Journal of Dermatological Science 58 (2010) 177–185

MicroRNAs and potential target interactions in psoriasis

John R. Zibert a,*, Marianne B. Løvendorf a, Thomas Litman b, Jørgen Olsen c,Bogumil Kaczkowski d, Lone Skov a

a Department of Dermato-Allergology, Gentofte Hospital, University of Copenhagen, Niels Andersens Vej 65, 2900 Hellerup, Denmarkb Exiqon A/S, Bygstubben 9, 2950 Vedbaek, Denmarkc Department of Cellular and Molecular Medicine, Faculty of Health Sciences, University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen N, Denmarkd The Bioinformatics Centre, Department of Biology, University of Copenhagen, Ole Maaloes Vej 5, 2200 Copenhagen, Denmark

A R T I C L E I N F O

Article history:

Received 29 September 2009

Received in revised form 17 February 2010

Accepted 9 March 2010

Keywords:

NoncodingRNA

Post-transcriptional regulation

Skin

miRNA

miR-221/2

TIMP3

A B S T R A C T

Background: Psoriasis is a chronic inflammatory skin disease often seen in patients with a genetic

susceptibility. MicroRNAs (miRNA) are endogenous, short RNA molecules that can bind to parts of mRNA

target genes, thus inhibiting their translation and causing accelerated turnover or transcript degradation.

MicroRNAs are important in the pathogenesis of human diseases such as immunological disorders, as

they regulate a broad range of biological processes.

Objective: We investigated miRNA–mRNA interactions in involved (PP) and non-involved (PN) psoriatic

skin compared with healthy skin (NN).

Methods: Biopsies were obtained from PP, PN and NN, the miRNA and mRNA expression was analyzed by

microarray techniques and a subset of miRNAs and mRNAs were validated by q-RT-PCR. Novel target

interactions in psoriasis were found using PubMed, miRBase and RNAhybrid. In addition, TIMP3 protein

expression was studied in PP, PN and NN. Finally, the miR-221/2–TIMP3 target interaction was studied in

primary human keratinocytes by endogenous overexpression of the miRNAs.

Results: We identified 42 upregulated miRNAs and 5 downregulated miRNAs in PP compared with NN,

and only few deregulated miRNAs in PN compared with NN. Based on the miRNA and mRNA profiles

miR-21, -205, -221 and -222 were found to have the following potential mRNA targets in psoriatic skin:

PDCD4, TPM1, P57, C-KIT, RTN4, SHIP2, TIMP3, RECK and NFIB. The identified target mRNAs were likely to

be involved in cellular growth, proliferation, apoptosis and degradation of the extracellular matrix.

Finally we found that TIMP3 is downregulated in psoriatic skin. In vitro overexpression of miR-221 and

miR-222 lead to degradation of TIMP3 resulting in decreased TIMP3 protein level.

Conclusion: Our data indicate several novel important associations for miRNAs in psoriasis and in particular

the miR-221/2–TIMP3 target interaction could among others play a role in the psoriasis pathogenesis.

� 2010 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights

reserved.

Contents lists available at ScienceDirect

Journal of Dermatological Science

journa l homepage: www.e lsev ier .com/ jds

1. Introduction

Psoriasis is a chronic inflammatory skin disease characterizedby intense proliferation and abnormal differentiation of keratino-cytes. Several observations suggest T cells, dendritic cells andinflammatory cytokines as key players in the pathogenesis [1].Subjects predisposed to psoriasis have an inherited disorderassociated with several different psoriasis susceptibility loci andmajor histocompatibility complex alleles [1]. However, psoriasis isa complex disorder requiring not only a genetic susceptibility butalso an environmental trigger [2].

* Corresponding author. Tel.: +45 2291 7020; fax: +45 7226 3284.

E-mail address: johnzibert@gmail.com (J.R. Zibert).

0923-1811/$36.00 � 2010 Japanese Society for Investigative Dermatology. Published b

doi:10.1016/j.jdermsci.2010.03.004

MicroRNAs (miRNAs) usually bind to the 30 untranslatedregions (UTR) of mRNAs, inhibiting translation, causing acceleratedturnover or degradation of the mRNA transcript [3]. The miRNA-mediated regulation is often detectable on the protein level, insome cases even without detectable changes at the mRNA level [4].Several publications implicate miRNAs as important players in thepathogenesis of human diseases such as immunological disorders,cancers and metabolic disorders [5,6]. Although several hundredmiRNAs have been identified in humans, new insight on theirfunction is lacking [7]. To date, one study has been published onmiRNA in psoriasis comparing psoriatic skin with healthy skinwhere miR-203 was suggested to act as a suppressor of cytokinesignaling 3 (SOCS-3), modulating cytokine signaling, keratinocytehyperproliferation and differentiation in psoriatic skin [8]. Little isknown about other miRNA–mRNA interactions in psoriatic skin,

y Elsevier Ireland Ltd. All rights reserved.

J.R. Zibert et al. / Journal of Dermatological Science 58 (2010) 177–185178

and no work has been done describing the deregulated miRNAs innon-involved psoriatic skin.

In this paper we describe the statistically significant expressionmiRNA and mRNA in involved (PP) and non-involved (PN) psoriaticskin compared with healthy skin (NN). To find the biologicalsignificance of the miRNA expression we aimed to associatepreviously experimentally validated miRNA–mRNA interactionswith our miRNA and mRNA expression data. Finally, we aimed topredict new potential miRNA targets among the most significantdownregulated mRNAs in psoriasis and identified miR-221/2,which are likely to target tissue inhibitor of metalloprotease-3(TIMP3) in keratinocytes.

2. Materials and methods

2.1. Patients

Thirteen healthy subjects of Caucasian origin (average age 38.9years, range 23–62 years, 5 women and 8 men) and 13 patients ofCaucasian origin diagnosed with psoriasis vulgaris (average age55.5 years, range 32–73 years, 7 women and 6 men), wererecruited for the study. None of the participants had used anysystemically immunosuppressive medications for four weeks andnone local treatment at the site of biopsies for two weeks beforestudy participation. The study was approved by the DanishNational Committee on Biomedical Research Ethics (KA-20060119) and in accordance with the Code of Ethics of theWorld Medical Association (Declaration of Helsinki) for experi-ments involving humans. Two 4 mm punch biopsies were takenfrom each patient (PP and PN) and one 4 mm punch biopsy fromhealthy subjects (NN). The skin area was either flash frozen usingliquid nitrogen and immediately placed in liquid nitrogen andstored at �80 8C or fixed in formaldehyde (4%) and paraffinembedded.

2.2. Total RNA purification and analysis

Skin biopsies were ground in liquid nitrogen, immediatelytransferred to Lysis/Binding Buffer (Applied Biosystems, Warrington,UK) and homogenized with a rotor stator (IKA, Staufen, Germany).Human primary keratinocytes were dissolved in Trizol (Invitrogen,Taastrup, Denmark) and RNA was isolated using standard RNAextraction methods with chloroform, isopropanol and EtOH. TotalRNA from the biopsies was isolated using the one-step mirVanaTM

miRNA Isolation Kit (Applied Biosystems) following the manufac-turer’s instructions. The RNA quality was assessed by Agilent RNA6000 Nano Assay (Agilent Technologies, Naerum, Denmark) accept-ing an RNA integrity number higher than 7.5 and the RNAconcentration was determined using a NanoDropTM 1000 Spectro-photometer (Thermo Fisher Scientific, Copenhagen, Denmark).

2.3. MicroRNA microarray

Total RNA from PP (N = 6) as compared with NN (N = 3), and PN(N = 6) as compared with NN (N = 3) were analyzed using the miRNAanalysis platform miRCURYTM LNA Array (v.8.1) (containing 561 of701 miRBase 12.0 annotated human miRNAs) (Exiqon, Vedbaek,Denmark). One microgram total RNA from each sample was labeledand hybridized to the array (Tecan HS4800, Grodig, Austria),scanned (ScanArray 4000 XL, PerkinElmer, Waltham, MA) andanalyzed (ImaGene 6.1.0, BioDiscovery, El Segundo, CA). The mediansignal of three out of four probes from each miRNA exceeding thelocal background by a factor of 2 was quantile normalized in dChip[9]. For multiple hypothesis testing correction and to findstatistically significant deregulated miRNA data were uploaded toSignificance Analysis of Microarray (SAM) [10], accepting a q-value

less than 0.05, based on measures of the proportion of miRNAs beingstatistically significant by a t-test (p < 0.05) and with a falsediscovery rate less than 5%, calculated by 100 random permutations.All other analysis were performed using dChip.

2.4. MessengerRNA microarray

Total RNA from 4 NN and 4 matched PP and PN biopsies wereanalyzed using the Affymetrix GeneChip1 Human Genome U133A2.0 Array containing 22,241 probe sets representing 14,500 well-characterized human mRNAs (Affymetrix, Santa Clara, CA). 100 ngtotal RNA was amplified, labeled, hybridized, stained and scannedaccording to the manufacturer’s instructions for the AffymetrixTwo-Cycle Eukaryotic Target Labeling kit and Affymetrix GeneAr-ray1 (Affymetrix). The generated DAT and CEL files were importedand analyzed in dChip. Data were quantile normalized with PN7 asbaseline (with a median probe intensity of 278). The PM/MMdifference model was used and data were filtered accepting probesets with a variation across samples between 0.5 < SD/mean < 1000, and a difference between samples of 100 or moreto account for the background level (�70). Data were log2transformed and imported to SAM [10] to do multiple hypothesistesting correction and to identify statistically significant mRNAs(q < 0.05). Gene ontology analyses were performed applying geneontology algorithms to the data (NetAffxTM Analysis Center,Affymetrix). Microarray data (miRNA and mRNA) were depositedat EMBL-EBI in accordance with MIAME guidelines (E-MEXP-2232).

2.5. Quantitative real-time PCR

Total RNA from skin biopsies from NN (N = 4), PN (N = 4) and PP(N = 4) were quantified for miR-21, -203, -205, -221, -222, RNU6B,PDCD4, TPM1, P57, C-KIT, RTN4, SHIP2, TIMP3, RECK, NFIB andactin by TaqMan1 Real-Time PCR (Applied Biosystems). Fivenanograms of total RNA was reverse transcribed (RT) using eitherfor the miRNA analysis the TaqMan1 MicroRNA Reverse Tran-scription Kit with miRNA-specific stem-loop primers or for themRNA analysis the TaqMan1 High-Capacity cDNA ReverseTranscription Kit with random primers (Applied Biosystems).1.33 ml RT-product was introduced to a 20 ml PCR reaction andincubated in a 7900HT sequence detection system (AppliedBiosystems) following the manufacturer’s instructions. The miRNAexpression was normalized to the RNU6B expression and themRNA expression was normalized to actin. The significance wascalculated by unpaired t-tests except for PP compared with PN,where a paired t-test was used (SPSS, Chicago, IL).

2.6. Experimentally validated miRNA–mRNA interactions

Experimentally validated in vitro or in vivo miRNA–mRNAinteractions from the literature were assessed (www.ncbi.nlm.-nih.gov/pubmed). The found miRNA targets were then comparedwith the downregulated mRNA expression data in PP comparedwith NN or PN (Table 2).

2.7. Prediction of miRNA–mRNA interactions

The 10 most downregulated mRNAs in PP were uploaded to themiRNA target prediction programs: TargetScan 5.0 [11], Pictar [12],MiRanda [13] and microRNA.org [14]. Predicted targets werecompared with the deregulated miRNAs in PP and evaluated inRNAhybrid [15] accepting: hybridization conditions with a helixconstraint of nucleotide position 2–8 in the 50 seed region of eachmiRNA binding to the 30UTR of the target mRNA [16], and aminimum free energy of �21 kcal/mol.

J.R. Zibert et al. / Journal of Dermatological Science 58 (2010) 177–185 179

2.8. Immunohistochemistry of TIMP3

Formalin fixed paraffin embedded biopsies from NN (N = 3), PN(N = 3) and PP (N = 3) were incubated overnight at 4 8C withmonoclonal mouse anti-human TIMP3 antibody diluted 1:100(Millipore, Copenhagen, Denmark). Fluorescent labelled (AlexaFluor1 488) secondary anti-mouse IgG antibody diluted 1:50(Invitrogen, Taastrup, Denmark) was applied and the images werecapturedusingaLeicaDC300FXmicrosystem (Leica,Cambridge, UK).

2.9. Cell culture transfections and western blotting

Human primary keratinocytes (HK) isolated from a singlehealthy donor were cultured in keratinocyte serum-free mediumincluding keratinocyte growth supplement (Invitrogen) at 37 8C.105 HK at 70% confluence were transfected with Lipofectamine2000 (Invitrogen) (Mock) or 50 nM Pre-miR-21, -221, or -222miRNA Precursor (Applied Biosystems). At 48 H or 72 H aftertransfection, the HKs were harvested. RNA was isolated asmentioned above, protein lysates were obtained from thekeratinocytes using a KK lysis buffer (50 mM Tris–HCl, pH 6.8,10 mM dithiothretiol, 10 mM b-glycerophosphate, 10 mM sodiumfluoride, 0.1 mM sodium orthovanadate, 10% glycerol, 2.5% SDSand 1 protease inhibitor cocktail tablet) (Roche Diagnostics,Hvidovre, Denmark). The protein concentration was determinedusing BCA-200 Protein Assay kit (Thermo Fisher Scientific). Bywestern blot analysis the TIMP3 and actin protein levels wereassessed using iBlotTM dry blotting system (Invitrogen) withmonoclonal mouse anti-human TIMP3 antibody diluted 1:1000(Millipore) and with monoclonal mouse anti-human beta actindiluted 1:2000 (Sigma–Aldrich, Brøndby, Denmark). HRP-conju-gated secondary anti-mouse IgG antibody diluted 1:2000 (Dako,Glostrup, Denmark) was applied and ECL chemiluminescencesubstrate (Thermo Fisher Scientific) was used to visualize theprotein levels. Equal loadings were confirmed by and normalizedto actin.

3. Results

3.1. MicroRNA expression in psoriasis

In this study we characterized the miRNA expression in PP, PNand NN. By comparing PP with NN we identified 42 significantlyupregulated and 5 downregulated miRNAs (Table 1 and Fig. 1a). Aclear separation of PP from NN was observed with unsupervisedhierarchical cluster analysis of the deregulated miRNAs (Fig. 1a).This observation was supported by PCA which showed that PPsamples were closely clustered and clearly separated from NNsamples (Fig. 1c). By comparing PN with NN we identified 9upregulated miRNAs and a single downregulated miRNA (Table 1).With a hierarchical cluster analysis of the deregulated miRNAs, aseparation of the PN from the NN samples was identified (Fig. 1b);however, being able to identify only 10 deregulated miRNAsindicates that PN is more similar to NN than to PP. This notion isalso supported by the fact that the distribution of PN samples weremore scattered and clustered closer to NN samples by PCA (Fig. 1d).Four miRNAs were upregulated in both PP and PN compared withNN, miR-22, miR-24-1, miR-498, and miR-551a (highlighted inTable 1), indicating psoriatic similarities in non-involved psoriaticskin. However, we were unable directly to compare deregulatedmiRNAs in PP with PN because of the study design, which in adirect comparison could introduce dye bias leading to misinter-pretation of the data. In PP three polycistronic miRNA clusters wereidentified, miR-17/20a, miR-24-1/27b and miR-221/2, as beingmiRNAs expressed from the same primary miRNA transcript (pri-miRNA), with an inter-miRNA distance of, respectively 0.4, 0.5 and

0.7 kb [13]. Notably, the miRNA clusters miR-24-1/27b and miR-221/2 were grouped closely in the hierarchical clustering analysis(Fig. 1a) indicating a similar expression pattern for each miRNAcluster. Furthermore, 9 miRNA families (having a similar maturemiRNA structure and similar target functions [13]) were identifiedin psoriasis: let-7, mir-8, mir-17, mir-27, mir-29, mir-30, mir-142,mir-146, mir-221 (Table 1).

To confirm the miRNAs expressed in PP we selected twopreviously published miRNAs miR-21 and miR-203 [8] and three ofthe miRNAs we have identified in this study, namely miR-205, -221and -222 for validation by q-RT-PCR analysis. All validated miRNAswere found to be statistically significant upregulated in PPcompared with NN (p < 0.05), and for miR-21, -203, -205 and -221 an upregulation was also evident in PP compared with PN(p < 0.05) (Fig. 2a).

3.2. MessengerRNA expression in psoriasis

To identify biologically relevant mRNA targets, we analyzed themRNA expression in PP, PN and NN. First, data were filtered byvariation across samples, and 1350 probe sets were obtained. Onperforming PCA a clear separation of PP from both the PN and NNcluster was found (Fig. 1e). In parallel to the miRNA data PNsamples clustered very close to the NN samples. To be able to findmiRNA targets in the mRNA dataset, we identified deregulatedmRNAs in a similar way as for miRNAs (PP compared with NN, PNcompared with NN, and additionally PP compared with PN). Bycomparing PP with NN, 1022 probe sets were upregulated and1178 probe sets were downregulated (Supplementary Table S1),with the gene ontology terms of interest: antigen presentation,apoptosis, basement membrane, cell proliferation, defenseresponses, epidermal development, extracellular matrix, immuneand inflammatory responses, and transcription and translationfactor activity (Supplementary Table S2). By comparing PN withNN, 70 probe sets were upregulated and 54 probe sets weredownregulated (Supplementary Table S3), with one gene ontologyterm of interest, namely structural molecule activity (Supplemen-tary Table S4). Finally, by comparing PP with PN, 1126 probe setswere upregulated and 1378 probe sets were downregulated(Supplementary Table S5) and with the gene ontology terms ofinterest: antigen presentation, apoptosis, basement membrane,cell proliferation, defense responses, epidermal development,extracellular matrix, immune and inflammatory responses, tran-scription and translation factor activity, and the calcium-bindingproteins S100 (Supplementary Table S6). To compare the mRNAexpression among PP, PN and NN we conducted a Venn analysis.For the upregulated mRNAs in PP, 849 mRNAs were common for PPvs. PN and PP vs. NN, which was more than 75% of the upregulatedmRNAs in PP (Supplementary Fig. S1A and Table S7). For thedownregulated mRNAs in PP, 781 mRNAs were common for PP vs.PN and PP vs. NN, which was more than 57% of the downregulatedmRNAs (Supplementary Fig. S1B and Table S8). Psoriasis is aninherited disease and several psoriasis susceptibility loci (PSORS)are known. In agreement, we found that the most prevalent loci forthe mRNA expression in PP compared with NN was located in thePSORS1 at 6p21 [17], and by comparing PP with PN the mostprevalent loci was PSORS4 at 1q21 [18].

3.3. Comparing miRNA and mRNA expression in psoriatic skin and

predicting novel target interactions

To be able to associate the miRNA expression with the mRNAexpression in PP and PN we identified studies through PubMed,that had experimentally validated a miRNA–mRNA interaction. Wefound 11 miRNA–mRNA interactions likely to occur in psoriasis(Table 2). Interestingly, in regulation of the upregulated miR-21 in

Table 1The miRNA expression in psoriatic skin and non-involved psoriatic skin, aligned in mir-families.

miR-family miRNA Locus miR-sequence d-Scorea q-Value(%)b Fold change

Psoriatic skin

let-7 hsa-let-7g 3p21.1 UGAGGUAGUAGUUUGUACAGUU 2.61 1.46 1.50

hsa-let-7i 12q14.1 UGAGGUAGUAGUUUGUGCUGUU 2.19 1.46 1.79

mir-8 hsa-miR-141 12p13.31 UAACACUGUCUGGUAAAGAUGG 2.04 2.49 1.56

hsa-miR-200a 1p36.33 UAACACUGUCUGGUAACGAUGU 3.57 0.00 2.01

mir-15 hsa-miR-16 13q14.3 UAGCAGCACGUAAAUAUUGGCG 3.07 0.00 2.33

mir-17 hsa-miR-17 13q31.3 CAAAGUGCUUACAGUGCAGGUAG 2.29 1.46 1.73

hsa-miR-20a 13q.31.3 UAAAGUGCUUAUAGUGCAGGUAG 2.84 0.00 2.40

hsa-miR-106b 7q22.1 UAAAGUGCUGACAGUGCAGAU 1.86 3.55 1.68

mir-21 hsa-miR-21 17q23.1 UAGCUUAUCAGACUGAUGUUGA 7.19 0.00 7.65

mir-22 hsa-miR-22 17p13.3 AAGCUGCCAGUUGAAGAACUGU 2.01 2.49 2.30mir-24 hsa-mir-24-1 9q22.32 UGGCUCAGUUCAGCAGGAACAG 2.35 1.46 1.51mir-27 hsa-miR-27a 19p13.12 UUCACAGUGGCUAAGUUCCGC 5.97 0.00 2.36

hsa-miR-27b 9q22.32 UUCACAGUGGCUAAGUUCUGC 2.50 1.46 1.71

mir-29 hsa-miR-29a 7q32.3 UAGCACCAUCUGAAAUCGGUUA 1.91 3.55 1.65

hsa-miR-29c 1q32.2 UAGCACCAUUUGAAAUCGGUUA 1.94 2.49 1.73

mir-30 hsa-miR-30b 8q24.22 UGUAAACAUCCUACACUCAGCU 2.43 1.46 1.53

hsa-miR-30c 6q13 UGUAAACAUCCUACACUCUCAGC 2.10 2.49 1.40

mir-31 hsa-miR-31 9p21 AGGCAAGAUGCUGGCAUAGCU 3.59 0.00 4.14

mir-103 hsa-miR-107 10q23.31 AGCAGCAUUGUACAGGGCUAUCA 1.89 3.55 1.47

mir-125 hsa-miR-125a-3p 19q13.33 ACAGGUGAGGUUCUUGGGAGCC 1.90 3.55 1.53

mir-126 hsa-miR-126 9q34.3 UCGUACCGUGAGUAAUAAUGCG 1.91 3.55 2.13

mir-136 hsa-miR-136 14q32.31 ACUCCAUUUGUUUUGAUGAUGGA 2.93 0.00 1.34

mir-138 hsa-miR-138 16q13 AGCUGGUGUUGUGAAUCAGGCCG -3.62 0.00 -1.48

mir-142 hsa-miR-142-3p 17q22 UGUAGUGUUUCCUACUUUAUGGA 5.38 0.00 4.69

hsa-miR-142-5p 17q22 CAUAAAGUAGAAAGCACUACU 2.02 2.49 2.32

mir-146 hsa-miR-146a 5q33.3 UGAGAACUGAAUUCCAUGGGUU 4.93 0.00 3.10

hsa-miR-146b-5p 10q24.32 UGAGAACUGAAUUCCAUAGGCU 2.90 0.00 2.73

mir-148 hsa-miR-148b 12q13.13 UCAGUGCAUCACAGAACUUUGU 2.49 1.46 1.48

mir-155 hsa-miR-155 21q21.3 UUAAUGCUAAUCGUGAUAGGGGU 2.18 1.46 1.24

mir-183 hsa-miR-183 7q32.2 UAUGGCACUGGUAGAAUUCACU 2.88 0.00 1.24

mir-183 hsa-miR-183* 7q32.2 GUGAAUUACCGAAGGGCCAUAA -5.04 0.00 -1.44

mir-193 hsa-miR-193a-3p 17q11.2 AACUGGCCUACAAAGUCCCAGU 3.02 0.00 2.34

mir-199 hsa-miR-199a-3p 19p13.2 ACAGUAGUCUGCACAUUGGUUA 2.43 1.46 1.89

mir-203 hsa-miR-203 19p13.2 GUGAAAUGUUUAGGACCACUAG 2.65 1.46 2.02

mir-205 hsa-miR-205 1q32.2 UCCUUCAUUCCACCGGAGUCUG 2.02 2.49 1.80

mir-221 hsa-miR-221 Xp22.2 AGCUACAUUGUCUGCUGGGUUUC 2.22 1.46 1.54

hsa-miR-222 Xp22.2 AGCUACAUCUGGCUACUGGGU 2.03 2.49 1.47

mir-223 hsa-miR-223 Xq12 UGUCAGUUUGUCAAAUACCCCA 2.20 1.46 4.82

mir-324 hsa-miR-324-3p 17p13.1 ACUGCCCCAGGUGCUGCUGG 1.87 3.55 1.31

mir-338 hsa-miR-338-5p 17q25.3 AACAAUAUCCUGGUGCUGAGUG -4.71 0.00 -1.31

mir-342 hsa-miR-342-3p 14q32.2 UCUCACACAGAAAUCGCACCCGU 2.06 2.49 1.68

mir-378 hsa-miR-378 5q33.1 ACUGGACUUGGAGUCAGAAGG 2.08 2.49 2.15

mir-498 hsa-miR-498 19q13.41 UUUCAAGCCAGGGGGCGUUUUUC 2.72 1.46 1.54mir-515 hsa-miR-518a-5p 19q13.41 CUGCAAAGGGAAGCCCUUUC 3.34 0.00 1.87

mir-551 hsa-miR-551a 1p36.32 GCGACCCACUCUUGGUUUCCA 2.05 2.49 1.36mir-627 hsa-miR-627 15q15.1 GUGAGUCUCUAAGAAAAGAGGA -3.94 0.00 -1.24

– hsa-miR-659 22q13.1 CUUGGUUCAGGGAGGGUCCCCA -4.40 0.00 -1.25

Non-involved psoriatic skin

mir-10 hsa-miR-10b 2q31.1 UACCCUGUAGAACCGAAUUUGUG 2.93 0.00 1.32

mir-22 hsa-miR-22 17p13.3 AAGCUGCCAGUUGAAGAACUGU 3.50 0.00 1.41mir-24 hsa-miR-24-1 9q22.32 UGGCUCAGUUCAGCAGGAACAG 2.60 2.47 1.41mir-498 hsa-miR-498 19q13.41 UUUCAAGCCAGGGGGCGUUUUUC 4.31 0.00 1.71mir-500 hsa-miR-501-3p Xp11.23 AAUGCACCCGGGCAAGGAUUCU 3.24 0.00 1.58

mir-515 hsa-miR-518c* 19q13.41 UCUCUGGAGGGAAGCACUUUCUG -3.72 3.45 -1.35

mir-551 hsa-miR-551a 1p36.32 GCGACCCACUCUUGGUUUCCA 7.61 0.00 1.98mir-612 hsa-miR-612 11q13.1 GCUGGGCAGGGCUUCUGAGCUCCUU 5.27 0.00 1.62

mir-654 hsa-miR-654-5p 14q32.31 UGGUGGGCCGCAGAACAUGUGC 3.52 0.00 1.51

mir-760 hsa-miR-760 1p22.1 CGGCUCUGGGUCUGUGGGGA 2.45 2.47 1.47

MicroRNAs in italics were downregulated and miRNAs in bold are upregulated in PP and PN.a The d-score is the T-statistic value computed in SAM.b The q-value is the FDR-corrected p-value.

J.R. Zibert et al. / Journal of Dermatological Science 58 (2010) 177–185180

psoriasis, the negative regulator NFIB [19] was downregulated(Table 2) and its positive regulator STAT3 (signal transducers andactivators of transcription 3) [20] was significantly upregulated inPP compared with PN and NN (pPPvsPN = 0.0002, pPPvsNN = 0.001)(Supplementary Table S1 and S5).

To confirm the miRNA–mRNA target interactions likely to occurin psoriasis we validated all mRNAs in Table 2 by q-RT-PCR(Fig. 2b). All mRNAs were found to be significantly downregulatedin PP compared with NN (p < 0.05), and for PDCD4, TPM1, P57, C-

KIT, TIMP3, RECK and NFIB, downregulation was also evident in PPcompared with PN (p < 0.05) (Fig. 2b).

3.4. Investigating the miR-221/2–TIMP3 target interaction

Finally, we investigated if there among the upregulatedmiRNA in psoriatic skin could be identified mRNA targets amongthe 10 most significantly downregulated mRNAs. Four targetprediction databases were used and to ensure the prediction of

Fig. 1. Illustrated is the microRNA expression in (a) PP (N = 6) or (b) PN (N = 6) compared to NN (N = 3). Two-way hierarchical clustering with a distance measure of 1- Pearson

correlation coefficient and a centroid linkage with a p-value threshold of 0.01 for significant sample clusters and 0.001 for significant gene clusters. The columns indicate the

samples and the rows indicate the individual miRNA genes. Increases and decreases in miRNA expression levels are represented by shades of red (upregulated) and green

(downregulated). PCA showing separation of samples based on all 579 miRNAs expressed in (c) PP (blue dots) or (d) PN (blue dots) compared with NN (red dots). (e) PCA of the

general mRNA expression in PP (N = 4, green dots), PN (N = 4, red dots) and NN (N = 4, blue dots). Data were background corrected, normalized, filtered and 1350 genes were

identified.

J.R. Zibert et al. / Journal of Dermatological Science 58 (2010) 177–185 181

Fig. 2. Validation of selected miRNAs and mRNAs by q-RT-PCR in a new subset of patients PP (N = 4), PN (N = 4) and NN (N = 4) of (a) mature miRNAs each, respectively

normalized to the endogenous control RNU6B or (b) mRNAs each, respectively normalized to the endogenous control beta actin. Displayed are the averaged expressions from

samples of origin, and error bars displaying SEM. The asterisk corresponds *<0.05, **<0.01, ***<0.005. All q-RT-PCR reactions were run in triplicates. Using four prediction

algorithms (PicTar, TargetScan, microRNA.org and MiRanda) target interaction among the upregulated miRNAs and the 10 most downregulated mRNAs in psoriatic skin was

investigated. (c) MicroRNA-221 and (d) miR-222 was predicted to targetTIMP3. Displayed is RNA folding plots (generated in RNAhybrid) of the target interactions (green is

the miRNA sequence and red is the mRNA target sequence), the minimum free energy (mfe) of the hybridization, and an alignment of the hybridization.

Immunohistochemistry stainings of TIMP3 expression (e) NN, (f) PN and (g) PP. Each pictures is representive for three biopsies. Pictures were acquired at equal exposure

times. A negative control omitting the primary antibody showed no immune reactivity. Scale bar = 100 mm.

J.R. Zibert et al. / Journal of Dermatological Science 58 (2010) 177–185182

the miRNA–mRNA interactions we uploaded the sequences toRNAhybrid. We found two miRNA–mRNA interactions: miR-221and miR-222 (the mir-221 family) hybridizing to TIMP3 (Fig. 2cand d). To study whether TIMP3 may be a target of miR-221/2we did immunohistochemistry for TIMP3 in a subset of newbiopsies of NN, PN and PP (N = 3). We observed an abundantexpression of TIMP3 localized to the keratinocytes. Theexpression of TIMP3 was downregulated in PP compared withPN and NN (Fig. 2e–g) supporting that miR-221/2 could targetTIMP3 in psoriasis. We then wanted to investigate as a proof-of-principle the actual effect of mimicking miR-221/2 in humanprimary keratinocytes (HK). MicroRNA-21 has previously beenshown to target TIMP3 and was chosen as a positive control forthe downregulation of TIMP3 [21]. Mimicking the endogenousmiRNA expression was done by transfecting HKs with pre-miR-21, -221, -222 or Mock and evaluating the effect 48 H and 72 Hafter transfection. By q-RT-PCR we found that TIMP3 mRNAlevels were reduced in the pre-miR-21, -221 and -222transfected cells after both 48 H and 72 H (Fig. 3a) (p < 0.05).

This result corresponds well with the fact that miR-221 andmiR-222 was predicted to hybridize to the majority of thenucleotides of TIMP3 (Fig. 2c and d), likely to induce degradationof TIMP3. A recent paper showed that miR-221 and miR-222both target TIMP3 30UTR in cancer cells, supporting our data.However the authors speculate that no degradation of TIMP3

mRNA is evident, as an effect is solely seen on the TIMP3translational level [22]. In our data the translational depressionof TIMP3 protein was also observed after 72 H after transfection(Fig. 3b and c) (p < 0.05).

4. Discussion

We report the results of a microarray based, miRNA and mRNAexpression profiling studies of involved and non-involved psoriaticskin as well as healthy skin. Our data show that the miRNA andmRNA expression in psoriatic skin differs from that of non-involved psoriatic and healthy skin. Hence, four miRNAs: miR-22,miR-24-1, miR-498, and miR-551a were downregulated in

Table 2Potential miRNA–mRNA interactions in psoriasis.

Previously experimentally verified miRNA–mRNA interactions Expression in psoriatic skin

Affymetrix ID PP compared to NN PP compared to PN

Fold change d-Scorea Fold change d-Scorea

Cell growth

miR-21–PDCD4 Increase cell growth [35] 202730_s_at �2.17 �3.94 – –

202731_at �2.23 �4.31 – –

miR-21–TPM1 Increase cell growth [34] 210986_s_at �3.22 �5.80 �2.50 �4.85

210987_x_at �2.86 �6.17 �2.40 �4.96

206116_s_at �2.71 �5.15 �2.47 �5.56

miR-221/222–P57 Increase cell proliferation [31] 213182_x_at �2.69 �3.58 �2.98 �4.62

213348_at �2.00 �3.97 �2.63 �6.27

216894_x_at �2.57 �4.05 �3.10 �5.79

219534_x_at �2.47 �4.40 �3.11 �6.48

miR-221/222–C-KIT Enhance proliferation [32] 205051_s_at – – �1.95 �3.65

Apoptosis

miR-21–RTN4 Influence apoptosis [36] 214629_x_at �1.38 �3.06 �1.31 �2.61

211509_s_at �1.46 �3.32 �1.33 �3.05

210968_s_at �1.51 �2.99 �1.37 �2.76

miR-205–SHIP2 Influence apoptosis [39] 201598_s_at �2.09 �4.97 �1.61 �2.63

Extracellular matrix

miR-21–TIMP3 Extracellular matrix degradation [21] 201147_s_at �2.48 �4.02 �3.40 �7.89

201148_s_at �2.58 �4.02 �3.75 �8.75

201150_s_at �2.62 �4.64 �3.35 �6.16

miR-21–RECK Extracellular matrix degradation [21] 216153_x_at – – �1.68 �2.88

miRNA regulation

miR-21–NFIB mir-21 targets the nuclear factor I/B, which 213029_at �2.39 �5.23 �2.00 �3.75

in its protein form binds the miR-21 209289_at �2.23 �4.38 �1.96 �3.46

promoter as a negative regulator [19] 209290_s_at �2.28 �4.31 �1.98 �3.72

213032_at �2.57 �4.76 �2.07 �4.08

a The d-score is the T-statistic value computed in SAM.

J.R. Zibert et al. / Journal of Dermatological Science 58 (2010) 177–185 183

involved and non-involved psoriatic skin compared with healthyskin, pointing to a central role of these miRNAs in the skin ofpatients diagnosed with psoriasis.

With unsupervised analysis of the miRNA and mRNA expres-sion, we found that non-involved psoriatic skin had a greatersimilarity to healthy skin than to psoriatic skin. In agreement withthis, a low number of deregulated miRNAs and mRNAs were foundwhen comparing non-involved psoriatic skin with healthy skin.However, one has to take into account that in our study a possibleintroduction of age-bias might be evident as we do have anelevated age of the group of patients diagnosed with psoriasisvulgaris compared to the control group.

Employing microarray analysis of psoriatic skin, a previous studyof Sonkoly et al. identified several deregulated miRNAs, in particularmiR-21, miR-125b, miR-146a and miR-203 [8]. Consistent with theirresults, we found 10 upregulated miRNAs in psoriatic skin: miR-17,20a, -21, -31, -141, -142-3p, -146b-5p, -146a, -200a, and -203.Notably, none of the downregulated miRNAs they found wereretrieved in our analysis; on the contrary, miR-22 and -30c wereupregulated in our study. The discrepancy between the two studiesmay be due to our sample population being twice as large as theirs[8], and that the miRNAs that we found were annotated withreference to miRbase 12.0 including several more miRNA annota-tions. However, the fact that 10 miRNAs did overlap between the twostudies strengthens the suggested association of these miRNAs topsoriasis. We extended the findings of Sonkoly et al. [8] toinvestigate the miRNA–mRNA target interactions in psoriatic skinby associating the miRNA expression with potential targets in themRNA expression profile in psoriasis on the basis of previouslyexperimentally validated target interactions from the literature. Aswe investigated the likely mRNA targets on the mRNA level and notalso on the protein level, we might miss some miRNA–mRNA targetinteractions as the target interaction in some cases only areidentified by decreased protein amounts [4].

Several miRNAs are involved in inflammation and immuneresponses [23]. We found support for that miR-142-3p/-5p, -146a/b and miR-155 were likely to play a role in psoriasis. For instance,miR-142-3p/-5p are upregulated during antigen-induced T cellproliferation in mice [24], the miR-146a/b are induced inmonocytes exposed to microbial components and proinflamma-tory cytokines and is found primarily in macrophages, T cells and Bcells [25]. MicroRNA-155 is expressed in monocytes and macro-phages acting as an inflammatory mediator [25,26]. MoreovermiR-146a/b has an anti-apoptotic effect by suppressing NF-kB inthe synovial tissue of rheumatoid arthritis (RA) [27]. In RA andpsoriasis, interleukin-1 and tumor necrosis factor-a (TNF-a) areknown inflammatory mediators [1,27], and these cytokines havebeen reported to stimulate the expression of miR-146a/b [27], andTNF-a to stimulate the miR-155 expression in synovial fibroblasts[28]. Furthermore, miR-155 is involved in a positive feedback loopin the TNF-a production [29].

Keratinocyte hyperproliferation in psoriasis is linked tonegative regulation of cell growth and anti-apoptosis [30]. Wefound that miR-21, -205, -221 and -222, are likely to be involved inregulating cell growth and apoptosis in psoriasis. Several othercomplex miRNA–mRNA interactions could contribute to theincreased keratinocyte proliferation in psoriasis. MicroRNA-221/2 are involved in hybridizing to the cell-cycle regulator p57/kip2

(P57) [31] and the c-KIT receptor in melanomas [32] increasingcellular proliferation [31,32]. The regulation of miR-221/2 iscontrolled by the transcription factor promyelocytic leukemia zincfinger protein (PLZF) [32], and PLZF has also been reported tonegatively control the miR-146a expression [33]. In psoriatic skin,the upregulation of miR-221/2 and miR-146a is underlined by thedownregulation of their regulator PLZF compared with healthyskin (Supplementary Table S1). MicroRNA-21 has been shown totarget tumor suppressor protein tropomyosin 1 (TPM1) [34] or theprogrammed cell death 4 (PDCD4) [35] leading to increased tumor

Fig. 3. Primary human keratinocytes were transfected with pre-miRNA for miR-21, -221 and -222 or Mock and harvested after 48 H or 72 H. All conditions were run in

triplicates. (a) The TIMP3 mRNA expression was calculated using the 2�DDCT as follows 2�ðCT;pre-miR�CT;ActinÞTime 48 H=72 H

�ðCT;Mock�CT;ActinÞTime 48 H=72 H . (b) The TIMP3 protein level

relative to the actin protein level was studied by western blotting and each band was quantified using ImageJ (rsbweb.nih.gov/ij). Displayed are the averaged expression, and

error bars displaying SEM. The asterisk corresponds *<0.05, **<0.01. (c) A representative western blot of TIMP3 and actin.

J.R. Zibert et al. / Journal of Dermatological Science 58 (2010) 177–185184

growth. In psoriasis, TPM1 and PDCD4 were downregulated(Table 2 and Fig. 2b), suggesting that miR-21 could interact withthese, leading to increased keratinocyte cell growth. Moreover,miR-21 has been reported to target reticulon 4 (RTN4) [36], whichwe found downregulated in psoriasis (Fig. 2b), and is reported toregulate apoptosis [37]. MicroRNA-21 is positively regulated bythe signal transducer and activator of transcription 3 (Stat3) inmalignant myeloma cells [20] and negatively regulated by thenuclear factor I/B (NFIB) by binding to the miR-21 promoter [19].We found that Stat3 mRNA was significantly upregulated inpsoriasis (Supplementary Table 1), in agreement with previousstudies [38] and NFIB was significantly downregulated (Table 2,Fig. 2b), supporting the upregulation of miR-21 in psoriasis. Inaddition, the downregulation of NFIB can be explained by miR-21directly targeting NFIB, thereby a double-negative feedbackregulation might be apparent [19]. Furthermore, SHIP2 a possibleregulator of Akt signaling and phosphorylated BAD, is targeted bymiR-205 resulting in avoidance of apoptosis [39]. Based on ourfindings of an upregulation of miR-205 and downregulation ofSHIP2 in psoriasis (Fig. 2a and b) we suggest that miR-205 could beinvolved in regulation of the Akt signaling pathway likely tocontribute to anti-apoptosis in psoriasis.

In psoriasis it has been suggested that the keratinocyteexpressed miR-203 targets the Stat inhibitor SOCS-3 (by transla-tional repression), resulting in keratinocyte hyperproliferation [8].We found miR-203 upregulated in psoriatic skin (Fig. 1a andFig. 2a); however, in agreement with Sonkoly et al. we could notuncover a downregulation of SOCS-3-mRNA in psoriasis [8]. Thisindicates that the miR-203-SOCS-3 target interaction may only bedetectable on the protein level in psoriasis. On the contrary, inmouse keratinocytes the target interaction has been questioned asthe miR-203-SOCS-3 target interaction could not be demonstrated[40]. MicroRNA-203 has been suggested to induce cell-cycle exitand to repress stemness in epidermal progenitors by targeting p63

[40,41]. The keratinocyte transcription factor p63 was not found tobe downregulated at the mRNA level in psoriasis (SupplementaryTable 1), however at the protein level p63 downregulation hasbeen reported in psoriasis [42] likely to confirm the miR-203–p63target interaction. Interestingly, we found support for that JunBcould be a positive regulator of miR-203 [43] as JunB wasupregulated in psoriasis (Supplementary Table S1) implicating acausal role of miR-203 in the pathogenesis of psoriasis.

The dermal extracellular matrix in psoriasis is composed of adegraded architecture, in which activated matrix metalloproteases(MMP) contribute to epidermal proliferation into the dermis [44].MMPs can be controlled by TIMP3 and the reversion-inducing-cysteine-rich protein (RECK) [21]. In cancer cells miR-21 targetsTIMP3 [45] and RECK [21]. We found that both TIMP3 and RECK

were downregulated (Fig. 2b) and MMP1 and MMP9 wereupregulated in psoriatic skin (Supplementary Table S1). Further-more, by target prediction we found that miR-221 and miR-222putatively target TIMP3 (Fig. 2c and d) and we found that TIMP3protein expression is downregulated in the epidermis of psoriasis(Fig. 2g). We then investigated whether mimicking endogenouslevels of miR-221 and miR-222 in human primary keratinocyteswould lead to reduced levels of TIMP3 mRNA and protein. We didfind reduced levels of TIMP3 mRNA and TIMP3 protein 72 H post-transfection (Fig. 3). Recently the miR-221/2–TIMP3 targetinteraction was shown in cancer cells, speculating that the targetinteraction is a product of inhibition and not degradation of TIMP3

mRNA [22]. Based on the prediction of the miR-221/2–TIMP3hybridization (Fig. 2c and d) and our in vitro data (Fig. 3a) wespeculate that the target interaction in human keratinocytes is aproduct of degradation, because we do observe a decrease in TIMP3

mRNA at both 48 H and 72 H post-transfection.Since the discovery of miRNAs they have attracted much

attention in basic and clinical research outlining importantregulatory roles in the pathogenesis of diseases. Recently, it has

J.R. Zibert et al. / Journal of Dermatological Science 58 (2010) 177–185 185

been suggested that knowledge of deregulation at the post-transcriptional level could lead to a direct antisense targeting ofmiRNAs [46]. The provided data on the miRNA and mRNAexpression and their likely target interactions in psoriasis maycontribute to a better understanding of the pathogenesis of thedisease. In conclusion, we identified specific miRNA and mRNAexpression patterns and miRNA–mRNA target interactions likely totake place in psoriatic skin. Finally, we suggest that miR-221/2could target TIMP3 in psoriatic skin, substantiating the role ofmiRNAs as fine tuners of psoriasis pathogenesis.

Acknowledgments

We would like to thank M. Fregil and J. Eriksen, Department ofOncology, University of Copenhagen, Herlev Hospital; S. Boesen,T.C. Sandberg and L. Rohde, Department of Molecular Biomedicine,LEO Pharma for technical assistance; M. Røpke and J. Worm,Department of Molecular Biomedicine, LEO Pharma for valuablediscussions. This study was supported by the LEO Pharma ResearchFoundation, the Copenhagen County Research Foundation and theDanish National Advanced Technology Foundation.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, in

the online version, at doi:10.1016/j.jdermsci.2010.03.004.

References

[1] Lowes MA, Bowcock AM, Krueger JG. Pathogenesis and therapy of psoriasis.Nature 2007;445:866–73.

[2] Elder JT, Nair RP, Henseler T, Jenisch S, Stuart P, Chia N, et al. The genetics ofpsoriasis 2001: the odyssey continues. Arch Dermatol 2001;137:1447–54.

[3] Stefani G, Slack FJ. Small non-coding RNAs in animal development. Nat Rev MolCell Biol 2008;9:219–30.

[4] Selbach M, Schwanhausser B, Thierfelder N, Fang Z, Khanin R, Rajewsky N.Widespread changes in protein synthesis induced by microRNAs. Nature2008;455:58–63.

[5] Eulalio A, Huntzinger E, Izaurralde E. Getting to the root of miRNA-mediatedgene silencing. Cell 2008;132:9–14.

[6] Xiao C, Rajewsky K. MicroRNA control in the immune system: basic principles.Cell 2009;136:26–36.

[7] Mendell JT. miRiad roles for the miR-17-92 cluster in development anddisease. Cell 2008;133:217–22.

[8] Sonkoly E, Wei T, Janson PC, Saaf A, Lundeberg L, Tengvall-Linder M, et al.MicroRNAs: novel regulators involved in the pathogenesis of psoriasis? PLoSOne 2007;2:e610.

[9] Li C, Wong WH. Model-based analysis of oligonucleotide arrays: expressionindex computation and outlier detection. Proc Natl Acad Sci USA 2001;98:31–6.

[10] Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied tothe ionizing radiation response. Proc Natl Acad Sci USA 2001;98:5116–21.

[11] Friedman RC, Farh KK, Burge CB, Bartel DP. Most mammalian mRNAs areconserved targets of microRNAs. Genome Res 2009;19:92–105.

[12] Lall S, Grun D, Krek A, Chen K, Wang YL, Dewey CN, et al. A genome-wide mapof conserved microRNA targets in C. elegans. Curr Biol 2006;16:460–71.

[13] Griffiths-Jones S, Saini HK, van DS, Enright AJ. miRBase: tools for microRNAgenomics. Nucleic Acids Res 2008;36:D154–8.

[14] Betel D, Wilson M, Gabow A, Marks DS, Sander C. The microRNA.org resource:targets and expression. Nucleic Acids Res 2008;36:D149–53.

[15] Kruger J, Rehmsmeier M. RNAhybrid: microRNA target prediction easy, fastand flexible. Nucleic Acids Res 2006;34:W451–4.

[16] Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked byadenosines, indicates that thousands of human genes are microRNA targets.Cell 2005;120:15–20.

[17] Elder JT, Nair RP, Voorhees JJ. Epidemiology and the genetics of psoriasis. JInvest Dermatol 1994;102:24S–7S.

[18] Hardas BD, Zhao X, Zhang J, Longqing X, Stoll S, Elder JT. Assignment ofpsoriasin to human chromosomal band 1q21: coordinate overexpression ofclustered genes in psoriasis. J Invest Dermatol 1996;106:753–8.

[19] Fujita S, Ito T, Mizutani T, Minoguchi S, Yamamichi N, Sakurai K, et al. miR-21Gene expression triggered by AP-1 is sustained through a double-negativefeedback mechanism. J Mol Biol 2008;378:492–504.

[20] Loffler D, Brocke-Heidrich K, Pfeifer G, Stocsits C, Hackermuller J, KretzschmarAK, et al. Interleukin-6 dependent survival of multiple myeloma cells involvesthe Stat3-mediated induction of microRNA-21 through a highly conservedenhancer. Blood 2007;110:1330–3.

[21] Gabriely G, Wurdinger T, Kesari S, Esau CC, Burchard J, Linsley PS, et al.MicroRNA 21 promotes glioma invasion by targeting matrix metalloprotei-nase regulators. Mol Cell Biol 2008;28:5369–80.

[22] Garofalo M, Di LG, Romano G, Nuovo G, Suh SS, Ngankeu A, et al. miR-221&222regulate TRAIL resistance and enhance tumorigenicity through PTEN andTIMP3 downregulation. Cancer Cell 2009;16:498–509.

[23] Lu LF, Liston A. MicroRNA in the immune system, microRNA as an immunesystem. Immunology 2009;127:291–8.

[24] Wu H, Neilson JR, Kumar P, Manocha M, Shankar P, Sharp PA, et al. miRNAprofiling of naive, effector and memory CD8 T cells. PLoS One 2007;2:e1020.

[25] Taganov KD, Boldin MP, Chang KJ, Baltimore D. NF-kappaB-dependent induc-tion of microRNA miR-146, an inhibitor targeted to signaling proteins of innateimmune responses. Proc Natl Acad Sci USA 2006;103:12481–6.

[26] O’Connell RM, Taganov KD, Boldin MP, Cheng G, Baltimore D. MicroRNA-155 isinduced during the macrophage inflammatory response. Proc Natl Acad SciUSA 2007;104:1604–9.

[27] Nakasa T, Miyaki S, Okubo A, Hashimoto M, Nishida K, Ochi M, et al. Expressionof microRNA-146 in rheumatoid arthritis synovial tissue. Arthritis Rheum2008;58:1284–92.

[28] Stanczyk J, Pedrioli DM, Brentano F, Sanchez-Pernaute O, Kolling C, Gay RE,et al. Altered expression of MicroRNA in synovial fibroblasts and synovialtissue in rheumatoid arthritis. Arthritis Rheum 2008;58:1001–9.

[29] Thai TH, Calado DP, Casola S, Ansel KM, Xiao C, Xue Y, et al. Regulation of thegerminal center response by microRNA-155. Science 2007;316:604–8.

[30] Wrone-Smith T, Johnson T, Nelson B, Boise LH, Thompson CB, Nunez G, et al.Discordant expression of Bcl-x and Bcl-2 by keratinocytes in vitro and psoriatickeratinocytes in vivo. Am J Pathol 1995;146:1079–88.

[31] Medina R, Zaidi SK, Liu CG, Stein JL, van Wijnen AJ, Croce CM, et al. MicroRNAs221 and 222 bypass quiescence and compromise cell survival. Cancer Res2008;68:2773–80.

[32] Felicetti F, Errico MC, Bottero L, Segnalini P, Stoppacciaro A, Biffoni M, et al. Thepromyelocytic leukemia zinc finger-microRNA-221/-222 pathway controlsmelanoma progression through multiple oncogenic mechanisms. CancerRes 2008;68:2745–54.

[33] Labbaye C, Spinello I, Quaranta MT, Pelosi E, Pasquini L, Petrucci E, et al. Athree-step pathway comprising PLZF/miR-146a/CXCR4 controls megakaryo-poiesis. Nat Cell Biol 2008;10:788–801.

[34] Zhu S, Si ML, Wu H, Mo YY. MicroRNA-21 targets the tumor suppressor genetropomyosin 1 (TPM1). J Biol Chem 2007;282:14328–36.

[35] Frankel LB, Christoffersen NR, Jacobsen A, Lindow M, Krogh A, Lund AH.Programmed cell death 4 (PDCD4) is an important functional target of themicroRNA miR-21 in breast cancer cells. J Biol Chem 2008;283:1026–33.

[36] Yang Y, Chaerkady R, Beer MA, Mendell JT, Pandey A. Identification of miR-21targets in breast cancer cells using a quantitative proteomic approach. Pro-teomics 2009;9:1374–84.

[37] Watari A, Yutsudo M. Multi-functional gene ASY/Nogo/RTN-X/RTN4: apopto-sis, tumor suppression, and inhibition of neuronal regeneration. Apoptosis2003;8:5–9.

[38] Sano S, Chan KS, Carbajal S, Clifford J, Peavey M, Kiguchi K, et al. Stat3 linksactivated keratinocytes and immunocytes required for development of psor-iasis in a novel transgenic mouse model. Nat Med 2005;11:43–9.

[39] Yu J, Ryan DG, Getsios S, Oliveira-Fernandes M, Fatima A, Lavker RM. Micro-RNA-184 antagonizes microRNA-205 to maintain SHIP2 levels in epithelia.Proc Natl Acad Sci USA 2008;105:19300–5.

[40] Lena AM, Shalom-Feuerstein R, di Val Cervo PR, Aberdam D, Knight RA, MelinoG, et al. miR-203 represses ‘stemness’ by repressing DeltaNp63. Cell DeathDiffer 2008;15:1187–95.

[41] Yi R, Poy MN, Stoffel M, Fuchs E. A skin microRNA promotes differentiation byrepressing ‘stemness’. Nature 2008;452:225–9.

[42] Gu X, Lundqvist EN, Coates PJ, Thurfjell N, Wettersand E, Nylander K. Dysre-gulation of TAp63 mRNA and protein levels in psoriasis. J Invest Dermatol2006;126:137–41.

[43] Sonkoly E, Wei T, Pavez LE, Suzuki H, Kato M, Torma H, et al. Protein kinase C-dependent upregulation of miR-203 induces the differentiation of humankeratinocytes. J Invest Dermatol 2010;130:124–34.

[44] Iizuka H, Takahashi H, Ishida-Yamamoto A. Psoriatic architecture constructedby epidermal remodeling. J Dermatol Sci 2004;35:93–9.

[45] Selaru FM, Olaru AV, Kan T, David S, Cheng Y, Mori Y, et al. MicroRNA-21 isoverexpressed in human cholangiocarcinoma and regulates programmed celldeath 4 and tissue inhibitor of metalloproteinase 3. Hepatology2009;49:1595–601.

[46] Elmen J, Lindow M, Schutz S, Lawrence M, Petri A, Obad S, et al. LNA-mediatedmicroRNA silencing in non-human primates. Nature 2008;452:896–9.