and Sylvie for they welcomed me in their lab and shared

their benches with me and taught me a lot.

From the Department of Molecular Medicine, Mayo Clinic College

of Medicine, I specially thank all the members of my laboratory: Sompong,

thank you so much for your infinite kindness and for welcoming me so well

in the lab; Patricia, thank you for teaching me a lot of techniques, for

reading my many attempts of writing science and for being a friend; Jorge,

my desk (almost) and bench colleague, thank you so much for your infinite,

infinite patience and for always helping me and try to solve my science

problems; Vincent, thank you so much for being always a good colleague

Acknowledgments

viii

and for your unmeasurable help in finishing the manuscript; Chanakha,

thank you so much; I wish we had played tennis more often; K.C. thank you

so much for you taught me to look only at the good in people and to accept

challenges with good thoughts, strength and faith. Thank you for your

pleasant company during our Saturday and Sunday lunches at the

Methodist cafeteria; Marie, thank you for your precious help in the lab and

in the animal facility and during all our meetings; Andrew, thank you for

your always good mood and kindness in helping everyone; Guy and

Johanna, thank you.

From the all floor of the Department of Molecular Medicine, I thank

all who helped me to go through these four years. To Richard Vile, Memy

Diaz, Candice Willmon, Ponpimon Wongthida, Feorillo Galivo, Tim Kottke,

Yasuhiro Ikeda, Ruyta Sakuma, Mark Federspiel, a special thank you. I also

thank the former director of the Department of Molecular Medicine,

Stephen Russell.

From the Department of Immunology, Mayo Clinic College of

Medicine, I thank Larry Pease, Hirohito Kita, Richard Vile and Adam Schrum

for valuable scientific ideas and discussions.

From the Transplantation Biology Unit, Mayo Clinic College of

Medicine, I thank Josie Williams, Kim Butters, Karen Lien, Bruce Knudsen,

Brenda Ogle and Gregory Brunn for all their immense support and help.

From the Department of Urology, Mayo Clinic College of Medicine, I

thank Sue Kunts for her precious help with the immuno stainings.

Acknowledgments

ix

From the Mayo Clinic Flow Cytometry and Optical Morphology Core

Facility I thank James Tarara and his team for their technical assistance and

valuable advice.

And I want to thank all my friends from around the world that

became my family during the time spent in Rochester and made my life so

much better: Catarina Cortesão for being so patient and such a good friend

and such a positive company; Susanne Lang, for being unique and for being

always there; Cristina Correia for her infinite patience and nice

conversations during coffee breaks; Sarwa Darwish-Murad for being such a

beautiful person and being there and to all the great people I met and that

I had the pleasure of being friends with: Josef Korinek, Filippo Agnesi,

Clifton Haider, Kostandinos Sideras, Noemi Vidal-Folch, Xavier Frigola-Baro,

Wissam ElRiachy, Justo Sierra Johnson, Angel Gonzalez, Laura Moreno-

Luna, Pedro Geraldes, Carolina Trabuco, Sandra Herrmann, Barry Boilson,

Aisling Carroll, Bolaji Ajao, Chris Van Der Walt, Alain, Jasminka and Dannah

Bernheim, Cristina João and Paulo Nicola and many more…

I could not not thank all the friends I made through my life: Elsa,

Maria, Catarina Noronha, Catarina Loureiro, Orieta, Fernanda, Gabi,

Catarina Cortesão, a special thank you. You mean a lot to me.

I have a special thank to Prof. Doutora Laurentina Pedroso for her

support at the Universidade Lusófona de Humanidades e Tecnologias,

where I’m a collaborator.

Acknowledgments

x

I thank with all my heart to my family, for their abundant support,

understanding and for strength. And I have a very special thank to Tiago,

for his support, for the strength, understanding and love.

.

Resumo

xi

Resumo

O desenvolvimento de novas terapias, de vacinas e a aplicação dos

vírus no tratamento do cancro será melhor sucedido quanto mais

abrangente e aprofundado for o conhecimento da interacção entre o vírus

e o hospedeiro.

Esta tese tem como objectivo global compreender a interacção

entre o vírus do sarampo e o hospedeiro e as consequências dessa

interacção no tropismo e patogénese viral. Em particular, pretende-se

identificar as células alvo iniciais do vírus bem como as células responsáveis

pela disseminação do vírus no hospedeiro. Pretende-se ainda compreender

os mecanismos de atenuação do vírus atenuado do sarampo.

O vírus do sarampo é transmitido através de aerossóis e, apesar da

infecção ter início no aparelho respiratório, as células alvo iniciais do vírus

não são conhecidas. A partir do aparelho respiratório o vírus alcança os

orgãos linfáticos e inicia a replicação nos nódulos linfaticos que drenam o

aparelho respiratório.

Apesar de vários estudos terem sido desenvolvidos, a contribuição

da interacção entre os receptores e o vírus no tropismo viral e progressão

da infecção têm sido restringidos pela falta de um modelo animal

adequado. Os macacos são os únicos primatas não humanos que mostram

susceptibilidade ao vírus do sarampo. No entanto, o seu uso fica muito

limitado devido a questoes éticas e monetárias. O vírus wild type do

sarampo utiliza como receptor celular uma proteína expressa em células

Resumo

xii

activadas do sistema imune denominada de molécula de sinalização de

activação linfocitária (SLAM, CD150). Com o objectivo de desenvolver um

modelo animal para o estudo da infecção pelo vírus do sarampo, ratinhos

transgénicos SLAMGe, ratinhos que expressam o SLAM humano (hSLAM),

foram cruzados com ratinhos que apresentam inactivação do gene que

codifica para o receptor do interferão tipo I, ratinhos Ifnarko

, de forma a

permitir uma replicação do vírus mais eficiente. Os ratinhos resultantes do

cruzamento foram denominados ratinhos Ifnarko

-SLAMGe. São deficientes

na produção de interferão tipo I e expressam hSLAM com um perfil de

expressão idêntico ao dos humanos. Estes ratinhos foram utilizados neste

estudo para caracterizar as células infectadas pelo vírus do sarampo

imediatamente após infecção respiratória bem como as células

responsáveis pela progressão e disseminação do vírus no hospedeiro.

Em primeiro lugar caracterizamos a expressão do hSLAM nos

ratinhos Ifnarko

-SLAMGe. A expressão de hSLAM foi detectada em linfócitos

B e T extraídos do baço e em macrófagos produzidos a partir da medula

óssea, através de citometria de fluxo, após activação destas células ex vivo.

Uma vez que o linfonodo mediastinal foi previamente demonstrado ser

relevante na infecção pelo vírus do sarampo em ratinhos SLAM, estudamos

a expressão de hSLAM em células imunes provenientes do linfonodo

mediastinal de ratinhos Ifnarko

-SLAMGe. Através de citometria de fluxo

demonstramos que os linfócitos B e T não activados provenientes do

linfonodo mediastinal expressavam baixos níveis de hSLAM.

Documentamos ainda que, mais células B do que células T expressavam

Resumo

xiii

hSLAM, como previamente demonstrado em tecidos linfáticos humanos.

Uma vez que SLAM é expresso em células imunes e não em células

epiteliais, as células imunes presentes nas vias respiratórias são candidatas

a células alvo para a replicação do vírus. Desta forma, analizamos a

expressão de hSLAM em células imunes provenientes dos pulmões do

ratinho Ifnarko

-SLAMGe. Cerca de 9% de células B e 3% de células T

expressavam hSLAM nos pulmões do ratinho Ifnarko

-SLAMGe e baixa

percentagem de macrófagos alveolares expressavam hSLAM.

De seguida, estes ratinhos foram inoculados via intranasal (IN) com

o vírus do sarampo wild type. Um vírus derivado da estírpe Ichinoise B e ao

qual foi adicionado o gene que codifica para a expressão da proteína verde

fluorescente, wtMVgreen. Vários orgãos foram recolhidos um, dois e três

dias após a inoculação e analizados para a expressão de proteína

fluorescente. Um dia após inoculação a replicação viral foi detectada nos

pulmões, e, de seguida, em vários orgãos do sistema linfático; inicialmente

no linfonodo que drena o aparelho respiratório, o linfonodo mediatinal, e

mais tarde em outros orgãos linfáticos, nomeadamente nos linfonodos

mandibular, inguinal e mesentérico, no baço e em células mononucleares

do sangue periférico.

Para responder à questão quais as células que sustentam a

replicação do vírus imediatamente após inoculação, os ratinhos foram

inoculados via IN com wtMVgreen; os pulmões e vários orgãos linfáticos

foram recolhidos e as células infectadas foram identificadas pela expressão

de proteína verde fluorescente através de citometria de fluxo.

Resumo

xiv

Os macrófagos alveolares foram identificados como as principais

células que sustêm a replicação do vírus do sarampo imediatamente após

inoculação respiratória. As células dendríticas foram 5 vezes menos

infectadas. Outras populações de células imunes foram infectadas em

menor extensão.

Apesar da expressão de SLAM pelos macrófagos alveolares ser

muito reduzida, 24 horas apos a infecção a expressão de SLAM aumentou

drasticamente; 0.86% de macrófagos alveolares expressava SLAM antes da

infecção, passando 16% a expressarem SLAM após a infecção. Este

resultado sugere que o vírus do sarampo utiliza um receptor celular que é

facilmente induzido nas células alvo, contribuindo assim para uma rápida e

eficiente disseminação no hospedeiro.

Dois dias após a inoculação IN o vírus propagou-se ao sistema

linfático sendo o linfonodo mediastinal o primeiro orgão linfático a ser

infectado e o que suportou título viral mais elevado. Através de citometria

de fluxo identificaram-se os linfócitos B e T como as principais células

infectadas bem como células dendríticas, pese embora em menor grau.

Por último, com o objectivo de compreender os mecanismos de

atenuação da estírpe do vírus usada como vacina do sarampo, foi

caracterizada a infecção e disseminação do vírus do sarampo atenuado,

denominado aqui de MVvac. Ratinhos Ifnarko

-SLAMGe foram inoculados

com MVvac pela via de infecção intraperitoneal (IP) e o título viral foi

determinado em vários orgãos linfáticos (nomeadamente nos linfonodos

mandibular, mediastinal, mesentérico e inguinal e no baço). A replicação

Resumo

xv

do vírus atenuado nos orgãos do ratinho foi muito baixa comparada com a

replicação do wild type. Três dias após inoculação, o orgão que apresentou

um título viral mais elevado foi o linfonodo mediastinal seguido do

linfonodo mesentérico e do baço. A replicação nos linfonodos mandibular e

inguinal ficou aquém do limite de detecção. Apesar de o linfonodo

mediastinal ser o orgão linfático onde o vírus mais eficientemente se

replicou a replicação neste linfonodo pelo MVvac foi cerca de 100 vezes

inferior à replicação pelo vírus wild type. De seguida, as células que

sustentam a replicação deste vírus bem como do wild type foram

identificadas. Um e três dias após a infecção, o linfonodo mediastinal e o

baço foram recolhidos e secções destes orgãos foram analisadas através de

microscopia confocal. Um dia após inoculação, ambos os vírus infectaram

uma população de macrófagos presente na região subcapsular dos

linfonodo e na zona marginal do baço, denominados macrófagos do seio

subcapsular (macrófagos SSC). Após uma primeira interacção com os

macrófagos, foi observada uma disseminação generalizada do vírus do wild

type nos folículos do linfonodo bem como na polpa branca do baço. Em

contraste, quando os ratinhos foram inoculados com um vírus do sarampo

atenuado, apesar de o vírus ser encontrado na região subcaspular do

linfonodo e zona marginal do baço no primeiro dia após infecção,

colocalizando com os macrófagos SSC, esta infecção inicial não foi seguida

de infecção massiva das células linfáticas nestes orgãos. O vírus foi

eliminado, observando-se apenas alguma replicação no linfonodo

mediastinal e baço mas inferior à replicação pelo wild type.

Resumo

xvi

Ainda com o objectivo de esclarecer o mecanismo de atenuação do

vírus do sarampo atenuado caracterizamos a replicação de um virus wild

type com uma substitução de um aminoácido na proteína hemaglutinina.

Esta mutação, asparagina por tirosina, no aminoácido 481 na proteína

hemaglutinina (N481Y), está presente em todas as estirpes atenuadas do

vírus do sarampo mas não no vírus wild type. Esta substituição introduzida

no genoma do vírus wild type permite ao vírus, que apenas usa o SLAM

como receptor celular, passar também a utilizar o receptor CD46. O

receptor CD46 ou cofactor proteico membranar (MCP) é expresso em

todas as células nucleadas do corpo humano. Todas estirpes atenuadas do

vírus do sarampo para além de SLAM utilizam o CD46 como receptor

celular. Para aceitar ou revogar a hipótese de que esta mutação presente

no vírus atenuado pode afectar o fitness do vírus, introduzimos esta

mutação num vírus wild type, denominado aqui wtMVN481Y e

comparamos a replicação in vivo deste vírus com um vírus wild type

original, wtMV. Para tal, ratinhos Ifnarko

-SLAMGe forma inoculados via IP

com wtMVN481Y ou wtMV. Três dias após inoculação, o título do vírus foi

determinado em vários linfonodos e no baço. Demonstramos que esta

mutação não afecta a replicação nem o tropismo do vírus uma vez que não

se verificaram diferenças relevantes na replicação dos vírus nos diferentes

orgãos. De seguida, para compreender se a interacção com o receptor

CD46 para além do SLAM afecta a replicação e disseminação do vírus,

obtivemos ratinhos transgénicos que expressam o CD46 humano (hCD46)

para além do hSLAM, aqui denominados de ratinhos Ifnarko

-CD46Ge-

Resumo

xvii

SLAMGe. Inoculamos ratinhos Ifnarko

-CD46Ge-SLAMGe e ratinhos Ifnarko

-

SLAMGe com o vírus wtMVN481Y e comparamos a replicação e

disseminação deste vírus em vários orgãos linfáticos destes ratinhos. Não

foram encontradas diferenças significativas na replicação e tropismo deste

vírus o que sugere que o uso do receptor CD46 é pouco relevante na

atenuação do vírus do sarampo.

Este estudo demonstra que os macrófagos e as células dendríticas

são as células alvo iniciais do vírus do sarampo e que podem estar

envolvidas na rápida disseminação do vírus para outras células imunes no

organismo. Demonstra-se ainda que, os macrófagos como células alvo

iniciais, aliado à baixa replicação do vírus do sarampo atenuado parecem

desempenhar um papel importante na atenuação deste vírus. O uso do

receptor CD46 parece ser pouco relevante no mecanismo de atenuação do

vírus. Para além disso, a linha de ratinhos transgénicos que expressam o

receptor hSLAM são uma peça chave no estudo das fases iniciais de

infecção do vírus do sarampo.

Palavras Chave: macrófagos alveolares, células dendríticas, vírus do

sarampo, SLAM, CD46, tropismo.

Abstract

xix

Abstract

Measles virus (MV) is one of the most infectious viruses but several

aspects of MV biology and pathogenesis remain poorly understood. The

virus is transmitted by aerosol droplets and initial infection is believed to

occur in the upper airways but the cells that support early infection and

viral spread throughout the body are not well defined. As wild type MV

(wtMV) enters cells through SLAM but not CD46 receptor, we generated a

transgenic mice expressing human SLAM (hSLAM) and used these mice to

identify the cells supporting primary MV infection. We first characterized

hSLAM expression in immune cells of these mice by flow cytometry. We

documented hSLAM expression in resting B and T cells in the mediastinal

lymph node (LN) and in B and T cells and in a small fraction of alveolar

macrophages (AM) collected from the lungs. Next, we inoculated these

animals intranasally and assessed viral infection in the nasal associated

lymphoid tissue, lungs, several LN, spleen and thymus. One day post

inoculation (p.i.), viral replication was documented in the lungs; the AM

and dendritic cells (DC) were the main infected cells. It was observed that

MV infection temporarily enhanced hSLAM expression in AM. From the

lungs, infection spread to all lymphatic organs and in particular to the

mediastinal LN. This LN supported high levels of infection upon IN and

intraperitoneal inoculation. Finally, to understand the mechanisms of MV

vaccine attenuation, we compared the spread of wtMV with that of a

vaccine strain (MVvac) in Ifnarko

-SLAM mice. One day p.i. MV was detected

Abstract

xx

in the subcapsular macrophages in the mediastinal LN. Three days later,

the wtMV spread to hSLAM expressing leukocytes whereas the MVvac was

cleared. As the wtMV does not enter cells through CD46 receptor but the

attenuated strain does, we compared the replication of a wtMV carrying a

mutation in the hemagglutinin protein allowing CD46 usage. CD46 usage

seems to have no relevant effect on MV attenuation. Thus, SLAM

expressing mice allowed characterization of the early steps of MV

infection. The alveolar macrophages and dendritic cells are the key players

in MV infection and propagation.

Keywords: alveolar macrophages, dendritic cells, measles virus, SLAM,

CD46, tropism.

Abbreviations

xxi

AAbbbbrreevviiaattiioonnss

aa amino acid

APC antigen presenting cell

APC-Cy7 allophycocyanin-Cy7

B95a marmoset B-cell line

BM bone marrow

CAT chloramphenicol acetyltransferase

CCPs complement control protein repeats

CD46 membrane cofactor protein

cDNA complementary DNA

CDV canine distemper virus

Cyt cytoplasmic

DAPI 4',6-diamidino-2-phenylindole

DC dendritic cells

DMEM dulbeco’s modified eagle medium

DNA deoxyribonucleic acid

EDTA ethylenediaminetetraacetic acid

ER endoplasmic reticulum

F fusion

FACS flow activated cell sorter

FBS fetal bovine serum

FITC fluorescein isothiocyanate

G guanosine

GFP green fluorescent protein

GM-CSF granulocyte-macrophage colony-stimulating factor

H hemagglutinin

hCD46 human CD46

hSLAM human SLAM

HδR hepatitis delta virus ribozyme

i.e. id est

IC-B ichinoise-B

IFN interferon

IFNAR interferon type I receptor

Ifnarko

interferon type I receptor knock out

Abbreviations

xxii

Ig immunoglobulin

IL interleukin

IN intranasal

IP intraperitoneal

IRF IFN regulatory factor

ISGF3 IFN-stimulated gene factor 3

ISRE IFN-stimulated response element

Kb kilobase

kDa kilo Dalton

KO knock out

L large

LcK lymphocyte protein tyrosine kinase

LN lymph node

LPS lipopolysaccharide

M matrix

M.O.I. multiplicity of Infection

MCP membrane cofactor protein

MDA-5 melanoma differentiation-associated gene 5

mL milliliter

Mm millimeter

mM millimolar

mRNA messenger RNA

MHC major histocompatibility complex

MS marginal sinus

MV measles virus

MW molecular weight

N nucleocapsid

NALT nasal associated lymphoid tissue

Nm nanometer

ºC degree celsius

ORF overlapping reading frame

P phosphoprotein

p.i. post infection

PBMC peripheral blood mononuclear cells

PBS phosphate buffered saline

PCR polymerase chain reaction

Abbreviations

xxiii

PCT C-terminal domain

PE phycoerythrin

PerCP peridin chorophyll protein

PNT N-terminal domain

PRRs pattern-recognition receptors

RdRp RNA dependent RNA polymerase

RIG-I retinoic acid-inducible gene I

RLRs retinoic acid-inducible gene I (RIG-I)-like receptors

RNA ribonucleic acid

RNP ribonucleocapsid

Rpm revolutions per minute

RPMI Roswell Park Memorial Institute

RT room temperature

SAP SLAM-associated protein

SCR short consensus repeats

SCS subcapsular Sinus

SDS-PAGE sodium dedecyl sulfate-polyacrylamide gel electrophoresis

SLAM signaling lymphocytic activation molecule

SSPE subacute sclerosing panencephalitis

STAT signal transducers and activators of transcription

STP serine-threonine-proline

TBS tris-buffered saline

TCID50 tissue culture infectious dose 50%

Th2 T helper 2

TLC thin layer chromatography

TLRs toll-like receptors

TNF-α tumor necrosis factor alpha

Tyr110 tyrosine 110

UV ultra violet

VSV vesicular stomatitis virus

WT wild type

μg microgram

μl microlitre

μm micrometer

Table of Contents

xxv

Table of Contents

Preface

v

Acknowledgments vii

Resumo xi

Abstract xix

Abbreviations xxi

Table of Contents xxv

Chapter 1 General introduction 1

1.1. Taxonomy 3

1.2. History of measles 4

1.3. Clinical features of measles 5

1.4. Basic biology 6

1.4.1. Virion structure and genome 6

1.4.1.1. Nucleocapsid protein 9

1.4.1.2. P, V, and C proteins 10

1.4.1.3. Matrix protein 12

1.4.1.4. Fusion protein 13

Table of Contents

xxvi

1.4.1.5. Hemagglutinin protein 14

1.4.1.6. Polymerase protein 15

1.4.2. Measles virus life cycle 16

1.4.3. Measles virus receptors 19

1.4.3.1. CD46 20

1.4.3.2. SLAM 23

1.4.3.3. Other receptors 24

1.5. Measles virus pathogenesis 27

1.5.1. Measles virus entry and spread 27

1.5.2. Immune response to measles virus infection 28

1.5.2.1. Innate immunity 28

1.5.2.2. Humoral immunity 29

1.5.2.3. Cellular immunity 30

1.5.3. Measles virus-induced immunosuppression 31

1.6. Mouse models for the study of measles pathogenesis: SLAM

transgenic mice

32

Aims 37

Chapter 2 Measles virus infection of transgenic mice expressing

human signaling lymphocytic activation molecule (SLAM, CD150)

39

Table of Contents

xxvii

Abstract 41

Introduction 43

Materials and Methods 45

Mouse strains 45

Mouse infections 45

Generation of a wild type MV expressing the reporter gene

chloramphenicol acetyl transferase

45

Rescue of viruses and preparation of virus stocks 46

Isolation and activation of B and T lymphocytes 47

Isolation and activation of macrophages 48

Flow cytometry 49

Immunohistochemistry 49

CAT assay 49

Results 51

Human SLAM expression in lymphocytes of hSLAM transgenic

mice

51

Human SLAM expression in macrophages of hSLAM transgenic

mice

52

Ifnar deficiency increases susceptibility to wild type MV

replication in hSLAM transgenic mice

54

Table of Contents

xxviii

Spread of MV in Ifnarko

-SLAMGe mice 57

Discussion 60

Chapter 3 Measles virus infection of alveolar macrophages and

dendritic cells precedes spread to lymphatic organs in transgenic

mice expressing human signaling lymphocytic activation molecule

(SLAM, CD150)

63

Abstract 65

Introduction 67


Mouse strains 70

Mouse infections 71

Viruses and virus stock preparation 72

Blood and organ collection, and preparation of single cell

suspensions

73

Immunohistochemistry and immunofluorescence 74

Flow cytometry 76

Quantification of virus load in lymphatic organs 77

Results 78

Ifnarko

-SLAMGe transgenic mice 78

Table of Contents

xxix

Human SLAM expression in lymphatic tissue of Ifnarko

-SLAMGe

transgenic mice

79

Human SLAM expression in immune cells of the lungs of Ifnarko

-

SLAMGe transgenic mice

80

Early MV replication in the lungs of Ifnarko

-SLAMGe transgenic

mice

82

AM sustain MV replication in the lungs 85

MV infects AM expressing SLAM, and MV infection enhances

SLAM expression

88

Spread in the lymphatic organs 90

Discussion 93

A new small animal model of MV infection 93

Crossing the epithelial barrier: alternatives 95

SLAM expression and virus amplification 97

Chapter 4 Pathways of lymphatic dissemination of measles virus

attenuated and wild type strains in SLAM expressing mice

99

Abstract 101

Introduction 103


Cells 104

Table of Contents

xxx

Cell infections 104

Mouse strains 105

Mouse infections 105

Site-specific mutagenesis of measles virus H protein 105

Viruses and virus stock preparation 106

Organ collection and preparation of single cell suspensions 106

Flow cytometry 106

Immunofluorescence 106

Quantification of virus load in lymphatic organs 107

Results 107

Low efficiency of replication of MV vaccine strain 107

Early capture of wild type and vaccine strains of MV by

subcapsular macrophages

108

Only wild type MV infection progresses to B and T cell areas 110

Replication of a recombinant wild type MV with a single

mutation allowing different receptor usage

114

Discussion 119

Chapter 5 Main conclusions and future perspectives 123

References 131

General Introduction

1

CHAPTER 1

General introduction


3

1.1. Taxonomy

Measles virus (MV) is a member of the family Paramyxoviridae, genus

Morbillivirus within the Mononegavirales order. The Paramyxoviridae are

enveloped viruses with a single-stranded nonsegmented RNA genome of

negative polarity. This family includes some of the most relevant pathogens

of humans and animals (Table 1).

Family

Subfamily Genus Species

Paramyxoviridae Paramyxovirinae Respirovirus Bovine parainfluenza virus

3

Human parainfluenza virus

1 and 3

Sendai virus

Rubulavirus Human parainfluenza virus

2, 4a and 4b

Parainfluenza virus 5

Mumps virus

Morbillivirus Canine distemper virus

Dolphin morbillivirus

Cetacean morbillivirus

Measles virus

Peste-des-petits-ruminants

virus

Phocine distemper virus

Rinderpest virus

Avulavirus Newcastle disease virus


4

Family

Subfamily Genus Species

Paramyxoviridae

Pneumovirinae Pneumovirus Bovine respiratory syncytial

virus

Human respiratory

syncytial virus

Ovine respiratory syncytial

virus

Pneumonia virus of mice

Henipaviruses Hendra virus

Nipah virus

Table 1. Examples of members of the family Paramyxoviridae. (Adapted

from Lamb, R.A. and Parks, G.D., Fields Virology, 2007).

1.2. History of measles

Measles is postulated to have emerged in the early civilization centers

in the Middle East around 3000 B.C.. Abu Becr is known as the first to

distinguishing measles from smallpox in the 9th

century. Many of the

epidemiological aspects of measles were elucidated by a young Danish

physician during a measles epidemic in 1846 in the Faroe Islands. He

postulated the respiratory route of transmission, the highly contagious

nature of the disease, a 14 days incubation period and the lifelong

immunity present in the older population (135). In 1790, an English

surgeon described measles complications, namely a case of post-measles

encephalomyelitis in a young woman who developed paresis as the rash

started to fade (103). Nineteenth century text books associated measles


5

infection with reactivation of latent tuberculosis and immunosuppression

caused by MV is connoted to von Pirquet, who observed, in 1908,

suppression of the tuberculin test response during measles (197).

1.3. Clinical features of measles

Measles is transmitted by aerosol droplets, and initial infection is

believed to be established in the respiratory tract although primary target

cells are not well defined. From the respiratory tract the virus spreads to

the regional lymph nodes where viral amplification occurs resulting in

viremia. The disease is characterized by an incubation period of 10-14 days,

followed by a 2 to 4 days of prodrome of fever, anorexia, cough and

conjunctivitis (59). During this phase, small white spots, Koplik’s spots, may

become visible in the buccal mucosa and are pathognomonic of measles

(90). The appearance of a maculopapular rash marks the end of the

prodrome and lasts 3 to 4 days. Recovery begins soon after onset of the

rash (59) with the appearance of a marked cellular and humoral immune

response conferring lifelong protective immunity (135). Concomitantly with

activation of the immune system a transient but profound

immunosuppression occurs. This immunosuppression continues for weeks

after apparent recovery and increases the host’s susceptibility to

opportunistic infections which accounts for measles associated deaths.

Several complications are associated with measles, including pneumonia,

encephalitis, otitis media, blindness, and secondary infections by bacteria

and viruses. Interstitial pneumonia caused by MV replication and


6

inflammation in the lower respiratory tract can occur in healthy patients

(58, 68) whereas giant cell pneumonia is seen mostly in

immunocompromised individuals (131). Diarrhea is a common

gastrointestinal complication of measles and frequently is associated with

bacterial infections.

A rare complication of measles is subacute sclerosing

panencephalitis (SSPE). SSPE is caused by a progressive dissemination of

defective virus replication in the central nervous system and occurs in

young individuals several years after infection (91, 122). In about 1 in 1000

cases measles is complicated by a post-infectious encephalitis that usually

occurs within 14 days after the onset of rash and mostly in individuals

under the age of 2 years (83). In contrast to SSPE, little evidence of viral

invasion of the central nervous system is observed and pathological studies

suggest an autoimmune etiology (51). Another measles-induced

neurological complication is measles inclusion body encephalitis or

progressive infectious encephalitis. It occurs 3 to 6 months after the

regular disease and is seen in immunocompromised individuals (115).

1.4. Basic biology

1.4.1. Virion structure and genome

Measles viral particles are pleomorphic or spherical with diameters

ranging from 120 to 300-1000 nm and therefore have variable cargo

volume and tolerate well foreign gene insertion (59, 148). The envelope,

composed of a lipid bilayer derived from the plasma membrane of the host


7

cell, surrounds the virions and contains surface projections composed by

the hemagglutinin (H) and the fusion (F) glycoproteins. The matrix (M) lines

the inner surface of the envelope and associates with the cytoplasmic tails

of the H and F proteins as well as the viral core particle or nucleocapsid.

The viral RNA genome is encapsidated by the nucleoprotein (N) to

form a helical ribonucleocapsid (RNP) that is the substrate for both

transcription and replication. These latter activities are carried out by the

RNA dependent RNA polymerase (RdRp) that is composed of the large (L)

protein and of the phosphoprotein (P). A schematic representation of a MV

particle is shown in Fig. 1 (A).

The 15,894 nucleotide long MV genome contains six genes, coding

for eight proteins in the order 3’-N-P/V/C-M-F-H-L-5’. The P gene uses

overlapping reading frames to code for three proteins, P, V and C. These

genes are flanked by a 3’ extracistronic region, the leader, and a 5’

extracistronic region, the trailer, that are essential for transcription and

replication Fig. 1 (B).


8

Figure 1. (A) Schematic diagram of a polyploid MV particle containing

three genomes. The viral nucleocapsid (N), phosphoprotein (P),

polymerase (large, L), matrix (M), fusion (F), and hemagglutinin (H) proteins

are indicated with different symbols. (B) Diagram of the MV antigenome

(plus strand). The coding regions of MV genes are represented by arrow-

shaped boxes.

M

H (tetramer)

F (trimer)

N

L

P

A

NN P/V/C M H LF

1 15894

B


9

1.4.1.1. Nucleocapsid protein

The nucleocapsid messenger RNA, the first to be transcribed, codes

for the N protein (525 aa), the most abundant viral protein. The N protein

is an RNA-binding protein that encapsidates the full length viral (-) sense

genomic and (+) sense antigenomic RNAs within a helical nucleocapsid

template. The helical nucleocapsid rather than the free genome RNA is the

template for all the RNA synthesis (95). Each N protein coats 6 nucleotides,

the so called “rule of six” i.e. their genome must be of polyhexameric

length to efficiently replicate (20). The binding of N to RNA to form a helical

structure is thought to have several functions, including protection from

nuclease digestion and providing interaction sites for assembly of

nucleocapsids into budding virions (95).

Biochemical and mutational studies have identified two structural

regions in the N protein: N core, a conserved N-terminal domain and a non

conserved N tail, C-terminal. The N core has ~ 400 aa and is essential for

self assembly of N with RNA, RNA binding and for RNA replication. The C-

terminal N tail region is ~ 100 aa and interacts with a C-terminal domain of

P protein. In infected cells, two forms of N exist: a monomeric form

(referred to as N0) and an assembled form (referred to as N

NUC) (55). In its

assembled form, N interacts with P and the polymerase complex (L–P),

which is essential to RNA synthesis by the viral polymerase (18). In its

monomeric form, it is responsible for the encapsidation of the nascent RNA

chain during genome and antigenome replication. During virus assembly, N


10

interacts with the M protein. Finally, it interacts with cellular factors,

including cytoskeleton components.

During the course of infection, polymerase activity changes from

transcription to replication. By analogy with studies made in vesicular

stomatitis virus (VSV) (14), the intracellular concentration of unassembled

N is thought to be a major factor controlling the rates of transcription and

replication from the genome templates.

1.4.1.2. P, V, and C proteins

The P protein, 507 aa, plays multiple roles in both transcription and

replication. It is an essential component of the viral polymerase and binds

to the nucleocapsid tethering the polymerase complex L-P to the

nucleocapsid (NNUC

) template (79, 88). It is a modular protein consisting of

at least 2 domains: an N-terminal domain (PNT) and a C-terminal domain

(PCT). The acidic and highly phosphorylated N-terminal domain includes aa

1 to 230 and is poorly conserved. It is the assembly module required to

chaperone unassembled N protein as a P-N complex during the nascent

chain assembly step of genome replication (73, 173). The C-terminal

domain (aa 231-507) is well conserved; it represents the polymerase

cofactor module and mediates binding of L to the N-RNA template.

In addition to the P protein, the P gene gives rise to two other

polypeptides by means of using overlapping reading frames (ORF) on a

single transcript. The C ORF is accessed by translational choice using an

initiator methionine codon 19 nucleotides downstream from that of P (10).


11

In contrast, the V protein shares the initiator methionine and the amino-

terminal 231 aa of the P protein but has a different C-terminal region. An

extra non-template-directed guanosine (G) residue at position 751 is added

following three Gs by a process known as RNA editing or pseudotemplated

transcription (25). This nucleotide addition results in a shift of the

translational reading frame into an alternative reading frame and hence a

different C-terminal region. The last 276 aa normally encoded by the P

mRNA are replaced with a cyteine-rich domain of 68 aa (25) that has zinc-

binding properties (100).

The N-terminal region of the P protein, as the collinear region of the

V protein, binds to STAT1, with the Tyr110 residue playing a key role in this

interaction (19, 38, 128). The C and V proteins play a role in the regulation

of transcription and replication and are not found in the virions (101, 188).

The V and C proteins have been analyzed for their ability to modulate

either interferon (IFN) type I or its signaling pathways. The C protein is

implicated in inhibition of IFNAR downstream signaling (166), modulation

of the viral polymerase activity, inhibition of cell death and of inflammatory

responses (9, 150, 185). Other reports show that V protein can counteract

the interferon antiviral activity and can inhibit the inflammatory response

in infected peripheral blood monocytic cells of experimentally infected

monkeys (36).


12

1.4.1.3. Matrix protein

The M protein, coded by the third gene, is a basic protein and

underlies the viral lipid bilayer. M is thought to play a crucial role in the

assembly of progeny virus by interacting with the RNP (70, 71). In addition,

M interacts with the cytoplasmic tails of H and F proteins (23, 174) and

drives the apical assembly of MV leading to the release of infectious

particles early after infection (116). Abrogation of M function dramatically

alters the assembly of MV (12, 22). M inactivation or failure to associate

with budding structures or with the viral nucleocapsid is likely to be a

factor responsible for MV persistent infection where release fails to occur.

In SSPE the M protein is either absent (12) or, when present, is not

associated with budding structures in cultivated cells and is not able to

bind to viral nucleocapsid in vitro (27, 70, 71). In addition, the M protein

controls fusion function of the viral envelope glycoproteins (22). A

genetically engineered recombinant MV that lacks M shows increased cell-

to-cell fusion and decreased production of infectious particles (22). More

recently, Tahara et al. (179), identified two substitutions in the M protein

of attenuated MV, P64S and E89K, that, by allowing a strong interaction

with the cytoplasmic tail of H, enhanced the assembly of infections

particles in Vero cells but inhibited MV signaling lymphocytic activation

molecule (SLAM)-dependent cell-cell fusion, reducing viral growth in B

lymphoid cells. By modulating viral growth, M protein may partly account

for the attenuation of MV attenuated strains (178, 179).


13

1.4.1.4. Fusion protein

The F protein mediates viral entry with release of the RNP into the

cytoplasm by fusion between the virion envelope and the host cell plasma

membrane at neutral pH. Later in infection, the F protein, expressed at the

cell surface membrane, can mediate fusion with neighboring cells to form

syncytia (giant multinucleated cells), a cytopathic effect caused by MV that

is an alternative mechanism of viral spread.

The fusion protein, 533 aa, is a type I transmembrane glycoprotein

(151). MV F protein includes an N terminal cleavable signal sequence that

targets the nascent polypeptide chain synthesis to the membrane of the

endoplasmic reticulum (ER). At the C terminus, a hydrophobic stop-transfer

domain anchors the protein in the membrane leaving a short 33 aa

cytoplasmic tail.

F is synthesized as an inactive precursor, F0 and gains its fusogenic

activity by cleavage by the ubiquitous intracellular protease furin, localized

in the trans Golgi network (15, 201). Proteolytic cleavage results in a

disulfide-linked fusion competent F protein that consists in a

transmembrane F1 and a membrane distal subunit F2. F1 contains a stretch

of hydrophobic aa at the N-terminus constituting the fusion peptide that is

inserted into the target membrane when fusion occurs. The F2 subunit

contains all three N-linked glycans that have a role in proteolytic cleavage,

stability and transport to the cell surface (77, 193).

The MV F-protein is classified as a class I fusion protein (94). Class I

fusion proteins mediate membrane fusion by coupling irreversible protein


14

refolding to membrane juxtaposition. This is accomplished by discrete

conformational changes of a metastable F protein structure to a lower

energy structure. The cleavage of F0 into F1-F2 primes the protein for

membrane fusion. Activation of the F-protein results in the insertion of the

fusion peptide located in the F1 subunit into the target membrane. This is

followed by dramatic conformational rearrangements of the F trimer and

results in juxtaposition of the target and donor membranes (205). As the F-

protein goes from a high-energy metastable structure to a low-energy

post-fusion structure, this eventually leads to the formation of a fusion

pore through which the RNP complex enters the cell (95).

1.4.1.5. Hemagglutinin protein

The H protein is the receptor attachment protein and is an

important determinant of cellular tropism. It is a 617 aa type II

transmembrane glycoprotein which is comprised of a N-terminal

cytoplasmic tail of 34 aa followed by a membrane-spanning domain and an

extracellular membrane - proximal stalk region connected to a C-terminal

receptor-binding head domain (3). Receptor-binding residues have been

mapped to this head domain (76, 99, 121, 177, 198). While other

paramyxovirus attachment proteins are globular, MV H protein exhibits a

cube shaped structure. A significant area of the H protein is covered with

N-linked oligosacharides which makes it unavailable for receptor

interaction (67). In contrast to other paramyxovirus attachment proteins, H

only forms dimers (142). The two H protein molecules making up the


15

homodimer are highly tilted with respect to each other. This has further

consequences for receptor specific fusion.

The first step in the fusion process is binding of H to its receptor. On

binding ligand, the H protein undergoes its own conformational change,

which in turn triggers a conformational change in F to release the fusion

peptide. The H protein of the Edmonston strain has five predicted N-linked

glycosylation sites; the first four of these sites are used. Glycosylation is

necessary for proper folding, antigenicity, dimerization, and export of H

from the Golgi (78).

1.4.1.6. Polymerase (large)

The L protein is the least abundant but the largest protein (240

KDa). The L gene codes for the paramyxovirus RdRp which possess all

enzymatic activities necessary to synthesize mRNA, like nucleotide

polymerization, 5’ end mRNA capping and methylation, and

polyadenylation of mRNA (57, 69, 124). L adds poly-A tails to nascent viral

mRNAs cotranscriptionally by stuttering on a stretch of U residues

occurring at the end of each viral gene.

L includes six highly conserved domains that were identified by

sequence comparisons. The exact role of several domains is not clear but

mutations in some of these domains resulted in L proteins that although

were able to transcribe viral mRNA were defective in RNA replication (143,

169).


16

L binding to the viral P protein is mapped to the N-terminal 408 aa

of L (73) and this interaction confers stability to L (65, 72). Within the L-P

complex, the P protein bridges the L polymerase to the nucleocapsid

template. The L protein besides interacting with P can interact with host

cell proteins (172).

1.4.2. Measles virus life cycle

MV contains nonsegmented single-stranded RNA genome of

negative polarity and replication occurs entirely in the cytoplasm. An

overview of the life cycle of MV is depicted in Fig. 2. The H protein contacts

the receptors whereas the F protein mediates fusion. After the viral

membrane fuses with the cellular plasma membrane at the neutral pH, the

helical nucleocapsids are released into the cytoplasm. The uncoating

process takes place by disrupting of the M-N contacts.

Early in virus infection, before the viral translation products

accumulate to high levels, the viral RdRp activity is restricted to the

production of a leader RNA and mRNAs from the incoming virion

nucleocapsid in what is called primary transcription. At later times

following infection, this input RNP is used as a template to produce (+)

sense antigenomes which are in turn used as templates to produce new (-)

sense genomic RNA. After primary transcription and translation, when

abundant progeny genomes have been produced, they can serve as

additional templates in what is called the secondary transcription to

produce much higher levels of viral mRNA transcripts (95). The processive


17

viral polymerase transcribes the N-encapsidated genome RNA into 5’

capped and 3’ polyadenylated mRNAs. Beginning at the 3’ end of the

genome, the polymerase transcribes the genes in a sequential and polar

manner by terminating and reinitiating at each end of the gene junctions.

This sequential “stop-start” mechanism continues across the viral genome

in a 3’ to 5’ direction. Polyadenylation occurs by reiterative copying of four

to seven uridylates in the gene end sequence, followed by release of the

mRNA. Initiation and capping of the downstream mRNA is specific by the

gene-start sequence following the short intergenic region. The RdRp

sometimes fails to reinitiate and this leads to a gradient of mRNA

abundance that decreases according to the distance from the genome

3’end with N mRNA being the most abundant and the L mRNA the least

abundant (26).

Paramyxovirus particles are formed by a budding process. Buds

emerge from the plasma membrane in locations where the viral

components are assembled. Assembly is thought to require coordinated

localization of multiple virus proteins that are preferently incorporated into

nascent viral particles, whereas most of the host proteins are excluded. The

assembly of the envelope is at the cell surface and in polarized epithelial

cells MV egress from the apical surface.


18

Figure 2. Measles virus life cicle. The top of the figure illustrates an

incoming virion which fuses with the cell plasma membrane followed by

release of the helical nucleocapsid in the cytoplasm. Viral mRNAs are

indicated by lines and 5’ mRNA cap is represented by a filled circle whereas

3’ poly A tail by an An. Genome replication carried out by the N-P-L

complex and primary and secondary transcription carried out by P-L

complex are represented in solid lines. Intracellular transport of RNP and M

protein to the plasma membrane and of F and H proteins from the ER to

Golgi to the plasma membrane is indicated with dotted lines. (Adapted

from Lamb, R.A. and Parks, G.D., Fields Virology, 2007).


19

1.4.3. Measles virus receptors

MV was isolated first by Enders and his team in 1954 by inoculating

blood of David Edmonston, a child with measles, onto a primary culture of

human kidney cells (42). However, it was not until 1993 that the first

cellular receptor for MV was identified. Two independent groups reported

that laboratory adapted strains of MV could enter host cells via the

ubiquitous regulator of complement activation membrane cofactor protein

(MCP; CD46) (39, 119). The observation that strains isolated in B95a cells or

human B-cell lines grow inefficiently in cells susceptible to the attenuated

strain, lead to hypothesize that these strains might use other cellular

receptor. Indeed, a few years later, Tatsuo et al. (186) using a functional

expression cloning approach, showed that a cDNA clone could render a

resistant cell line susceptible to a B95a cell-isolated MV. This cDNA was

shown to encode human SLAM or signaling lymphocytic activation

molecule, expressed on several immune cells and first described as

involved in T cell activation (29, 170). Other authors confirmed these

findings (44, 75).

MV is able to infect several tissues and cells that do not express any

of the known receptors, suggesting that additional receptors may still await

identification. Indeed, recent studies showed that human polarized

epithelial cell lines support MV entry, replication, and cytopathic effect

independent of SLAM and CD46 (99, 177).


20

1.4.3.1. CD46

CD46 (MCP) was identified by several research groups in the

eighties as a cell surface molecule with a broad double pattern on SDS-

PAGE and later denominated CD46. Further studies characterized this

glycoprotein belonging to the regulators of complement activation family

with the function to protect host cells from complement mediated attack

(102). CD46 protects the cells from complement mediated damage by

serving as a cofactor for the factor I-mediated cleavage of C3b to C3bi and

C4b to C4c and C4d, preventing the C3b and C4b forming the C3/C5

convertase required for complement regulatory function (102).

CD46 is a cell surface, type I transmembrane glycoprotein of 57-67

kDa encoded by a single gene that is ~ 50 kb long and comprises 14 exons.

The N-terminal region of the CD46 protein consists of four short consensus

repeats (SCR) also named complement control protein repeats (CCPs) (Fig.

3). These SCR are domains of about 60 aa. SCR 1, 2 and 4 are N-

glycosylated; N-glycosylation of SCR 2 is essential for its function as MV

receptor (105). The SCR are followed by one or two serine-threonine-

proline (STP) rich regions, sites of O-glycosylation. Following the STP region

are 12 aa of unknown function, a transmembrane domain and one of two

cytoplasmic tails (CYT-1 or CYT-2).

CD46 is expressed as four predominant isoforms. These isoforms

are the result of the alternative splicing of CD46 gene and differ in the

presence of one (C) or two (BC) STP region and the 16 amino acid (CYT-1)

or 23 amino acid (CYT-2) CYT domains (102). These isoforms are termed


21

STP-BC1, STP-BC2, STP-C1, and STP-C2 and migrate on a SDS-PAGE as two

band pattern with molecular weight (MW) of 62,000-67,000 (STP-BC1 and

STP-BC2 isoforms) and 54,000-60,000 (STP-C1 and STP-C2 isoforms) (102).

All isoforms can serve as receptors for MV (52, 106). Functional studies

mapped the C3b/C4b-regulatory activity on SCR2-4 (2, 80) whereas MV H

protein binding site resides within SCR 1 and 2 (17, 37).

CD46 is expressed on almost all human nucleated cells (165). Three

patterns of expression, differing in the ratio of expression of the four main

isoforms, are recognized in the population: most individuals (65%) express

the STP-BC1/2 forms, 29% express both forms in equal quantities and 6%

express the STP-C1/2 forms (102).

Besides serving as a cellular receptor for MV, CD46 is used as a

receptor and port of entry by other human pathogens. A number of

pathogenic bacteria including Streptococcus pyogenes and Neisseria

meningitides and gonorrhoeae bind to CD46 and different serotypes of

adenovirus and herpesvirus 6 utilize CD46 as cellular receptor (24).


22

Figure 3. Structures of MV receptors SLAM (left) and CD46 (right). SLAM, a

member of the CD2 subset of the immunoglobulin superfamily, regulates

synthesis of T helper 2 cytokines by T cells. The extracellular domain is

composed of a variable (V) and a constant (C2) domains. All MV strains

bind to the V domain of SLAM. CD46, a regulator of complement activation,

has four SCR modules in the extracellular domain. The vaccine strains of

MV interact with SCR1 and 2, whereas SCR 2 and 4 interact with

complement C3b and C4b. APC: antigen presenting cell. (Adapted from

Yanagi, et al., Measles virus: cellular receptors, tropism and pathogenesis.

J. Gen. Virol., 2006).


23

1.4.3.2. SLAM

The lingering question of the relevance of a ubiquitous receptor for

MV pathogenesis was answered when in 2000, the signaling lymphocyte

activation molecule (SLAM; CD150) was identified as the cellular receptor

for clinical isolates of MV (44, 75, 186). Importantly, attenuated strains of

MV can use SLAM as a cellular receptor, in addition to CD46 (45, 132).

SLAM is a 70 kDa membrane glycoprotein that belongs to the CD2

subset of immunoglobulin gene superfamily and has two extracellular

immunoglobulin domains (V and C2) (Fig. 3). The MV H protein interacts

with the N-terminal V domain of SLAM and this domain is necessary and

sufficient to allow MV entry (133). Although mouse SLAM has 60%

sequence identity to human SLAM and similar function, it cannot act as MV

receptor.

SLAM can interact with another SLAM molecule present on a

neighbor cell (Fig. 3) (107). Its cytoplasmic domain contains three tyrosine

residues that are surrounded by SH2 domain-binding sequences. SLAM

associates intracellularly with SH2 domain-containg molecules such as the

SLAM-associated protein (SAP), protein tyrosine phosphatase SHP2 and,

inositol phophatase SHIP (159). Ligation of SLAM on T cells leads to its

binding to SAP, which then recruits and activates FynT, resulting in tyrosine

phosphorylation of SLAM. This triggers the recruitment of multiple players

involved in SLAM signaling (96). This leads to the production of T helper 2

(Th2) cytokines such as IL-4 and IL-13 (43, 104). SLAM regulates the

production of IL-12, tumor necrosis factor-α (TNF-α) and nitric oxide by


24

macrophages (32, 200). In addition, SLAM may induce B cell proliferation

and immunoglobulin (Ig) synthesis (146).

SLAM is expressed on immature thymocytes, on memory T cells,

and is readily induced on B and T cells following activation (7, 29, 170).

According to the same authors, SLAM is not detected on granulocytes,

monocytes and cells from non lymphoid organs (7, 29, 170). However,

SLAM expression on monocytes was readily induced after stimulation with

mitogens or after MV infection (109). Furthermore, SLAM was detected in

murine macrophages following activation with LPS (74). Mature dendritic

cells, but not immature ones express SLAM (13, 92, 125, 144). Distribution

of this receptor overlaps with sensitivity of different cell types to wild type

MV infection and better explains the immunosuppressive characteristics of

the virus.

Besides MV, other morbillivirus like canine distemper virus (CDV)

and rinderpest virus use SLAM (canine and bovine respectively) as their

cellular receptor (187).

1.4.3.3. Other receptors

MV spreads systemically and eventually it infects epithelial tissues

of several organs (108, 157). However these tissues do not express SLAM;

CD46, which is ubiquitously expressed, does not support infection by wild

type MV. This implies that MV may use another receptor (204). The

identification of a putative receptor on epithelial cells still remains elusive

but two groups mapped the residues of the MV attachment protein


25

sustaining epithelial cell receptor mediated cell fusion and showed that the

receptor binding site on the H-protein required to infect epithelial cells

differs from the binding sites for CD46 and SLAM (99, 177). Moreover,

results from these two groups suggest that the epithelial receptor may be a

molecule related with tight junctions and located on the basolateral

surface of the epithelial cells (Fig. 4, top left scheme). Infected immune

cells would infect the epithelial cells through this basolateral molecule and

the virus would initiate replication in epithelial cells. The active release of

infectious viral particles in the airways would explain the high infectious

nature of MV.


26

Immune cellsImmune cells

Figure 4. MV is transmitted by respiratory aerosol droplets containing

MV particles and initial replication takes place in immune cells in the

upper respiratory tract using SLAM receptor (right drawing). Infected

immune cells enter the lymphatic or blood circulation and propagate in

the lymphatic organs throughout the body (bottom drawing). MV

infected immune cells or released viral particles infect epithelia of

several mucosal organs trough the use of a putative epithelial receptor.

Infected epithelial cells release viruses in the airways to achieve

transmission and completing the infectious cycle (left drawing).

(Adapted from Navaratnarajah, C. et al., Measles virus glycoprotein

complex assembly, receptor attachment, and cell entry. Curr. Topics

Microbiol. Immunol., 2009).


27

1.5. Measles virus pathogenesis

Measles is typically a childhood acute disease characterized by

fever, cough, conjunctivitis and a generalized maculopapular rash. Clinical

symptoms appear after a period of incubation of 10-14 days and this is

accompanied by a transient but profound immunosuppression. Recovery is

accompanied by lifelong protective immunity to re-infection (59).

1.5.1. Measles virus entry and spread

MV is transmitted by aerosol droplets and until recently initial

replication was believed to occur in the epithelia of the respiratory tract

followed by viremia mediated by infected monocytes or macrophages (47,

59). From the respiratory tract the virus spreads to the lymphatic tissues,

where viral amplification occurs and then to other organs like skin,

conjunctiva, kidney, lung, gastrointestinal tract, respiratory and genital

mucosa, and the liver (152).

A classical study of the infection of CDV, a related morbillivirus of

dogs showed that the virus was present in the bronchial LN and tonsils 1

day p.i. and it appeared in the lungs only 3 to 6 days later (4). Moreover, in

a ferret model of CDV pathogenesis (194, 195) primary replication occurred

in the lymphatic tissue of the oral cavity and of the respiratory tract. Viral

replication in epithelial cells, sustaining lung and bladder invasion, was

found only in later stages of infection (194). In addition, experimentally

infection of macaques with a recombinant wild type MV expressing GFP

resulted in predominant infection of SLAM positive lymphocytes and DCs


28

and an occasional infection of epithelial cells at later stages of infection

(34). Based on this, the initial target cells for MV infection are still not well

characterized. Fig. 4 illustrates the proposed model of MV infection and

transmission based on the recent findings.

1.5.2. Immune response to measles virus infection

MV infection induces an efficient immune response leading to viral

clearance and long life immunity against re-infections. It gives rise to a non-

specific activation of the immune system characterized by a spontaneous

proliferation of peripheral blood mononuclear cells (PBMC) and an

upregulation of activation associated cell surface markers. Along with this

immune activation, MV induces a transient but severe immunosuppression

which increases the susceptibility to opportunistic secondary bacterial and

viral infections, mainly in immunocompromised individuals.

Different components of the immune response are elicited by MV

infection. The first immune response to be activated by MV infection is the

innate immune response followed by the development of MV specific

adaptive immune responses.

1.5.2.1. Innate immunity

Innate immunity plays a major role in establishment of adaptive

immune responses. The innate immune system recognizes viral

components through pattern-recognition receptors (PRRs). This recognition

triggers a signal transduction cascade that activates transcriptional


29

responses that culminates in the production of proinflamatory cytokines,

interferons, and TNF-α. Two classes of PRRs have been described in innate

immune cells and involved in the recognition of MV, namely Toll-like

receptors (TLRs) and retinoic acid-inducible gene I (RIG-I)-like receptors

(RLRs). Activation of TLRs and RLRs is important for the production of type I

interferons and cytokines. Binding of type I IFNs to cognate receptors on

the cell surface triggers JAK/STAT signaling pathway leading to a formation

of IFN-stimulated gene factor 3 (ISGF3) complex comprised of STAT1,

STAT2 and IRF9. The ISGF3 complex translocates into the nucleus and

activates the IFN-stimulated response element (ISRE)-mediated gene

transcription gene resulting in synthesis of numerous proteins to establish

the antiviral state.

MV has developed ways to circumvent the host innate immune

response. MV was shown to inhibit signaling for both type I IFN induction

and JAK/STAT signaling pathway. MV is able to shut down IFN-α induction

in response to TLR7 and TLR9 ligands (160) and MV V protein can block

melanoma differentiation-associated gene 5 (MDA-5) mediated IFN

induction pathway (117). Several other reports show that the V, C, and P

proteins are able to block the JAK/STAT signaling pathway (19, 38, 49, 123,

128, 134, 149, 166, 183, 206).

1.5.2.2. Humoral immunity

MV specific neutralizing antibodies play a key role in preventing re-

infection after natural exposure to MV. However, the role of antibodies in


30

viral clearance remains unclear since individuals with deficient antibody

production are still able to resolve the infection, and depletion of B cells in

experimentally infected monkeys does not affect viral clearance (138).

Nevertheless, it was reported that failure to mount an adequate antibody

response to MV infection carries a poor prognosis in children (203).

Antibodies are initially detected at the onset of the rash. During

acute measles IgM are predominant and this is followed by a switch to IgG2

and IgG3, whereas during recovery IgG3 seems to decrease and IgG1 and

IgG4 increase (59). Antibodies are produced to all MV proteins, with

antibodies to the N protein being initially most abundant. Absence of this

antibody is an indicator of seronegativity. The majority of neutralizing

antibodies are specific for the H protein although antibodies to F

contribute to virus neutralization as well (145). MV specific neutralizing

antibodies binding to infected cells alters intracellular virus replication and

this way may contribute to control of infection (50, 54).

1.5.2.3. Cellular immunity

The role of cellular immunity in recovery from MV infection has

been appreciated from humans presenting immune abnormalities. Children

with impaired T cell immunity frequently die of progressive measles while

infection is cleared in individuals with agammaglobulinaemia (138, 140). In

addition, monkeys depleted of CD8+ T cells and challenged with wild type

MV had more severe rash, higher viral load in the blood and a prolonged

time to clear infection (139).


31

The cellular immune response is present at the onset of the rash.

Expansion of cytotoxic CD8 T cells and production of IFN-γ were observed

after MV infection and the establishment of CD8 T cell memory as well (81,

82, 118, 190). In addition, CD4 T responses are activated during MV

infection and the synthesis of cytokines is increased.

Acute measles generates a Th1 response profile, characterized by

IFN-γ and IL-2 production while the recovery phase is characterized by a

skew towards a Th2 response resulting in high levels of IL-4 and IL-10 and

low IFN-γ levels. The cytokine response after MV infection influences

disease outcome. In the acute phase of measles, IFN-γ, neopterin and IL-2

rise whereas at the time of the rash there is an increase in IL-2, in soluble

CD8 and CD4. In the recovery phase, when the rash starts to fade, there is

an elevation in the levels of IL-4, IL-10 and IL-13 persisting for several

weeks (61, 111).

1.5.3. Measles virus-induced immunosuppression

MV infection of immunocompetent host causes a virus-specific

immune response that clears infection and provides lifelong immunity.

However, concomitantly, MV is responsible for a generalized

immunosuppression that dampens immune responses to other pathogens.

Immunosuppression induced by MV is characterized by: abnormal cytokine

production, with an imbalance towards a Th2 response resulting in an

impaired cellular immune response to new antigens (60); suppression of


32

lymphoproliferative responses to mitogens and a marked lymphopenia

(156).

The mechanisms underlying immunosuppression induced by MV

are complex. Apoptosis (46), unidentified soluble mediators produced by

infected cells causing inhibition of proliferation of B and T cells (175, 199),

impaired dendritic cell function, lymphocyte depletion (129, 130) and

interleukin 12 downregulation (6, 87) may account for this immunological

abnormality.

1.6. Mouse models for the study of measles pathogenesis: SLAM

transgenic mice

Studies of MV pathogenesis have been hindered by the lack of

suitable animal models. Humans are the only natural host for MV. Non-

human primates have been successfully infected with MV and can

reproduce many aspects of the disease, however these are scarce and

costly and their use raises ethical questions. Since viral tropism is

determined by the pattern of expression of virus specific cellular receptors,

the discovery of the human MV receptors, CD46 and SLAM, has opened the

possibility of the development of transgenic mice susceptible to MV

infection. Several transgenic mice lines have been developed expressing

one or both receptors. The different outcome obtained with these models

reflects the use of different promoters, composition and integration site of

the transgenic construct.


33

Since the identification of human SLAM as the receptor for both

wild type and attenuated strains of MV several mice lines expressing SLAM

have been developed. Table 2 refers to the most relevant SLAM transgenic

lines and the outcome of infection.

Table 2. Comparison of SLAM transgenic mouse models of MV infection.

(adapted from Sellin C.I. and Horvat B., Current animal models: transgenic

animal models for the study of measles pathogenesis. Curr. Topics

Microbiol. Immunol., 2009).

Model Pattern of

expression

Immunological

status

Clinical signs and

pathology following

infection Lck-CD150

(Hahm et al. 2003)

T

lymphocytes

Immunocompetent Infection of thymocytes

of neonates infected IP

Ex vivo inhibition of T

cell proliferation

CD11c-CD150

(Hahm et al. 2004)

Splenic and

bone

marrow

derived

dendritic

cells

Immunocompetent Infection of 2 to 5%

dendritic cells after i.v.

inoculation

CD150Ge x STAT1-ko

(Welstead et al.

2005)

Human-like

expression

Immunodeficient IN and IP infection of

lymph nodes, spleen

and thymus

Knock-in CD150 x

IFNAR-ko

(Ohno et al. 2007)

Human-like

expression

Immunodeficient IN and IP infection of

spleen and lymph

nodes,

immunosuppression

CD46Ge x CD150Ge

x IFNAR-ko

(Shingai et al. 2005)

Human-like

expression

Immunodeficient Infection of dendritic

cells in lymph nodes


34

The Lck-CD150 transgenic mouse was the first CD150 transgenic

mouse to be generated. Human SLAM was expressed under the control of

Lck promoter and thus restricted to T lymphocytes from thymus, spleen

and blood. Spleen lymphocytes were susceptible to in vitro infection with

MV wild type and vaccine strains and infection correlated with the amount

of SLAM expressed in these cells. In addition, MV infection of T cells

expressing hSLAM inhibited their proliferation and rendered them

unresponsive to mitogen. Intraperitoneal infection of newborns resulted in

infection of SLAM expressing thymocytes (62).

To test the role of infection of DC on MV-induced

immunosuppression a transgenic mouse was generated where hSLAM is

expressed under a CD11c specific promoter; hSLAM expression was

restricted to splenic and bone marrow derived dendritic cells (63). These

mice were also used to study the effect of MV infection on the ability of

dendritic cells to induce IL-12 synthesis via toll-like receptor signaling.

Engagement of TLR-4 on MV infected DCs but not TLR-2, 3, 7 or 9 resulted

in defective IL-12 production. Furthermore, interaction of MV H with

hSLAM, but not the MV V and C proteins, influenced this inhibition. These

results suggested that MV, by altering DC function, renders them

unresponsive to secondary pathogens via TLR4 (64).

Another transgenic mouse was generated expressing the complete

human gene through the use of the human’s gene endogenous promoter

(202). Human SLAM expression profile was equivalent to expression in

humans; expression of SLAM was detected on activated B and T


35

lymphocytes from spleen and on activated bone marrow derived DC.

Intranasal infection of these mice with a wild type MV resulted in transient

infection of the nasal associated lymphoid tissue 6 days after inoculation.

To improve efficiency of MV infection these mice were then bred into a

STAT-1 deficient background. Four to six days upon IN or IP infection,

mRNA of MV was detected on thymus, spleen, and lymph nodes of these

mice. However, these mice did not show clinical signs of disease.

Abnormally number of neutrophils and natural killer cells were shown to

be responsible for the splenomegaly observed after IP infection. Crossing

this parental strain, SLAMGe mice (202), with Ifnarko

-CD46Ge mice (113)

resulted in the strain Ifnarko

-SLAMGe mice used in our studies, further

showed in Chapters 2, 3 and 4.

As the V domain of human SLAM is necessary and sufficient for MV

binding to CD150 receptor (133), Ohno et al (127) used a knock-in

approach to establish a mouse model where the V domain of mouse SLAM

was replaced by that of human SLAM by homologous recombination in

embryonic stem cells. In these mice SLAM had an expected human-like

tissue specificity of expression and retained normal function. Splenocytes

from these mice sustained productive infection when infected in vitro.

However, in vivo infection was limited. To increase efficiency of infection

these mice were crossed on an IFNARko

background. Following IN infection

virus spread to the draining lymph nodes of the respiratory tract and to

other lymphatic tissues throughout the body. In addition, after IP infection,

splenocytes failed to proliferate when stimulated with concanavalin A.


36

Thus, infection of these mice reproduces MV lymphotropism and

immunosuppression as in humans and might be relevant for the study of

MV immunopathology when production of type I interferon is not relevant.

Aims

37

Aims

The aim of this thesis is to study MV receptor-host interactions and

assess the consequences of these interactions for MV spread and

pathogenesis. Towards this we characterized MV infection in a transgenic

mouse expressing the cellular receptor for MV, SLAM (CD150). First, we

characterized the tissue specificity of SLAM expression in these mice and

assessed the spread of wild type MV in lymphoid and non-lymphoid organs

of mice that are expressing human SLAM (Chapter 2). Second, we aimed at

identifying the initial cellular target cells of MV infection after contagion

(Chapter 3) and third, to gain insight on the mechanisms of MV attenuation

we characterized the spread of an attenuated and a wild type strains of MV

in the lymphatic system in the transgenic mice expressing human SLAM

(Chapter 4).

Results Chapter 2

39

CHAPTER 2

Measles virus infection of transgenic mice expressing human

signaling lymphocytic activation molecule (SLAM, CD150)

Results Chapter 2

41

Abstract

We bred a transgenic mouse expressing SLAM with human like

tissue specificity in an interferon type I deficient background (Ifnarko

) to

allow more extensive measles virus (MV) replication. We obtained B cells

from the spleen and T cells from the thymus of these Ifnarko

-SLAMGe mice

and documented an increase in human SLAM (hSLAM) expression after

activation of these cells. Macrophages from the bone marrow of these

mice expressed hSLAM twenty four hours after lipopolysaccharide (LPS)

activation. Furthermore we showed that ex vivo inoculation of

macrophages with a MV expressing green fluorescent protein, wtMVgreen,

resulted in infection in a receptor-dependent manner. To assess the spread

of MV in vivo, we infected these mice intranasally or intraperitoneally with

a virus expressing the reporter protein chloramphenicol acetyltransferase

(CAT), from an additional transcription unit downstream the hemagglutinin

gene, here named wtMVCAT. Three and six days after inoculation, the lungs,

thymus and spleen were collected and the CAT activity was assessed in

homogenates of these tissues. Intranasal (IN) inoculation resulted in viral

replication in the airways. Later the virus spread to the lymphatic system

with involvement of the spleen. MV replication was more efficient in the

spleen and less efficient in the lungs after intraperitoneal (IP) inoculation.

Thus, Ifnarko

-SLAMGe mice seem particularly useful in the study of the

early phases of MV infection and dissemination.

Results Chapter 2

43

Introduction

Despite eradication efforts and the availability of an inexpensive

and safe vaccine, measles is still included in the group of five conditions

that make up to 70% of deaths in children younger than 5 years (41).

As humans are the only natural host for MV, a complete

understanding of many aspects of MV infection and pathogenesis is

hampered by the lack of a suitable animal model. MV is pathogenic only for

non human primates but these are scarce and costly and ethical questions

can be raised. Mice, for their availability and low cost, constitute an

alternative model to study MV pathogenesis. However, MV replication in

mice is inefficient and occurs only after intracranial inoculation of brain-

adapted strains. The lack of human receptors for MV on mice presents a

major obstacle to their use and has motivated the development of

transgenic mice expressing MV receptors with human like tissue specificity

as recently reviewed (164).

Several transgenic mice have been generated in the last decade to

study MV infection and pathogenesis. Initial studies of MV infections were

conducted in transgenic mice expressing human CD46 (MCP, human

membrane cofactor protein). CD46 is the cellular receptor for MV

attenuated strains (39, 119). These studies reported inefficient and short-

lived dissemination of an attenuated strain of MV. To overcome these

limitations CD46 transgenic mice were bred into a type I interferon

receptor knock out (IFNARko

) background (112, 113).

Results Chapter 2

44

CD46 transgenic mice present a major limitation as they only

support infection by the vaccine and laboratory adapted strains of MV; the

identification of SLAM (CD150, signaling lymphocyte activation molecule)

as a receptor for both wild type and laboratory MV strains (75, 186)

opened new perspectives in the generation of transgenic mice to study the

pathogenesis of clinical isolates.

Unlike CD46, which is ubiquitously expressed, SLAM expression is

restricted to immune cells. This protein was originally identified on

activated B and T lymphocytes (29, 170) but is expressed constitutively on

immature thymocytes, memory T cells and certain B cells. Monocytes and

dendritic cells express SLAM only following activation. Importantly, besides

MV, other morbillivirus like canine distemper virus and rinderpest virus use

SLAM (canine and bovine respectively) as their cellular receptor (187).

Although murine immune cells express SLAM, which has 60% sequence

identity to human SLAM and a similar function, it cannot act as MV

receptor (126).

In the next chapter we describe how we generated a mouse line

expressing human SLAM with human-like tissue specificity and defective in

the interferon response. In this chapter we present a detailed

characterization of the expression profile of hSLAM in hSLAMGe transgenic

mice and investigate the susceptibility of these mice to MV infection. We

analyzed hSLAM expression in activated B and T cells, and in bone marrow

derived macrophages. Human SLAM expression increases after activation

Results Chapter 2

45

of these cell populations. Next we characterized the tissues supporting MV

infection upon IN or IP inoculation.

Materials and Methods

Mouse strains. The establishment of a transgenic mouse line

expressing hSLAM is described in Chapter 3.

Mouse infections. All animal experimental procedures were

performed according to protocols previously approved by the Mayo Clinic

Institutional Animal Care and Use Committee. Five to 8-week-old animals

were anesthetized with isoflurane (Novation, IL, USA) and infected IN with

4x105 tissue culture infectious dose 50% (TCID50) MV. Five to 8-week-old

mice were infected IP with 8x106 TCID50 for histological analysis or with

1.5x106 TCID50 for assessment of CAT activity in infected tissues.

Generation of a wild type MV expressing the reporter gene

chloramphenicol acetyltransferase. MVwtIC323 (here abbreviated wtMV)

was obtained from an infectious cDNA derived from the Ichinoise B (IC-B)

wild type strain and cloned in the plasmid p(+)MV323 (provided by Dr. K.

Takeuchi, University of Tsukuba, Tsukuba, Japan) (182). wtMVCAT is a

derivative of MVwtIC323 to which a transcription unit expressing the gene

CAT was added downstream of the hemaglutinin (H) gene. Briefly, the CAT

gene was obtained from the plasmid pcDNA3.1CAT. The restriction sites

MluI and AatII were added to the CAT using the forward primer F

Results Chapter 2

46

5’CGACGCGTATGGAGAAAAAAATCACTGG 3’ and reverse 5’

CGGACGTCTTTACGCCCCGCCCTG 3’ and amplified by a PCR reaction The

CAT was then amplified using the pCR2.1 TOPO, and cloned using the

restriction sites MluI and AatII in the expression plasmid pCG-vac-H. The

segment H-CAT was then obtained from the resulting plasmid, pCG-vac2-H-

CAT, with the restriction sites PacI/SpeI and cloned in the plasmid p(+)

MVvac (named MVvacCAT). The CAT was then obtained with the restriction

sites PvuII/SpeI and cloned in the plasmid pCG-IC323-H. IC323-H-CAT was

then cloned with PacI/SpeI in the full length p(+) MV323 coding for the wt

genome.

Rescue of viruses and preparation of virus stocks. Viruses were

rescued as described by Radecke et al. (147). Briefly, the helper cell line

293-3-46 stably expressing MV-N, MV-P and T7 polymerase was

transfected by calcium phosphate precipitation using ProFection Kit

(Promega, Madison, WI) with two plasmids, one containing the relevant

MV genome and the other coding for the MV polymerase (pEMCLa). Three

days after transfection, the helper cells were overlaid on Vero/hSLAM cells

and the appearance of infectious centers was monitored. Single syncytia

were picked and propagated on Vero/hSLAM cells. To prepare virus stocks,

Vero/hSLAM cells were infected at a multiplicity of infection (M.O.I.) of

0.03 and incubated at 37ºC. Cells were scraped in Opti-MEM

(Gibco/Invitrogen Corp., Grand Island, NY) and viral particles were released

by two freeze-thaw cycles. Titers were determined by TCID50 titration on

Results Chapter 2

47

Vero/hSLAM cells according to the Spearman-Kärber method (86). A UV-

inactivated virus was prepared by incubating a vial containing 50 µl of

wtMVCAT on a UVP CL-1000 UV crosslinker (UVP, Upland, CA) on ice. The

virus was exposed to a UV light of 254 nm at 3 cm from a UV source of 1.85

x105 μJ/cm

2 for 30 minutes.

Isolation and activation of B and T lymphocytes. Spleen and

thymus were collected aseptically and transferred into a 15 ml tube

containing RPMI 1640 (Mediatech Inc., Herndon, VA) with 5% fetal bovine

serum (FBS) (Gibco/Invitrogen Corp.) and 1% Penicillin/Streptomycin

(Mediatech Inc.). To obtain single cell suspensions, spleen and thymus

were transferred to a 70 µm cell strainer (BD Biosciences, Bedford, MA),

smashed with the plunger of a syringe, washed with RPMI 1640 medium

and resuspended in this medium.

T and B cells isolated from the thymus and spleen respectively,

were negatively separated by magnetically labeling cells with MACS

microbeads (MiltenyiBiotec, Bergisch Gladbach, Germany) according with

manufacturer’s recommendations. To activate the T lymphocytes, 96 well

plates were coated over night at 4ºC with CD3 antibody (5 µg/ml) (BD

Pharmingen). T lymphocytes were incubated for 24 hours at 37ºC in anti-

CD3 coated plates and interleukin-2 (IL-2) (100 U/ml). B cells were

activated by incubating B lymphocytes with LPS (Sigma) (20 µg/ml) for 24

hours at 37ºC.

Results Chapter 2

48

Isolation and activation of macrophages. Femurs of 5-8 weeks

Ifnarko

-SLAMGe and C57BL/6 mice were collected and cleaned with the

help of a blade to remove adherent muscle tissue. Intact bones were then

left in 70% ethanol for 5 minutes for disinfection and washed with

phosphate buffered saline (PBS). Both ends were cut with scissors and the

marrow flushed with PBS using a syringe with 0.45 mm diameter needle.

Clusters within the marrow suspension were disintegrated by vigorous

vortexing. After wash with PBS, about 1-1.5x107 leukocytes were obtained

per femur.

At day 0 bone marrow (BM) leukocytes were seeded at 2x106 per

100 mm bacteriological petri dish in 10 ml complete medium (RPMI 1640

(Mediatech Inc.) with 10% heat inactivated and filtered (0.22 µm,

Millipore) FBS (Gibco/Invitrogen Corp.) and 1% Penicillin/Streptomycin

(Mediatech Inc.). Cells were allowed to attach for 2 hours, after which the

unattached were washed off with PBS. The attached cells were cultured

with 10 ml of complete medium containing 200 U/ml of granulocyte-

macrophage colony-stimulating factor (GM-CSF) and allowed to

differentiate to macrophages for 3 to 5 days. Every third day medium was

replaced with fresh medium containing GM-CSF. One day before

harvesting, 500 U/ml of LPS (Sigma) was added to the culture medium. At

day 5, medium was replaced by PBS/0.005% trypsin and the cells were

gentle scraped and collected. Macrophages were analyzed for CD11b (also

named Mac-1), F4/80, and hSLAM expression. C57Bl6 mice served as

negative control.

Results Chapter 2

49

Flow cytometry. Different cell populations were identified with the

following markers: for the identification of CD4+ T cells, anti-CD4-

fluorescein isothiocyanate (FITC) (GK1.5, BD Pharmingen) was used. For the

identification of CD8+ T cells, cells were stained with anti-CD8-FITC

(Lou/Ws1/M, BD Pharmingen). B lymphocytes were identified with anti-

CD45R (B220)-FITC (RA3-6B2, BD Pharmingen). Bone marrow derived

macrophages were identified with the following stainings: anti-Mac-1-

PerCP (Peridinin chlorophyll protein) (M1/70, eBioscience) and anti-F4/80-

APC (BM8, eBioscience).

SLAM expression was detected by incubating cells with PE anti-

human CD150 (A12, BD Pharmingen). Corresponding isotype antibodies

were used as controls for antibody specificity. Acquisition of samples was

performed on a cytometer (FacsCanto) and analyzed using FlowJo software

(Tree Star, Inc., Asland, OR).

Immunohistochemistry. Tissues were collected and prepared as

described in Chapter 3. Briefly, frozen tissue sections 4-6 µm in thickness

were incubated with anti-MV N polyclonal antibody (189), washed,

counterstained and mounted.

CAT assay. Animals were sacrificed and tissues removed and snap

frozen in liquid nitrogen. Frozen tissues were grinded on ice in 500 µl of

Tris-buffered saline (TBS), 1mM EDTA, and antiproteases (Calbiochem).

After grinding, 500 µl of TBS, 1 mM EDTA and 1% Triton x100 were added

Results Chapter 2

50

and the samples were subjected to vortex for 30 seconds and left on ice for

30 minutes. The homogenates were then subjected to two freeze-thaw

cycles and centrifuged at 12,000 rpm at 4ºC for 5 minutes. The supernatant

was recovered and the protein concentration was measured by the

Bradford method. For each tissue, 800 µg of protein in 500 µl volume was

analyzed for CAT activity according to the supplier’s protocol (Molecular

Probes). Briefly, 10 µl of FAST CAT (provided) substrate solution was added

to the tissue extract and incubated at 37ºC for 5 minutes. The mixture was

then incubated at 37ºC for 5 hours with 10 µl of acetyl coA (Sigma). The

reaction was stopped by adding 1 ml of ice-cold ethyl acetate (Sigma) and

the samples were vortexed for about 20 seconds. Samples were

centrifuged at top speed for 3 minutes to separate the liquid phase. The

top 900 µl of ethyl acetate were recovered and transferred to a clean

Eppendorf tube and the solvent allowed evaporating. The residue was

dissolved in 25 µl of ethyl acetate and stored in the dark at – 20ºC until

further analysis. Samples were applied in a thin layer chromatography silica

gel plate. The solvent was allowed to ascend the plate. Samples were air

dried and the results visualized under UV-light.

Results Chapter 2

51

Results

Human SLAM expression in lymphocytes of hSLAM transgenic

mice. To characterize the protein expression profile of hSLAM in the

hSLAM transgenic mice, we purified B and T cells from the spleen and

thymus, respectively, and analyzed hSLAM expression by flow cytometry.

As SLAM expression in resting lymphocytes is expected to be very low (29),

B cells were purified from the spleen and activated for 24 hours with LPS,

stained with a B cell marker and analyzed for hSLAM expression. T cells

were purified from the thymus and activated for 24 hours with CD3

antibody and IL-2.

Figure 1 documents hSLAM expression in one representative

animal. The panels in Figures 1A, B and C document hSLAM expression

levels in activated cells (red line) as compared to non activated cells (blue

line) from Ifnarko

-SLAMGe mice and to non- activated cells from C57BL/6

mice (green line). In non-activated B and CD4 and CD8 T cells hSLAM

expression was very low whereas the expression levels increased after

activation of B cells with LPS (Fig. 1A, red line) and CD4 and CD8T cells with

anti-CD3 and IL-2 (Fig. 1B and C, red line). Thus, resting T and B cells from

Ifnarko

-SLAMGe mice express human SLAM at low levels whereas

expression increases following activation as previously described (29, 153,

170).

Results Chapter 2

52

Figure 1. Analysis of hSLAM expression in activated B and T lymphocytes

from hSLAM transgenic mice. Activated (red lines) and non-activated (blue

lines) B cells were stained with antibodies specific for B cells (B220) (A) and

T cells (CD4) and (CD8) (B and C respectively) and SLAM. Activated cells of

C57BL/6 mice served as negative controls (green lines). Histogram panels, Y

axis: % of Max is a measure of the number of cells normalized to the same

total number in each sample.

Human SLAM expression in macrophages of hSLAM transgenic

mice. Since MV may infect initially macrophages or dendritic cells in the

respiratory tract rather than epithelial cells (34) we characterized hSLAM

expression in BM derived macrophages of Ifnarko

-SLAMGe mice.

To generate macrophages, cells were harvested from the femurs of

transgenic mice. Cells were allowed to attach and cultured with GM-CSF for

3 to 5 days. Half of the cells were further cultured with LPS for activation.

Bone marrow derived macrophages were analyzed for Mac-1, F4/80, and

hSLAM expression.

Results Chapter 2

53

Figures 2 documents hSLAM expression in activated cells (red line)

as compared to non-activated cells (blue line) from Ifnarko

-SLAMGe mice

and non-activated cells from C57BL/6 mice (green line).

A small fraction of non-activated macrophages from Ifnarko

-SLAMGe

mice expresses hSLAM compared with macrophages obtained from

C57BL/6 mice (compare blue line with green line of C57BL/6 negative

control), but a substantial increase in the percentage of cells expressing

SLAM was documented following activation with LPS.

Figure 2. Analysis of hSLAM expression

in activated macrophages cultured

from bone marrow of Ifnarko

-SLAMGe

mice (red lines). Blue lines represent

hSLAM expression in non activated

macrophages. C57BL/6 mice were used

as negative controls (green lines).

To assess whether macrophages from Ifnarko

-SLAMGe mice were

susceptible to MV infection, cells obtained from BM of Ifnarko

-SLAMGe

mice were activated and infected with wtMVgreen at an M.O.I. of 5 and

analyzed by flow cytometry at 48 hours p.i..

As shown in Figure 3, inoculation of activated macrophages from

Ifnarko

-SLAMGe mice resulted in receptor-dependent infection as

Results Chapter 2

54

determined by GFP expression. Compare GFP expression in activated

macrophages from Ifnarko

-SLAMGe mice (red line) with GFP expression in

non-activated macrophages from Ifnarko

-SLAMGe or C57BL/6 mice (blue

and green line respectively).

Figure 3. Analysis of GFP expression in

activated (red line) and in non activated

(blue line) macrophages from Ifnarko

-

SLAMGe mice and C57BL/6 mice (green

line). Cells were inoculated with

wtMVgreen at an M.O.I. of 5 and analyzed

by flow cytometry 48 hours later.

Ifnar deficiency increases susceptibility to wild type MV

replication in hSLAM transgenic mice. Previous studies with mice

expressing hCD46 infected with the vaccine strain of MV, showed that Ifnar

deficiency render mice more susceptible to MV infection (113). This effect

was documented already 2-3 days post-infection. Therefore we bred SLAM

transgenic mice into an Ifnar deficient background. As we plan to use our

mice to characterize even earlier steps of MV infection we sought to

determine whether interferon type I exerts its antiviral effect already one

day after inoculation. Therefore, we inoculated Ifnarko

-SLAMGe and

SLAMGe mice intraperitoneally with wtMV and analyzed MV infection. At

Results Chapter 2

55

one day after inoculation, lymphatic organs (mediastinal LN and spleen)

were harvested and analyzed by immunohistochemistry.

Figure 4A and B shows a representative immunohistochemistry

analysis of mediastinal LN one day after inoculation of SLAMGe (panel A)

and Ifnarko

-SLAMGe mice (panel B). MV N protein was detected in this LN

of Ifnarko

-SLAMGe mice, whereas no virus was detected in the

corresponding LN of SLAMGe mice. In addition, Figure 4B shows that the

virus is localized mainly in the subcapsular sinus of this LN and the

presence of syncytial cells is documented (box in higher magnification on

the low right corner of panel B).

Figure 4C and D shows that MV replicated in the spleen of Ifnarko

-

SLAMGe mice (panel D, arrows), but not in the spleen of SLAMGe mice

(panel C) one day p.i..

Results Chapter 2

56

Figure 4. Identification of MV infection in the mediastinal LN and spleen

of SLAMGe or Ifnarko

-SLAMGe mice one day after IP inoculation. Frozen

sections of mouse mediastinal LN and spleen were stained with an anti-N

antibody and counterstained with hematoxylin. N protein was visualized

with red chromogen.

Results Chapter 2

57

This suggests that interferon type I acts as an important restriction

factor for MV replication in this animal model as early as 24 hours after

infection.

Spread of MV in Ifnarko

-SLAMGe mice. To be in the position of

easily measure the levels of MV-based gene expression in different tissues,

we generated a virus expressing the reporter gene CAT (Materials and

Methods). A map of the plasmid constructed to generate the virus is shown

in Figure 5.

Figure 5. Map of the p(+) MV323 plasmid coding for the wt genome and

location of the inserted CAT gene. Six coding regions of MV genes are

represented by colored boxes. The T7 promoter, hepatitis delta virus

ribozyme (HδR) and selected unique restriction sites are indicated. The CAT

transcription unit was inserted between the PvuII and SpeI restriction sites

downstream the H gene.

Since the respiratory tract is the natural route of MV infection in

humans, mice were inoculated intranasally with 4x105 TCID50 of wtMVCAT.

Lungs, thymus and spleen were harvested and CAT activity was assessed in

the homogenates of these tissues (Fig. 6A). Inoculation with UV-inactivated

virus served as negative control. No virus was detected in the homogenates

Results Chapter 2

58

of tissues of mice infected with UV-inactivated virus (not shown). In

contrast, viral replication was detected three days p.i. in the lungs of all

animals inoculated with live virus and in the thymus of one of six animals.

At day 6 virus was detected in spleen of one of six mice (Fig. 6A).

We also tested an alternative route of inoculation and assessed

viral spread after IP infection. Animals were inoculated with 1.5x106 TCID50

of wtMVCAT and viral replication was documented by the presence of CAT

activity in the homogenates of lungs, thymus and spleen.

As shown in Figure 6B, after IP infection MV replication was

strongest in the spleen, it was detectable in the thymus of all mice at day 6

but not at day 3, and it was detected also in the lungs at both 3 and 6 days

p.i.. This pilot experiment suggests that these mice can serve as a model to

study the initial steps of MV infection and pathogenesis.

Results Chapter 2

59

Figure 6. MV spread in different organs of Ifnarko

-SLAMGe mice. Mice

inoculated intranasally (A) or intraperitoneally (B) with wtMVCAT were

sacrificed at days 3 or 6 p.i., tissues collected and homogenized and tested

for CAT activity. As a positive control Vero/hSLAM cells infected with

wtMVCAT were used (+CAT) and homogenates from organs of a non

infected mice were used as a negative control (-CAT).

Results Chapter 2

60

Discussion

Since the identification of SLAM as the cellular receptor for wild

type MV strains (44, 75, 186) several types of transgenic mice have been

generated with the goal of serving as animals models for MV infection.

These models differ in what concerns to the profile of hSLAM expression.

Some of these animals cannot be used as a model for MV infection because

SLAM expression is restricted to certain cell types (62, 63). In our

transgenic mouse the use of a large fragment of the human genome

including the locus control region resulted in a human-like expression

profile. We documented hSLAM expression in activated B and T

lymphocytes, and in macrophages following their activation. B and T cells

were previously shown to be important targets for MV infection of SLAM

‘’knock-in’’ mice: three days after IP infection up to 1% of B and T cells

were infected by wild type MV (127).

We also generated macrophages from Ifnarko

-SLAMGe transgenic

mice and documented hSLAM expression following activation with LPS.

SLAM expression was reported to be absent in resting monocytes (144,

170). Nevertheless, it could be induced by mitogens and cytokines as well

as with MV infection (109). Another finding was that macrophages

expressing hSLAM were susceptible to MV infection in a receptor-

dependent manner. Consistent with the relevance of these cells as specific

hosts for MV infection and dissemination is the fact that these cells are the

major targets for a vaccine strain of MV in Ifnarko

-CD46Ge mice

Results Chapter 2

61

independent of the route of infection (154). Thus, macrophages may play

an important role in the initial phases of MV infection and dissemination.

We also show that upon IN or IP infection MV replicates in the

airways and in lymphatic tissues of Ifnarko

-SLAMGe mice. One interesting

point is that two of six mice inoculated IP show some infection of the lungs

three days post-inoculation. We do not know whether infection is due to

infiltration of infected immune cells or direct infection of the respiratory

epithelia.

Based on these results we hypothesize that SLAM expressing

macrophages or lymphocytes might constitute the major targets for MV

infection upon respiratory inoculation and may be responsible for

transmission of the virus to the lymphatic tissues. Following amplification

of the virus in the lymphatic tissues infected immune cells may cross the

airway epithelium and promote transmission to a new host. Thus, infection

of these mice provide the ideal opportunity to characterize the early

phases of MV infection and gain insights in the cell types supporting initial

MV infection and dissemination.

Results Chapter 3

63

CHAPTER 3

Measles virus infection of alveolar macrophages and dendritic

cells precedes spread to lymphatic organs in transgenic mice

expressing human signaling lymphocytic activation molecule

(SLAM, CD150)

Claudia S. Antunes Ferreira1, *

, Marie Frenzke1, Vincent H.J. Leonard

1,

G. Grant Welstead2, Christopher D. Richardson

2,3, Roberto Cattaneo

1

1Department of Molecular Medicine, and Virology and Gene Therapy Track,

Mayo Clinic College of Medicine, Rochester, Minnesota 55905, 2Department of Medical Biophysics, University of Toronto, and Ontario

Cancer Institute, Toronto, Ontario, Canada M5G 2M9, 3Department of

Microbiology & Immunology/Pediatrics, Dalhousie University Halifax, Nova

Scotia, Canada B3H 1X5

* Current address: Universidade Lusofona de Humanidades e Tecnologias,

Avenida do Campo Grande, 376, 1749 – 024 Lisboa Portugal

J. Virol. 2010; 83:3033-3042

Results Chapter 3

65

Abstract

Recent studies in primate models suggest that wild type measles

virus (MV) infects immune cells located in the airways before spreading

systemically, but the identity of these cells is unknown. To identify cells

supporting primary MV infection we took advantage of mice expressing the

MV receptor human signaling lymphocyte activation molecule (SLAM,

CD150) with human-like tissue specificity. We infected these mice

intranasally with a wild type MV expressing green fluorescent protein. One,

two or three days after inoculation, nasal-associated lymphoid tissue, the

lungs, several lymph nodes, spleen and thymus were collected and

analyzed by microscopy and flow cytometry, and virus isolation was

attempted. One day after inoculation MV replication was documented only

in the airways, in about 2.5% of alveolar macrophages and 0.5% of

dendritic cells. These cells expressed human SLAM, and it was observed

that MV infection temporarily enhanced SLAM expression. Later, MV

infected other immune cell types including B and T lymphocytes. Virus was

isolated from lymphatic tissue as early as two days post IN inoculation; the

mediastinal lymph node (LN) was an early site of replication, and supported

high levels of infection. Three days after intraperitoneal inoculation 1-8% of

the mediastinal LN cells were infected. Thus, MV infection of alveolar

macrophages and sub-epithelial dendritic cells in the airways precedes

Results Chapter 3

66

infection of lymphocytes in lymphatic organs of mice expressing human

SLAM with human-like tissue specificity.

Results Chapter 3

67

Introduction

Measles virus, a member of the Morbillivirus genus of the

Paramyxoviridae family, causes measles, a highly contagious disease

transmitted by respiratory aerosols that induces a transient but severe

immunosuppression (59, 161). In spite of eradication efforts, MV still

accounts for about 4% of deaths in children aged under five years

worldwide (16, 110), mainly due to opportunistic secondary infections

facilitated by MV-induced immune suppression (59). Experimental analyses

of the mechanisms of pathogenesis, including the characterization of cells

and tissues supporting primary MV infection, is limited by host species

specificity: old world monkeys and humans are the only natural MV hosts.

MV replication has been characterized mainly around the time of

rash appearance, 10-14 days after experimental infection of monkeys (33,

34, 108, 185). Viremia in blood cells peaks at or slightly before rash:

infected B and T lymphocytes, monocytes and dendritic cells (DC) are

detected, while little if any cell-free virus is produced. Infected cells express

the signaling lymphocytic activation molecule (SLAM, CD150), the

lymphatic cell MV receptor (44, 75, 186). More information about the

cellular targets of wild type MV infection in the airways immediately after

contagion is important: recent studies in monkeys have suggested that MV

may replicate initially in immune cells in the airways (34, 99) rather than in

lung epithelial cells as previously postulated (31, 157).

Results Chapter 3

68

Limited availability and high costs of primate experimentation

motivated the development of transgenic rodent models of MV infection.

Studies in the ‘90s were based on mice expressing human membrane

cofactor protein (MCP, CD46), the receptor used only by the attenuated

MV strain (39, 119, 204). These studies indicated that airway macrophages

are infected by the MV vaccine strain in the first days after intranasal (IN)

inoculation, and that blood monocytes and tissue macrophages

disseminate the infection (113, 154). To increase susceptibility to MV

infection, CD46-expressing mice were crossed into an interferon receptor

knock-out (Ifnarko

) background; this did not appear to change the cell type

specificity of viral replication (154).

After human SLAM (hSLAM) was characterized as the immune cell

receptor for wild type and vaccine MV, several mouse strains expressing

this protein were generated, as recently reviewed (164). SLAM is a 70-kDa,

type I transmembrane glycoprotein expressed on immune cells such as

activated T cells, B cells, monocytes/macrophages, and DC (29). It belongs

to the immunoglobulin protein superfamily and has two extracellular

domains named V and C2; V interacts with the MV attachment protein

hemagglutinin (133). SLAM determines Th2 cytokine production such as IL-

4 and it may be involved in the production of IL-12, TNF-α, and nitric oxide

by macrophages (171, 192, 200). In addition, SLAM may induce B cell

proliferation and immunoglobulin synthesis. Importantly, hSLAM-

expressing mice but not CD46-expressing mice can be infected by wild type

MV strains that use SLAM but not CD46 as receptor (120).

Results Chapter 3

69

Initially a model expressing hSLAM under control of the T-cell

specific lck promoter was reported (62). In this model hSLAM expression

was restricted to immature and mature lymphocytes in the spleen, thymus,

and blood; lymphocyte proliferation was observed, but there were no

clinical signs of disease. The second model was a mouse in which the

hSLAM coding sequence was expressed under control of the promoter of

the ubiquitously expressed HMGCoA protein (163). In suckling mice

generalized but not necessarily relevant infections of most of the major

organs were documented. Adult mice were less susceptible to MV

infection: only intracerebral inoculation was productive, and yielded viral

proteins but no infectious virus. The third model consisted of a transgenic

mouse expressing hSLAM in DC from a cDNA under control of the CD11c

promoter (63). MV infections are limited to DC in this model and disrupt

the function of these cells in stimulating adaptive immunity.

An alternative approach to transgenesis seeks human-like tissue

specificity of expression. Towards this, Shingai et al. (168) added a full-

length hSLAM gene to the mouse genome, showed that indeed these mice

express hSLAM with human-like tissue specificity, and crossed them in an

Ifnarko

and human CD46-positive background. In this model CD11c-positive

DC are instrumental to establish MV infections. The fifth mouse strain was

generated by exchanging only the MV binding site on mouse SLAM with

that in the V domain of hSLAM (127). Since human and mice have similar

tissue specificity of SLAM expression, this led to human like expression.

When these mice were crossed in an Ifnarko

background, efficient MV

Results Chapter 3

70

replication suppressing proliferative responses to concanavalin A was

documented.

We previously generated a mouse strain expressing hSLAM with

human-like tissue specificity in a STAT1-deficient background (202) We

showed that hSLAM expression was restricted to B and T lymphocytes and

some monocytes/macrophages, and that it was inducible by LPS, lectins or

anti-CD3 antibodies in immune cells, as in primates. Since the Ifnarko

background allows more efficient MV spread (113, 154) without apparent

effects on the cell type specificity of MV infection in mice (127, 168), we

crossed here these mice in the Ifnarko

background. We then used the

Ifnarko

-SLAMGe mice to identify the cells infected by wild type MV

immediately after IN inoculation. We document efficient early infection of

alveolar macrophages (AM) and DC. We also observed subsequent

infection of all lymphatic organs, and in particular of the mediastinal LN,

upon both IN and intraperitoneal (IP) inoculation.


Mouse strains. To establish a transgenic mouse line expressing the

hSLAM gene and deficient in the alpha/beta interferon response, Ifnarko

-

CD46Ge mice (113) were crossed with SLAMGe mice (202). The hSLAM

gene was added to the genome of congenic C57Bl/6 mice (202), but the

Ifnarko

-CD46Ge mice is on a mixed C57Bl/6 and C3H background (113), and

the crossing yields a mixed background. To obtain homozygous Ifnarko

-

SLAMGe mice, the F2 and F3 progeny was screened for inactivation of both

Results Chapter 3

71

copies of the interferon alpha receptor gene (114) for availability of two

copies of the hSLAM gene, and for absence of the CD46 gene.

Since no simple PCR test for the hSLAM genotype was available, the

site of insertion of the hSLAM gene in the mouse genome was

characterized. To accomplish this, primers specific for terminal sequences

of the human genome inserted in the bacterial artificial chromosome used

for transgenesis (202) were synthesized. These primers were used in

combination with primers provided in the GenomeWalker Universal Kit (BD

Pharmingen, San Diego, CA) to identify the insertion site of hSLAM in the

mouse genome, after nucleotide 47,072,810 of chromosome 12, in band

B3 (mouse genome sequence available through www.ensembl.org). The

hSLAM specific analysis was then based on two combined PCR reactions.

SLAM PCR 1 used the primers pairs: 5’–

GTGTCACCTAAATAGCTTGGCGTAATCATG and 5’–

GTTAATATAGACAATGCCCATCTCCAGCAG, amplifying a 1030 base pair band

including part of the hSLAM gene and part of the mouse chromosome 12.

SLAM PCR 2 used the primer pairs 5’-

AGCTTTCTGAATAGGGGTGTTACTTAATGC and 5’-

GTTAATATAGACAATGCCCATCTCCAGCAG, amplifying a 1339 base pair band

of mouse chromosome 12. Mice homozygous for the hSLAM gene had a

positive signal from PCR 1 and no signal from PCR 2.



Results Chapter 3

72


were anesthetized with isoflurane (Novation, IL, USA) and infected IN with

8x105 tissue culture infectious dose 50% (TCID50) MV in 100 μl divided in

two doses of 50 μl (25μl in each nare) in Opti-MEM. Ten minutes elapsed

between both inoculations. Five to 8-week-old mice were infected IP with

1.5x106 TCID50 in 1 ml Opti-MEM to measure viral load in lymphatic tissues;

for the experiments of Table 3 the TCID50 was 8x106. IN and IP infections

with ten-fold smaller inocula were productive, but the results were difficult

to quantify.

Viruses and virus stock preparation. MVwtIC323 (here abbreviated

wtMV) was obtained from an infectious cDNA derived from the Ichinoise B

(IC-B) wild type strain and cloned in the plasmid p(+)MV323 (provided by

Dr. K. Takeuchi, University of Tsukuba, Tsukuba, Japan) (182). wtMVgreen is a

derivative of MVwtIC323 to which a transcription unit containing the open

reading frame of enhanced green fluorescence protein (GFP) (40) was

added upstream of the nucleocapsid gene (99). Viruses were amplified on

Vero/hSLAM cells as described by Radecke et al. (147). Cells were scraped

in Opti-MEM (Gibco/Invitrogen Corp., Grand Island, NY) and viral particles

were released by two freeze-thaw cycles. Titers were determined by TCID50

titration on Vero/hSLAM cells according to the Spearman-Kärber method

(86).

Results Chapter 3

73

Blood and organ collection, and preparation of single cell

suspensions. Blood samples obtained by cardiac puncture at terminal

bleeding were collected in a microtainer tube with lithium heparin (Becton

Dickinson, Franklin Lakes, NJ). Peripheral blood mononuclear cells (PBMCs)

were isolated by density gradient centrifugation with Ficoll-Paque Plus (GE

Healthcare, Sweden).

Nasal associated lymphoid tissue (NALT), LN, spleen and lungs were

collected aseptically and transferred into a 15 ml tube containing RPMI

1640 (Mediatech Inc., Herndon, VA) with 5% fetal bovine serum (FBS)

(Gibco/Invitrogen Corp.) and 1% Penicillin/Streptomycin (Mediatech Inc.).

NALT was collected as follows (5): the facial skin was stripped from the

head and the nose tip was cut off including the front teeth. The cheek

muscles and cheek bones were taken off. The soft and the hard palate

were removed and the NALT was excised distal to the emergence of the

palatine nerve. To obtain single cell suspensions, NALT, LN and spleen were

transferred to a 70 µm cell strainer (BD Biosciences, Bedford, MA), mashed

with the plunger of a syringe, washed with RPMI 1640 medium and

resuspended in this medium.

Single cell suspensions from lungs were generated as described in

(158) with some modifications. Briefly, the lungs were aseptically collected

in 10 ml of RPMI 1640 with 5% FBS and 1% Penicillin/Streptomycin,

reduced to small pieces (approximately 1-2 mm2) and digested at 37 ºC for

1 hour in 10 ml phosphate buffered saline (PBS) (Mediatech) containing

300 U/ml collagenase type II (Worthington, Lakewood, NJ) and 0.15 mg/ml

Results Chapter 3

74

DNase (Roche Diagnostics, Germany). After digestion, lung pieces were

minced with the plunger of a syringe and washed in a 70 µm pore size cell

strainer with RPMI 1640. Cells were centrifuged and resuspended in 3 ml of

red cell lysis buffer (ACK lysis buffer, 0.15 M NH4Cl, 1 mM KHCO3, 0.1 mM

EDTA, pH 7.2) and incubated at 37 ºC for 3 minutes. Cell suspensions were

washed once with RPMI 1640 medium in a 70 µm pore size cell strainer,

centrifuged and resuspended in RPMI 1640 medium.

Immunohistochemistry and immunofluorescence. Initial

preparation of tissues was as follows: tissues were collected at different

time points after infection, embedded in Tissue Tek OCT compound (Sakura

Finetek, Torrence, CA) and frozen by immersion in liquid nitrogen-cooled

methylbutane (Sigma-Aldrich Inc., St.Louis, MO). Tissue sections 4-6 µm in

thickness were obtained, fixed in 99.5% histological grade acetone (Sigma-

Aldrich) and stored at -80ºC until further use. Sections were thawed at

room temperature (RT) for 5 minutes and fixed in 2% paraformaldehyde

solution (USB Corporation, Cleveland, OH) for 10 minutes.

For immunohistochemistry staining, frozen sections were incubated

with peroxidase blocking reagent (Dako, Carpinteria, CA) for 30 minutes at

RT, followed by incubation with background reducer solution (Background

Sniper, Biocare Medical, Concord, CA) for 30 minutes at RT, and by

incubation with anti-MV N polyclonal antibody (189) diluted in Background

Sniper solution for 1 hour at RT. Sections were then washed with Bio-Rad

Tris-buffered saline [20 mM tris (hydroxymethyl) aminomethane, 500 mM

Results Chapter 3

75

NaCl] and incubated with rabbit or rodent alkaline phosphatase-polymer

solution (Biocare Medical) for 20 minutes at RT. Alkaline phosphatase was

visualized with red chromogen substrate (Biocare Medical). Sections were

counterstained with hematoxylin (Vector, Burlingame, CA) and mounted

with permanent mounting medium (Vector).

For immunofluorescence stainings, sections were permeabilized for

3 minutes at RT in PBS with 0.1% (v/v) Triton X-100 (Sigma-Aldrich).

Sections were incubated with 5% goat serum blocking solution for 30

minutes at RT. Streptavidine-biotin blocking was performed prior to

incubation of sections with biotinylated anti-MHC class II (I-Ab) antibody,

using a streptavidin-biotin blocking kit (Vector). After blocking, sections

were incubated one hour at RT with antibodies diluted according to

manufacturer’s recommendations in blocking solution. MV N protein was

detected with a rabbit polyclonal anti-MV N antibody (described above) at

a dilution of 1/100 followed by incubation with Alexa Fluor 488-conjugated

anti-rabbit IgG (Invitrogen, Molecular Probes, Eugene, OR). B lymphocytes

were identified with anti-CD45 (B220) (clone RA3-6B2; BD Biosciences

Pharmingen); CD4 and CD8 T cells were identified with anti-CD4 (YTS191.2;

Abcam Inc., Cambridge, MA) and anti-CD8 (YTS169.4; Abcam) respectively;

AMs were characterized with anti-CD2 (LFA-2) (RM2-5, eBioscience, San

Diego, CA); anti-CD11c (223H7; MBL International, Woburn, MA); anti-

F4/80 (Cl:A3-1, Abcam); biotinylated mouse monoclonal anti-MHC class II

(I-Ab) (AF6-120.1, BD Pharmingen) and anti-Mac-1 (M1/70, eBioscience).

Epithelial cells were identified with anti-CD326 (Ep-CAM, Epithelial Cell

Results Chapter 3

76

Adhesion Molecule) (G8.8, BD Biosciences Pharmingen). Secondary

antibodies included Alexa Fluor 594-conjugated anti-rat IgG (Invitrogen).

Sections stained with biotinylated mouse monoclonal anti-MHC class II (I-

Ab) as primary antibody were stained with Alexa 594 conjugated-

streptavidin (Invitrogen) as the secondary antibody. Sections were

mounted in Prolong Gold antifade reagent with DAPI (Invitrogen, Molecular

Probes) and visualized with a Zeiss Axioplan confocal microscope (LSM 510;

Carl Zeiss Inc., Germany).

Flow cytometry. For flow cytometry analysis, whole lungs were

collected without lavage, to allow the inclusion of bronchoalveolar cells. A

single cell suspension was prepared as described above. Cells were counted

using a hemacytometer after diluting with trypan blue dye to exclude dead

cells. Isolated cells were resuspended at a density of 106

cells/50 µl. To

identify specific cell sub-populations a multicolor staining was performed

by incubating cells with appropriate antibodies (1 µg per million cells), for

45 minutes on ice. GFP was assessed to identify MV infected cells. For the

identification of CD4+ T cells, anti-CD4-phycoerythrin (PE) (H129.19, BD

Pharmingen) and anti-CD3-allophycocyanin (APC)-Cy7 (17A2, eBioscience)

antibodies were used. For the identification of CD8+ T cells, cells were

stained with anti-CD8-PE-Cy7 (53-6.7, eBioscience) and anti-CD3-APC-Cy7

(eBioscience) antibodies. B lymphocytes were identified with anti-CD45R

(B220)-APC-Cy7 (RA3-6B2, eBioscience). In order to reduce Fc receptor

binding, cells stained with CD45R (B220) antibody (B cells) were first

Results Chapter 3

77

incubated with CD16/32 antibody (2.4G2, BD Pharmingen) for 5 minutes on

ice. DC (conventional dendritic cells) were identified with anti-MHCII (I-Ab)-

PE (AF6-120.1, BD Pharmingen) and anti-CD11c-APC (HL3, BD Pharmingen).

Macrophages were stained with anti-CD11c-APC (HL3, BD Pharmingen) and

anti-Mac-1-PE-Cy5 (M1/70, eBioscience). AM were identified with the

following staining: anti-Mac-1-PE-Cy5 (M1/70, eBioscience), anti-F4/80-

APC-Cy7 (BM8, eBioscience), anti-CD11c-APC (HL3, BD Pharmingen) and

anti-MHCII (I-Ab)-PE (AF6-120.1, BD Pharmingen). Epithelial cells were

identified with anti-CD326-PE (Ep-CAM) (G8.8, BD Pharmingen). Ifnarko

-

CD46Ge mice were used as negative controls for quantification.

Human SLAM expression was detected by incubating cells with

biotin anti-human CD150 (A12 (7D4), BioLegend, San Diego, CA) followed

by incubation with streptavidin-PerCP (Becton Dickinson

Immunocytometry Systems, San Jose, CA). Ifnarko

-CD46Ge mice were used

as negative controls and mock-infected animals were used as a negative

control for GFP expression. Acquisition of samples was performed on a

cytometer (FacsCanto or LSRII, BD Biosciences) and analyzed using using

FlowJo software (Tree Star Inc., Asland, OR). Statistical analysis was

performed with standard paired t tests using the JMP7 software (SAS, Cary,

NC).

Quantification of virus load in lymphatic organs. Single cell

suspensions from mandibular, mediastinal, mesenteric and inguinal LN and

spleen were obtained as described above. Serial 10-fold dilutions of

Results Chapter 3

78

mononuclear cells were made in DMEM with 5% FBS and 1%

Penicillin/Streptomycin. Four replicates of 101 to 10

5 mononuclear cells

were co-cultured with 5x105 Vero/hSLAM cells in 24-well plates and 10

6

mononuclear cells were co-cultured with 106 Vero/hSLAM cells in a 100

mm dish. Cultures were monitored for cytopathic effects 4 days later. Virus

titers were expressed as TCID50 per 106 cells.

Results

Ifnarko

-SLAMGe transgenic mice. To generate mice susceptible to

wild type MV infection, the hSLAM gene, including all its transcription

control elements, was previously transferred to the mouse genome (202).

In another approach to enhance replication of any exogenous virus in mice

(114), the mouse interferon type I receptor gene was inactivated (Ifnarko

background). For our study we combined these desirable characteristics by

crossing hSLAM-expressing with Ifnarko

mice; to facilitate progeny

screening, we mapped the insertion site of the hSLAM gene in the mouse

genome, as detailed in the materials and methods. The resulting mouse

strain was named Ifnarko

-SLAMGe. It is defective in the interferon type I

response and expresses hSLAM with human-like tissue specificity: for

example, 11-13% CD3 positive T cells of these mice express hSLAM (data

not shown), as compared to 10-20% CD3 positive T cells of humans (29,

170); 28-31% CD19 positive B cells of these mice express hSLAM, as

compared to 20-25% CD20 positive B cells of humans (data not shown).

Results Chapter 3

79

Human SLAM expression in lymphatic tissue of Ifnarko

-SLAMGe

transgenic mice. We document here cell type specificity of hSLAM

expression in the mediastinal LN, previously shown to be important for MV

infection of SLAM “knock-in” mice (127): in these mice MV reaches higher

titers in this LN than in other lymphatic organs. Single cell suspensions

were prepared from the mediastinal LN of five uninfected Ifnarko

-SLAMGe

mice and stained with specific markers to indentify B cells (B220), T cells

(CD3), and macrophages (CD11clow

Mac-1high

). Cells were gated for live

leukocytes and analyzed for hSLAM expression within each cell population.

Figure 1 documents hSLAM expression in one representative

animal: about 5% B cells (Fig. 1A, left panel, compare top left and right

quadrants) and 2% T cells (Fig. 1B, left panel, compare top left and right

quadrants) scored positive; the right panels in Figures 1A and 1B document

hSLAM expression levels in Ifnarko

-SLAMGe mice (red line) as compared to

a negative control (Ifnarko

-CD46Ge mice, blue line). The mean and standard

deviation of SLAM expression in mediastinal LN of five animals were 10 ±

5.9% for B cells and 1.5 ± 0.6% for T cells (data not shown). Thus resting B

and T cells from mediastinal LN of Ifnarko

-SLAMGe mice express hSLAM at

low levels, and more B than T cells express this protein, as in human

lymphatic tissues (7, 30). In CD11clow

Mac-1high

macrophages of this mouse

(Fig. 1C, left panel, bottom right quadrant) hSLAM expression was below

detection level (Fig. 1C, right panel).

Results Chapter 3

80

Figure 1. Analysis of

hSLAM expression in

leukocytes from the

mediastinal LN of Ifnarko

-

SLAMGe mice. Cells were

stained with antibodies

specific for B cells (B220+)

(A), T cells (CD3+) (B) or

macrophages

(CD11clow

Mac-1high

) (C).

Ifnarko

-CD46Ge mice were

used as negative controls

(right panels, blue lines).

Right panels, Y axis: % of

Max is a measure of the

number of cells normalized

to the same total number

in each sample.

Human SLAM expression in immune cells of the lungs of Ifnarko

-

SLAMGe transgenic mice. Since primary wtMV replication occurs mainly if

not exclusively in immune cells, rather than in epithelial cells (99), SLAM-

expressing immune cells in the airways or in sub-epithelial tissue are

candidate hosts for virus replication. We thus characterized hSLAM

expression in single cell suspensions obtained from lungs of uninfected

Ifnarko

-SLAMGe mice, including B cells (B220+), T cells (CD3

+) and alveolar

Results Chapter 3

81

macrophages (AM) defined as CD11chigh

MHCIIlow

Mac-1low

F4/80high

cells (53,

93).

Figure 2. Analysis of SLAM

expression in leukocytes from

the lungs of Ifnarko

-SLAMGe

mice. For (A) and (B),

lymphocytes were gated and

sorted with antibodies against

B cells (B220+) or T cells

(CD3+), respectively. For AM

(C), total live cells were

stained with three antibodies

and sorted for the

combination

CD11chigh

MHCIIlow

Mac-1low

.

Ifnarko

-CD46Ge mice were

used as negative controls.

Histogram panels, Y axis: % of

Max is a measure of the

number of cells normalized to

the same total number in each

sample. (C) y axis: FSC,

forward scatter.

Results Chapter 3

82

Figure 2 documents hSLAM expression in these cells: about 5% of B

cells (Fig. 2A, left panel, compare top left and right quadrants) and 4% of T

cells (Fig. 2B, left panel, compare top left and right quadrants) of one

animal scored positive; the right panels in Figures 2A and 2B document

hSLAM expression levels in Ifnarko

-SLAMGe mice (red line) as compared to

a negative control (Ifnarko

-CD46Ge mice, blue line). The mean and standard

deviation of SLAM expression in lung tissue of five animals were 8.7 ± 1.9%

for B cells and 3.3 ± 0.7% for T cells (data not shown). A small fraction of

AM also express SLAM (Fig. 2C, lower left panel, compare red line of

Ifnarko

-SLAMGe mice with blue line of Ifnarko

-CD46Ge negative control

mice).

Early MV replication in the lungs of Ifnarko

-SLAMGe transgenic

mice. We then sought to identify the tissue and cell types sustaining wtMV

replication immediately after IN inoculation of Ifnarko

-SLAMGe mice.

Candidate host tissues/cell types include NALT and immune cells in the

airway lumen or sub-epithelial airway tissue. Mice were inoculated with

wtMVgreen, a GFP-expressing virus; since wtMV interacts with SLAM but not

CD46, Ifnarko

mice expressing CD46 but not SLAM served as negative

control. One to seven days after IN inoculation, as indicated in Table 1,

NALT and the lungs were harvested; in addition, mandibular and

mediastinal LN, thymus, spleen and PBMC were collected. Cells from these

organs were co-cultured with Vero/hSLAM cells and the appearance of

syncytia was monitored over 4 days.

Results Chapter 3

83

As shown in Table 1 MV was isolated from the lungs of every

Ifnarko

-SLAMGe mouse at every time point. Virus was also isolated from the

lungs of all three Ifnarko

-CD46Ge mice sacrificed 1 day p.i., but not at later

time points (data not shown) suggesting that some of the virus re-isolated

at day 1 may be the inoculum. At 2 days p.i., virus was recovered from the

mediastinal LN in 2 out of 3 animals. At 3 and 7 days p.i., virus was isolated

from the mediastinal LN and the spleen of most mice, and from the

mandibular LN, thymus and PBMC of some mice. However, no virus was

isolated from the NALT of any animal. These observations suggest that MV

replicates initially in the lungs of Ifnarko

-SLAMGe mice, and then spreads to

lymphatic organs through infected cells circulating in the lymphatics rather

than in the blood.

Results Chapter 3

84

TABLE 1. MV re-isolation from organs of Ifnarko

-SLAMGe mice after IN

infection

Organs Nº. positive/total nº.

Day 1a Day 2 Day 3 Day 7

Lungs 5/5 3/3 3/3 3/3

NALT 0/5 0/3 0/3 0/3

Mandibular LN 0/5 0/3 1/3 2/3

Mediastinal LN 0/5 2/3 3/3 3/3

Thymus 0/5 NDb 0/3 2/3

Spleen 0/5 0/3 3/3 2/3

PBMC 0/5 0/3 1/3 1/3

a day post-infection.

b ND, not done.

To assess whether the inoculum accounts for a significant fraction

of the signal detected after inoculation, we infected Ifnarko

-SLAMGe mice

IN with UV-inactivated MVgreen. Mice were sacrificed one, two or three days

after inoculation and whole lungs examined under a fluorescence

microscope; no fluorescence was detected in mice infected with UV-

inactivated virus. On the other hand, the pattern of GFP expression was

quite homogeneous; in four of four Ifnarko

-SLAMGe mice inoculated with

live virus green fluorescence was observed in all the lobes of the lung, and

reached into the lower respiratory airways (data not shown). As an

additional control, we infected Ifnarko

-CD46Ge mice with MVgreen but again

Results Chapter 3

85

no fluorescence was detected in the lungs of these animals (data not

shown). Since the UV-inactivated inoculum is not detectable by analysis of

GFP fluorescence, we conclude that one day post-inoculation significant

MV replication accounts for strong GFP expression.

AM sustain MV replication in the lungs. We then assessed by

immunohistochemistry (Fig. 3A and B) and immunofluorescence (Fig. 3C to

H) which cell types sustain MV replication in the airways. Ifnarko

-SLAMGe

mice were infected IN with wtMVgreen, lungs collected one day post-

inoculation, frozen, and stained with an anti-N antibody (red colour). Figure

3, panels A and B, shows one representative immunohistochemistry

analysis: MV N protein was most often detected in cells located on the

luminal side of respiratory bronchioles, a location typical for AM.

To assess the identity of infected cells and differentiate between

AM and other immune cells including DCs, we stained lung sections with an

anti-N antibody (green colour) and different cellular markers: the immune

cells markers CD11c, F4/80, CD2 (also named LFA-2), Mac-1 (also named

CD11b) and MHCII, and the epithelial cell marker EpCAM (53, 93). None of

the infected cells were EpCAM positive (Fig. 3G), suggesting that epithelial

cells are not infected. Infected cells were often CD11c, F4/80, and CD2

positive (Fig. 3 C-E), but very rarely Mac-1 or MHCII positive (Fig. 3F and

Fig. 3H). Even if none of the above markers is entirely specific for one type

of immune cells, altogether these results suggest that AM may sustain

primary MV infection in the lungs.

Results Chapter 3

86

Figure 3. Characterization of wtMV-infected cells in the lungs one day

after mouse inoculation. (A and B) Frozen sections of mouse lung stained

with an anti-N antibody and counterstained with hematoxylin. N protein

was visualized with red chromogen. Arrows indicate positive cells, which

localize in the airway lumen. (C to H) Identification of the cell types

accumulating MV N by confocal micrographs analysis of lung frozen

sections. N protein was visualized with Alexa Fluor 488 (green). The specific

cell markers indicated on the top right of each panel were visualized with

Alexa Fluor 594 (red). Nuclei were conterstained in blue with DAPI. Scale

bars represent 10 µm.

To quantify the level of infection of AM and other immune cell

types mice inoculated IN with wtMVgreen were sacrificed 1 or 3 days later.

Lungs were collected, tissue cells were dissociated, and GFP expression

analyzed using flow cytometry. The analysis presented in Table 2 indicates

that AM (sorted as CD11chigh

MHCIIlow

Mac-1low

F4/80high

cells) were infected

Results Chapter 3

87

at the highest levels (2.4 ± 0.9%) one day post-inoculation (P = 0.0016

between AM and epithelial cells). Conventional DC (sorted as

MHCIIhigh

CD11chigh

cells) were infected at about five times lower levels (0.5

± 0.2%; P = 0.0024 between DC and epithelial cells), whereas only 0.1-0.3%

of different populations of lymphocytes were infected. Near background

(0.1%) levels of infection of epithelial cells was documented.

TABLE 2. Percentile of MV-infected cells in the lungs 1 and 3 days after IN

inoculation b

Cell type a

Day 1 (6 mice) Day 3 (10 mice) Mock (5 mice)

B cells (B220+)

a 0.3 ± 0.1 (8-64)

b 0.1 ± 0.1 (1-20) 0

CD4+ T cells (CD3

+CD4

+) 0.2 ± 0.1 (1-7) 0.7 ± 0.8 (0-52) 0.01 ± 0.02 (0-1)

CD8+ T cells (CD3

+CD8

+) 0.1 ± 0.04 (1-3) 0.1 ± 0.1(0-3) 0

DC (MHCIIhigh

CD11chigh

) 0.5 ± 0.2 (5-11) 0.3 ± 0.2 (0-4) 0.1 ± 0.2 (0-2)

AM (CD11chigh

MHCIIlow

Mac-1low

F4/80high

)

Monocytes (Mac-1high

CD11clow

)

2.4 ± 0.9 (90-330)

0

0.7 ± 0.4 (9-77)

0.4 ± 0.2 (2-10)

0

0

Epithelial cells (EpCAM+) 0.1 ± 0.02 (4-13) 0.1 ± 0.1 (1-10) 0.04 ± 0.02 (2-4)

a number of cells counted were over 5,000 B cells, AM and epithelial cells;

about 3,000 CD4+ and CD8

+ T cells, about 1,500 monocytes, and about

1,200 DC b average ± standard deviation (range of counts)

At day 3 post-infection low (0.1-0.7%) levels of infections were

documented in all immune cell types analysed, with AM and CD4 T cells

Results Chapter 3

88

being infected at the highest levels; monocytes that are available in

unperfused lungs were infected at similar levels as other immune cell types

(0.4%). Epithelial cell infection remained near background (0.1%). These

data confirm that AM are the main initial target cells for MV infection, and

also indicate that MV replication in immune cells located in the mouse

airways is limited and short-lived. We also detected cellular infiltrates in

the lungs 3 days p.i., which was due mainly to neutrophils (data not

shown).

MV infects AM expressing SLAM, and MV infection enhances

SLAM expression. To assess whether hSLAM expression correlates with MV

infection, we inoculated Ifnarko

-SLAMGe mice IN with MVgreen and analyzed

hSLAM expression on AM collected one day after inoculation. AM from

mock-infected Ifnarko

-SLAMGe mice, and from infected Ifnarko

-CD46Ge

mice, served as controls. AM were sorted as CD11chigh

(Fig. 4, left panels),

MHCIIlow

(Fig. 4, center-left panels), Mac-1low

(Fig. 4, center-right panels)

cells.

Figure 4A (right panel, right quadrants) shows that background

(0.12%) SLAM expression was detected in AM from control Ifnarko

-CD46Ge

mice. On the other hand, 0.86% AMs of Ifnarko

-SLAMGe mice mock-

infected with the post-nuclear fraction of uninfected Vero/hSLAM cells

expressed SLAM (Fig. 4B, right panel, right quadrants). Remarkably, about

16% (1.44% GFP-positive and 14.8% GFP-negative) AMs of infected Ifnarko

-

Results Chapter 3

89

SLAMGe mice expressed SLAM (Fig. 4C, right panel), which may reflect AM

activation.

D

Results Chapter 3

90

Figure 4. Analysis of hSLAM expression in AM before and after MV

infection. AM from non-infected Ifnarko

-CD46Ge mice (A), mock-infected

Ifnarko

-SLAMGe (B) or MV-infected Ifnarko

-SLAMGe mice (C). Cells were

gated for CD11chigh

(left panels), MHCIIlow

(center left panels), and Mac-1low

(center right panels) and analyzed for infection (GFP) versus SLAM

expression (right panels). Effect of MV infection on hSLAM expression in AM

(D). X axis: FSC, forward scatter. Ifnarko

-CD46Ge mice were used as negative

controls to set the quadrants.

Importantly, about one in 11 SLAM-expressing AM were infected

(Fig. 4C, compare numbers in top and bottom right panels), whereas one in

28 SLAM-negative AM were infected (Fig. 4C, compare numbers in top and

bottom left panels). Analysis of AM from additional four animals confirmed

2-3 times preferential infection of SLAM-expressing cells (data not shown).

These data confirm that infection of AMs in a SLAM-dependent manner is a

crucial step in the early stages of MV infection. Enhanced hSLAM

expression on infected and non-infected AM is short-lived: 3 days after

infection, hSLAM expression returned to levels slightly above the values

found on AM from mock infected mice (data not shown).

Spread in the lymphatic organs. We further characterized MV

spread by quantifying viral replication in different lymphatic organs of

Ifnarko

-SLAMGe mice 3 days after IN inoculation. As shown in Figure 5A, the

mediastinal LN was infected with high efficiency in two mice and at lower

levels in other three animals, whereas the other lymphatic tissues

(mandibular, mesenteric, and inguinal LN, and spleen) were infected at low

or undetectable levels. Thus the mediastinal LN that drains the respiratory

Results Chapter 3

91

tract appears to be a prominent site of MV replication after IN infection of

Ifnarko

-SLAMGe mice, as well as knock-in hSLAM expressing mice (127).

Figure 5. MV infection

levels in lymphatic organs.

Data were obtained three

days after IN inoculation (A),

three days after IP

inoculation (B), or six days

after IP inoculation (C). Each

dot represents a single

mouse. Group average is

represented by a horizontal

bar and detection limit by a

dotted line. Man:

mandibular LN; Med:

mediastinal LN; Mes:

mesenteric LN; Ing: inguinal

LN; Spl: spleen.

Results Chapter 3

92

We then asked whether this effect is due to the IN route of

infection or to a stronger susceptibility of cells in the mediastinal LN to MV

infection. We inoculated mice IP and compared replication levels in a LN

located in the peritoneum (mesenteric), one in the thoracic cavity

(mediastinal), and two control lymph nodes (mandibular and inguinal).

Three days later lymphatic tissues were harvested and the viral load

measured. Again, a high MV titer was documented in the mediastinal LN

(Fig. 5B): in different mice 1-8% of the cells of this LN were infected 3 days

p.i. The average levels of infected cells in the mandibular, mesenteric and

inguinal LN, and the spleen, were 10-100 times lower, but the differences

between different LN were not statistically significant. Six days p.i. (Fig. 5C)

0.01-0.1% of the cells were infected in all lymph nodes and in the spleen.

Finally, we sought to identify which cells support MV replication in

the mediastinal LN. A group of 6 Ifnarko

-SLAMGe mice was inoculated IP,

mediastinal LN collected three days p.i., single cell suspensions obtained

and GFP expression analyzed by flow cytometry. As shown in Table 3,

lymphocytes were infected at the highest levels: 2 ± 0.7% of B cells (B220+),

1.1 ± 0.3% of CD4+ T cells (CD3

+CD4

+), and 2 ± 0.4% of CD8

+ T cells

(CD3+CD8

+). DC (MHCII

highCD11c

high) were infected at similar levels (1.4 ±

0.4% infection) but macrophages (CD11clow

Mac-1high

MHCIIhigh

) were

infected at lower levels (0.6 ± 0.1%). We note that DC and macrophages

account only for a small fraction of cells in the mediastinal LN, and thus

that lymphocytes are by far the most abundant cell type infected.

Results Chapter 3

93

TABLE 3. Percentile of infected cells in the mediastinal LN after IP

inoculation a

Cell type Day 3 Mock

B cells (B220+) 2 ± 0.7 (362-851) <0.01 (0-1)

CD4+ T cells (CD3

+CD4

+) 1.1 ± 0.3 (159-332) <0.01 (0-1)

CD8+ T cells (CD3

+CD8

+) 2 ± 0.4 (188-313) 0.02 ± 0.01 (1-5)

DC (MHCIIhigh

CD11chigh

Mac-1low

) 1.4 ± 0.4 (18-54) 0.08 (0-2)

Macrophages (CD11clow

Mac-1high

) 0.6 ± 0.1 (10-22) 0.01 (0-2)

a average ± standard deviation (range of counts); group size was 6 animals

(both groups)

Discussion

A new small animal model of MV infection. Small animal models

for measles do not exactly mimic the human disease but allow one to focus

on particular aspects of infection. We focused our study on the question of

which cells are infected immediately after respiratory inoculation, and

documented that hSLAM-expressing AM, as well as DC, are the initial

targets in the lungs. These cells may ferry the infection through the

epithelial barrier. Similarly, recent work with wild type and selectively

receptor-blind MVs (34, 99), and with a selectively receptor-blind canine

distemper virus (196) brought evidence for a model of morbillivirus

dissemination postulating that these viruses take advantage of SLAM-

expressing immune cells situated in the lumen of the respiratory tract of

natural hosts to cross the epithelial barrier after contagion.

Results Chapter 3

94

Our improved mouse model has an immune deficient background:

we generated hSLAM transgenic mice whose innate immune system is

compromised by the deletion of the interferon alpha receptor. As

expected, the Ifnarko

background allowed more extensive MV infections

than the previously used STAT1-defective background (202). Minimal MV

replication in hSLAM-expressing mice that are immune-competent did not

allow a sensitive study of the cell type specificity of infection, and we do

not know whether prevention of the interferon type I response induces a

different cell type specificity of infection. However, we know this was not

the case for other mouse strains expressing CD46 or hSLAM in an Ifnarko

background mice (127, 168), and we do not have indications of the

contrary for our mouse strain.

Most characteristics of the Ifnarko

and the STAT1-defective strain

were similar: for example, equivalent levels of SLAM expression were

observed in different cell types. Moreover, in the STAT1-defective mice we

reported enlarged lymph nodes and splenomegaly due to immune cell

infiltration (202); similarly, six days post-inoculation we observed enlarged

lymph nodes in the Ifnarko

mice, and the weight of their spleens was on

average double than normal (119.8 ± 23.4 mg versus 54.8 ± 6.2 mg in

uninfected mice, average and standard deviation in groups of five mice).

The cell-type specificity of expression of hSLAM suggests that a wild

type MV might infect certain target lymphocytes,

monocytes/macrophages, and DC, in transgenic mice. Indeed we

monitored and quantified MV entry in these cell types, and documented

Results Chapter 3

95

predominant interactions with AM and DC one day after IN inoculation. To

our knowledge, this report is the first direct analysis of the events that

support primary MV replication and early viral spread in an animal model.

Later, infection progresses to lymphatic tissues, with an early (2 days p.i.)

involvement of the mediastinal LN. Lymphocytes sustain the bulk of MV

infection not only in the mediastinal LN (Table 3) but also in other LN and

lymphatic organs (data not shown). Thus, our model reproduces the

lymphatic phases of the infections of MV and other morbilliviruses in their

natural hosts (108, 194).

Crossing the epithelial barrier: alternatives. One day after IN

inoculation with 106 TCID50, MV replication was documented in about 2.5%

of AM and 0.5% of DC of hSLAM-expressing mice. MV replication was

below detection levels in Ifnarko

mice not expressing hSLAM, indicating that

scavenging of infectious virus by Ifnarko

AM rarely if at all results in

productive infection. Since there are about 2 million AM in a mouse (191)

about 5x104 AM were productively infected and expressed GFP. Even if

only 1 in 1000 infected AM crosses the lung epithelium, about 50 of these

cells would have the opportunity to transmit infectivity to the lymphatic

organs. AM are implicated in the translocation of particles from the lungs

to the draining lymph nodes (66), a process that MV may exploit to cross

the epithelial barrier: infected AM might migrate to the draining lymph

nodes and spread infection to B and T lymphocytes. The fact that

replication of a MV vaccine strain in CD46-expressing transgenic mice is

Results Chapter 3

96

most prominent in macrophages after inoculation by three different routes

(154) is consistent with these cells sustaining the immediate early phase of

MV infection. Moreover, in Ifnarko

-CD46Ge mice in vivo depletion of AM

resulted in strong local DC infiltration, virus infection of infiltrating DCs and

macrophages, and ultimately higher virus titer in lymphatic tissues (154).

Thus, while protecting other immune cells from infection, AM also support

MV replication in the lungs, and are likely to be one of the pathways

exploited by MV to cross the epithelial barrier.

Another potential ferry for MV are DC present in the sub-epithelial

tissues of the airways. We have observed that there are about 10 times

less DC than AM in the lungs of mice, and estimate that about 0.5% of

2x105

DC, or about 1000 DC, are infected. It has been reported that DC

infected with influenza virus rapidly migrate from the respiratory tract to

the draining LN (56), beginning 2 hours after infection (98). Analogously, DC

productively infected with MV might cross the epithelial barrier and rapidly

disseminate virus in the lymphatic organs including the mediastinal LN.

Alternatively, the virus would attach to DC through DC-SIGN but not

replicate, and DC would trans-infect T lymphocytes (35). DC that carry low

levels of MV may be detected inefficiently by flow cytometry, resulting in

an under-estimation of the efficiency of infection. Finally, it is also possible

that cell-free virus exploits breaks in the epithelial barrier to reach immune

organs through the lymphatics, but the efficiency of AM and DC infection is

consistent with either cell type being more important than epithelium

leakage as primary mean for MV to cross the epithelial barrier.

Results Chapter 3

97

SLAM expression and virus amplification. Ohno et al. (127)

observed that the mediastinal LN is preferentially infected in mice

expressing a human-mouse SLAM hybrid, and several lines of evidence in

our study suggest that a similar phenomenon occurs in our mice expressing

hSLAM. To assess whether this is simply explained by higher receptor

expression, we measured hSLAM expression levels in this and the

mesenteric, mandibular and inguinal LN of uninfected animals, but failed to

document significant differences (data not shown). Thus the cause for

preferential MV spread in the mediastinal LN remains to be determined.

In transgenic mice (Fig. 4) as in human tonsillar tissue (30), MV

infects predominantly, but not exclusively, immune cells expressing SLAM.

We do not know if the apparently SLAM-independent entry really occurs: it

is possible that hSLAM expression is undetectable with antibodies but still

sufficient to facilitate viral entry.

After IN inoculation with MV, hSLAM expression is enhanced in

infected and non-infected AM. Similarly, induction of SLAM expression

after MV infection was previously reported ex vivo in monocytes (11, 109).

The mechanisms activating SLAM expression in both systems are unknown

and could be indirect. Nevertheless, since SLAM is a low affinity self-ligand

glycoprotein (107), increase of its expression in few target cells may cause

a feed-back loop of cell activation. This feed-back loop may in turn sustain

extremely rapid spread of Morbillivirus infections in natural hosts (194).

The new mouse model developed in this study allowed

characterization of the immediate early phases of wild type MV infection in

Results Chapter 3

98

the respiratory airways of an interferon-defective host, and gave

quantitative insights in the cell types supporting primary MV replication in

the lungs of this host. Future studies will address the relative importance of

AM and DC for supporting primary MV infection and ferrying virus through

the epithelial barrier in mice, and the question of the levels of infection of

these cells in interferon-competent hosts.

Results Chapter 4

99

CHAPTER 4

Pathways of lymphatic dissemination of measles virus

attenuated and wild type strains in SLAM expressing mice

Results Chapter 4

101

Abstract

MV vaccine has outstanding safety and efficacy records but the

mechanisms underlying its attenuation are poorly understood. We

characterized the spread of a vaccine strain and compared with that of a

wild type. We also characterized the host cells supporting early infection

and dissemination in the lymphatics. We infected Ifnarko

-SLAMGe mice

intraperitoneally with a MV vaccine strain (MVvac) or with a wild type

strain (wtMV). To identify which cells sustained the wild type MV and the

attenuated strain infection, several lymph nodes (LN) and spleen were

collected one or three days after intraperitoneal (IP) inoculation and

analyzed by confocal microscopy. One day after inoculation MV was

detected in a macrophage population in the subcapsular sinus (SCS) of the

mediastinal LN and marginal sinus (MS) of the spleen (here named SCS

macrophages). Later, three days post infection, the wtMV efficiently spread

to SLAM expressing leukocytes in the mediastinal LN and spleen whereas

the vaccine strain was cleared. The spread of a wild type virus strain

carrying a mutation in the H protein (N481Y) allowing CD46 binding in

addition to SLAM did not alter viral tropism or replication efficiency. Thus,

vaccine attenuation may be caused by suboptimal replication and early

clearance by the host innate immune system.

Results Chapter 4

103

Introduction

Measles is preventable by a safe and effective vaccine. A

vaccination program led to a significant reduction in the number of MV

related deaths; since 2000 to 2008 the number of deaths related to MV

decreased 78%, from 733.000 in 2000 to 164.000 in 2008 (1). However, in

countries with poor health infrastructure measles remains a major cause of

human mortality and morbidity.

The current available measles vaccines are derived from the original

Edmonston strain, isolated from a patient by Enders and Peebles in 1954

(42). The live attenuated vaccines in use were obtained by passaging of the

original strain in several cell lines, including human kidney and amnion cells

and chicken embryo fibroblasts (59). The vaccine strain used here was

obtained from an infectious cDNA derived from a vial of the Moraten strain

(38). The Moraten is one of several attenuated strains derived from the

original Edmonston clinical isolate and is identical to the Schwartz vaccine

strain (137).

We recently bred a mouse line expressing hSLAM in an interferon

type I deficient background and documented that alveolar macrophages

and dendritic cells support early MV replication in the respiratory tract. In

addition, we observed early infection of all lymphatic organs, and in

particular of the mediastinal LN, upon IP and intranasal (IN) inoculation.

Based on this, we sought to compare the viral tropism and spread of a wild

type strain with that of a vaccine strain in the lymphatic tissues. In

Results Chapter 4

104

addition, we characterized the spread of a wild type strain carrying a single

mutation in the H protein, an asparagine to tyrosine substitution at aa 481

(N481Y), allowing CD46 binding in addition to SLAM. CD46 is the receptor

used only by the attenuated MV strain (39, 119, 204).

One day after IP inoculation we documented that MV colocalized

with SCS and MS macrophages in the mediastinal LN and spleen,

respectively. Later, wild type MV efficiently infected SLAM expressing

leukocytes in the mediastinal LN. In contrast, the vaccine strain was cleared

after an initial infection of SCS or MS macrophages. Thus, early clearance

may account for the MV vaccine attenuation.


Cells. B95a (marmoset B-cell line kindly provided by Dr. Gerlier) and

Vero cells were maintained in DMEM and 10% fetal bovine serum (FBS).

Vero/hSLAM cells (Vero cells expressing human SLAM, kindly provided by

Dr. Y. Yanagi) were maintained in DMEM supplemented with 10% FBS and

0.5 mg of G418/ml. The rescue helper cell line 293-3-46 (147) was grown in

DMEM with 10% FBS and 1.2 mg of G418/ml.

Cell infections. B95a (5x105 cells/well), Vero and Vero/hSLAM

(2.5x105 cells/well) were cultured on 12 well plate and infected with wtMV,

MVvac, MVvacY481N, and wtMVN481Y at an M.O.I. of 0.1 in 0.5 ml of Opti-

MEM. Two hours later the opti-MEM was replaced by DMEM

Results Chapter 4

105

supplemented with 10% FBS. Syncytia formation was photographed 24 to

48 hours post infection (p.i.) under a phase-contrast microscopy.

Mouse strains. Generation of Ifnarko

-SLAMGe mice was described in

Chapter 3. To establish a transgenic mouse line expressing the hSLAM and

hCD46 gene and deficient in the alpha/beta interferon response, Ifnarko

-

CD46Ge mice (113) were crossed with SLAMGe mice (202). To obtain

Ifnarko

-CD46Ge-SLAMGe mice, the F2 and F3 progeny was screened for

inactivation of both copies of the interferon alpha receptor gene as

previously described (114) and for the availability of two copies of the

hSLAM gene and hCD46 gene.




were infected IP with 1.5x106 tissue culture infectious dose 50% (TCID50)

MV to measure viral load in lymphatic tissues, or with 8x106 TCID50 for

detection of infected cells by flow cytometry or histology.

Site-specific mutagenesis of measles virus H protein. The specific

mutation (asparagine to tyrosine substitution at amino acid 481 (N481Y) or

the reverse (Y481N) was introduced into the wild type measles and vaccine

strain virus H genes with the Quickchange site-directed mutagenesis kit

(Stratagene) on pCG-IC323-H or pCG-vac-H respectively. The mutated H,

Results Chapter 4

106

HN481Y or HY481N, was cloned in the full length p(+)MV323 or

pB(+)MVvac with PacI/SpeI. The full construct was named wtMVN481Y or

MVvacY481N.

Viruses and virus stock preparation. wtMV, wtMVCAT and MVvacCAT

were previously described in Chapter 2 and wtMVgreen in Chapter 3.

MVvac (38), MVvacY481N and wtMVN481Y were generated from full-

length cDNAs as descrived by Radecke et al. (147). Cells were scraped in

Opti-MEM (Gibco/Invitrogen Corp.) and viral particles were released by

two freeze-thaw cycles. Titers were determined by TCID50 titration on

Vero/hSLAM cells according to the Spearman-Kärber method (86).

Organ collection and preparation of single cell suspensions. Organ

collection and preparation of single cell suspensions were as described in

Chapter 3.

Flow cytometry. As previously described in Chapter 3, SLAM

expression was detected by incubating cells with PE anti-human CD150

(A12, BD Pharmingen). Acquisition of samples was performed on a

cytometer (FacsCanto) and analyzed using FlowJo software (Tree Star, Inc.,

Asland, OR).

Immunofluorescence. Frozen sections, obtained as previously

explained in Chapters 2 and 3, were incubated one hour at RT with

Results Chapter 4

107

antibodies diluted according to manufacturer’s recommendations in

blocking solution. MV N protein was detected with a rabbit polyclonal anti-

MV N antibody (described in Chapters 2 and 3) at a dilution of 1/100

followed by incubation with Alexa Fluor 488-conjugated anti-rabbit IgG

(Invitrogen, Molecular Probes, Eugene, OR). Subcapsular macrophages

were identified with rat anti-mouse sialoadhesin (CD169) (clone 3D6.112;

Abcam Inc., Cambridge, MA). Sections were mounted in Prolong Gold

antifade reagent with DAPI (Invitrogen, Molecular Probes) and visualized

with a Zeiss Axioplan confocal microscope (LSM 510; Carl Zeiss Inc.,

Germany).

Quantification of virus load in lymphatic organs. Quantification of

virus load in lymphatic organs was performed as described in Chapter 3.

Results

Low efficiency of replication of MV vaccine strain. As shown in

Chapters 2 and 3, infection by the wild type MV upon IN or IP inoculation

resulted in spread to several lymphatic organs, with preferential replication

in the mediastinal LN.

We then asked whether infection of an attenuated strain of MV,

MVvac, reproduces the tropism and efficiency of infection as that of a wild

type strain. To quantify and characterize the spread of an attenuated strain

of MV, Ifnarko

-SLAMGe mice were inoculated IP with MVvac; three days

later the lymph nodes and spleen were harvested and the viral load

Results Chapter 4

108

measured. As shown in Figure 1, panel A, MVvac infected the mediastinal

and mesenteric LNs and spleen about 100 times less efficiently as

compared to wtMV (panel B). The infection levels of mandibular and

inguinal LN by the attenuated strain were undetectable (panel A). Although

infection of the lymphoid tissues was generally low, the mediastinal LN

supported the highest level of infection. Thus, in this animal model, the

vaccine strain replication is very inefficient compared to wild type.

Figure 1. MVvac (A) and wtMV (B) infection levels in lymphatic organs

three days after IP inoculation. Each dot represents a single mouse. Group

average is represented by a horizontal bar and detection limit by a dotted

line. Man: mandibular LN; Med: mediastinal LN; Mes: mesenteric LN; Ing:

inguinal LN; Spl: spleen. (Panel B is from Chapter 3, Fig. 5B).

Early capture of wild type and vaccine strains of MV by

subcapsular macrophages. We next sought to identify which cells support

early infection by the wtMV and MVvac strains in the lymphatic tissues and

A

B

Results Chapter 4

109

whether the tropism of these two strains differs. To characterize the initial

targets of MV infection in the lymphoid tissues, Ifnarko

-SLAMGe mice were

inoculated IP with wtMVgreen or MVvac and were sacrificed one or three

days after infection. The mediastinal LN and spleen were collected and

frozen sections were obtained and stained with anti-N antibody to

detected viral protein. As shown in Figures 2 and 3, panels A and C, one day

p.i. wtMV and MVvac viruses were localized mainly in the SCS of the

mediastinal LN and to a lesser extent in the MS of the spleen (green

colour).

The subcapsular sinus of LN is an area rich in macrophages (28, 48)

and, recently, VSV was shown to colocalize with a macrophage marker,

CD169 in the subcapsular sinus of LN early after injection into the footpad

(84). This macrophage population, SCS macrophages, is characterized as

CD169+ Mac-1

+ MHCII

+ and CD11c

low (84). To assess whether MV replicates

in SCS macrophages, Ifnarko

-SLAMGe mice were infected IP with wtMV or

MVvac. Frozen sections of LN and MS of spleen were double stained with

anti-CD169 (red) and anti-MVN (green) antibodies. Figures 2 and 3 (A and

C) shows that one day p.i. MV wild type and vaccine strains colocalized

mainly with SCS macrophages in the mediastinal LN and spleen.

Results Chapter 4

110

Only wild type MV infection progresses to B and T cell areas. We

next infected Ifnarko

-SLAMGe mice IP with wtMV or MVvac, and assessed

progression of infection in the mediastinal LN and spleen. Three days p.i.

these organs were harvested, frozen sections obtained and stained with

anti-MV N and anti-CD169 antibodies. Three days after inoculation the

colocalization of wild type or vaccine strains with the SCS macrophages was

strongly reduced (Figs. 2 and 3, B and D). However, MV wild type replicated

extensively and spread to the B and T cell areas of the LN (below the SCS)

and spleen (white pulp area represented by a white dotted circle) (Figure.

2, panels B and D), whereas the vaccine strain did not (Figure 3, panels B

and D). This suggests that only wild type can escape capture by SCS and MS

macrophages in the LN and spleen and continue replicating; replication of

the vaccine strain is impaired after capture by SCS macrophages.

Results Chapter 4

111

Figure 2. Characterization of wtMV-infected cells in the lymphatic organs

one and three days after IP inoculation of Ifnarko

-SLAMGe mice.

Identification of the cell types accumulating MV N, by confocal micrographs

analysis. Frozen sections of mouse mediastinal LN (A and B) or spleen (C

and D) stained with an anti-N and anti-CD169 antibodies. N protein was

visualized with Alexa Fluor 488 (green). The macrophage marker, CD169,

was visualized with Alexa Fluor 594 (red). Nuclei were counterstained in

blue with DAPI. Scale bars represent 200 µm. Scale bar for insert in panel A

represent 10 µm.

Results Chapter 4

112

Figure 3. Characterization of MVvac-infected cells in the lymphatic organs

one and three days after IP inoculation of Ifnarko

-SLAMGe mice.

Identification of the cell types accumulating MV N, by confocal micrographs

analysis. Frozen sections of mouse mediastinal LN (A and B) or spleen (C

and D) stained with an anti-N antibody. N protein was visualized with Alexa

Fluor 488 (green). The macrophage marker, CD169, was visualized with

Alexa Fluor 594 (red). Nuclei were counterstained in blue with DAPI. Scale

bars represent 200 µm (A to C) and 50 µm (D).

Results Chapter 4

113

Next we sought to assess whether infection in the mediastinal LN

correlates with SLAM expression. A group of 6 Ifnarko

-SLAMGe mice were

infected IP with wtMVgreen, three days later the mediastinal LN was

collected and leukocytes were analyzed for GFP versus SLAM expression by

flow cytometry. Leukocytes from mock-infected Ifnarko

-SLAMGe mice and

from non infected Ifnarko

-CD46Ge mice served as controls. Figure 4A (right

quadrants) shows that background (0.81%; 0.75% plus 0.06%) hSLAM

expression was detected in leukocytes from control Ifnarko

-CD46Ge mice

whereas 11.61% (11.57% plus 0.04%) and 13.25% (11.54% plus 1.71%) of

leucocytes from mock-infected Ifnarko

-SLAMGe mice and infected Ifnarko

-

SLAMGe mice respectively expressed hSLAM (Figs. 4B and C, right

quadrants). Importantly, about one in 8 SLAM-expressing leukocytes were

infected (8.3 ± 2.7; average ± standard deviation) (Fig. 4C, compare

numbers in top and bottom right panels), whereas one in 96 SLAM-

negative leucocytes were infected (94.5 ± 32.65, average ± standard

deviation) (Fig. 4C, compare numbers in top and bottom left panels). Thus,

these results confirm the relevance of infection of SLAM expressing

leukocytes in MV propagation.

Results Chapter 4

114

Figure 4. Analysis of hSLAM expression in immune cells from the

mediastinal LN before and after MV infection. Leukocytes from non-

infected Ifnarko

-CD46Ge mice (A), mock-infected Ifnarko

-SLAMGe (B) or MV-

infected Ifnarko

-SLAMGe mice (C). Cells were gated for live cells and

analyzed for infection (GFP expression) (top quadrants) versus SLAM

expression (right quadrants).

Replication of a recombinant wild type MV with a single mutation

allowing different receptor usage. Because the vaccine strain can enter

cells through CD46 in addition to SLAM whereas the wild type only uses

SLAM, we asked whether low efficiency of infection of this virus was

dependent on cellular receptor usage. In a pilot study, one group of 3 mice

expressing hCD46 in addition to hSLAM, here named Ifnarko

-CD46Ge-

SLAMGe, and one group of mice expressing hSLAM, Ifnarko

-SLAMGe, were

infected intranasally with MVvac expressing the reporter gene CAT.

Another group of 3 Ifnarko

-SLAMGe mice was infected with wtMVCAT. The

lungs, spleen and thymus were collected and analysed for CAT activity

Results Chapter 4

115

three days after inoculation. Upon IN infection, the vaccine strain was

detected at low levels only in the thymus of one Ifnarko

-CD46Ge-SLAMGe

animal and in the lungs of one Ifnarko

-SLAMGe animal; in contrast, the wild

type virus was detected in the lungs of all Ifnarko

-SLAMGe mice, in the

spleen of two out of three Ifnarko

-SLAMGe animals and in the thymus of

one Ifnarko

-SLAMGe animal (data not shown). Thus, vaccine strain infection

is very inefficient and this inefficiency seems to be independent of receptor

usage.

Adaptation to growth in certain cell lines results in the selection of

certain mutations in MV genomes (136, 137). One frequent mutation is the

substitution of an asparagine to tyrosine at amino acid 481 (N481Y) in the

H protein. This mutation is absent in the wild type strains but common to

all vaccine strains and is linked to the ability of the virus to use an

alternative receptor for entry into cells, CD46 (76, 97). CD46, a

complement regulatory protein, is expressed in all nucleated cells and the

usage of this receptor in addition to SLAM may play a role in vaccine

attenuation. To confirm or deny whether this mutation and adaptation in

receptor specificity alters replication efficiency of MV, we characterized the

replication of a wild type MV with an asparagine to tyrosine substitution in

the hemagglutinin protein allowing binding to CD46.

We generated a wild type virus with an asparagine to tyrosine

substitution and a vaccine virus with a tyrosine to asparagine substitution

in the hemagglutinin protein, wtMVN481Y and MVvacY481N, respectively.

We first documented receptor usage by wtMV, wtMVN481Y, MVvac and

Results Chapter 4

116

MVvacY481N, using several cell lines expressing CD46 and/or SLAM. Figure

5A (top row) shows that all viruses (wtMV, wtMVN481Y, MVvac and

MVvacY481N) induce syncytia on B95a cells, expressing SLAM but not

CD46, whereas only wtMVN481Y and MVvac can fuse Vero cells, expressing

only CD46 (second row). However, MVvac induced syncytia in Vero cells

more efficiently than wtMVN481Y virus. Substitution of a tyrosine to

asparagine in MVvac abolishes CD46 usage and this virus no longer fuses

Vero cells (second row). All viruses can infect Vero cells expressing SLAM

(third row). Thus, the N481Y mutation allows the wild type MV to infect

cells expressing CD46 without compromising its ability to use SLAM

receptor.

wtMV and wtMVN481Y grew to similarly high titers in vitro in

Vero/hSLAM cells (not shown). To analyse whether wtMVN481Y replicates

as efficiently as the wtMV in vivo, we infected Ifnarko

-SLAMGe mice IP with

wtMVN481Y or wtMV; three days after inoculation the viral replication was

measured in several lymph nodes (mandibular, mediastinal, mesenteric,

and inguinal LN) and spleen. Fig. 5 B and C graphs, shows that wtMV and

wtMVN481Y moderately infected the mandibular, mesenteric and inguinal

LNs whereas the mediastinal LN and the spleen were infected with higher

efficiency. The wtMV replicated slightly more efficiently in the mediastinal

LN than the wtMVN481Y whereas the wtMVN481Y infected in average 10

times more the spleen compared to wtMV. But overall, both viruses

replicated efficiently in Ifnarko

-SLAMGe mice.

Results Chapter 4

117

Next, we sought to analyse whether the ability to infect cells

through CD46 in addition to SLAM would affect viral replication. Towards

this, we inoculated a mouse strain expressing hCD46 in addition to hSLAM,

and bred in an interferon type I deficient background, named Ifnarko

-

CD46Ge-SLAMGe mice. Infection of Ifnarko

-SLAMGe mice served as a

control. A group of 6 Ifnarko

-CD46Ge-SLAMGe mice and a group of 6 Ifnarko

-

SLAMGe mice were infected with wtMVN481Y and several lymphatic

organs (lymph nodes and spleen) were collected and the viral load was

assessed 3 days after infection. As shown in Figs. 6A and B, wtMVN481Y

replicated equally well in Ifnarko

-SLAMGe mice and in Ifnarko

-CD46Ge-

SLAMGe mice. Thus, N481Y mutation and CD46 usage does not seem to

affect replication of the wild type strain of MV, at least in this animal

model.

A

Results Chapter 4

118

B C

Ifnar

ko-SLAMGe mice

Figure 5. Characterization of a recombinant MV containing an H protein

with an asparagine to tyrosine substitution at position 481 (N481Y

mutation), wtMVN481Y. (A) Differential receptor usage by MV carrying a

mutation in the hemagglutinin protein. Different cell types expressing

different receptors (indicated at the left of each row) were infected by

several viruses (indicated at the top of each column) at an MOI of 0.1.

Syncytia formation was photographed 24 to 48 hours later under phase-

contrast microscopy.

(B) Replication of wtMV and (C) wtMVN481Y in several lymphatic organs of

Ifnarko

-SLAMGe mice. Titers were measured 3 days after IP inoculation.

Each dot represents a single mouse. Group average is represented by a

horizontal bar and detection limit by a dotted line. Man: mandibular LN;

Med: mediastinal LN; Mes: mesenteric LN; Ing: inguinal LN; Spl: spleen.

Results Chapter 4

119

A B

Figure 6. wtMVN481Y infection levels in lymphatic organs of

Ifnarko

SLAMGe (A) or Ifnarko

CD46Ge-SLAMGe mice (B) three days after IP

inoculation. Each dot represents a single mouse. Group average is

represented by a horizontal bar and detection limit by a dotted line. Man:

mandibular LN; Med: mediastinal LN; Mes: mesenteric LN; Ing: inguinal LN;

Spl: spleen.

Discussion

We previously showed that wild type MV after initial replication in

the lungs spreads to several lymphatic organs; the mediastinal LN

supported higher levels of infection. We report here that the efficiency of

infection of the mediastinal LN and other lymphatic tissues by the vaccine

strain is significantly lower than that of the wild type. As observed in

studies in human tonsillar tissue, with the exception of naïve T

lymphocytes, the efficiency of infection of different cell populations by the

Results Chapter 4

120

vaccine strain was significantly lower than that of the wild type (30). We

also show that wild type infection of SCS macrophages is followed by

extensive replication in SLAM expressing leukocytes. In contrast, after an

initial interaction with SCS macrophages the vaccine strain of MV does not

propagates as efficiently as the wild type. Thus, initial encounter with

macrophages in the secondary lymphatic organs might be fatal for the

vaccine strain; whereas the wild type overcomes this barrier and

disseminates to lymphocytes.

Subcapsular sinus macrophages are resident macrophages lining

the sinuses of the secondary lymphoid organs involved in filtering

pathogens out of the lymph or blood. These macrophages are poorly

endocytic and have low degradative capacity which enables them to

present intact antigen on their cell surface (84). In fact, electron

microscopy studies of captured VSV reported virions on the cell surface and

also in vacuoles of SCS macrophages (84, 141). It has been reported that B

cells, located immediately beneath the subcapsular sinus in the secondary

lymphoid organs, are able to capture antigens from SCS macrophages (21,

84, 141). Analogously, SCS macrophages infected with MV might present

infectious viral particles to B lymphocytes; a process that MV may exploit

to secure efficient infection and spread. Moreover, following capture of

MV SCS macrophages themselves might become infected and therefore

constitute an early viral reservoir. This associated to the low degradative

capacity of these cells may make them a safe sanctuary for the wild type

MV.

Results Chapter 4

121

We next asked whether the N481Y mutation selected during

adaptation to certain cultivated cells, would affect the tropism or

replication efficiency of MV. We showed that the mutated strain as well as

the parental strain replicated efficiently in the lymphatic organs of Ifnarko

-

SLAMGe mice, suggesting that the mutation did not affect replication

ability. We further showed that wtMVN481Y replicated as efficiently as

wtMV in Ifnarko

-SLAMGe and Ifnarko

-CD46Ge-SLAMGe mice. Thus,

adaptation to entry through CD46 does not strongly alter the tropism of

the virus in vivo. Additional mutations acquired by attenuated strains such

as S546G, N390I, N416D, T446S, T484N and E492G seem to increase the

viral binding affinity for CD46 (155, 162, 167, 176). Thus, it is conceivable

that a wild type virus with all these mutations may enter cells preferably

through CD46 instead of SLAM with a possible implication in viral tropism

and attenuation.

On the other hand, besides mutations in the H protein, cell culture

adaptation of MV has generated several amino acid substitutions in P, C, V

and M proteins of the virus (8, 180, 181, 184). These genetic changes might

affect viral replication, maturation or interaction with host proteins and

may have a cumulative effect on attenuation. Whatever the mechanism or

mechanisms underlying MV vaccine attenuation are, escape from

macrophage infection appears to be a key aspect of attenuation.

Main Conclusions and Future Perspectives

123

CHAPTER 5

Main conclusions and future perspectives


125

This thesis aimed at a better understanding of the interaction

between MV and the cellular receptor SLAM and the consequences for MV

spread and pathogenesis. Towards this we characterized the spread of MV

in a transgenic mouse expressing human SLAM, the cellular receptor for

wild type and attenuated strains of MV.

These studies provided valuable insights about MV initial target

cells upon respiratory infection as well as the development of infection in

the lymphatic system. Moreover we bred a transgenic mice expressing

hSLAM into an IFNAR deficient background and we used these mice to

show that alveolar macrophages and dendritic cells are the major target

cells immediately after intranasal infection. Infection in the airways was

short lived and early the virus spread to the lymphatic tissues. The

mediastinal LN was the LN where the virus reached the highest titre. In the

lymphatic tissues we documented an early involvement of MV with a

specific population of macrophages, SCS macrophages, localized in the

subcapsular sinus of the mediastinal LN and marginal sinus of spleen. Later

the virus spread to the follicular areas and extensively replicated in SLAM

expressing immune cells. In contrast, MV vaccine strain seems to be

impaired by this population of macrophages; after initial infection of SCS

macrophages the vaccine strain showed low levels of replication. Thus,

macrophages seem to play a dual role: they might serve as an early

reservoir of MV and seed infection to other lymphatic cells but they also


126

protect the host from uncontrolled viral dissemination as documented in

the case of the attenuated strains of MV.

Briefly the main conclusions are presented here as follows:

In Chapter 2

• We showed that SLAM transgenic mice expressed hSLAM

with human like tissue specificity; hSLAM expression in B

and T lymphocytes and in macrophages is dependent on the

activation status of the cells. Resting B and CD4 and CD8 T

and macrophages expressed hSLAM at low levels whereas

activation increased hSLAM expression;

• We documented that macrophages from Ifnarko

-SLAMGe

mice support MV infection ex vivo in a receptor-dependent

manner;

• We showed that Ifnarko

-SLAMGe mice are susceptible to MV

infection after IP or IN inoculation; several lymphatic tissues

and non lymphatic tissues supported replication of MV.

Thus, these mice are suitable to assess the relevance of receptor

usage for MV infection and should give insights into the early steps of MV


127

infection and into the mechanism of MV pathogenesis including

immunosuppression.

In Chapter 3

We took advantage of mice expressing SLAM with human like tissue

specificity, Ifnarko

-SLAMGe mice, to characterize the early steps of MV

infection. Moreover, we identified the initial target cells after respiratory

infection.

• We identified alveolar macrophages and dendritic cells as

the cells that sustain MV replication immediately after

respiratory infection; these cells expressed hSLAM;

• We documented that MV infection of alveolar macrophages

temporarily enhanced SLAM expression in these cells. Thus,

MV infects cells that easily up-regulate its receptor,

improving spread and infection efficacy;

• We showed that one day after initial replication in the

alveolar macrophages the virus disseminated to the

lymphatic system with early involvement of the mediastinal

LN. Furthermore, the mediastinal LN supported the highest

titre after IN or IP inoculation. In the mediastinal LN MV

infected immune cells such as B and T lymphocytes.


128

In Chapter 4

The mechanisms underlying MV vaccine attenuation are not well

understood. We compared the spread of an attenuated strain of MV with

that of a wild type in an animal model expressing hSLAM.

• We showed that MVvac replication was very inefficient in

the lymphatic tissues of Ifnarko

-SLAMGe mice. Infection of

mediastinal LN and spleen by the vaccine strain was 100

times less efficient as that of a wild type strain. Infection of

other lymph nodes was under detectable levels;

• We documented by confocal microscopy that at one day p.i.

both, the vaccine and the wild type viruses were retained in

the subcapsular sinus of mediastinal LN and in the marginal

sinus of the spleen; the virus colocalized with a specific

population of macrophages, the subcapsular sinus

macrophages. Subcapsular macrophages are typically

present in the SCS and MS of lymph nodes and spleen

respectively and play an important protective role by

sampling pathogens in the lymphatic organs;

• We showed that infection of SCS macrophages by the wild

type is preceded by massive infection of SLAM expressing


129

lymphoid cells in the lymphoid tissues whereas the

replication of the vaccine strain is disallowed after

interaction with the macrophages; 3 days after IP infection

the vaccine strain was almost cleared from the mediastinal

LN and spleen;

• We showed that adaptation to CD46 usage by the wild type

MV, in addition to SLAM, has little influence on MV virulence

and does not alter viral tropism.

Three characteristics of the mouse model used in these studies,

Ifnarko

-SLAMGe mouse, allowed the study of the early phases of MV

infection. First, infection of these animals resulted in extensive viral

replication due to an interferon defective response without affecting the

specificity of MV replication (127, 154). Second, the expression of the

lymphatic MV receptor, SLAM, in these animals allowed the

characterization of the early stages of MV infection and lymphatic

dissemination. And third, this mouse does not express the basolateral

epithelial cell receptor necessary for MV to leave the host (99) but allowed

characterization of the early stages of infection and spread of the virus in

the lymphatic tissues. This animal model gave insights in the cellular

targets supporting primary MV replication. Future studies are necessary to

understand whether the conclusion that the AM and DC are the early and


130

primary target cells can be extended to infection of the natural hosts.

Further studies into the mechanism(s) of how the virus crosses the

epithelial barrier and achieves dissemination throughout the body are

necessary.

It is interesting that replication of MV is detected in the

macrophages by two different routes of infection. AMs have been

implicated in the transport of particles and pathogens from the lungs to the

draining LN (66, 89), whereas SCS macrophages were shown to guide

captured virions across the SCS of the lymph nodes for efficient

presentation and activation of B cells (84, 85). MV may exploit these

characteristics to achieve dissemination throughout the host permissive

cells. Further research will be required to determine how the virus infected

macrophages achieves dissemination to other immune cells. The fact that

after interaction with the macrophages the wild type MV propagates

efficiently whereas the vaccine does not is puzzling. The low efficiency of

replication may disable the vaccine strain to counteract the innate immune

response and thus plays a role in viral attenuation.

Understanding the interactions of MV with macrophages and

dendritic cells may open new avenues for the development of more

efficient vaccines and novel therapeutic approaches.

References

131

References

1. 2009. Global measles mortality, 2000-2008. MMWR Morb Mortal

Wkly Rep 58:1321-1326.

2. Adams, E. M., M. C. Brown, M. Nunge, M. Krych, and J. P.

Atkinson. 1991. Contribution of the repeating domains of

membrane cofactor protein (CD46) of the complement system to

ligand binding and cofactor activity. J Immunol 147:3005-3011.

3. Alkhatib, G., and D. J. Briedis. 1986. The predicted primary

structure of the measles virus hemagglutinin. Virology 150:479-490.

4. Appel, M. J. 1969. Pathogenesis of canine distemper. Am J Vet Res

30:1167-1182.

5. Asanuma, H., A. H. Thompson, T. Iwasaki, Y. Sato, Y. Inaba, C.

Aizawa, T. Kurata, and S. Tamura. 1997. Isolation and

characterization of mouse nasal-associated lymphoid tissue. J

Immunol Methods 202:123-131.

6. Atabani, S. F., A. A. Byrnes, A. Jaye, I. M. Kidd, A. F.

Magnusen, H. Whittle, and C. L. Karp. 2001. Natural measles

causes prolonged suppression of interleukin-12 production. J Infect

Dis 184:1-9.

7. Aversa, G., C. C. Chang, J. M. Carballido, B. G. Cocks, and J. E.

de Vries. 1997. Engagement of the signaling lymphocytic activation

molecule (SLAM) on activated T cells results in IL-2-independent,

cyclosporin A-sensitive T cell proliferation and IFN-gamma

production. J Immunol 158:4036-4044.

8. Bankamp, B., G. Hodge, M. B. McChesney, W. J. Bellini, and P.

A. Rota. 2008. Genetic changes that affect the virulence of measles

virus in a rhesus macaque model. Virology 373:39-50.

9. Bankamp, B., J. Wilson, W. J. Bellini, and P. A. Rota. 2005.

Identification of naturally occurring amino acid variations that affect

the ability of the measles virus C protein to regulate genome

replication and transcription. Virology 336:120-129.

10. Bellini, W. J., G. Englund, S. Rozenblatt, H. Arnheiter, and C.

D. Richardson. 1985. Measles virus P gene codes for two proteins. J

Virol 53:908-919.

References

132

11. Bieback, K., E. Lien, I. M. Klagge, E. Avota, J. Schneider-

Schaulies, W. P. Duprex, H. Wagner, C. J. Kirschning, V. Ter Meulen, and S. Schneider-Schaulies. 2002. Hemagglutinin protein

of wild-type measles virus activates toll-like receptor 2 signaling. J

Virol 76:8729-8736.

12. Billeter, M. A., R. Cattaneo, P. Spielhofer, K. Kaelin, M. Huber,

A. Schmid, K. Baczko, and V. ter Meulen. 1994. Generation and

properties of measles virus mutations typically associated with

subacute sclerosing panencephalitis. Annals of the New York

Academy of Sciences 724:367-377.

13. Bleharski, J. R., K. R. Niazi, P. A. Sieling, G. Cheng, and R. L.

Modlin. 2001. Signaling lymphocytic activation molecule is

expressed on CD40 ligand-activated dendritic cells and directly

augments production of inflammatory cytokines. J Immunol

167:3174-3181.

14. Blumberg, B. M., M. Leppert, and D. Kolakofsky. 1981.

Interaction of VSV leader RNA and nucleocapsid protein may

control VSV genome replication. Cell 23:837-845.

15. Bolt, G., and I. R. Pedersen. 1998. The role of subtilisin-like

proprotein convertases for cleavage of the measles virus fusion

glycoprotein in different cell types. Virology 252:387-398.

16. Bryce, J., C. Boschi-Pinto, K. Shibuya, and R. E. Black. 2005.

WHO estimates of the causes of death in children. Lancet 365:1147-

1152.

17. Buchholz, C. J., D. Koller, P. Devaux, C. Mumenthaler, J.

Schneider-Schaulies, W. Braun, D. Gerlier, and R. Cattaneo. 1997. Mapping of the primary binding site of measles virus to its

receptor CD46. J Biol Chem 272:22072-22079.

18. Buchholz, C. J., C. Retzler, H. E. Homann, and W. J. Neubert.

1994. The carboxy-terminal domain of Sendai virus nucleocapsid

protein is involved in complex formation between phosphoprotein

and nucleocapsid-like particles. Virology 204:770-776.

19. Caignard, G., M. Guerbois, J. L. Labernardiere, Y. Jacob, L. M.

Jones, F. Wild, F. Tangy, and P. O. Vidalain. 2007. Measles virus

V protein blocks Jak1-mediated phosphorylation of STAT1 to

escape IFN-alpha/beta signaling. Virology 368:351-362.

References

133

20. Calain, P., and L. Roux. 1993. The rule of six, a basic feature for

efficient replication of Sendai virus defective interfering RNA. J

Virol 67:4822-4830.

21. Carrasco, Y. R., and F. D. Batista. 2007. B cells acquire

particulate antigen in a macrophage-rich area at the boundary

between the follicle and the subcapsular sinus of the lymph node.

Immunity 27:160-171.

22. Cathomen, T., B. Mrkic, D. Spehner, R. Drillien, R. Naef, J.

Pavlovic, A. Aguzzi, M. A. Billeter, and R. Cattaneo. 1998. A

matrix-less measles virus is infectious and elicits extensive cell

fusion: consequences for propagation in the brain. EMBO J

17:3899-3908.

23. Cathomen, T., H. Y. Naim, and R. Cattaneo. 1998. Measles

viruses with altered envelope protein cytoplasmic tails gain cell

fusion competence. J Virol 72:1224-1234.

24. Cattaneo, R. 2004. Four viruses, two bacteria and one receptor:

membrane cofactor protein (CD46) as a pathogen’s magnet. J Virol

78:4385-4388.

25. Cattaneo, R., K. Kaelin, K. Baczko, and M. A. Billeter. 1989.

Measles virus editing provides an additional cysteine-rich protein.

Cell 56:759-764.

26. Cattaneo, R., G. Rebmann, A. Schmid, K. Baczko, V. ter

Meulen, and M. A. Billeter. 1987. Altered transcription of a

defective measles virus genome derived from a diseased human

brain. EMBO J 6:681-688.

27. Cattaneo, R., A. Schmid, D. Eschle, K. Baczko, V. ter Meulen,

and M. A. Billeter. 1988. Biased hypermutation and other genetic

changes in defective measles viruses in human brain infections. Cell

55:255-265.

28. Clark, S. L., Jr. 1962. The reticulum of lymph nodes in mice

studied with the electron microscope. Am J Anat 110:217-257.

29. Cocks, B. G., C. C. Chang, J. M. Carballido, H. Yssel, J. E. de

Vries, and G. Aversa. 1995. A novel receptor involved in T-cell

activation. Nature 376:260-263.

30. Condack, C., J. C. Grivel, P. Devaux, L. Margolis, and R.

Cattaneo. 2007. Measles virus vaccine attenuation: suboptimal

infection of lymphatic tissue and tropism alteration. J Infect Dis

196:541-549.

References

134

31. Cherry, J. 2003. Measles Virus, p. 2283-2304. In C. J. Buck, G.

Demmler, and S. Kaplan (ed.), Textbook of Pediatric Infectious

Diseases. Elsevier Health Sciences.

32. Davidson, D., X. Shi, S. Zhang, H. Wang, M. Nemer, N. Ono, S.

Ohno, Y. Yanagi, and A. Veillette. 2004. Genetic evidence linking

SAP, the X-linked lymphoproliferative gene product, to Src-related

kinase FynT in T(H)2 cytokine regulation. Immunity 21:707-717.

33. de Swart, R. L. 2009. Measles studies in the macaque model. Curr

Top Microbiol Immunol 330:55-72.

34. de Swart, R. L., M. Ludlow, L. de Witte, Y. Yanagi, G. van

Amerongen, S. McQuaid, S. Yuksel, T. B. H. Geijtenbeek, W. P. Duprex, and A. D. M. E. Osterhaus. 2007. Predominant infection

of CD150+ lymphocytes and dendritic cells during measles virus

infection of macaques. PLoS Pathogens 3:e178.

35. de Witte, L., R. D. de Vries, M. van der Vlist, S. Yuksel, M.

Litjens, R. L. de Swart, and T. B. H. Geijtenbeek. 2008. DC-

SIGN and CD150 have distinct roles in transmission of measles

virus from dendritic cells to T-lymphocytes. PLoS Pathogens

4:e1000049.

36. Devaux, P., G. Hodge, M. B. McChesney, and R. Cattaneo. 2008.

Attenuation of V- or C-defective measles viruses: infection control

by the inflammatory and interferon responses of rhesus monkeys. J

Virol 82:5359-5367.

37. Devaux, P., B. Loveland, D. Christiansen, J. Milland, and D.

Gerlier. 1996. Interactions between the ectodomains of

haemagglutinin and CD46 as a primary step in measles virus entry. J

Gen Virol 77:1477-1481.

38. Devaux, P., V. von Messling, W. Songsungthong, C. Springfeld,

and R. Cattaneo. 2007. Tyrosine 110 in the measles virus

phosphoprotein is required to block STAT1 phosphorylation.

Virology 360:72-83.

39. Dorig, R. E., A. Marcil, A. Chopra, and C. D. Richardson. 1993.

The human CD46 molecule is a receptor for measles virus

(Edmonston strain). Cell 75:295-305.

References

135

40. Duprex, W. P., I. Duffy, S. McQuaid, L. Hamill, S. L. Cosby, M.

A. Billeter, J. Schneider-Schaulies, V. ter Meulen, and B. K. Rima. 1999. The H gene of rodent brain-adapted measles virus

confers neurovirulence to the Edmonston vaccine strain. J Virol

73:6916-6922.

41. Elliman, D., and H. Bedford. 2007. Achieving the goal for global

measles mortality. Lancet 369:165-166.

42. Enders, J. F., and T. C. Peebles. 1954. Propagation in tissue

cultures of cytopathogenic agents from patients with measles. Proc

Natl Acad Sci U S A 86:277-286.

43. Engel, P., M. J. Eck, and C. Terhorst. 2003. The SAP and SLAM

families in immune responses and X-linked lymphoproliferative

disease. Nat Rev Immunol 3:813-821.

44. Erlenhoefer, C., W. J. Wurzer, S. Loffler, S. Schneider-

Schaulies, V. ter Meulen, and J. Schneider-Schaulies. 2001.

CD150 (SLAM) is a receptor for measles virus but is not involved in

viral contact-mediated proliferation inhibition. J Virol 75:4499-

4505.

45. Erlenhofer, C., W. P. Duprex, B. K. Rima, V. ter Meulen, and J.

Schneider-Schaulies. 2002. Analysis of receptor (CD46, CD150)

usage by measles virus. J Gen Virol 83:1431-1436.

46. Esolen, L. M., S. W. Park, J. M. Hardwick, and D. E. Griffin.

1995. Apoptosis as a cause of death in measles virus-infected cells. J

Virol 69:3955-3958.

47. Esolen, L. M., B. J. Ward, T. R. Moench, and D. E. Griffin. 1993.

Infection of monocytes during measles. J Infect Dis 168:47-52.

48. Farr, A. G., Y. Cho, and P. P. De Bruyn. 1980. The structure of

the sinus wall of the lymph node relative to its endocytic properties

and transmural cell passage. Am J Anat 157:265-284.

49. Fontana, J. M., B. Bankamp, W. J. Bellini, and P. A. Rota. 2008.

Regulation of interferon signaling by the C and V proteins from

attenuated and wild-type strains of measles virus. Virology 374:71-

81.

50. Fujinami, R. S., and M. B. Oldstone. 1979. Antiviral antibody

reacting on the plasma membrane alters measles virus expression

inside the cell. Nature 279:529-530.

References

136

51. Gendelman, H. E., J. S. Wolinsky, R. T. Johnson, N. J.

Pressman, G. H. Pezeshkpour, and G. F. Boisset. 1984. Measles

encephalomyelitis: lack of evidence of viral invasion of the central

nervous system and quantitative study of the nature of

demyelination. Ann Neurol 15:353-360.

52. Gerlier, D., B. Loveland, G. Varior-Krishnan, B. Thorley, I. F.

McKenzie, and C. Rabourdin-Combe. 1994. Measles virus

receptor properties are shared by several CD46 isoforms differing in

extracellular regions and cytoplasmic tails. J Gen Virol 75:2163-

2171.

53. GeurtsvanKessel, C. H., M. A. Willart, L. S. van Rijt, F.

Muskens, M. Kool, C. Baas, K. Thielemans, C. Bennett, B. E.

Clausen, H. C. Hoogsteden, A. D. Osterhaus, G. F. Rimmelzwaan, and B. N. Lambrecht. 2008. Clearance of influenza

virus from the lung depends on migratory langerin+CD11b- but not

plasmacytoid dendritic cells. J Exp Med 205:1621-1634.

54. Goldman, M. B., T. A. O'Bryan, D. J. Buckthal, L. M. Tetor, and

J. N. Goldman. 1995. Suppression of measles virus expression by

noncytolytic antibody in an immortalized macrophage cell line. J

Virol 69:734-740.

55. Gombart, A. F., A. Hirano, and T. C. Wong. 1993.

Conformational maturation of measles virus nucleocapsid protein. J

Virol 67:4133-4141.

56. Grayson, M. H., and M. J. Holtzman. 2007. Emerging role of

dendritic cells in respiratory viral infection. J Mol Med 85:1057-

1068.

57. Grdzelishvili, V. Z., S. Smallwood, D. Tower, R. L. Hall, D. M.

Hunt, and S. A. Moyer. 2005. A single amino acid change in the L-

polymerase protein of vesicular stomatitis virus completely abolishes

viral mRNA cap methylation. J Virol 79:7327-7337.

58. Gremillion, D. H., and G. E. Crawford. 1981. Measles pneumonia

in young adults. An analysis of 106 cases. Am J Med 71:539-542.

59. Griffin, D. E. 2007. Measles Virus, p. 1551-1585. In D. M. Knipe

and P. M. Howley (ed.), Fields' Virology, vol. 1. Lippincott

Williams and Wilkins, Philadelphia.

60. Griffin, D. E., and B. J. Ward. 1993. Differential CD4 T cell

activation in measles. J Infect Dis 168:275-281.

References

137

61. Grivel, J. C., M. Garcia, W. J. Moss, and L. B. Margolis. 2005.

Inhibition of HIV-1 replication in human lymphoid tissues ex vivo

by measles virus. J Infect Dis 192:71-78.

62. Hahm, B., N. Arbour, D. Naniche, D. Homann, M. Manchester,

and M. B. Oldstone. 2003. Measles virus infects and suppresses

proliferation of T lymphocytes from transgenic mice bearing human

signaling lymphocytic activation molecule. J Virol 77:3505-3515.

63. Hahm, B., N. Arbour, and M. B. Oldstone. 2004. Measles virus

interacts with human SLAM receptor on dendritic cells to cause

immunosuppression. Virology 323:292-302.

64. Hahm, B., J. H. Cho, and M. B. Oldstone. 2007. Measles virus-

dendritic cell interaction via SLAM inhibits innate immunity:

selective signaling through TLR4 but not other TLRs mediates

suppression of IL-12 synthesis. Virology 358:251-257.

65. Hamaguchi, M., T. Yoshida, K. Nishikawa, H. Naruse, and Y.

Nagai. 1983. Transcriptive complex of Newcastle disease virus. I.

Both L and P proteins are required to constitute an active complex.

Virology 128:105-117.

66. Harmsen, A. G., B. A. Muggenburg, M. B. Snipes, and D. E.

Bice. 1985. The role of macrophages in particle translocation from

lungs to lymph nodes. Science 230:1277-1280.

67. Hashiguchi, T., and e. al. 2007. Crystal structure of measles virus

hemagglutinin provides insight into effective vaccines. Proc Natl

Acad Sci U.S.A. 104:19535-19540.

68. Henneman, P. L., D. M. Birnbaumer, and C. B. Cairns. 1995.

Measles pneumonitis. Ann Emerg Med 26:278-282.

69. Hercyk, N., S. M. Horikami, and S. A. Moyer. 1988. The vesicular

stomatitis virus L protein possesses the mRNA methyltransferase

activities. Virology 163:222-225.

70. Hirano, A., M. Ayata, A. H. Wang, and T. C. Wong. 1993.

Functional analysis of matrix proteins expressed from cloned genes

of measles virus variants that cause subacute sclerosing

panencephalitis reveals a common defect in nucleocapsid binding. J

Virol 67:1848-1853.

71. Hirano, A., A. H. Wang, A. F. Gombart, and T. C. Wong. 1992.

The matrix proteins of neurovirulent subacute sclerosing

panencephalitis virus and its acute measles virus progenitor are

functionally different. Proc Natl Acad Sci U S A 89:8745-8749.

References

138

72. Horikami, S. M., J. Curran, D. Kolakofsky, and S. A. Moyer.

1992. Complexes of Sendai virus NP-P and P-L proteins are required

for defective interfering particle genome replication in vitro. J Virol

66:4901-4908.

73. Horikami, S. M., S. Smallwood, B. Bankamp, and S. A. Moyer.

1994. An amino-proximal domain of the L protein binds to the P

protein in the measles virus RNA polymerase complex. Virology

205:540-545.

74. Howie, D., S. Okamoto, S. Rietdijk, K. Clarke, N. Wang, C.

Gullo, J. P. Bruggeman, S. Manning, A. J. Coyle, E. Greenfield, V. Kuchroo, and C. Terhorst. 2002. The role of SAP in murine

CD150 (SLAM)-mediated T-cell proliferation and interferon gamma

production. Blood 100:2899-2907.

75. Hsu, E. C., C. Iorio, F. Sarangi, A. A. Khine, and C. D.

Richardson. 2001. CDw150(SLAM) is a receptor for a

lymphotropic strain of measles virus and may account for the

immunosuppressive properties of this virus. Virology 279:9-21.

76. Hsu, E. C., F. Sarangi, C. Iorio, M. S. Sidhu, S. A. Udem, D. L.

Dillehay, W. Xu, P. A. Rota, W. J. Bellini, and C. D. Richardson. 1998. A single amino acid change in the hemagglutinin protein of

measles virus determines its ability to bind CD46 and reveals

another receptor on marmoset B cells. J Virol 72:2905-2916.

77. Hu, A., T. Cathomen, R. Cattaneo, and E. Norrby. 1995.

Influence of N-linked oligosaccharide chains on the processing, cell

surface expression and function of the measles virus fusion protein. J

Gen Virol 76:705-710.

78. Hu, A., R. Cattaneo, S. Schwartz, and E. Norrby. 1994. Role of

N-linked oligosaccharide chains in the processing and antigenicity of

measles virus haemagglutinin protein. J Gen Virol 75:1043-1052.

79. Huber, M., R. Cattaneo, P. Spielhofer, C. Orvell, E. Norrby, M.

Messerli, J. C. Perriard, and M. A. Billeter. 1991. Measles virus

phosphoprotein retains the nucleocapsid protein in the cytoplasm.

Virology 185:299-308.

80. Iwata, K., T. Seya, S. Ueda, H. Ariga, and S. Nagasawa. 1994.

Modulation of complement regulatory function and measles virus

receptor function by the serine-threonine-rich domains of membrane

cofactor protein (CD46). Biochem J 304:169-175.

References

139

81. Jaye, A., A. F. Magnusen, A. D. Sadiq, T. Corrah, and H. C.

Whittle. 1998. Ex vivo analysis of cytotoxic T lymphocytes to

measles antigens during infection and after vaccination in Gambian

children. J Clin Invest 102:1969-1977.

82. Jaye, A., A. F. Magnusen, and H. C. Whittle. 1998. Human

leukocyte antigen class I- and class II-restricted cytotoxic T

lymphocyte responses to measles antigens in immune adults. J Infect

Dis 177:1282-1289.

83. Johnson, R. T., D. E. Griffin, R. L. Hirsch, J. S. Wolinsky, S.

Roedenbeck, I. Lindo de Soriano, and A. Vaisberg. 1984. Measles

encephalomyelitis--clinical and immunologic studies. N Engl J Med

310:137-141.

84. Junt, T., E. A. Moseman, M. Iannacone, S. Massberg, P. A.

Lang, M. Boes, K. Fink, S. E. Henrickson, D. M. Shayakhmetov,

N. C. Di Paolo, N. van Rooijen, T. R. Mempel, S. P. Whelan, and

U. H. von Andrian. 2007. Subcapsular sinus macrophages in lymph

nodes clear lymph-borne viruses and present them to antiviral B

cells. Nature 450:110-114.

85. Junt, T., E. Scandella, and B. Ludewig. 2008. Form follows

function: lymphoid tissue microarchitecture in antimicrobial immune

defence. Nat Rev Immunol 8:764-775.

86. Kärber, G. 1931. Beitrag zur kollektiven Behandlung

pharmakologischer Reihenversuche. Arch. Exp. Pathol. Pharmakol.

162:480-483.

87. Karp, C. L., M. Wysocka, L. M. Wahl, J. M. Ahearn, P. J.

Cuomo, B. Sherry, G. Trinchieri, and D. E. Griffin. 1996.

Mechanism of suppression of cell-mediated immunity by measles

virus. Science 273:228-231.

88. Kingston, R. L., W. A. Baase, and L. S. Gay. 2004.

Characterization of nucleocapsid binding by the measles virus and

mumps virus phosphoproteins. J Virol 78:8630-8640.

89. Kirby, A. C., M. C. Coles, and P. M. Kaye. 2009. Alveolar

macrophages transport pathogens to lung draining lymph nodes. J

Immunol 183:1983-1989.

90. Koplik, H. 1962. The diagnosis of the invasion of measles from a

study of the exanthema as it appears on the buccal mucous

membrane. Arch Pediatr 79:162-165.

References

140

91. Kristensson, K., and E. Norrby. 1986. Persistence of RNA viruses

in the central nervous system. Annu Rev Microbiol 40:159-184.

92. Kruse, M., E. Meinl, G. Henning, C. Kuhnt, S. Berchtold, T.

Berger, G. Schuler, and A. Steinkasserer. 2001. Signaling

lymphocytic activation molecule is expressed on mature CD83+

dendritic cells and is up-regulated by IL-1 beta. J Immunol

167:1989-1995.

93. Kumagai, Y., O. Takeuchi, H. Kato, H. Kumar, K. Matsui, E.

Morii, K. Aozasa, T. Kawai, and S. Akira. 2007. Alveolar

macrophages are the primary interferon-alpha producer in

pulmonary infection with RNA viruses. Immunity 27:240-252.

94. Lamb, R. A. 1993. Paramyxovirus fusion: a hypothesis for changes.

Virology 197:1-11.

95. Lamb, R. A., and G. D. Parks. 2007. Paramyxoviridae: the viruses

and their replication, p. 1449-1496. In D. M. Knipe and P. M.

Howley (ed.), Fields Virology, Fifth ed. Lippincott, Williams and

Wilkins, Philadelphia.

96. Latour, S., G. Gish, C. D. Helgason, R. K. Humphries, T.

Pawson, and A. Veillette. 2001. Regulation of SLAM-mediated

signal transduction by SAP, the X-linked lymphoproliferative gene

product. Nat Immunol 2:681-690.

97. Lecouturier, V., J. Fayolle, M. Caballero, J. Carabana, M. L.

Celma, R. Fernandez-Munoz, T. F. Wild, and R. Buckland. 1996. Identification of two amino acids in the hemagglutinin

glycoprotein of measles virus (MV) that govern hemadsorption,

HeLa cell fusion, and CD46 downregulation: phenotypic markers

that differentiate vaccine and wild-type MV strains. J Virol 70:4200-

4204.

98. Legge, K. L., and T. J. Braciale. 2003. Accelerated migration of

respiratory dendritic cells to the regional lymph nodes is limited to

the early phase of pulmonary infection. Immunity 18:265-277.

99. Leonard, V. H. L., P. L. Sinn, G. Hodge, T. Miest, P. Devaux, N.

Oezguen, W. Braun, P. B. McCray, M. B. McChesney, and R. Cattaneo. 2008. Measles virus blind to its epithelial cell receptor

remains virulent in rhesus monkeys but cannot cross the airway

epithelium and is not shed. J Clin Invest 118:2448-2458.

100. Liston, P., and D. J. Briedis. 1994. Measles virus V protein binds

zinc. Virology 198:399-404.

References

141

101. Liston, P., C. DiFlumeri, and D. J. Briedis. 1995. Protein

interactions entered into by the measles virus P, V, and C proteins.

Virus Res 38:241-259.

102. Liszewski, M. K., T. W. Post, and J. P. Atkinson. 1991.

Membrane cofactor protein (MCP or CD46): newest member of the

regulators of complement activation gene cluster. Annu Rev

Immunol 9:431-455.

103. Lucas, J. 1790. An account of uncommon symptoms succeeding the

measles; with additional remarks on the infection of measles and

smallpox. London Med J 11:325-331.

104. Ma, C. S., K. E. Nichols, and S. G. Tangye. 2007. Regulation of

cellular and humoral immune responses by the SLAM and SAP

families of molecules. Annu Rev Immunol 25:337-379.

105. Maisner, A., and G. Herrler. 1995. Membrane cofactor protein

with different types of N-glycans can serve as measles virus

receptor. Virology 210:479-481.

106. Manchester, M., M. K. Liszewski, J. P. Atkinson, and M. B.

Oldstone. 1994. Multiple isoforms of CD46 (membrane cofactor

protein) serve as receptors for measles virus. Proc Natl Acad Sci U S

A 91:2161-2165.

107. Mavaddat, N., D. W. Mason, P. D. Atkinson, E. J. Evans, R. J.

Gilbert, D. I. Stuart, J. A. Fennelly, A. N. Barclay, S. J. Davis, and M. H. Brown. 2000. Signaling lymphocytic activation molecule

(CDw150) is homophilic but self-associates with very low affinity. J

Biol Chem 275:28100-28109.

108. McChesney, M. B., C. J. Miller, P. A. Rota, Y. D. Zhu, L.

Antipa, N. W. Lerche, R. Ahmed, and W. J. Bellini. 1997.

Experimental Measles. I. Pathogenesis in the normal and the

immunized host. Virology 233:74-84.

109. Minagawa, H., K. Tanaka, N. Ono, H. Tatsuo, and Y. Yanagi.

2001. Induction of the measles virus receptor SLAM (CD150) on

monocytes. J Gen Virol 82:2913-2917.

110. Moss, W. J. 2009. Measles control and the prospect of eradication.

Curr Top Microbiol Immunol 330:173-189.

111. Moss, W. J., J. J. Ryon, M. Monze, and D. E. Griffin. 2002.

Differential regulation of interleukin (IL)-4, IL-5, and IL-10 during

measles in Zambian children. J Infect Dis 186:879-887.

References

142

112. Mrkic, B., B. Odermatt, M. A. Klein, M. A. Billeter, J. Pavlovic,

and R. Cattaneo. 2000. Lymphatic dissemination and comparative

pathology of recombinant measles viruses in genetically modified

mice. J Virol 74:1364-1372.

113. Mrkic, B., J. Pavlovic, T. Rulicke, P. Volpe, C. J. Buchholz, D.

Hourcade, J. P. Atkinson, A. Aguzzi, and R. Cattaneo. 1998.

Measles virus spread and pathogenesis in genetically modified mice.

J Virol 72:7420-7427.

114. Müller, U., U. Steinhoff, L. F. Reis, S. Hemmi, J. Pavlovic, R. M.

Zinkernagel, and M. Aguet. 1994. Functional role of type I and

type II interferons in antiviral defense. Science 264:1918-1921.

115. Mustafa, M. M., S. D. Weitman, N. J. Winick, W. J. Bellini, C. F.

Timmons, and J. D. Siegel. 1993. Subacute measles encephalitis in

the young immunocompromised host: report of two cases diagnosed

by polymerase chain reaction and treated with ribavirin and review

of the literature. Clin Infect Dis 16:654-660.

116. Naim, H. Y., E. Ehler, and M. A. Billeter. 2000. Measles virus

matrix protein specifies apical virus release and glycoprotein sorting

in epithelial cells. EMBO J 19:3576-3585.

117. Nakatsu, Y., M. Takeda, S. Ohno, Y. Shirogane, M. Iwasaki, and

Y. Yanagi. 2008. Measles virus circumvents the host interferon

response by different actions of the C and V proteins. J Virol

82:8296-8306.

118. Nanan, R., C. Carstens, and H. W. Kreth. 1995. Demonstration of

virus-specific CD8+ memory T cells in measles-seropositive

individuals by in vitro peptide stimulation. Clin Exp Immunol

102:40-45.

119. Naniche, D., G. Varior-Krishnan, F. Cervoni, T. F. Wild, B.

Rossi, C. Rabourdin-Combe, and D. Gerlier. 1993. Human

membrane cofactor protein (CD46) acts as a cellular receptor for

measles virus. J Virol 67:6025-6032.

120. Navaratnarajah, C. K., V. H. Leonard, and R. Cattaneo. 2009.

Measles virus glycoprotein complex assembly, receptor attachment,

and cell entry. Curr Top Microbiol Immunol 329:59-76.

References

143

121. Navaratnarajah, C. K., S. Vongpunsawad, N. Oezguen, T.

Stehle, W. Braun, T. Hashiguchi, K. Maenaka, Y. Yanagi, and R. Cattaneo. 2008. Dynamic interaction of the measles virus

hemagglutinin with its receptor signaling lymphocytic activation

molecule (SLAM, CD150). J Biol Chem 283:11763-11771.

122. Norrby, E., and K. Kristensson. 1997. Measles virus in the brain.

Brain Res Bull 44:213-220.

123. Caignard, G., M. Bourai, Y. Jacob, F. Tangy, and P. O. Vidalain.

2009. Inhibition of IFN-alpha/beta signaling by two discrete peptides

within measles virus V protein that specifically bind STAT1 and

STAT2. Virology 383:112-120.

124. Ogino, T., M. Kobayashi, M. Iwama, and K. Mizumoto. 2005.

Sendai virus RNA-dependent RNA polymerase L protein catalyzes

cap methylation of virus-specific mRNA. J Biol Chem 280:4429-

4435.

125. Ohgimoto, S., K. Ohgimoto, S. Niewiesk, I. M. Klagge, J.

Pfeuffer, I. C. Johnston, J. Schneider-Schaulies, A. Weidmann, V. ter Meulen, and S. Schneider-Schaulies. 2001. The

haemagglutinin protein is an important determinant of measles virus

tropism for dendritic cells in vitro. J Gen Virol 82:1835-1844.

126. Ohno, S., S. Fumio, N. Ono, and Y. Yanagi. 2003. Histidine at

position 61 and its adjacent amino acid residues are critical for the

ability of SLAM (CD150) to act as a cellular receptor for measles

virus. J Gen Virol 84:2381-2388.

127. Ohno, S., N. Ono, F. Seki, M. Takeda, S. Kura, T. Tsuzuki, and

Y. Yanagi. 2007. Measles virus infection of SLAM (CD150)

knockin mice reproduces tropism and immunosuppression in human

infection. J Virol 81:1650-1659.

128. Ohno, S., N. Ono, M. Takeda, K. Takeuchi, and Y. Yanagi. 2004.

Dissection of measles virus V protein in relation to its ability to

block alpha/beta interferon signal transduction. J Gen Virol 85:2991-

2999.

129. Okada, H., F. Kobune, T. A. Sato, T. Kohama, Y. Takeuchi, T.

Abe, N. Takayama, T. Tsuchiya, and M. Tashiro. 2000. Extensive

lymphopenia due to apoptosis of uninfected lymphocytes in acute

measles patients. Arch Virol 145:905-920.

References

144

130. Okada, H., T. A. Sato, A. Katayama, K. Higuchi, K. Shichijo, T.

Tsuchiya, N. Takayama, Y. Takeuchi, T. Abe, N. Okabe, and M. Tashiro. 2001. Comparative analysis of host responses related to

immunosuppression between measles patients and vaccine recipients

with live attenuated measles vaccines. Arch Virol 146:859-874.

131. Okamura, A., O. Itakura, M. Yoshioka, M. Kubota, H. Kikuta,

and K. Kobayashi. 2001. Unusual presentation of measles giant cell

pneumonia in a patient with acquired immunodeficiency syndrome.

Clin Infect Dis 32:E57-58.

132. Ono, N., H. Tatsuo, Y. Hidaka, T. Aoki, H. Minagawa, and Y.

Yanagi. 2001. Measles viruses on throat swabs from measles

patients use signaling lymphocytic activation molecule (CDw150)

but not CD46 as a cellular receptor. J Virol 75:4399-4401.

133. Ono, N., H. Tatsuo, K. Tanaka, H. Minagawa, and Y. Yanagi.

2001. V domain of human SLAM (CDw150) is essential for its

function as a measles virus receptor. J Virol 75:1594-1600.

134. Palosaari, H., J. P. Parisien, J. J. Rodriguez, C. M. Ulane, and C.

M. Horvath. 2003. STAT protein interference and suppression of

cytokine signal transduction by measles virus V protein. J Virol

77:7635-7644.

135. Panum, P. 1938. Observations made during the epidemic of measles

on the Faroe Islands in the year of 1846. Medical Classics 3:829-

886.

136. Parks, C. L., R. A. Lerch, P. Walpita, H. P. Wang, M. S. Sidhu,

and S. A. Udem. 2001. Analysis of the noncoding regions of

measles virus strains in the Edmonston vaccine lineage. J Virol

75:921-933.

137. Parks, C. L., R. A. Lerch, P. Walpita, H. P. Wang, M. S. Sidhu,

and S. A. Udem. 2001. Comparison of predicted amino acid

sequences of measles virus strains in the Edmonston vaccine lineage.

J Virol 75:910-920.

138. Permar, S. R., S. A. Klumpp, K. G. Mansfield, A. A. Carville, D.

A. Gorgone, M. A. Lifton, J. E. Schmitz, K. A. Reimann, F. P. Polack, D. E. Griffin, and N. L. Letvin. 2004. Limited contribution

of humoral immunity to the clearance of measles viremia in rhesus

monkeys. J Infect Dis 190:998-1005.

References

145

139. Permar, S. R., S. A. Klumpp, K. G. Mansfield, W. K. Kim, D. A.

Gorgone, M. A. Lifton, K. C. Williams, J. E. Schmitz, K. A.

Reimann, M. K. Axthelm, F. P. Polack, D. E. Griffin, and N. L. Letvin. 2003. Role of CD8(+) lymphocytes in control and clearance

of measles virus infection of rhesus monkeys. J Virol 77:4396-4400.

140. Permar, S. R., W. J. Moss, J. J. Ryon, M. Monze, F. Cutts, T. C.

Quinn, and D. E. Griffin. 2001. Prolonged measles virus shedding

in human immunodeficiency virus-infected children, detected by

reverse transcriptase-polymerase chain reaction. J Infect Dis

183:532-538.

141. Phan, T. G., I. Grigorova, T. Okada, and J. G. Cyster. 2007.

Subcapsular encounter and complement-dependent transport of

immune complexes by lymph node B cells. Nat Immunol 8:992-

1000.

142. Plemper, R., A. Hammond, and R. Cattaneo. 2000.

Characterization of a region of measles virus hemagglutinin

sufficient for its dimerization. J Virol 74:6485-6493.

143. Poch, O., B. M. Blumberg, L. Bougueleret, and N. Tordo. 1990.

Sequence comparison of five polymerases (L proteins) of

unsegmented negative-strand RNA viruses: theoretical assignment

of functional domains. J Gen Virol 71:1153-1162.

144. Polacino, P. S., L. M. Pinchuk, S. P. Sidorenko, and E. A. Clark.

1996. Immunodeficiency virus cDNA synthesis in resting T

lymphocytes is regulated by T cell activation signals and dendritic

cells. J Med Primatol 25:201-209.

145. Polack, F. P., S. H. Lee, S. Permar, E. Manyara, H. G. Nousari,

Y. Jeng, F. Mustafa, A. Valsamakis, R. J. Adams, H. L. Robinson, and D. E. Griffin. 2000. Successful DNA immunization

against measles: Neutralizing antibody against either the

hemagglutinin or fusion glycoprotein protects rhesus macaques

without evidence of atypical measles. Nat Med 6:776-781.

146. Punnonen, J., B. G. Cocks, J. M. Carballido, B. Bennett, D.

Peterson, G. Aversa, and J. E. de Vries. 1997. Soluble and

membrane-bound forms of signaling lymphocytic activation

molecule (SLAM) induce proliferation and Ig synthesis by activated

human B lymphocytes. J Exp Med 185:993-1004.

References

146

147. Radecke, F., P. Spielhofer, H. Schneider, K. Kaelin, M. Huber,

C. Dotsch, G. Christiansen, and M. A. Billeter. 1995. Rescue of

measles viruses from cloned DNA. EMBO J 14:5773-5784.

148. Rager, M., S. Vongpunsawad, W. P. Duprex, and R. Cattaneo.

2002. Polyploid measles virus with hexameric genome length.

EMBO J 21:2364-2372.

149. Ramachandran, A., J. P. Parisien, and C. M. Horvath. 2008.

STAT2 is a primary target for measles virus V protein-medicated

IFNα/β signaling inhibition. J Virol 82:8330-8338.

150. Reutter, G. L., C. Cortese-Grogan, J. Wilson, and S. A. Moyer.

2001. Mutations in the measles virus C protein that up regulate viral

RNA synthesis. Virology 285:100-109.

151. Richardson, C., D. Hull, P. Greer, K. Hasel, A. Berkovich, G.

Englund, W. Bellini, B. Rima, and R. Lazzarini. 1986. The

nucleotide sequence of the mRNA encoding the fusion protein of

measles virus (Edmonston strain): a comparison of fusion proteins

from several different paramyxoviruses. Virology 155:508-523.

152. Rima, B. K., and W. P. Duprex. 2006. Morbilliviruses and human

disease. J Pathol 208:199-214.

153. Romero, X., D. Benitez, S. March, R. Vilella, M. Miralpeix, and

P. Engel. 2004. Differential expression of SAP and EAT-2-binding

leukocyte cell-surface molecules CD84, CD150 (SLAM), CD229

(Ly9) and CD244 (2B4). Tissue Antigens 64:132-144.

154. Roscic-Mrkic, B., R. A. Schwendener, B. Odermatt, A. Zuniga,

J. Pavlovic, M. A. Billeter, and R. Cattaneo. 2001. Roles of

macrophages in measles virus infection of genetically modified

mice. J Virol 75:3343-3351.

155. Rota, J. S., Z. D. Wang, P. A. Rota, and W. J. Bellini. 1994.

Comparison of sequences of the H, F, and N coding genes of

measles virus vaccine strains. Virus Res 31:317-330.

156. Ryon, J. J., W. J. Moss, M. Monze, and D. E. Griffin. 2002.

Functional and phenotypic changes in circulating lymphocytes from

hospitalized Zambian children with measles. Clin Diagn Lab

Immunol 9:994-1003.

157. Sakaguchi, M., Y. Yoshikawa, K. Yamanouchi, T. Sata, K.

Nagashima, and K. Takeda. 1986. Growth of measles virus in

epithelial and lymphoid tissues of cynomolgus monkeys. Microbiol

Immunol 30:1067-1073.

References

147

158. Sauer, K. A., P. Scholtes, R. Karwot, and S. Finotto. 2006.

Isolation of CD4+ T cells from murine lungs: a method to analyze

ongoing immune responses in the lung. Nat Protoc 1:2870-2875.

159. Sayos, J., C. Wu, M. Morra, N. Wang, X. Zhang, D. Allen, S. van

Schaik, L. Notarangelo, R. Geha, M. G. Roncarolo, H. Oettgen,

J. E. De Vries, G. Aversa, and C. Terhorst. 1998. The X-linked

lymphoproliferative-disease gene product SAP regulates signals

induced through the co-receptor SLAM. Nature 395:462-469.

160. Schlender, J., V. Hornung, S. Finke, M. Gunthner-Biller, S.

Marozin, K. Brzozka, S. Moghim, S. Endres, G. Hartmann, and K. K. Conzelmann. 2005. Inhibition of toll-like receptor 7- and 9-

mediated alpha/beta interferon production in human plasmacytoid

dendritic cells by respiratory syncytial virus and measles virus. J

Virol 79:5507-5515.

161. Schneider-Schaulies, S., and J. Schneider-Schaulies. 2009.

Measles virus-induced immunosuppression. Curr Top Microbiol

Immunol 330:243-269.

162. Schneider, U., V. von Messling, P. Devaux, and R. Cattaneo.

2002. Efficiency of measles virus entry and dissemination through

different receptors. J Virol 76:7460-7467.

163. Sellin, C. I., N. Davoust, V. Guillaume, D. Baas, M. F. Belin, R.

Buckland, T. F. Wild, and B. Horvat. 2006. High pathogenicity of

wild-type measles virus infection in CD150 (SLAM) transgenic

mice. J Virol 80:6420-6429.

164. Sellin, C. I., and B. Horvat. 2009. Current animal models:

transgenic animal models for the study of measles pathogenesis.

Curr Top Microbiol Immunol 330:111-127.

165. Seya T, B. L., Bora NS, Kumar V, Cui W, Atkinson JP. 1988.

Distribution of membrane cofactor protein of complement on human

peripheral blood cells. An altered form is found on granulocytes. Eur

J Immunol 18:1289-1294.

166. Shaffer, J. A., W. J. Bellini, and P. A. Rota. 2003. The C protein

of measles virus inhibits the type I interferon response. Virology

315:389-397.

References

148

167. Shibahara, K., H. Hotta, Y. Katayama, and M. Homma. 1994.

Increased binding activity of measles virus to monkey red blood

cells after long-term passage in Vero cell cultures. J Gen Virol

75:3511-3516.

168. Shingai, M., N. Inoue, T. Okuno, M. Okabe, T. Akazawa, Y.

Miyamoto, M. Ayata, K. Honda, M. Kurita-Taniguchi, M.

Matsumoto, H. Ogura, T. Taniguchi, and T. Seya. 2005. Wild-

type measles virus infection in human CD46/CD150-transgenic

mice: CD11c-positive dendritic cells establish systemic viral

infection. J Immunol 175:3252-3261.

169. Sidhu, M. S., J. P. Menonna, S. D. Cook, P. C. Dowling, and S.

A. Udem. 1993. Canine distemper virus L gene: sequence and

comparison with related viruses. Virology 193:50-65.

170. Sidorenko, S. P., and E. A. Clark. 1993. Characterization of a cell

surface glycoprotein IPO-3, expressed on activated human B and T

lymphocytes. J Immunol 151:4614-4624.

171. Sidorenko, S. P., and E. A. Clark. 2003. The dual-function CD150

receptor subfamily: the viral attraction. Nat Immunol 4:19-24.

172. Sleeman, K., and M. D. Baron. 2005. The polymerase (L) protein

of rinderpest virus interacts with the host cell protein striatin.

Virology 332:225-234.

173. Spehner, D., R. Drillien, and P. M. Howley. 1997. The assembly

of the measles virus nucleoprotein into nucleocapsid-like particles is

modulated by the phosphoprotein. Virology 232:260-268.

174. Spielhofer, P., T. Bachi, T. Fehr, G. Christiansen, R. Cattaneo,

K. Kaelin, M. A. Billeter, and H. Y. Naim. 1998. Chimeric

measles viruses with a foreign envelope. J Virol 72:2150-2159.

175. Sun, X., J. B. Burns, J. M. Howell, and R. S. Fujinami. 1998.

Suppression of antigen-specific T cell proliferation by measles virus

infection: role of a soluble factor in suppression. Virology 246:24-

33.

176. Tahara, M., M. Takeda, F. Seki, T. Hashiguchi, and Y. Yanagi.

2007. Multiple amino acid substitutions in hemagglutinin are

necessary for wild-type measles virus to acquire the ability to use

receptor CD46 efficiently. J Virol 81:2564-2572.

References

149

177. Tahara, M., M. Takeda, Y. Shirogane, T. Hashiguchi, S. Ohno,

and Y. Tanagi. 2008. Mealses virus infects both polarized epithelial

and immune cells by using distrinctive receptor-binding sites on its

hemagglutinin. J Virol 82:4630-4637.

178. Tahara, M., M. Takeda, and Y. Yanagi. 2007. Altered interaction

of the matrix protein with the cytoplasmic tail of hemagglutinin

modulates measles virus growth by affecting virus assembly and

cell-cell fusion. J Virol 81:6827-6836.

179. Tahara, M., M. Takeda, and Y. Yanagi. 2005. Contributions of

matrix and large protein genes of the measles virus edmonston strain

to growth in cultured cells as revealed by recombinant viruses. J

Virol 79:15218-15225.

180. Takeda, M., A. Kato, F. Kobune, H. Sakata, Y. Li, T. Shioda, Y.

Sakai, M. Asakawa, and Y. Nagai. 1998. Measles virus attenuation

associated with transcriptional impediment and a few amino acid

changes in the polymerase and accessory proteins. J Virol 72:8690-

8696.

181. Takeda, M., T. Sakaguchi, Y. Li, F. Kobune, A. Kato, and Y.

Nagai. 1999. The genome nucleotide sequence of a contemporary

wild strain of measles virus and its comparison with the classical

Edmonston strain genome. Virology 256:340-350.

182. Takeda, M., K. Takeuchi, N. Miyajima, F. Kobune, Y. Ami, N.

Nagata, Y. Suzaki, Y. Nagai, and M. Tashiro. 2000. Recovery of

pathogenic measles virus from cloned cDNA. J Virol 74:6643-6647.

183. Takeuchi, K., S. I. Kadota, M. Takeda, N. Miyajima, and K.

Nagata. 2003. Measles virus V protein blocks interferon (IFN)-

alpha/beta but not IFN-gamma signaling by inhibiting STAT1 and

STAT2 phosphorylation. FEBS Lett 545:177-182.

184. Takeuchi, K., N. Miyajima, F. Kobune, and M. Tashiro. 2000.

Comparative nucleotide sequence analyses of the entire genomes of

B95a cell-isolated and vero cell-isolated measles viruses from the

same patient. Virus Genes 20:253-257.

185. Takeuchi, K., M. Takeda, N. Miyajima, Y. Ami, N. Nagata, Y.

Suzaki, J. Shahnewaz, S. Kadota, and K. Nagata. 2005. Stringent

requirement for the C protein of wild-type measles virus for growth

both in vitro and in macaques. J Virol 79:7838-7844.

References

150

186. Tatsuo, H., N. Ono, K. Tanaka, and Y. Yanagi. 2000. SLAM

(CDw150) is a cellular receptor for measles virus. Nature 406:893-

897.

187. Tatsuo, H., N. Ono, and Y. Yanagi. 2001. Morbilliviruses use

signaling lymphocyte activation molecules (CD150) as cellular

receptors. J Virol 75:5842-5850.

188. Tober, C., M. Seufert, H. Schneider, M. A. Billeter, I. C.

Johnston, S. Niewiesk, V. ter Meulen, and S. Schneider-Schaulies. 1998. Expression of measles virus V protein is associated

with pathogenicity and control of viral RNA synthesis. J Virol

72:8124-8132.

189. Toth, A. M., P. Devaux, R. Cattaneo, and C. E. Samuel. 2009.

Protein kinase PKR mediates the apoptosis induction and growth

restriction phenotypes of C protein-deficient measles virus. J Virol

83:961-968.

190. van Binnendijk, R. S., M. C. Poelen, K. C. Kuijpers, A. D.

Osterhaus, and F. G. Uytdehaag. 1990. The predominance of

CD8+ T cells after infection with measles virus suggests a role for

CD8+ class I MHC-restricted cytotoxic T lymphocytes (CTL) in

recovery from measles. Clonal analyses of human CD8+ class I

MHC-restricted CTL. J Immunol 144:2394-2399.

191. van oud Alblas, A. B., and R. van Furth. 1979. Origin, kinetics,

and characterization of pulmonary macrophages in the normal steady

state. J. Exp.Med. 149:1504-1518.

192. Veillette, A. 2006. Immune regulation by SLAM family receptors

and SAP-related adaptors. Nat Rev Immunol 6:56-66.

193. von Messling, V., and R. Cattaneo. 2003. N-linked glycans with

similar location in the fusion protein head modulate paramyxovirus

fusion. J Virol 77:10202-10212.

194. von Messling, V., D. Milosevic, and R. Cattaneo. 2004. Tropism

illuminated: lymphocyte-based pathways blazed by lethal

morbillivirus through the host immune system. Proc Natl Acad Sci U

S A 101:14216-14221.

195. von Messling, V., C. Springfeld, P. Devaux, and R. Cattaneo.

2003. A ferret model of canine distemper virus virulence and

immunosuppression. J Virol 77:12579-12591.

References

151

196. von Messling, V., N. Svitek, and R. Cattaneo. 2006. Receptor

(SLAM, CD150) recognition and the V protein sustain swift

lymphocyte-based invasion of mucosal tissue and lymphatic organs

by a morbillivirus. J Virol 80:6084-6092.

197. von Pirquet, C. 1908. Das Verhalten der kutanen

Tuberkulinreaktion waehrend der Masern. Dtsch. Med. Wochenschr.

30:1297-1300.

198. Vongpunsawad, S., N. Oezgun, W. Braun, and R. Cattaneo.

2004. Selectively receptor-blind measles viruses: identification of

residues necessary for SLAM- or CD46-induced fusion and their

localization on a new hemagglutinin structural model. J Virol

78:302-313.

199. Wang, M., J. E. Libbey, I. Tsunoda, and R. S. Fujinami. 2003.

Modulation of immune system function by measles virus infection.

II. Infection of B cells leads to the production of a soluble factor that

arrests uninfected B cells in G0/G1. Viral Immunol 16:45-55.

200. Wang, N., A. Satoskar, W. Faubion, D. Howie, S. Okamoto, S.

Feske, C. Gullo, K. Clarke, M. R. Sosa, A. H. Sharpe, and C. Terhorst. 2004. The cell surface receptor SLAM controls T cell and

macrophage functions. J Exp Med 199:1255-1264.

201. Watanabe, M., A. Hirano, S. Stenglein, J. Nelson, G. Thomas,

and T. C. Wong. 1995. Engineered serine protease inhibitor

prevents furin-catalyzed activation of the fusion glycoprotein and

production of infectious measles virus. J Virol 69:3206-3210.

202. Welstead, G. G., C. Iorio, R. Draker, J. Bayani, J. Squire, S.

Vongpunsawad, R. Cattaneo, and C. D. Richardson. 2005.

Measles virus replication in lymphatic cells and organs of CD150

(SLAM) transgenic mice. Proc Natl Acad Sci U S A 102:16415-

16420.

203. Wesley, A. G., H. M. Coovadia, and P. Kiepiela. 1982. Further

predictive indices of clinical severity of measles. S Afr Med J

61:663-665.

204. Yanagi, Y., M. Takeda, and S. Ohno. 2006. Measles virus: cellular

receptors, tropism and pathogenesis. J Gen Virol 87:2767-2779.

205. Yin, H. S., X. Wen, R. G. Paterson, R. A. Lamb, and T. S.

Jardetzky. 2006. Structure of the parainfluenza virus 5 F protein in

its metastable, prefusion conformation. Nature 439:38-44.

References

152

206. Yokota, S., H. Saito, T. Kubota, N. Yokosawa, K. Amano, and N.

Fujii. 2003. Measles virus suppresses interferon-alpha signaling

pathway: suppression of Jak1 phosphorylation and association of

viral accessory proteins, C and V, with interferon-alpha receptor

complex. Virology 306:135-146.

measles virus: early infection, progression and pathogenesis in a

Documents