mitochondrial peptide pβ - university of toronto t-space...ii characterization of the mitochondrial...

Characterization of the

Mitochondrial Peptide Pβ

By

Wendy Tan

A Thesis submitted in conformity with the requirements

for the degree of Master of Science

Department of Biochemistry

University of Toronto

© Copyright by Wendy Tan 2018

ii

Characterization of the Mitochondrial Peptide Pβ by

Wendy Tan

Master of Science

Department of Biochemistry

University of Toronto

2018

ABSTRACT

Mitophagy, the degradation of damaged mitochondria, and mitochondrial

biogenesis, the formation of new mitochondria, are two critical mitochondrial quality

control pathways that maintain a healthy mitochondrial network and thus a healthy cell.

We propose that the mitochondrial protease presenilins-associated rhomboid-like (PARL)

coordinates these two processes. PARL undergoes regulated cleavage, termed β

cleavage, in response to mitochondrial stress to produce N-terminally cleaved β PARL

and a 25 amino acid peptide, Pβ. We have recently demonstrated that β PARL promotes

mitochondrial fragmentation and has reduced proteolytic activity for a key component of

PINK1/Parkin-mediated mitophagy, PINK1, which may instigate mitophagy. In contrast,

Pβ’s putative role and mechanism of action in mitochondrial biogenesis remains poorly

defined. In this thesis, I determined that the mitochondrial Pβ peptide translocates to the

nucleus where it associates with chromatin. Together, these results further support PARL

as a key coordinator of mitophagy and mitochondrial biogenesis.

iii

ACKNOWLEDGEMENTS

I entered research only thinking about studying mitochondria. It doesn’t escape me

how lucky I am to have gotten to study the organelle that I love in such a supportive and

academically rigorous environment. The largest stroke of luck was meeting my

supervisor, Dr. Angus McQuibban, who took a chance on me, both as an undergraduate

and graduate student. He has been equal parts optimistic and analytical, and I’ve learned

a lot from him, both as a researcher and as a person. I am incredibly grateful for his

patience, time, guidance, honesty, and support.

I would also like to thank my supervisory committee members, Dr. Alex Palazzo

and Dr. Anurag Tandon. Alex and Anurag have been incredibly generous with their

reagents, but more importantly with invaluable their scientific suggestions and guidance.

Alex has always kept his door open for me when I was stumped and has given me

excellent scientific and life advice. Likewise, Anurag’s unique expertise and perspectives

have been instrumental to my thesis.

Additionally, I would like to extend my gratitude to all the past and present

members of the McQuibban lab, who’ve shared their intelligence, enthusiasm, and

cheerfulness with me. I’m incredibly lucky to have met them. I am especially thankful to

the original Team PARL: Dr. Guang Shi and Navdeep Deol. Guang was my first mentor

when I was a clueless undergrad and has continued to brainstorm with me and give me

countless pep talks when I was pessimistic (i.e. often). And thank you to Dr. Eliana Chan,

whose kind words of encouragement continue to be a strong source of motivation for me.

My gratitude also extends to the many friends and professors I’ve met along the

way in the University of Toronto research community who’ve shared their knowledge,

time, concerns, laughter, reagents, advice, and unwavering support.

Finally, I’d like to thank my parents and family. My parents, who’ve instilled in me

an enthusiasm for learning, are going grey from constantly worrying for me. Nevertheless

they are also constantly and selflessly supporting me and encouraging me to follow my

passions. Thank you for loving and trusting me, I am going to do my absolute best to be

a daughter you can be proud of.

iv

TABLE OF CONTENTS

ACKNOWLEDGEMENTS ..……………….…………………………………………………………………………….iii

TABLE OF CONTENTS …..….………………………………………………………………………………………….iv

LIST OF FIGURES ………………………………………………………………………………….………..……………vii

LIST OF ABBREVIATIONS…………………………......………………………………………………..…………viii

CHAPTER 1: INTRODUCTION ................................................................................................ 1

1.1 Mitochondrial Biology ...................................................................................................................... 1

1.1.1 The Mitochondrial Genome .......................................................................................... 1

1.1.2 Mitochondrial Organization ........................................................................................... 2

1.2 Mitochondrial Function ................................................................................................................... 4

1.2.1 Energy Production ........................................................................................................... 4

1.2.2 Cell Death .......................................................................................................................... 5

1.3 Mitochondrial Dysfunction in Parkinson’s Disease ................................................................ 6

1.4 Mitochondrial Quality Control ....................................................................................................... 7

1.4.1 Mitochondrial Dynamics ................................................................................................ 8

1.4.2 PINK1/Parkin-mediated Mitophagy ............................................................................ 9

1.4.3 Mitochondrial Biogenesis ............................................................................................ 13

1.4.4 Coordination of Mitophagy and Mitochondrial Biogenesis ................................ 17

1.4.4.1 Parkin................................................................................................................ 17

1.4.4.2 PGC-1α ............................................................................................................ 18

1.4.4.3 AMPK................................................................................................................ 18

1.5 The Mitochondrial Rhomboid Protease, PARL ..................................................................... 19

1.5.1 Identification of the Rhomboid Superfamily ........................................................... 19

1.5.2 Rhomboid Structure ...................................................................................................... 20

1.5.3 Identification of the Mitochondrial Rhomboid ........................................................ 21

v

1.5.4 The Mammalian Mitochondrial Rhomboid, PARL ............................................... 23

1.5.4.1 PARL α/β/γ Cleavage .................................................................................. 23

1.5.4.2 The Role of PARL in Mitochondrial Morphology ................................. 27

1.5.4.3 The Role of PARL in Apoptosis ................................................................ 27

1.5.4.4 The Role of PARL in Mitophagy and Parkinson’s disease ............... 28

1.5.4.5 The Role of PARL in Mitochondrial Biogenesis ................................... 29

1.6 Thesis Rationale ................................................................................................................ 30

CHAPTER 2: MATERIALS AND METHODS ................................................................ 31

2.1 Reagents ........................................................................................................................................... 31

2.1.1 Cell Culture and Transfection .................................................................................... 31

2.1.2 Chemical Reagents and Antibodies ......................................................................... 31

2.1.3 Plasmids ........................................................................................................................... 32

2.2 Subcellular Fractionations ........................................................................................................... 32

2.2.1 Abcam Subcellular Fractionation .............................................................................. 32

2.2.2 CSK Subcellular Fractionation................................................................................... 33

2.3 Chromatin Fractionations ............................................................................................................. 33

2.3.1 DNase-based Chromatin Fractionation .................................................................. 33

2.3.2 Acid-based Chromatin Fractionation ....................................................................... 34

2.3 Immunoprecipitation ...................................................................................................................... 34

2.4 Western Blotting ............................................................................................................................. 35

2.4.1 Protein Precipitation ...................................................................................................... 35

2.4.2 SDS-PAGE and Western Blotting ............................................................................ 35

CHAPTER 3: RESULTS ............................................................................................................. 36

3.1 Over-expressed Pβ localizes to the nucleus ......................................................................... 36

3.2 Endogenous Pβ localizes to the nucleus ................................................................................ 40

3.3 Endogenous Pβ associates with chromatin in SH-SY5Ys ................................................. 42

3.4 MG132 does not affect Pβ expression or localization ......................................................... 47

3.5 Endogenous PARL β cleavage occurs in absence of

mitochondrial stress in SH-SY5Ys ................................................................................................... 49

vi

CHAPTER 4: DISCUSSION ..................................................................................................... 51

4.1 Brief Summary of Results ............................................................................................................ 51

4.2 Model: PARL as a Coordinator of Mitophagy and Mitochondrial Biogenesis .............. 52

4.3 Perspectives .................................................................................................................................... 54

4.3.1 Pβ Translocates to the Nucleus ................................................................................ 54

4.3.2 Pβ Associates with Chromatin ................................................................................... 55

4.3.3 Experiments in SH-SY5Ys Produce Variable Results........................................ 56

4.3.4 Pβ: a Peptide with Purpose?...................................................................................... 57

4.4 Future Directions ............................................................................................................................ 58

4.4.1 What is the Phosphatase Responsible for β Cleavage? ................................... 58

4.4.2 What Allows Pβ Export from Mitochondria? .......................................................... 59

4.4.3 Does Pβ Undergo any Post-Cleavage Modifications? ....................................... 60

4.4.4 Does Pβ Interact with Other Proteins? ................................................................... 61

4.4.5 What Genes does Pβ Bind to? .................................................................................. 63

4.4.6 What is the Effect of Pβ on Mitochondrial Biogenesis? ..................................... 64

4.5 Conclusions ..................................................................................................................................... 65

REFERENCES ...................................................................................... Error! Bookmark not defined.66

APPENDIX .............................................................................................................................................. 66

vii

LIST OF FIGURES

Figure 1-1: Overview of mitochondrial structure and morphology........................... 2

Figure 1-2: Representation of PINK1/Parkin-mediated mitophagy ......................... 10

Figure 1-3 Representation of Mitochondrial Biogenesis ......................................... 16

Figure 1-4: PARL β cleavage is a disease-relevant regulatory event ..................... 26

Figure 3-1: Overexpressed Pβ localizes to the nucleus in HEK293s ...................... 38

Figure 3-2: Previous work from our lab demonstrates that PARL β cleavage

. is sensitive to OlA treatment in SH-SY5Ys ............................................ 40

Figure 3-3: Endogenous Pβ localizes to the nucleus in SH-SY5Ys ........................ 42

Figure 3-4: Overexpressed Pβ does not associate with chromatin in HEK293s ... 44

Figure 3-5: Endogenous Pβ associates with chromatin in SH-SY5Ys .................... 46

Figure 3-6: MG132 does not affect Pβ detection or localization in SH-SY5Ys ....... 48

Figure 3- 7: Endogenous PARL β cleavage occurs in the

. absence of mitochondrial stress in SH-SY5Ys ..................................... 50

Figure 4-1: Model of PARL coordination of mitophagy and

. mitochondrial biogenesis ........................................................................ 52

Figure 4-2: Pβ doublet and phosphorylated/unphosphorylated Pβ . .

. run at similar molecular weights ............................................................. 60

Table 1- 1: List of mitochondrial rhomboids and their putative substrates............ 22

viii

LIST OF ABBREVIATIONS

ΔΨm Mitochondrial membrane potential

Aβ42 Amyloid β 42

ABCB8/10 ATP-binding cassette (ABC) B8/B10

ADP Adenosine diphosphate

AMP Adenosine monophosphate

AMPK Adenosine monophosphate (AMP) kinase

ATP Adenosine triphosphate

CCCP Cyanide m-chlorophenyl hydrazone

Ccp1 Cytochrome c peroxidase 1

CICD Caspase-independent cell death

ChIP Chromatin immunoprecipitation

CRISPR Clustered regularly interspaced short palindromic repeats

DAPI 4',6-diamidino-2-phenylindole

DMSO Dimethyl sulfoxide

DRP1 Dynamin-related protein 1

Dyn2 Dynamin 2

EGF Epidermal growth factor

EMSA Electrophoretic mobility shift assay

ER Endoplasmic reticulum

ETC Electron transport chain

FADH2 Flavin adenine dinucleotide (hydroquinone form)

Fis1 Mitochondrial fission 1 protein

FOXO3 Forkhead box O3

HD Huntington’s disease

HtrA2 High-temperature requirement protein A2

ix

IMM Inner mitochondrial membrane

IMS Intermembrane space

IP Immunoprecipitation

MDL1 Multi-drug resistance-like 1

MiD49/51 Mitochondrial dynamics protein of 49/51 kDa

Mff Mitochondrial fission factor

Mgm1 Mitochondrial genome maintenance 1

MFN1/2 Mitofusin 1/2

MPP Mitochondrial processing peptidase

MPP+ 1-methyl-4-phenylpyridinium

MPTP 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine

MTS Mitochondrial targeting sequence

NADH Nicotinamide adenine dinucleotide (reduced)

NLS Nuclear localization sequence

NRF1/2 Nuclear respiratory factor 1/2

OlA Oligomycin A

OMM Outer mitochondrial membrane

OPA1 Dominant optic atrophy 1

OXPHOS Oxidative phosphorylation

Pβ PARL-β

PARL Presenilins-associated rhomboid-like

PD Parkinson’s disease

PDK2 Pyruvate dehydrogenase kinase 2

PDP1/2 Pyruvate dehydrogenase phosphatase 1/2

PGAM5 Phosphoglycerate mutase 5

PGC-1α/β Proliferator-activated receptor γ (PPARγ) coactivator-1 (PGC-1) α/β

PINK1 Phosphatase and tensin homolog (PTEN)-induced putative kinase 1

PKA Protein kinase A

x

PRC PGC-1-related coactivator

Rbd1 Rhomboid-1

ROS Reactive oxygen species

SIRT1 Silent information regulator 2 (SIR2) protein 1

STS Staurosporine

TIM Translocase of the inner membrane

TFAM Transcription factor A, mitochondrial

TFEB Transcription factor EB

TFB1M/TFB2M Transcription factor B1/2, mitochondrial

TMH Transmembrane helix

TOM Translocase of the outer membrane

UBL Ubiquitin-like

ULK1 Unc-51-like autophagy activating kinase 1

VDAC Voltage-dependent anion channel

WT Wild type

1

CHAPTER 1

INTRODUCTION

1.1 Mitochondrial Biology

The innocuously named mitochondria (coined by German anatomist Carl Benda in

1898; from the Greek mitos, “thread” and chondrion, “granule”) are central to complex

eukaryotic life as we know it1. Proper understanding of this vital organelle requires

understanding of its origin: mitochondria are derived from a bacterium of α proteobacterial

ancestry that was engulfed by a host cell of archaeal origin2–4. This ancient endosymbiotic

event occurred roughly 1.6 billion years ago and gave rise to all known eukaryotes5–8.

The endosymbiotic origin of mitochondria is evidenced most obviously by their unique

retention of genetic information and double membrane composition.

1.1.1 The Mitochondrial Genome

As semi-autonomous organelles, mitochondria possess their own genomes9–11.

Owing to their bacterial origin, mitochondrial DNA (mtDNA) in almost all multicellular

organisms is circular12. Human mtDNA is a 16 569 bp circular DNA molecule that tightly

sequences 37 genes: two rRNAs, 22 tRNAs, and 13 polypeptides coding for core

hydrophobic subunits of enzyme complexes in the oxidative phosphorylation (OXPHOS)

system13. OXPHOS is made up of the electron transport chain (ETC) (also known as the

2

respiratory chain; composed of Complexes I-IV) and ATP synthase (also known as

Complex V)11,13. The vast majority of mitochondrial proteins, including the machinery

required to transcribe and translate mtDNA, is encoded by the nuclear genome and

imported into mitochondria9–11.

1.1.2 Mitochondrial Organization

The double membrane structure of the mitochondrion was first visualized by

Palade and Sjöstrand independently through several high-resolution electron

micrographs, which were published in 1952 and 195314–17. These images revealed two

membranes dividing mitochondria into four distinct compartments: the outer mitochondrial

A

Elongated Mitochondrial Morphology Fragmented Mitochondrial Morphology

B

Figure 1-1: Overview of mitochondrial structure and morphology: A Transmission

electron micrograph of a mitochondrion. Mitochondria are composed of an outer

mitochondrial membrane (OMM), intermembrane space (IMS), inner mitochondrial

membrane (IMM) which forms cristae, and mitochondrial matrix. Adapted with

permission4. B Representative confocal immunofluorescence microscopy images of

mitochondrial morphology in mouse embryonic fibroblasts (MEFs), visualized by TOM20

immunostaining. Nuclei were stained with DAPI. When treated with vehicle control,

DMSO, elongated mitochondrial morphology is maintained. When treated with 100ng/mL

rotenone for 1 hour, mitochondrial morphology becomes fragmented. Reprinted with

permission50.

3

membrane (OMM); the intermembrane space (IMS), which is contained between the two

membranes; the inner mitochondrial membrane (IMM), which is folded in on itself to form

many ridges termed cristae; and the mitochondrial matrix, which is enclosed by the IMM

(Fig.1-1A)14–17.

However, these electron micrographs did not immediately expose the degree of

specialization of the two mitochondrial membranes. In the human liver, an estimated 6%

of total mitochondrial protein is located in the OMM18. Of this 6%, many proteins

embedded in the OMM are porins (transport proteins that form large aqueous channels)

and voltage-dependent anion channels (VDAC)18,19. As a consequence, ions and small

uncharged molecules less than 5 kilodaltons (kDa) freely pass through the OMM18,19 The

majority of mitochondrial proteins larger than 5 kDa contain an N-terminal mitochondrial

targeting sequence (MTS) that is comprised of an amphipathic α helix with a +3 to +6 net

charge20. The MTS is recognized by the translocase of the outer membrane (TOM), which

is the general transporter protein complex in the OMM21. Due to the porous nature of the

OMM, the IMS is chemically similar to the cytosol at a pH of approximately 719.

At first glance, the most prominent feature of the IMM is its convolutedness as it

forms many cristae which project into the mitochondrial matrix15,19. These convolutions

are so abundant that in the human liver, the IMM constitutes approximately one third of

total cell membrane18.

The other defining feature of the IMM is its extreme impermeability19,20. Unlike the

OMM, ions and other molecules require specific membrane-spanning transport

complexes to enter or exit the IMM18,21. In the human liver, these transport complexes

contribute to the 21% of total mitochondrial proteins found in the IMM18,21. In particular,

4

the high proportion of cardiolipin (up to 20% of the IMM), a phospholipid that is

characterized by four fatty acid chains rather than the conventional two, is a key

contributor to the IMM’s impermeability19,22. As a result, an electrochemical mitochondrial

membrane potential (ΔΨm) of approximately 180 mV is generated across the IMM by

many copies of the IMM-embedded ETC chain19. Consequently, the pH of the

mitochondrial matrix is approximately 7.919. In addition to being the driving force of ATP

production for aerobically respiring cells, maintenance of ΔΨm also determines the import

of many proteins into or across the IMM, including the OXPHOS machinery itself23. A

leading hypothesis is that ΔΨm electrophoretically positions the positively charged MTS

to initiate import across or into the IMM through the translocase of the inner mitochondrial

membrane (TIM)23.

1.2 Mitochondrial Function

Often referred to as “the Powerhouse of the Cell”, mitochondria are indeed critical

to energy production, as well as many other key cellular processes including metabolism

of fatty acids and amino acids, calcium signalling, heat production, various signalling

pathways, and cell death2. For the sake of brevity, only two of the mitochondrion’s many

important functions, energy production and cell death, are highlighted below.

1.2.1 Energy Production

As the generators of more than 90% of our cellular energy, the most prominent

responsibility of mitochondria is to produce energy in the currency of ATP by aerobic

respiration24,25. Ideally, pyruvate, the byproduct of glycolysis, is metabolized through the

tricarboxylic acid (TCA) cycle (also known as the Krebs cycle or the citric acid cycle) in

5

the mitochondrial matrix24. Although not as preferred, fatty acids and amino acids may

also feed into the TCA cycle24. Electron-rich reduced forms of nicotinamide adenine

dinucleotide (NADH) and flavin adenine dinucleotide (hydroquinone form) (FADH2) that

are produced by the TCA cycle and glycolysis transfer electrons to the ETC18. Energy

released by electrons passed down the ETC by a series of redox reactions is used to

pump H+ ions across the IMM to the IMS to generate and maintain the electrochemical

gradient, ΔΨm26,27. H+ ions are then channeled back into the matrix by ATP synthase,

which uses the electromotive force to drive phosphorylation of adenosine diphosphate

(ADP) to ATP19.

1.2.2 Cell Death

Mitochondria are less commonly referred to as the judge and executioner of the

cell28,29. In mammals, the best characterized mitochondria-centric cell death pathway is

intrinsic apoptosis, which is occasionally termed mitochondrial apoptosis29,30. Intrinsic

apoptosis is a controlled cell death pathway that activates in response to non-receptor-

mediated stimuli such as toxins, viral infections, and free radicals31. As the convergence

point for many apoptosis-inducing cues, mitochondria regulate apoptosis through

mitochondrial outer membrane permeabilization (MOMP), which is mediated by

oligomerization and pore formation by the proapoptotic proteins Bax and Bak32,33. MOMP

is considered the point of no return as it commits the cell to death30. This event releases

IMS proteins that promote apoptosis29. The most important of these is cytochrome c,

which activates the caspase protease cascade in the cytosol, which ultimately leads to

cell death32. In the absence of caspase activity, MOMP still results in cell death through

an ill-defined mechanism termed caspase-independent cell death (CICD)34.

6

1.3 Mitochondrial Dysfunction in Parkinson’s Disease

The importance of mitochondrial function in the eukaryotic cell is emphasized by

the commonality of mitochondrial dysfunction in various diseases3. Briefly, a few lines of

evidence implicating mitochondrial dysfunction in Parkinson’s disease (PD) etiology are

emphasized below.

PD is the most common neurodegenerative movement disorder; it affects a

growing estimate of 10 million people worldwide35,36. PD is characterized by progressive

deterioration of dopaminergic neurons in the substantia nigra, which contributes to

cardinal PD motor impairments36. Neurons are particularly sensitive to mitochondrial

dysfunction due to their high energetic demand, their need for high calcium buffering

capacity due to action potential-driven calcium influxes, and because their predominant

mode of energy production is by OXPHOS37. Dopaminergic neurons in the substantia

nigra are especially sensitive to mitochondrial stress, although the exact reasons remain

to be determined38.

The first causative association of mitochondrial dysfunction in PD pathogenesis

occurred when accidental infusions of the neurotoxin 1-methyl-4-phenyl-1,2,3,6-

tetrahydropyridine (MPTP) induced selective dopaminergic neurodegeneration and

resultant rapid onset of PD-like symptoms39,40. Although little evidence suggests that

MPTP itself is toxic, researchers later found that in glial cells, MPTP could be oxidized to

produce 1-methyl-4-phenylpyridinium (MPP+), which selectively inhibits Complex I of the

ETC39,40. Other Complex I inhibitors such as rotenone, pyridaben, trichloroethylene, and

fenpyroximate also cause dopaminergic neurodegeneration in various animal models41.

7

Consistent with this, Complex I activity is impaired in the substantia nigra of PD patients,

likely due in part to oxidative stress41. Notably, dopamine is a relatively unstable

neurotransmitter that can oxidize to generate dopamine quinone and reactive oxygen

species (ROS) which may in turn impair Complexes I and III of the ETC42. Aside from

obvious perturbations in the ETC and consequent energy production, Complex I

impairment also increases superoxide formation42. In line with this, postmortem brain

samples from PD patients have shown evidence of oxidative damage43.

Mutations in numerous genes that cause mitochondrial dysfunction also cause

familial forms of PD. PD-linked mutations in Parkin, PTEN-induced kinase 1 (PINK1), α-

synuclein, DJ-1, UCHL-1, LRRK2, NURR1, VPS35, and HtrA2 are all directly or indirectly

linked to abnormal mitochondrial function41. Some of these mutations are suggested to

affect core mitochondrial functions such as mitochondrial import or the ETC; still others

disrupt critical mitochondrial quality control pathways that protect the mitochondrial

network, and thus the cell, from damage41.

1.4 Mitochondrial Quality Control

The severe consequences of impaired mitochondrial function have driven the

evolution of several quality control mechanisms to maintain mitochondrial homeostasis.

These quality control systems vary dramatically in scale. For example, the

mitochondrion’s own proteolytic system degrades misfolded and oxidatively denatured

proteins within the mitochondrion44. Conversely, oxidized, damaged proteins may also be

enriched in mitochondrial-derived vesicles (MDVs) that bud off mitochondria and are

ultimately degraded by the lysosome45. Lastly, whole, severely damaged mitochondria

8

may be degraded by a specialized autophagic pathway termed mitophagy46. Highlighted

below are a few mitochondrial quality control pathways that affect the entire

mitochondrion.

1.4.1 Mitochondrial Dynamics

Between 1914 and 1915, Lewis and Lewis first described a key characteristic of

mitochondria: their dynamic network1,47. Of note, mitochondrial fission and fusion are

constant, regulated processes that are critical components of multiple mitochondrial and

cellular functions, including other mitochondrial quality control pathways48–50.

Mitochondrial fusion is suggested to be a first line of defense by diluting mitochondrial

damage across the mitochondrial network48. Conversely, mitochondrial fission resulting

in fragmentation is associated with dissipation of ΔΨm; it separates severely damaged

mitochondria to be subsequently degraded (Fig.1-1B)48,51. Fission facilitates and,

according to multiple studies, is required for mitophagy48,49.

In mammals, mitochondria fusion is mediated by dynamin-like GTPases:

membrane-bound mitofusin 1 (MFN1) and MFN2 for the OMM; and various isoforms of

optic atrophy 1 (OPA1) for the IMM48. In response to mitochondrial depolarization, long

isoforms of OPA1 are cleaved by the inducible protease OMA1 to inhibit fusion and thus

encourage mitochondrial fragmentation51,52. Additionally, initiation of mitophagy results in

MFN1/2 ubiquitination and proteasomal degradation, which further fragments damaged

mitochondria for eventual degradation53–55.

Mammalian mitochondrial fission is also driven by a pair of cytosolic dynamin-like

GTPases: Dynamin-related protein 1 (Drp1) and Dynamin 2 (Dyn2)56,57. Sites of

mitochondrial fission are initially marked by contact with the endoplasmic reticulum,

9

followed by recruitment of Drp1 by mitochondrial OMM receptor proteins: fission protein

1 (Fis1); mitochondrial fission factor (Mff); mitochondrial dynamics protein of 49 kDa

(MiD49); and MiD5158,59. Drp1 assembles on the OMM into a helical ring-like structure

that constricts the mitochondrion to a diameter of approximately 100nm48,56. Dyn2

subsequently completes mitochondrial constriction until fission occurs57. In addition to

fusion machinery degradation, mitophagy initiation also results in displacement of protein

kinase A (PKA), which inhibits Drp1 by phosphorylation, from mitochondria60. Drp1 and

fission machinery is also implicated in other processes, including apoptosis61,62

1.4.2 PINK1/Parkin-mediated Mitophagy

First reported and named in 2005 by Lemasters, mitophagy, which results in whole

degradation of mitochondria, is considered to be the last line of defense in mitochondrial

quality control63. Mitophagy is a mitochondria-specific subcategory of macroautophagy,

which is characterized by the engulfment of cargo by a double-membraned vesicle, the

autophagosome, which then fuses with the lysosome for degradation63,64. Since its fairly

recent discovery, mitophagy has burgeoned as a research field: multiple mitophagy

mechanisms have been identified and their pathophysiological roles in development and

disease have been heavily scrutinized46,64. The best studied mitophagy pathway is

PINK1/Parkin-mediated mitophagy, which is triggered by mitochondrial depolarization64.

There are some indications that PINK1/Parkin-mediated mitophagy also occurs under

basal conditions, however a recent 2018 study in PINK1 knockout mice suggests that this

pathway is unessential to basal mitophagy64,65. Much of this attention has stemmed from

PINK1 and Parkin’s implication in PD; mutations in the E3 ubiquitin ligase Parkin and the

10

mitochondrial Serine/threonine kinase PINK1 are the most common causes of autosomal

recessive PD66–68.

Suggestions that PINK1 and Parkin participate in the same mitochondrial

maintenance pathway were first raised by genetic studies in Drosophila melanogaster68–

72. Initial studies demonstrated that Parkin over-expression could partially rescue PINK1

deletion mutants but not vice versa, suggesting that PINK1 acts upstream of Parkin69–71.

Figure 1-2: Representation of PINK1/Parkin-mediated mitophagy: A PINK1/Parkin-

mediated mitophagy is inhibited in healthy polarized mitochondria by PINK1 import into

mitochondria for processing by MPP and PARL proteases, which releases cleaved PINK1

to the cytosol where it is rapidly degraded. B In damaged depolarized mitochondria,

PINK1 is instead stabilized on the OMM where it phosphorylates OMM proteins, ubiquitin

and Parkin, which is recruited to the OMM. Parkin in turn ubiquitinates OMM proteins,

which recruit the autophagic machinery necessary to target the damaged mitochondrion

for degradation.

A

B

11

The pathway was shown to be conserved and further elucidated in the mammalian

system73–75.

In healthy mitochondria, endogenous PINK1 protein levels are constitutively low

due to rapid degradation (Fig.1-2A)48. PINK1 is imported and anchored to the IMM by the

TOM and TIM transporters by its MTS, which is subsequently cleaved off by the

mitochondrial processing peptidase (MPP) in the matrix72,76. The serine protease,

presenilins-associated rhomboid-like (PARL) then cleaves PINK1 between A103 and

F104 in the IMM77–80. PARL-cleaved PINK1 is untethered from the IMM and relocalizes

to the cytosol, where it is rapidly degraded by the proteasome according to the N-end

rule77–81. Recently, one study has also proposed that the PINK1 cleavage product binds

to Parkin in the cytosol to inhibit Parkin mitochondrial localization and resultant

mitophagy82. Under normal conditions, Parkin exists in a compact native autoinhibited

conformation in the cytosol that is mediated by tight intramolecular association between

its ubiquitin-like (UBL) domain and C-terminal region83. The importance of this regulation

is highlighted by pathogenic Parkin mutations, K27N, R33Q, R42P, and A46P in the UBL

domain, that disrupt this autoinhibition83.

Mitochondrial damage leading to mitochondrial depolarization inhibits PINK1

import to the IMM (Fig1-2B)23,76,77. Instead, PINK1 is stabilized on the OMM of the

damaged mitochondrion with its kinase domain facing the cytosol by TOM, although

mechanistic details are still under active investigation76,84,85. Multiple studies have shown

that PINK1 kinase activity is required to recruit and activate Parkin84–86. Stabilized PINK1

phosphorylates Parkin’s linker region between the In-Between Ring and RING2 domains

at T175 and T217, which activates Parkin E3 ligase activity and recruits Parkin to

12

mitochondria74,87,88. PINK1 also phosphorylates both Parkin’s UBL domain and ubiquitin

at S6589–92. PINK1 phosphorylation of S65 in Parkin’s UBL domain is proposed to prime

Parkin for further activation by S65-phosphorylated ubiquitin (p-Ub)90. Rigorous

biophysical and structural studies collectively suggest that p-Ub binds to phosphorylated

Parkin with high affinity to allosterically induce conformational changes that promote its

E2 recruitment and further stimulate Parkin E3 ligase activity93–96. PINK1 is suggested to

phosphorylate monoubiquitin and/or polyubiquitin chains covalently conjugated to OMM

proteins at basal levels to further recruit Parkin, which has a high affinity for p-Ub97,98.

Recruited Parkin further ubiquitinates OMM proteins that are phosphorylated by PINK1,

thus forming a positive feedback loop84,97,98.

PINK1 has also been suggested to directly phosphorylate a number of other OMM

proteins. Of note, one study reported Miro1, a component of the primary motor/adaptor

complex that links mitochondria to the microtubule cytoskeleton, as a direct PINK1

substrate99. However, two other studies have been unable to replicate this result100,101.

Nevertheless, these studies agree that PINK1 and Parkin mediate Miro1 proteasomal

degradation to inhibit mitochondrial motility. Another study identified the OMM fusion

protein MFN2 as a PINK1 substrate at T111 and S442102. Chen and Dorn demonstrated

that PINK1-dependent MFN2 phosphorylation facilitates Parkin recruitment and resultant

mitophagy102. Others report MFN1/2 as targets for PINK1/Parkin-mediated proteasomal

degradation to promote mitochondrial fragmentation, which is a necessary primer for

mitophagy53–55.

Once recruited, Parkin conjugates OMM proteins with K48- and K63-linked

ubiquitin chains54,103. Sarraf et al. identified 36 Parkin OMM substrates with high

13

confidence, suggesting that chain-linkage types and density rather than specific

substrates target the damaged mitochondrion for mitophagic degradation103. This theory

is supported by the observation that ectopic PINK1 expression on peroxisomes was

sufficient to recruit Parkin and trigger pexophagy (peroxisome-specific autophagy)85. To

date, six ubiquitin-binding autophagy receptor proteins associated with mitophagy have

been identified: NBR1, NDP53, OPTN, p62/SQSTM1, TAX1BP1, and TOLLIP104. Studies

suggest that NDP52 and OPTN are essential and TAX1BP1 is important for

PINK1/Parkin-mediated mitophagy105,106. These receptors recruit autophagy machinery

necessary for autophagosome formation and eventual lysosomal degradation107.

1.4.3 Mitochondrial Biogenesis

Multiple studies have demonstrated that mitophagy has the capacity to clear most

or all mitochondria in the cell73,108,109. While mitophagy protects the cell from excessive

mitochondrial damage, persistent mitophagy resulting in mitochondrial depletion has an

equal repercussion: cell death109. Therefore it is critical for the cell to replace damaged

mitochondria by activation of the mitochondrial biogenesis program. Due to the

mitochondrion’s endosymbiotic origin, biogenesis of these organelles presents unique

challenges: firstly, mitochondria cannot be made de novo; secondly, mitochondrial genes

reside in both mitochondrial and nuclear genomes. As a result, mitochondrial biogenesis

is a complex, highly regulated coordination of several distinct processes including mtDNA

expression, synthesis and import of nuclear-encoded proteins, coordinated assembly of

mitochondrial complexes, expansion of OMM and IMM, and mtDNA replication110–112.

Mitochondrial biogenesis is regulated mainly at the level of transcription (Fig1-3).

The core controllers that modulate mitochondrial biogenesis are the proliferator-activated

14

receptor γ (PPARγ) coactivator-1 (PGC-1) family of transcriptional coactivators and the

transcription factors, nuclear respiratory factor 1 (NRF1) and NRF2113,114. The PGC-1

family is composed of PGC-1α, PGC1-β, and PGC-1-related coactivator (PRC)115. While

the PGC-1 family regulates overlapping mitochondrial gene expression programs, they

significantly differ in their physiological expression and modes of regulation115–117. PGC-

1α, the founding member of the family, is the best studied and suggested to be the most

regulated (Fig1-3)116,118; however, this observation may in part due to the emphasis of

study in adipocyte and muscle cell differentiation119. Both PGC-1α/β are ubiquitously

expressed, but at especially high levels in tissues with high metabolic demands, such as

heart, skeletal muscle, kidney, and brain tissue120–122. In contrast, PRC, the least

characterized member of the family, appears to be restricted to regulating mitochondrial

biogenesis in proliferating cells123. PGC-1α, and to a lesser extent PGC-1β, are

considered master regulators of mitochondrial biogenesis as they increase expression of

various key transcription factors, including NRF1/2, and act as their transcriptional

coactivators to stimulate activity (Fig1-3)124–126. While PGC-1α/β share many overlapping

mitochondrial gene targets, they have been shown through multiple studies to be

activated independently and affect mitochondrial biogenesis in an additive and

independent manner127,128.

Upon activation, the transcription factors NRF1/2 stimulate gene expression of

multiple key mitochondrial structures, including OXPHOS, mitochondrial transcription,

translation, protein import, and assembly machinery113,119,129,130. Critically, NRF1/2

coordinate nuclear and mitochondrial gene expression to facilitate OXPHOS assembly.

As their name suggests, the nuclear respiratory factors NRF1/2 bind to the promoters and

15

activate expression of the nuclear genes that encode subunits of the five respiratory

OXPHOS complexes and cytochrome c in a partially redundant manner131–133. NRF1/2

also regulate mitochondrial gene expression by directly activating genes encoding

mitochondrial transcription factor A (TFAM), mitochondrial transcription factor B1

(TFB1M), and TFB2M, which are crucial regulators of mtDNA transcription and

replication, and mitochondrial ribosome assembly (Fig1-3)129,131. As the majority of

mitochondrial proteins are nuclear-encoded, the synthesis of mitochondrial import

machinery is a crucial component of mitochondrial biogenesis. Importantly, NRF1/2 also

activate expression of TOMM20, a key receptor subunit of the main mitochondrial

translocase TOM that is involved with initial precursor protein recognition130,131.

Mitochondrial biogenesis is another mitochondrial quality control pathway whose

dysfunction is implicated in the pathogenesis of multiple neurodegenerative diseases.

PGC-1α and its downstream effectors are down-regulated in brain tissue of PD,

Alzheimer’s disease (AD), and Huntington’s disease (HD) patients114,134. Decrease in

PGC-1α in PD is partially owed to repressive PGC-1α promoter methylation134.

Additionally, one study demonstrated that polymorphisms in NRF1 and TFAM genes

significantly correlated with HD age of onset135.

16

Figure 1-3: Representation of Mitochondrial Biogenesis: Mitochondrial biogenesis is

controlled by many transcriptional regulators. One of these key master regulators, PGC-

1α, is activated by AMPK phosphorylation and SIRT1 deacetylation. In conjunction with

various transcription factors, including NRF1/2, PGC-1α/β upregulate nuclear

mitochondrial gene expression. The mitochondrial transcription factor Tfam, as well as

TFB1/2M, is also expressed and activate mtDNA transcription with PGC-1α. Coordinated

nuclear and mitochondrial protein expression, as well as protein import, complex

assembly, membrane expansion and mtDNA replication are necessary processes in

mitochondrial biogenesis.

17

1.4.4 Coordination of Mitophagy and Mitochondrial Biogenesis

The mitochondrial content of the cell is controlled by the balance between the

opposing processes of mitophagy and mitochondrial biogenesis. However, as mitophagy

and mitochondrial biogenesis have only gained attention within recent decades, the

additional regulatory layer of coordination between the two processes is still not fully

understood. While certain known coordinating mechanisms favor one pathway and

repress the other, the pathways highlighted below share the common characteristic of

activating both mitophagy and mitochondrial biogenesis to allow for efficient mitochondrial

turnover.

1.4.4.1 Parkin

The E3 ubiquitin ligase Parkin has been extensively studied in the context of

mitophagy; however, its participation in mitochondrial biogenesis was also determined in

the same time period69–71,136. Work from Kuroda et al. suggests that Parkin promotes

mitochondrial biogenesis by interacting with and enhancing TFAM mtDNA transcriptional

activity136. Moreover, a recent study from Shin et al. re-identified the Parkin interacting

substrate, PARIS (ZNF746), which is repressed by Parkin ubiquitination and degraded by

the ubiquitin-proteasome system137,138. PARIS inhibits mitochondrial biogenesis by

binding to PGC-1α’s promoter region to repress PGC-1α and its target genes (Fig1-3)137.

The authors emphasized the importance of PARIS in mitochondrial homeostasis and PD

by demonstrating that mice over-expressing PARIS displayed progressive loss of

dopaminergic neurons, which could be rescued by Parkin or PGC-1α over-expression.

Parkin inactivation in sporadic PD patients139–143 is suggested to contribute to

18

mitochondrial dysfunction by disrupting PINK1/Parkin-mediated mitophagy and by PARIS

accumulation resulting in PGC-1α repression110,144.

1.4.4.2 PGC-1α

Likewise, although PGC-1α is often described as a master regulator of

mitochondrial biogenesis, new evidence suggests that it also acts as an autophagy

regulator. In one HD mouse model study, researchers found that PGC-1α over-

expression ameliorated neurodegeneration and huntingtin aggregation by upregulation of

mitochondrial biogenesis and by activation of transcription factor EB (TFEB), a master

regulator of the autophagy-lysosome pathway145. Additionally, another study found that

acute exercise-induced mitophagy in skeletal muscle was impaired in PGC-1α -/- mice146.

In particular, PGC-1α appeared to mediate expression of autophagy factors LC3B and

p62 independent of TFEB or Forkhead box O3 (FOXO3), a PGC-1α-associated

transcriptional regulator of autophagy146. This suggests that in addition to regulating

mitochondrial biogenesis, PGC-1α regulates autophagy through known and yet-to-be

elucidated mechanisms.

1.4.4.3 AMPK

AMP-activated kinase (AMPK) is activated in response to high cellular AMP levels,

which may indicate nutrient deprivation and environmental stress110,147. Once activated,

AMPK stimulates mitochondrial biogenesis by activating PGC-1α through direct

phosphorylation and by promoting PGC-1α deacetylation by Silent Information Regulator

2 (SIR2) protein 1 (SIRT1) (Fig1-3)148,149. Recently, AMPK was also shown to mediate

mitophagy by directly phosphorylating the DRP1 receptor MFF to promote mitochondrial

fragmentation50. Additionally, the autophagy-initiating kinase, Unc-51-like autophagy

activating kinase 1 (ULK1) is also a direct AMPK activation target150,151. Egan et al.

19

showed mitophagy defects in ULK1- and AMPK-deficient primary murine hepatocytes,

although the mechanism of ULK1-mediated mitophagy is not yet fully understood150–152.

1.5 The Mitochondrial Rhomboid Protease, PARL

The mitochondrial rhomboid protease PARL is commonly described as a key

protease of PINK1 that prevents aberrant mitophagy of healthy mitochondria77–80. Work

from our group and others has revealed that PARL plays a critical but not entirely

understood role in multiple mitochondrial and cellular functions.

1.5.1 Identification of the Rhomboid Superfamily

The first rhomboid protease, Rhomboid-1, was identified in 1984 in a genetic

screen where researchers identified a mutation in Drosophila embryos that resulted in an

abnormal rhombus-like head skeleton153. Rhomboid-1 and its homologues are

predominantly characterized in the activation of epidermal growth factors (EGFs)154. It

was later shown that Rhomboid-1 activated the EGF-like protein Spitz by cleaving it in its

transmembrane domain155–157. Thus, Rhomboid-1 and its six Drosophila homologues

became the founding members of the well-conserved rhomboid superfamily of

intramembrane proteases157–159. Rhomboid homologues have since been found in nearly

every sequenced genome across virtually all life forms and constitute the most

widespread family of intramembrane proteases157–159. The rhomboid superfamily is

composed of proteolytically active RHO secretory pathway rhomboids and PARL

mitochondrial rhomboids, and proteolytically inactive iRhoms and Derlin proteins159.

20

1.5.2 Rhomboid Structure

Rhomboids are the best mechanistically characterized intramembrane proteases

but are still not well understood160. Much of our structural and mechanistic understanding

is gleaned from seven crystal structures of GlpG, the rhomboid homologue in Escherichia

coli, which were solved just over a decade ago161–163. All active prokaryotic and eukaryotic

rhomboids share a catalytic domain comprised of six transmembrane helices (TMH)164.

These crystal structures reveal that the bacterial rhomboid is almost entirely immersed in

the detergent micelle with its universally conserved catalytic serine on TMH-4 (S277 in

human PARL) submerged approximately 10 Å from the presumed membrane surface161–

164. Molecular dynamics studies indicate that although proteolysis occurs in the

membrane, water molecules necessary for catalysis are still able to access the active site,

which is composed of a catalytic dyad, serine on TMH-4 and histidine on TMH-6 (H335

in human PARL)165–167.

Most eukaryotic members of the PARL and RHO subfamilies possess seven

TMHs, having gained an additional TMH at the N-terminus (PARL subfamily) or at the C-

terminus (RHO family)158. One group has noted the difficulty in expressing PARL’s 6 TMH

catalytic domain due to issues of topology and misfolding, which suggests that the

additional N-terminal TMH-A may facilitate PARL import and folding164. Homology

modeling of PARL’s 6 TMH core indicates that disruption of PARL’s ‘1+6’ structure may

displace D319, which is implicated in PARL’s catalytic activity164. To date, the structural

and functional contribution of the 7th TMH, TMH-A in PARL, remains an open question.

21

1.5.3 Identification of the Mitochondrial Rhomboid

The first mitochondrial rhomboid protease, Rhomboid-1 (Rbd1), was identified in

2002 in Saccharomyces cerevisiae as a protease of cytochrome c peroxidase 1 (Ccp1)168.

While Ccp1 deletion had minimal consequences, Δrbd1 yeast cells were unable to grow

on glycerol media and displayed prominent mitochondrial abnormalities, including

mitochondrial fragmentation and aggregation, loss of mtDNA nucleoids, and respiratory

defects169. This drastic phenotype was one of the first pieces of evidence that Rbd1 and

its homologues play a critical role in mitochondrial biology. Less than a year after its initial

discovery, Rbd1’s second substrate, mitochondrial genome maintenance 1 (Mgm1), was

identified170. Mgm1, like its mammalian homologue, the IMM fusion GTPase OPA1, is a

key participant in mitochondrial fusion and mtDNA maintenance171. Rbd1-dependent

Mgm1 cleavage and production of short Mgm1 (s-Mgm1) is required to carry out these

functions171. Part of Rbd1’s effect on mitochondrial biology is through Mgm1 cleavage as

expression of s-Mgm1 partially rescues Δrbd1 mitochondrial defects169,170. Importantly,

the Δrbd1 phenotype could be rescued by expression of its human mitochondrial

homologue PARL; this was the first demonstration that mitochondrial rhomboid function

is conserved from yeast to humans169,171.

Mitochondrial Rbd1 homologues in other model organisms, including Drosophila,

became more heavily scrutinized in light of Rbd1’s regulation of mitochondrial biology.

The few Drosophila deficient in the Rbd1 homologue Rhomboid-7 that survived pupation

displayed neurological defects, male sterility, and did not survive past three days into

adulthood172. Notably, rhomboid-7-deficient Drosophila testis and skeletal muscle

displayed mitochondrial abnormalities suggestive of defective mitochondrial fusion172.

Rhomboid-7 silencing in Drosophila S2 cells also resulted in severe mitochondrial

22

fragmentation, similar to opa1-like (homologue of Mgm1 and OPA1) silencing172.

However, evidence of conserved Rhomboid-7 cleavage of Opa1-like is conflicting173,174.

Surprisingly, Rhomboid-7-overexpressing Drosophila displayed similar defects to

Rhomboid-7-deficient Drosophila: increased lethality, neurological defects, and severe

mitochondrial malfunction173. These converging phenotypes suggest the necessity of

regulating Rhomboid-7 proteolytic activity.

Studies of Rhomboid-7 in Drosophila also led to the first line of evidence

connecting the mitochondrial rhomboid to PD174. Whitworth et al. identified three PD-

linked genes as genetic interactors of rhomboid-7: pink1, parkin, and the serine protease

high temperature requirement A2 (htrA2; also known as omi)174. Further work suggests

that Pink1 and HtrA2 are Rhomboid-7 proteolytic substrates and that this cleavage is

required for substrate function174.

Table 1- 1: List of mitochondrial rhomboids and their putative substrates

Species Rhomboid Putative

Substrates Function

Saccharomyces

Cerevisiae Rbd1

Ccp1 -

Mgm1 Mitochondrial Fusion

Drosophila

melanogaster Rhomboid-7

Opa1-Like Mitochondrial Fusion

Pink1 Mitophagy

HtrA2 Apoptosis

Mammals PARL

OPA1 Mitochondrial Fusion

PINK1 Mitophagy

HtrA2 Apoptosis

PGAM5 Apoptosis

Smac Apoptosis

23

1.5.4 The Mammalian Mitochondrial Rhomboid, PARL

The only human mitochondrial rhomboid protease, presenilins-associated

rhomboid-like (PARL), was identified in 2001 in a yeast two-hybrid screen as a putative

interactor of presenilins, which are implicated in AD175. Unlike what PARL’s name

suggests, this interaction was ruled as artefactual as PARL is located in the IMM,

separated by an additional OMM, whereas the presenilins are located in the plasma

membrane; this false positive may be attributed to the yeast two-hybrid system’s poor

suitability for membrane proteins169,171. To correct this misnomer and retain PARL’s

historical name, it has recently been suggested that the meaning of the PARL acronym

be changed to “PINK1/PGAM5-associated rhomboid-like”176.

1.5.4.1 PARL α/β/γ Cleavage

As a eukaryotic mitochondrial rhomboid, mammalian PARL is an IMM protease

with seven TMHs: the evolutionarily conserved 6 TMHs (TMH1-6) containing the catalytic

core, and the additional TMH-A that is appended to PARL’s N-terminus. TMH-A is

suspected to exert some regulatory control on PARL. As a nuclear-encoded protein,

PARL import into the IMM results in removal of its N-terminal MTS by MPP in the matrix;

this event is referred to as α cleavage (Fig 1-4A)164,177,178.

PARL undergoes a sequential cleavage event at its N-terminus in the matrix

between amino acids S77 and A78, which is termed β cleavage (Fig 1-4A)78,177. β

cleavage is dependent on PARL catalytic activity as mutation of PARL’s catalytic serine,

S277G, abolishes β cleavage78,177. However, as PARL cleaves in the IMM and the site of

β cleavage is in the mitochondrial matrix, the protease responsible for β cleavage remains

an active topic of debate. The protease responsible for β cleavage may be PARL itself

24

through some unknown mechanism or an as-of-yet unknown protease whose recruitment

or activity requires PARL proteolytic activity.

Unlike α cleavage, which is a constitutive event, β cleavage is triggered by

mitochondrial stress. Our group has demonstrated that PARL β cleavage is exacerbated

by the mitochondrial stressors, Oligomycin A (OlA), Rotenone, and carbonyl cyanide m-

chlorophenyl hydrazone (CCCP), but not by the endoplasmic reticulum (ER) stressor,

Thapsigargin179. Mechanistically, β cleavage is additively inhibited by phosphorylation of

S65, T69, and S70, N-terminal to the site of β cleavage178. Pyruvate dehydrogenase

kinase 2 (PDK2), a key regulator of energy production and metabolism, was recently

identified as the kinase responsible for PARL phosphorylation and β cleavage inhibition.

Shi and McQuibban hypothesize that PDK2 promotes β cleavage by reducing PARL

phosphorylation rates in response to reduction of mitochondrial energy metabolism179.

The matrix phosphatase responsible for reversing PARL phosphorylation and promoting

β cleavage remains an open question.

Also unlike α cleavage, whose site is highly conserved amongst animal

orthologues of PARL, the β cleavage site is strictly conserved in mammals (Fig 1-

4B)78,177. This suggests that β cleavage may mediate some mammalian-specific

regulation on PARL in response to mitochondrial stress. The importance of PARL β

cleavage in mitochondrial and cellular health is emphasized by our group’s discovery of

the PD-associated missense mutation S77N at PARL’s β cleavage site, which abolishes

this cleavage event (Fig 1-4C)78.

β cleavage results in two moieties: N-terminally cleaved PARL, termed β PARL,

and a 25 amino acid peptide, termed PARL β (Pβ) (Fig 1-4A)177. Our group and others

25

have found that exogenous expression of β PARL results in a fragmented mitochondrial

morphology similar to WT PARL over-expression phenotypes78,178. Fragmented

mitochondrial morphology is not recapitulated when PARL catalytic activity (S277G) or β

cleavage (S77N) is disrupted78,178. Additionally, our group has shown that β cleavage

alters PARL cleavage efficiency of its substrate PINK1179. The effect of PARL β cleavage

on PINK1 of PINK1/Parkin-mediated mitophagy is further expanded below.

Speculations that the second product of PARL β cleavage, the small peptide Pβ,

may carry some as-of-yet unknown role in mitochondrial and cellular biology have

stemmed from its strong conservation in vertebrates and especially in mammals78,177.

Interestingly, Sík et al. identified a non-canonical nuclear localization sequence (NLS) in

Pβ composed of three closely spaced doublets of positively charged amino acids; the first

and second are conserved in vertebrates whereas the third pair is mammalian-specific177.

Indeed, two studies exogenously expressing Pβ-GFP fusion constructs found that Pβ

appeared to partially localize to the nucleus177,180. Sík et al. determined that mutation of

Pβ-GFP’s putative NLS abrogated nuclear localization177. However, the results of these

localization studies are obscured by the usage of Pβ-GFP as GFP itself can localize to

the nucleus to some extent181.

One group has suggested that PARL’s N-terminus undergoes a third sequential

cleavage, this time in the loop region separating TMH-A from the core catalytic domain,

termed ϒ cleavage (Fig 1-4A)164,177. Homology modeling of ϒ PARL suggests that

removal of TMH-A results in structural changes that disrupted PARL proteolytic activity164.

In line with this, exogenous expression of ϒ PARL results in elongated mitochondrial

26

morphology, similar to catalytically dead PARL177. However, our group has had difficulties

recapitulating this data.

A

B C

Figure 1-4: PARL β cleavage is a disease-relevant regulatory event: A A

representation of PARL structure and cleavage events. PARL contains 7 transmembrane

helices (TMH) organized in a “1+6” manner, where the latter 6 make up the conserved

rhomboid catalytic core and the N-terminal TMH is a mitochondrial rhomboid-specific

addition. PARL undergoes 3 cleavage events: constitutive α cleavage; mitochondrial-

stress regulated β cleavage, which is additively inhibited by phosphorylation; and ϒ

cleavage, which is mechanistically paired to β cleavage. B PARL β cleavage site amino

acid sequence alignment by CLUSTALW. S77, the β cleavage site, is highlighted in red.

Alignment demonstrates a high degree of sequence similarity in mammals. S77N

mutation was identified in Parkinson’s disease (PD) patients. C Western blot of FLAG-

tagged PARL constructs in HEK293Ts. S77N abolishes PARL β cleavage.

27

1.5.4.2 The Role of PARL in Mitochondrial Morphology

As previously noted, WT PARL overexpression in cultured cells induces

mitochondrial fragmentation, a phenotype that is dependent on both PARL catalytic

activity and β cleavage78,178. These observations suggest the importance of mammalian

PARL, especially β PARL, the product of β cleavage, in regulation of mitochondrial

dynamics and morphology. However, studies of mitochondrial morphology in Parl -/- mice

are conflicting. Two studies, one in Parl -/- mouse embryonic fibroblasts (MEFs) and one

in PARL-depleted mouse skeletal muscle and cultured human myotubes, found no major

disruption of mitochondrial morphology180,182. The second study observed changes in

mitochondrial cristae structure180. PARL proteolytic activity for the IMM fusion protein

OPA1 is suggested to be conserved as yeast two-hybrid screens and co-

immunoprecipitation experiments indicate interaction182. However, other studies suggest

that PARL is dispensable for OPA1 processing as OPA1 is a substrate for many other

proteases183,184.

1.5.4.3 The Role of PARL in Apoptosis

The implication of PARL in intrinsic apoptosis is also conflicting. One study argued

that PARL is an anti-apoptotic protein by demonstrating that Parl -/- mice had a drastically

reduced life span owing to progressive multisystemic atrophy that was sustained by

increased apoptosis182. Increased apoptosis was attributed to higher susceptibility to

cytochrome c release in Parl -/- MEFs and primary myoblasts in response to several

intrinsic apoptotic inducers, including staurosporine (STS)182. In contrast, a 2017 study

identified PARL as a pro-apoptotic protein. Saita et al. showed that PARL-deficient human

cells were more resistant to apoptotic inducers, including STS185. They demonstrated that

PARL cleaved the pro-apoptotic protein Smac (also known as DIABLO) which

28

subsequently inhibited apoptosis inhibitors to promote caspase activity and resultant

apoptosis185.

PARL may also influence apoptosis through two other substrates: the

mitochondrial kinase phosphoglycerate mutase 5 (PGAM5), which is implicated in

multiple cell death pathways including apoptosis and necroptosis186–188; and HtrA2, a

controversial PARL substrate implicated in apoptosis185,189. However, these connections

remain circumstantial at best. To date, there are no studies observing PARL β cleavage

in cell death pathways.

1.5.4.4 The Role of PARL in Mitophagy and Parkinson’s disease

According to current mitophagy models, PARL’s role in mitophagy extends only to

prevent aberrant mitophagy of healthy polarized mitochondria because it cleaves

imported PINK1 to target it to the cytosol for degradation. While other proteases have

been documented to proteolyze PINK1, PARL likely acts as the favoured PINK1 protease

as PARL ablation or expression of catalytically inactive S277G PARL results in impaired

PINK1 processing78,176,190. One study also noted mitochondrial PINK1 retention and

premature Parkin recruitment in PARL-deficient human cells190.

As the PD-linked S77N mutation disrupts PARL β cleavage, we hypothesized that

β cleavage and resultant β PARL expression may play a role in mitophagy. Indeed,

although S77N PARL retains catalytic activity, exogenous expression of S77N PARL

showed impaired mitochondrial fragmentation and Parkin recruitment in response to

mitochondrial depolarization by treatment with the ionophore, CCCP, in comparison to

WT PARL-expressing cells78. Recent work from Shi and McQuibban demonstrated that β

PARL was less efficient at cleaving PINK1 in comparison to S77N PARL179. WT PARL,

which exists as both full length and β PARL when over-expressed, showed intermediate

29

PINK1 cleavage efficiency179. Furthermore, PARL β cleavage was responsive to a

number of stresses that may occur prior to depolarization, including ATP depletion by the

ATP synthase inhibitor, OlA179. Of note, the PARL kinase, PDK2, is highly sensitive to

ATP depletion, owing to its role in metabolism179. Thus, we hypothesize that PARL β

cleavage initiates PINK1/mediated mitophagy prior to ΔΨm depletion through β PARL’s

reduced proteolytic efficiency for PINK1, leading to PINK1 OMM stabilization.

Interestingly, over-expression of β PARL but not S77N PARL induced mitochondrial

fragmentation, a necessary prerequisite of mitophagy78. Assuming inefficient PINK1

processing results in stabilization on the OMM, PINK1 may drive PARL-mediated

mitochondrial fragmentation by phosphorylating and targeting MFN1/2 for degradation.

1.5.4.5 The Role of PARL in Mitochondrial Biogenesis

One study conducted in 2010 by Civitarese et al. has connected PARL to

mitochondrial biogenesis. The authors showed that Parl knockdown in mouse skeletal

muscle cells resulted in decreased mitochondrial mass and concomitant decreased

protein expression in PGC-1α, OPA1, and MFN1/2180. Surprisingly, transfection of

untagged Pβ in human myotubes increased mRNA expression of the mitochondrial

biogenesis genes, PGC-1β and NRF1; mitochondrial fusion genes, MFN1/2; and PARL

itself180. In addition, Pβ-transfected myotubes also displayed increased protein

expression of the OPA1 and SIRT1, a PGC-1α activator180. Pβ treatment also appeared

to increase mitochondrial mass and oxygen consumption, in line with increased

mitochondrial biogenesis180. However, the mechanism by which the 25 amino acid

peptide Pβ may activate mitochondrial biogenesis remains unresolved.

30

1.6 Thesis Rationale

Mounting evidence suggests that PARL plays a crucial but as-of-yet unclear role

in mitochondrial and cellular biology. Specifically, recent reports indicate that PARL β

cleavage coordinates two critical mitochondrial quality control processes, mitophagy and

mitochondrial biogenesis, through its cleavage products, β PARL and Pβ, respectively.

However, Pβ’s putative role in mitochondrial biogenesis remains poorly characterized.

This study sought to delineate the mechanism of Pβ regulation of mitochondrial

biogenesis by identifying its expression and subcellular localization in cells and its

potential interactions. In this thesis, I demonstrated that Pβ localizes to the nucleus, where

it associates with chromatin. My work suggests that Pβ may act at the transcriptional level

to upregulate mitochondrial biogenesis and thus enforce mitochondrial quality control.

31

Chapter 2

MATERIAL AND METHODS

2.1 Reagents

2.1.1 Cell Culture and Transfection

HEK293 cell lines were cultured in Dulbecco’s Modified Essential Medium (DMEM,

Sigma) supplemented with 10% fetal bovine serum (FBS, Sigma) at 37˚C in 5% (v/v) CO2.

SH-SY5Y cell lines were cultured in DMEM/F12 with L-Glutamine (Sigma), 15mM HEPES

(Gibco) supplemented with 10% FBS at 37˚C in 5% (v/v) CO2. Both adherent and floating

cell populations were maintained. HEK293s were transiently transfected using

XtremeGENE9 (Roche) according to manufacturer’s instructions.

2.1.2 Chemical Reagents and Antibodies

Oligomycin A treatment was conducted for 24 hours to induce mitochondrial stress.

5μM MG132 treatment was conducted for 16 hours in SH-SY5Y cells to stabilize Pβ signal

by inhibition of the proteasome.

The following antibodies were used: rabbit anti-Pβ (a generous gift from Dr. Lyndal

Bayles, Deakin University), mouse M2 anti-FLAG (Sigma, F1804), rabbit-PARL (Abcam,

ab45231), mouse anti-ATP5α (Abcam, ab95962), mouse anti-actin (Sigma, A3853),

mouse anti-tubulin (Sigma, T9026), rabbit anti-Lamin B1 (Abcam, ab16048), rabbit anti-

ALY (a generous gift from Dr. Alex Palazzo, University of Toronto) rabbit anti-H3 (Sigma,

32

SAB4200651), and rabbit and mouse horseradish peroxidase-conjugated secondary

antibodies (Jackson Labs).

2.1.3 Plasmids

C-terminally 3X FLAG-tagged WT PARL was generated as previously described78.

β PARL was generated by Pβ deletion from WT PARL by inverse PCR, as previously

described179.

2.2 Subcellular Fractionations

2.2.1 Abcam Subcellular Fractionation

Subcellular fractionations were conducted by differential centrifugation using a

method adapted from manufacturer’s instructions for the Mitochondrial Isolation Kit for

Cultured Cells (Abcam, ab110170). Cells were trypsinized, harvested, and washed twice

in chilled PBS buffer. On ice, collected cells were lysed in 10:1 volumes of reagent A (Tris,

trisethanolamine, EDTA, digitonin) for 5 minutes, homogenized by 26½ gauge needle 30

times, and incubated for an additional 5 minutes. A total fraction was collected and

remaining sample was centrifuged at 1000xg for 10 minutes at 4˚C to pellet the nuclear

fraction. The supernatant fraction was subsequently centrifuged at 16 000xg for 15

minutes to separate the pelleted mitochondrial fraction and the cytosolic fraction. The

mitochondrial pellet was washed once in reagent A. The pelleted nuclear fraction was

resuspended in reagent B (Tris, EDTA, digitonin) and homogenized with a 26½ gauge

needle 30 times. The nuclear fraction was centrifuged at 1000xg for 10 min and washed

twice with reagent B. Fractions were protein precipitated if necessary and resuspended

in 2X Lammli sample buffer.

33

2.2.2 CSK Subcellular Fractionation

Subcellular fractionations were conducted using a protocol adapted from Mirzoeva

and Petrini191. Cells were trypsinized, harvested, and washed twice with chilled PBS.

Cells were lysed in cytoskeleton (CSK) buffer (10mM PIPES pH 6.8, 300mM sucrose,

100mM NaCl, 3mM MgCl2, 1mM EGTA, 0.5% Triton X-100, and protease inhibitors) for 7

minutes on ice. A total fraction was obtained prior to centrifugation at 5000xg for 5 minutes

at 4˚C to pellet the nuclear fraction. The nuclear pellet was washed twice in CSK buffer.

The supernatant was centrifuged at 16 000xg for 15 minutes to obtain the pelleted

mitochondrial fraction and the cytoplasmic fraction. The mitochondrial pellet was washed

once with CSK buffer. Fractions were protein precipitated if necessary and resuspended

in 2X Lammli sample buffer.

2.3 Chromatin Fractionations

2.3.1 DNase-based Chromatin Fractionation

Chromatin fractionations were conducted using a protocol adapted from Mirzoeva

and Petrini191. Cells were trypsinized, harvested, and washed twice with chilled PBS.

Cells were lysed in CSK buffer for 7 minutes on ice prior to centrifugation at 5000xg for 5

minutes at 4˚C to obtain the pelleted nuclear fraction and the triton-soluble supernatant.

The triton-soluble fraction was centrifuged at 16 000xg for 15 minutes to obtain the

pelleted mitochondrial fraction and the cytoplasmic fraction. The mitochondrial pellet was

washed once with CSK buffer. The nuclear pellet was washed once with CSK buffer and

incubated in CSK buffer and 1:5 volumes of DNase I (New England Biolabs) at 37˚C for

1 hour. The fraction was then centrifuged at 5000xg for 5 minutes at 4˚C. The supernatant

was taken as the DNase-soluble fraction and the pellet was taken as the DNase-insoluble

34

nuclear pellet. Fractions were protein precipitated if necessary and resuspended in 2X

Lammli sample buffer.

2.3.2 Acid-based Chromatin Fractionation

Chromatin fractionations were adapted from a previously described protocol by

Huang et al.192. Cells were trypsinized, harvested, and washed twice with chilled PBS.

Cells were lysed in 5 volumes of lysis buffer (10mM HEPES pH 7.4, 10mM KCl, 0.05%

NP-40, and protease and phosphatase inhibitors) for 20 minutes on ice prior to

centrifugation at 2000xg for 10 minutes at 4˚C to obtain a pelleted nuclear fraction and a

cytosolic supernatant. The pelleted nuclear fraction was subsequently washed once in

lysis buffer prior to incubation in low salt buffer (10mM Tris-HCl pH 7.4, 0.2mM MgCl2,

1% Triton-X 100 and protease and phosphatase inhibitors) for 15 minutes on ice. The

lysate was centrifuged at 5000xg for 10 minutes at 4˚C to obtain the pellet and the

supernatant containing nucleoplasmic proteins. The pelleted fraction was incubated in 5

volumes of HCl 0.2N for 20 minutes on ice and centrifuged at 15000xg to obtain an

insoluble nuclear pellet fraction and the supernatant containing chromatin-associated

proteins. The collected supernatant was neutralized with the same volume of 1M Tris HCl

pH 8. Fractions were protein precipitated if necessary and resuspended in 2X Lammli

sample buffer.

2.3 Immunoprecipitation

Cells were trypsinized, harvested, and washed twice with chilled PBS. Collected

cells were subsequently lysed with IP lysis buffer (150mM NaCl, 10mM Tris-HCl, 1mM

EDTA, 1% TX-100, 0.5% NP-40, and protease inhibitors) at 4˚C for 25 minutes and

centrifuged at 1500xg for 10 minutes. To immunoprecipitate PARL, 1:100 rabbit

35

polyclonal anti-PARL was incubated with supernatant at 4˚C overnight, followed by

incubation with protein A magnetic beads (Bio-Rad, ab214286) at 4˚C for 2 hours,

according to manufacturer’s instructions.

2.4 Western Blotting

2.4.1 Protein Precipitation

Protein was precipitated as previously described by Wessel and Flügge193. Briefly,

sample volume was raised to 600μL with ddH2O and 600μL methanol and 100μL

chloroform were added. The resulting sample was mixed thoroughly followed by

centrifugation at 10 000xg for 5 minutes at room temperature (RT). The upper layer was

extracted and 600μL methanol was added. The two phases were carefully mixed by low

vortexing or by tilting the tube lengthwise. Mixed samples were centrifuged at 16 000xg

for 5 minutes at RT. The supernatant was removed and the protein pellets were dried at

42˚C. Dried pellets were subsequently resuspended in 2X Laemmli buffer.

2.4.2 SDS-PAGE and Western Blotting

Cell lysates were resuspended in 2X Laemmli buffer followed by 15 minute

incubation at 95˚C or 65˚C for PARL to avoid aggregation. Samples were electrophoresed

on 15% polyacrylamide gels or 4-20% Mini-PROTEAN® TGX™ Precast Protein Gels

(Biorad, ab 456-1094) for endogenous Pβ. Gels were transferred for 45min for Pβ

detection or 1 hour for PARL detection at 110V onto methanol-activated PVDF

membranes. Membranes were blocked in 5% bovine serum albumin (BSA) in TBST for 1

hour, incubated in 1˚ antibody in 1% BSA overnight, and 2˚ antibody in 1% BSA for 2

hours at room temperature. Chemiluminescence was detected via Clarity Western ECL

Substrate (Biorad, 170-5061) and Versadoc imager (Biorad).

36

Chapter 3

RESULTS

3.1 Over-expressed Pβ localizes to the nucleus

Pβ contains a putative non-canonical vertebrate-specific nuclear localization

sequence (NLS), which has lead two groups to demonstrate partial nuclear localization

of the small peptide through fluorescence microscopy experiments over-expressing GFP

fusion constructs177,180. However, these results are obscured by the usage of Pβ-GFP as

GFP itself can localize to the nucleus to some extent181. Furthermore, as these constructs

are expressed in the cytoplasm, there is currently no published evidence that the

mitochondrial peptide is exported from mitochondria. To address these issues, I

determined untagged Pβ subcellular localization. As PARL β cleavage is an N-terminal

event, C-terminally 3XFLAG-tagged PARL was transiently expressed in HEK293s. PARL-

FLAG localizes to the IMM and produces untagged Pβ in the mitochondrial matrix upon

β cleavage. Because mitochondrial stress instigates PARL β cleavage, HEK293s were

treated with 2.5μM Oligomycin A (OlA), an ATP synthase inhibitor and potent

mitochondrial stressor, or DMSO as control for 24 hours. I was unable to detect free Pβ

localization by immunofluorescence microscopy due to the simultaneous recognition of

full-length PARL in mitochondria (data not shown). Therefore, I conducted two separate

37

subcellular fractionations which isolated total, cytoplasmic, mitochondrial and nuclear

fractions to rigorously determine free Pβ subcellular localization. Fractionations were

verified by mitochondrial ATP5α, a subunit of ATP synthase that faces the mitochondrial

matrix, and the nuclear lamina protein, Lamin B1. Pβ, as detected by Pβ-specific antibody

gifted by Dr. Lyndal Bayles (Deakin University), was largely enriched in the nuclear

fraction in both fractionations, corroborating previous studies suggesting nuclear Pβ

localization (Fig. 3-1A,B)177,180. Little to no Pβ was reliably detectable in the mitochondrial

fraction in subsequent repetitions, which suggests efficient Pβ clearance by efflux and/or

degradation from the mitochondrial matrix.

38

A

B

C

Figure 3-1: Overexpressed Pβ localizes to the nucleus in HEK293s: HEK293 cells were transiently transfected with PARL-FLAG and treated with 2.5μM Oligomycin (OlA) or DMSO for 24 hours. HEK293s were fractionated according to manufacturer’s instructions using the Mitochondrial Isolation Kit for Cultured Cells (Abcam ab110170) (A) or using a fractionation protocol as previously described190 (B). Both fractionations isolated Tot (total), Cyto (cytoplasmic), Mito (mitochondrial) and Nuc (nuclear) fractions. C To determine the effect of increasing mitochondrial stress on Pβ production, HEK293s transiently expressing PARL-FLAG were treated with higher concentrations of OlA, 10μM and 20μM. β PARL-FLAG was also transiently transfected as a control for antibody specificity. Cells were fractionated using Abcam protocol as in Fig 1A. PARL β cleavage was monitored by ratio of full length PARL (upper band) to β PARL (lower band).

39

Surprisingly, Pβ was detected at comparable amounts in both 2.5μM OlA- and

DMSO-treated fractions, contrary to previous reports of cleavage dependency on

mitochondrial damage179. To determine whether the lack of change could be due to

insufficient mitochondrial stress, PARL-transfected HEK293s were treated with higher

concentrations of OlA (10μM and 20μM) for 24 hours and subcellular fractionations were

conducted. PARL β cleavage was monitored by the ratio of full length PARL to β PARL

in response to mitochondrial stress. Notably, nuclear Pβ expression and mitochondrial

PARL β cleavage were prominent and comparable in DMSO- and 10μM OlA-treated

HEK293s (Fig. 3-1C). Preliminary results suggest that while PARL β cleavage

correspondingly increased in cells treated with 20μM OlA, the highest concentration

tested, the expression of the cleavage byproduct Pβ paradoxically decreased. Pβ

decrease in 20μM OlA-treated HEK293s may be due to increased Pβ degradation in

response to increased mitochondrial and thus cellular stress, although it is unclear in

which subcellular compartment this degradation may occur.

As a control for antibody specificity, I also transiently transfected HEK293s with

β PARL, an N-terminally truncated construct where the Pβ sequence has been deleted

in-frame. In these cells, only a lower molecular weight band corresponding to β PARL

was present in the mitochondrial fraction (Fig. 3-1C). No bands corresponding to Pβ were

detectable by western blot, verifying that the doublet visualized by Pβ antibody is Pβ-

specific (Fig. 3-1C).

These results corroborate and extend previous observations of nuclear Pβ-GFP

localization by establishing that overexpressed, untagged Pβ efficiently translocates from

the mitochondrial matrix to the nucleus in HEK293s.

40

3.2 Endogenous Pβ localizes to the nucleus

As Pβ localization studies heavily rely on overexpression systems, I next aimed to

determine the subcellular localization of endogenous Pβ, made possible by the

possession of a Pβ-specific antibody. Experiments observing endogenous Pβ were

conducted in the human neuroblastoma cell line, SH-SY5Y, which was a gracious gift

from Dr. Anurag Tandon (University of Toronto). SH-SY5Ys are a common cell line to

study neurodegenerative diseases, especially PD, in part due to their catecholaminergic

properties194. These properties include tyrosine hydroxylase expression and dopamine

and norepinephrine/noradrenaline production, which are intact in undifferentiated SH-

SY5Ys194,195. Most importantly, we chose this cell line as endogenous PARL and PARL β

cleavage is detectable in SH-SY5Ys179.

Figure 3-2: Previous work from our lab demonstrates that PARL β cleavage is

sensitive to OlA treatment in SH-SY5Ys177: SH-SY5Ys were treated with increasing

concentrations of OlA for 24 hours. PARL was immunoprecipitated to increase signal.

PARL β cleavage was monitored by ratio of full length PARL (upper band) to β PARL

(lower band). ATP5α is the loading control. Reprinted with permission177.

41

Our lab has previously shown that PARL does not undergo β cleavage in SH-

SY5Ys in the absence of mitochondrial stress (Fig. 3-2)179. Previous unpublished results

also suggest that endogenous Pβ is difficult to detect by western blot without the addition

of MG132, a potent proteasome inhibitor, which inhibits Pβ degradation. To induce β

cleavage and ensure Pβ visualization, I treated SH-SY5Ys with 2.5μM OlA, which was

previously shown to be sufficient to initiate PARL β cleavage (Fig.3-2), or DMSO for 24

hours. SH-SY5Ys were also treated with 5μM MG132 for 16 hours to aid Pβ visualization.

Cells were subsequently fractionated using two independent protocols. In agreement with

Pβ overexpression studies, both published and presented above, free endogenous Pβ

was largely enriched in the nuclear fraction in both fractionations (Fig. 3-3A,B).

Surprisingly, Pβ was comparably expressed in DMSO- and OlA-treated cells. This result

is congruous with Pβ overexpression fractionations in HEK193s, but contrary to previous

reports that PARL β cleavage and thus Pβ expression are tightly controlled by induction

with mitochondrial stress in SH-SY5Ys179. Nevertheless, my findings provide evidence

that Pβ translocates from mitochondria to the nucleus in SH-SY5Ys.

42

Figure 3-3: Endogenous Pβ localizes to the nucleus in SH-SY5Ys: SH-SY5Y cells were treated with either 2.5μM OlA or DMSO for 24 hours. Cells were also treated with 5μM MG132 for 16 hours. SH-SY5Ys were fractionated using an Abcam mitochondrial isolation kit for cultured cells (A) or as described previously by Mirzoeva and Petrini (B)9. Both fractionations isolated Tot (total), Cyto (cytoplasmic), Mito (mitochondrial) and Nuc (nuclear) fractions. ATP5α (α subunit of ATP Synthase) is the mitochondrial marker. Lamin B1 (component of nuclear matrix) is the nuclear marker.

A

B

43

3.3 Endogenous Pβ associates with chromatin in SH-SY5Ys

Civitarese et. al. have shown that transfection of naive synthetic Pβ peptide in

mouse cardiomyocytes resulted in transcriptional upregulation of mitochondrial

biogenesis genes, PGC1β and NRF1; mitochondrial fusion genes, MFN1, MFN2, and

OPA1; and PARL itself180. Combined with multiple reports of Pβ nuclear localization, we

and others have hypothesized that Pβ peptide may act as transcriptional upregulator to

activate mitochondrial biogenesis in response to mitochondrial damage. To assess

whether Pβ’s suggested role in nuclear mitochondrial gene expression could occur

directly at the level of DNA, I determined whether Pβ associates with chromatin.

Initially, I aimed to test Pβ chromatin association in HEK293s transiently

transfected with WT PARL and treated with 5μM OlA or DMSO for 24 hours. HEK293s

were subsequently fractionated to obtain nuclear fractions. Chromatin-associated

proteins were eluted from nuclear fractions by DNase I incubation, as previously

documented191. The chromatin-associated fraction was verified by the selective

enrichment of histone octamer subunit H3 and the disenrichment of nuclear structural

protein and insoluble nuclear pellet marker Lamin B1, mitochondrial marker ATP5α, and

cytosolic marker Tubulin. In HEK293s, overexpressed Pβ largely localized to the insoluble

nuclear pellet fraction, suggesting that overexpressed Pβ does not associate with

chromatin (Fig. 3-4). As overexpression studies may be prone to artefactual

mislocalization, I next aimed to determine whether endogenous Pβ associates with

chromatin in SH-SY5Ys.

44

SH-SY5Ys were treated with 5μM OlA or DMSO control for 24 hours and 5μM

MG132 for 16 hours to aid Pβ visualization. I then fractionated cells to determine

chromatin association by DNase I incubation, as previously described. Contrary to data

obtained from overexpression studies in HEK293s, endogenous Pβ was solely detected

in the chromatin-associated fraction (Fig. 3-5A). In line with previous fractionations, Pβ

chromatin association was comparable in DMSO- and 5μM OlA-treated SH-SY5Ys. To

further validate this result, I conducted a second independent fractionation that isolates

chromatin-associated proteins by acid extraction192. SH-SY5Ys were treated with DMSO

Figure 3-4: Overexpressed Pβ does not associate with chromatin in HEK293s:

HEK293 cells were transiently transfected with PARL-FLAG and treated with either 2.5μM

Oligomycin (OlA) or DMSO for 24 hours. HEK293s were fractionated as previously

described by Mirzoeva and Petrini with the additional step of DNase I incubation. The

fractionation resulted in a Tot (total) fraction; a TS (triton soluble) fraction containing

cytosolic and mitochondrial proteins; a DS (DNase I soluble) fraction containing

chromatin-associated proteins; and an NP (nuclear pellet) fraction containing nuclear

DNase I insoluble proteins. ATP5α (α subunit of ATP Synthase) is the mitochondrial

marker. H3 (subunit of histone octamer) is the chromatin-associated marker. Lamin B1

(component of nuclear matrix) is the nuclear marker.

45

or 5μM OlA for 24 hours and MG132 for 16 hours. This fractionation also isolated

nucleoplasmic proteins whose fraction was validated by the enrichment of Aly, a nuclear

export factor196, and disenrichment of other markers: cytosolic Tubulin, mitochondrial

ATP5α, chromatin-associated H3, and the nuclear structural protein, Lamin B1. In

agreement with the previous chromatin fractionation, Pβ was highly enriched in the

chromatin-associated fraction, regardless of presence of mitochondrial stress (Fig. 3-5B).

Taken together, these results advance studies establishing Pβ nuclear localization by

demonstrating that endogenous Pβ peptide associates with chromatin in the nucleus and

may act at the level of transcription to regulate mitochondrial biogenesis.

46

Figure 3-5: Endogenous Pβ associates with chromatin in SH-SY5Ys: A SH-SY5Y

cells were treated with 5μM OlA or DMSO for 24 hours. Cells were also treated with 5μM

MG132 for 16 hours. SH-SY5Ys were fractionated as previously described by Mirzoeva

and Petrini with the additional step of DNase I incubation. The fractionation resulted in a

Tot (total) fraction; a TS (triton soluble) fraction containing cytosolic and mitochondrial

proteins; a DS (DNase I soluble) fraction containing chromatin-associated proteins; and

an NP (nuclear pellet) fraction containing nuclear DNase I insoluble proteins. B A second

fractionation isolating chromatin-associated proteins was conducted on SH-SY5Ys

treated with 5μM OlA or DMSO for 24 hours and MG132 for 16 hours, as previously

described191. The fractionation resulted in a Cyto (cytoplasmic) fraction; a Nuc Plas

(nucleoplasmic) fraction; a Chr (chromatin-associated) fraction; and a Nuc Pellet (nuclear

pellet fraction). ATP5α is the mitochondrial marker. H3 is the chromatin-associated

marker. Lamin B1 is the nuclear pellet marker. Tubulin (major component of cytoskeleton)

is the cytosolic marker. Aly (mRNA export factor) is the nucleoplasmic marker.

B

A

A

B

47

3.4 MG132 does not affect Pβ expression or localization

Our lab has previously shown that endogenous PARL undergoes β cleavage and

subsequent Pβ expression upon mitochondrial stress in SH-SY5Ys (Fig. 3-2)179.

However, as shown in sections 3.2 and 3.3, results in this thesis found no difference in

Pβ production in the presence or absence of OlA, a mitochondrial stressor, at

concentrations that were previously shown to be sufficient and necessary for PARL β

cleavage. One hypothesis is that this incongruity may be due to incubation with MG132,

a common proteasome inhibitor, to increase Pβ stability and detection. It is possible that

treating cells with 5μM MG132 for 16 hours may indirectly cause mitochondrial stress and

subsequent β cleavage and Pβ production. This is supported by previous studies

reporting observations of mitochondrial stress with prolonged treatment of MG132197–200.

Indeed, Maharjan et. al. have shown that an 8 hour treatment with 10μM MG132 in

Chinese hamster ovary cells resulted in loss of ΔΨm and increased mitochondrial ROS200.

To determine whether MG132 treatment affected Pβ production, I treated SH-

SY5Ys with 5μM OlA or DMSO for 24 hours and 5μM MG132 or DMSO for 16 hours. To

test whether PARL β cleavage would increase with additional mitochondrial stress, I also

treated SH-SY5Ys with 20μM OlA for 24 hours and 5μM MG132 for 16 hours. Chromatin

fractionations were subsequently conducted on treated cells. MG132 treatment did not

affect Pβ detection, as previously suggested, nor did it affect Pβ production as I had

hypothesized (Fig. 3-6). Thus, future studies of endogenous Pβ in SH-SY5Ys should omit

MG132 treatment. In agreement with section 3.3, detected Pβ was heavily enriched in

the chromatin-associated fraction regardless of the presence or absence of mitochondrial

stress when compared to the chromatin-associated fraction control, H3 (Fig. 3-6).

48

Additionally, there was no noticeable difference in Pβ detection with the added

mitochondrial stress in the form of 20μM OlA in comparison to 5μM OlA or DMSO control.

Figure 3-6: MG132 does not affect Pβ detection or localization in SH-SY5Ys: SH-

SY5Ys were treated with 5μM OlA, 20μM OlA, or DMSO for 24 hours. Cells were also

treated with 5μM MG132 or DMSO for 16 hours. SH-SY5Ys were fractionated as

previously described by Mirzoeva and Petrini to obtain a TS (triton soluble) fraction

containing cytoplasmic and mitochondrial proteins and DS (DNase soluble) fraction

containing chromatin-associated proteins. ATP5α is the mitochondrial marker. H3 is the

chromatin-associated marker. Actin (major component of cytoskeleton) is the cytosolic

marker.

49

3.5 Endogenous PARL β cleavage occurs in absence

of mitochondrial stress in SH-SY5Ys

Previously, our lab has shown that PARL β cleavage is virtually undetectable in

SH-SY5Ys without mitochondrial stress whereas 2.5μM OlA for 24 hours is sufficient to

induce cleavage (Fig. 3-2)179. However, my results presented thus far have consistently

shown that Pβ, a product of PARL β cleavage, is easily detected in the absence of stress.

Furthermore, Pβ detection is comparable in DMSO, 2.5μM, 5μM, 10μM, and 20μM OlA-

treated conditions. These concentrations are more than sufficient to cause mitochondrial

stress as 1μM OlA treatment in undifferentiated SH-SY5Ys inhibits mitochondrial

respiration201. These results suggest that Pβ production in SH-SY5Ys is insensitive to

mitochondrial stress. As SH-SY5Ys are particularly susceptible to cell line changes, I

hypothesized that PARL β cleavage may be altered in current SH-SY5Ys in comparison

to published data from our group180.

To compare PARL β cleavage in SH-SY5Ys, I treated cells with 5μM OlA or control

DMSO for 24 hours. As previously described179, endogenous PARL was then

immunoprecipitated from cells using an antibody specific to the C-terminus of PARL,

which is capable of detecting full length and N-terminally-cleaved forms of PARL. PARL

immunoprecipitation (IP) is necessary to detect full-length PARL and β PARL and to

decrease relative background. A parallel IP was conducted without PARL antibody to

control for possible nonspecific interactions. As expected, no bands were detected in this

negative control (Fig 3-7). Contrary to previously published results but congruous with

fractionations conducted in this thesis, β PARL was reliably detected in DMSO-treated

SH-SY5Ys, indicating that PARL β cleavage occurs constitutively in the absence of

50

mitochondrial stress (Fig. 3-7). Additionally, β cleavage was comparable in DMSO and

5μM OlA conditions, indicating that PARL β cleavage is not responsive to mitochondrial

stress in SH-SY5Ys (Fig. 3-7).

Figure 3-7: Endogenous PARL β cleavage occurs in the absence of mitochondrial

stress in SH-SY5Ys: SH-SY5Ys were treated with 5μM OlA or DMSO for 24 hours. PARL

was immunoprecipitated (IP) to increase signal. PARL β cleavage was monitored by ratio

of full length PARL (upper band) to β PARL (lower band). ATP5α is the loading control.

51

Chapter 4

CONCLUSIONS & FUTURE DIRECTIONS

4.1 Brief Summary of Results

Previous reports have proposed that the PARL β cleavage product Pβ localizes to

the nucleus and instigates mitochondrial biogenesis177,180. In this thesis I have supported

and extended these findings by demonstrating that free untagged Pβ, which originates in

the mitochondrial matrix, translocates to the nucleus. Importantly, I have established that

endogenous nuclear Pβ localization is maintained in SH-SY5Ys, a common PD model

cell line. A previous study demonstrated that Pβ may upregulate transcription of

mitochondrial biogenesis genes180. To this end, I have provided evidence that

endogenous Pβ interacts with chromatin in the nucleus, which suggests that Pβ affects

nuclear mitochondrial gene expression transcriptionally, although it is unclear whether

this interaction is direct or indirect. Additionally, I have shown that MG132, a proteasome

inhibitor, is not required to stabilize endogenous Pβ in SH-SY5Ys as previously

suggested. Finally, I demonstrated that PARL undergoes β cleavage in current SH-SY5Ys

without the addition of mitochondrial stress, contrary to previous reports179. Together,

these data support the hypothesis that the small mitochondrial peptide Pβ acts as a

transcriptional regulator by demonstrating that endogenous Pβ stably translocates to the

nucleus where it associates with chromatin.

52

Figure 4-1: Model of PARL coordination of mitophagy and mitochondrial

biogenesis: In response to mitochondrial stress, PARL is dephosphorylated and β

cleavage occurs, resulting in β PARL and Pβ. β PARL’s reduced proteolytic activity for

PINK1 results in PINK1 accumulation on damaged mitochondria and initiation of

mitophagy prior to global depolarization. Conversely, Pβ relocalizes from the

mitochondrial matrix to the nucleus where it associates with chromatin to instigate

mitochondrial biogenesis by upregulation of mitochondrial genes, including PGC-1β,

NRF1, and MFN1/2.

53

4.2 Model: PARL as a Coordinator of Mitophagy and

Mitochondrial Biogenesis The coordinated regulation of mitophagy and mitochondrial biogenesis, two

processes that control overall mitochondrial mass in the cell, is critical to maintain both

mitochondrial and cellular health. Our group proposes that through regulated cleavage of

the IMM intramembrane protease, PARL synchronistically activates mitochondrial

biogenesis and mitophagy in response to mitochondrial stress (Fig.4-1).

In healthy, polarized mitochondria, PARL cleaves PINK1 in the IMM, which results

in subsequent PINK1 cytoplasmic relocalization and rapid proteasomal degradation77–80.

The current understanding is that PARL is not involved with the initiation of PINK1/Parkin-

mediated mitophagy as PINK1 import to the IMM is disrupted by mitochondrial

depolarization23,76,77. However, we have previously proposed that PARL may initiate

PINK1/Parkin-mediated mitophagy prior to mitochondrial depolarization179. Our group has

shown that PARL β cleavage is sensitive to various mitochondrial stresses, including ATP

depletion and ROS production179. β PARL, the N-terminally cleaved product of β

cleavage, has reduced catalytic efficiency for PINK1 and instigates mitochondrial

fragmentation, a necessary primer for mitphagy78,179. In our model, increased β PARL

production in response to mitochondrial stress leads to less efficient PINK1 cleavage.

Inefficient PINK1 cleavage results in PINK1 OMM accumulation and consequent

mitophagic initiation prior to global mitochondrial depolarization (Fig.4-1).

The other product of PARL β cleavage, the 25 amino acid peptide Pβ, has also

been proposed to play a role in mitochondrial biogenesis177,180. Treatment of human

myotubes with Pβ resulted in upregulation of mitochondrial biogenesis and mitochondrial

54

fusion genes and increased mitochondrial mass180. Pβ has been proposed to function in

the nucleus, as suggested by two studies determining Pβ-GFP localization177,180. My

thesis supports these studies by demonstrating that untagged, endogenous Pβ stably

translocates from the mitochondrial matrix to the nucleus. More excitingly, data indicates

that Pβ associates with chromatin, which suggests that Pβ’s mechanism of regulating

mitochondrial biogenesis occurs at the transcriptional level (Fig.4-1).

Thus, we propose that in response to mitochondrial stress, PARL β cleavage

simultaneously activates mitophagy via β PARL and mitochondrial biogenesis via Pβ to

ensure mitochondrial turnover to maintain a healthy mitochondrial network.

4.3 Perspectives

4.3.1 Pβ Translocates to the Nucleus

Two studies have shown that Pβ-GFP localizes to the nucleus177,180. These studies

are partially confounded by the use of GFP fusion constructs, as GFP itself has been

documented to localize to the nucleus181, and the usage of constructs expressed in the

cytosol, as it is unclear whether Pβ is capable of exiting mitochondria. These issues were

circumvented by expressing mitochondrial-localized PARL constructs that produce

untagged Pβ upon β cleavage. Fractionation data indicates that Pβ, which is

physiologically produced in the mitochondrial matrix, is enriched in the nuclear fraction,

thus corroborating previously published studies. More excitingly, further experiments

showed that endogenously-expressed Pβ also localizes to the nucleus, indicating that

this process is physiologically conserved. Previous studies from our group suggests that

endogenous Pβ is rapidly degraded by the proteasome. In contrast, my data

55

demonstrates that MG132, a proteasome inhibitor, is dispensable for endogenous Pβ

detection. This suggests that Pβ is not significantly degraded by the proteasome and

instead largely accumulates in the nucleus; however it does not negate the possibility that

Pβ is a substrate for other cytoplasmic peptidases.

4.3.2 Pβ Associates with Chromatin

One report in 2010 by Civitarese et al implicates Pβ in mitochondrial biogenesis,

although its putative mechanism of action has not yet been elucidated180. Data in this

thesis indicates that Pβ peptide associates with chromatin, which suggests that Pβ

transcriptionally regulates mitochondrial biogenesis. Historically, small peptides have

been observed to strongly associate with DNA in spite of chromatin deproteinization with

NaCl, SDS, chloroform/ isoamyl alcohol and phenol202,203. Interestingly, Pβ chromatin

association also appears to be fairly strong as lysis protocols previously documented to

solubize various DNA-bound complexes were unable to extract Pβ from chromatin204–206.

These results immediately raise multiple questions, including what the effect of this

interaction is on immediate gene transcription. One study demonstrated that global

peptide removal from DNA by alkaline extraction resulted in increased in vitro

transcription in comparison to deproteinized DNA preparations202. This study suggests

that the majority of chromatin-bound peptides act in an inhibitory fashion. However, the

majority chromatin-bound peptides in this study are suggested to be approximately

1kDa202, smaller than the 25 amino acid Pβ. If Pβ acts as a transcriptional repressor, it

may increase expression of mitochondrial biogenesis and fusion genes by inhibiting

mitochondrial biogenesis repressors. However, it is also possible that Pβ directly binds

56

chromatin to act as an activator or interacts with an undetermined protein complex to

influence gene expression.

4.3.3 Experiments in SH-SY5Ys Produce Variable Results

Our group has previously demonstrated that PARL β cleavage is tightly controlled

in SH-SY5Ys; it is undetectable by immunoblotting unless induced by various

mitochondrial stresses179. Titration of the ATP synthase inhibitor, OlA, demonstrated that

concentrations as low as 2.5μM were sufficient to trigger PARL β cleavage179. In contrast,

under the same conditions and with the same reagents, I detected equivalent amounts of

PARL β cleavage in SH-SY5Ys treated with or without 5μM OlA. A notable difference

between the two experiments is the source of SH-SY5Ys. The tumour-derived SH-SY5Ys

are notoriously susceptible to cell line changes due to factors including passage number,

confluence, differentiation, and differences in subculturing. A prominent consideration

with SH-SY5Ys is the presence of two morphologically distinct phenotypes that were

inherited from the parental SK-N-SH cell line: neuroblast-like cells and epithelial-like

cells207–209. Another consideration is the existence of both adherent and floating cell

populations209. Both of these characteristic ratios of cell populations may be drastically

altered with differing subculturing methods or due to drift over time. Of note, both

subculturing methods used by our group previously and in this thesis maintained both

floating and adherent cell populations. Nevertheless, if difficulties in reproducing results

in SH-SY5Ys are due to tendency of the cell line to change over time, alternative cell

models should be evaluated to ensure project continuity.

One cell model that should not be pursued is the overexpression system in

HEK293s. Data in this thesis indicates that overexpressed Pβ does not associate with

57

chromatin upon nuclear translocation, as endogenous Pβ in SH-SY5Ys does, but instead

accumulates in the insoluble nuclear fraction in HEK293s. This difference may be due to

disparity in the two cell lines’ expression profiles or in expression levels of Pβ. If it is the

former, this may suggest that Pβ chromatin association is cell line-specific and/or

dependent on other cell-specific actors to mediate its association. If it is the latter, this

may suggest that Pβ chromatin association is saturable.

4.3.4 Pβ: a Peptide with Purpose?

As a potential regulator of mitochondrial biogenesis, Pβ joins the small but recently

growing group of peptides implicated in mitochondrial quality control and homeostasis210–

212. One of the founding members of this group is humanin, a 21 or 24 amino acid peptide

(depending on the location of its translation) expressed from an open reading frame

(ORF) in the mitochondrial 16S rRNA, has been demonstrated to be anti-apoptotic, anti-

inflammatory, and neuroprotective by inhibiting various protein-binding partners210,213,214.

Given their roles in maintaining mitochondrial homeostasis, humanin and other

mitochondrial peptides are targets for therapeutic development against various diseases

and conditions including neurodegeneration and diabetes215,216.

Pβ is not the first peptide produced by proteolysis that has been proposed to

regulate transcription. Amyloid-β42 (Aβ42), a 44 amino acid product of amyloid precursor

protein (APP) proteolysis and a hypothesized central player in Alzheimer’s disease (AD)

pathogenesis, has been demonstrated to localize to the nucleus and is suggested to

directly associate with gene promoters to repress their expression217–219. While Pβ is not

pathogenic, it will be interesting to determine whether any parallels in transcriptional

regulation may be identified in the future.

58

4.4 Future Directions

Work presented in this thesis further characterizes Pβ, a product of PARL β

cleavage, by providing a foundation to elucidate its putative mechanism of action in

affecting mitochondrial biogenesis, a pathway that can replace damaged mitochondria

degraded by mitophagy. However, the work presented in this thesis proposes more

questions than it has answered. Presented below are some of the many questions that

remain.

4.4.1 What is the Phosphatase Responsible for β Cleavage?

The mitochondrial matrix kinase, PDK2, was identified as the kinase responsible

for the phosphorylation of PARL’s N-terminus to inhibit PARL β cleavage. However, the

phosphatase responsible for lifting these repressive post-translational modifications

remains unknown. PARL’s putative phosphatase is a key regulator of PARL β cleavage

and Pβ production, and by extension, a key regulator in mitochondrial quality control and

homeostasis. The most obvious candidate is Pyruvate Dehydrogenase Phosphatase

(PDP), which reverses PDK phosphorylation of Pyruvate Dehydrogenase220. To date, two

isoforms of PDP have been identified: PDP1, which is most highly expressed in the heart,

brain, and testis; and PDP2, which is most highly expressed in the heart, liver, and

kidney220–222. It is possible that like PDK2, only one isoform is responsible for PARL

dephosphorylation. Another possibility is that another unidentified phosphatase located

in the matrix or IMM dephosphorylates PARL. To identify the PARL phosphatase,

matrix/IMM phosphatases may be systematically overexpressed and cells may be

monitored for increased PARL β cleavage by western blot. Phosphatases whose altered

expression affects PARL β cleavage may be validated for PARL interaction by

59

coimmunoprecipitation (co-IP), similar to Shi and McQuibban’s approach to identify

PARL’s kinase, PDK2179.

4.4.2 What Allows Pβ Export from Mitochondria?

As Pβ’s effect on mitochondrial biogenesis likely necessitates its nuclear

localization, mitochondrial Pβ retention or export may serve as an additional layer of

regulation on Pβ activity. As Pβ possesses six highly conserved positively charged

residues, it is an extremely poor candidate for unfacilitated diffusion across the highly

impermeable IMM and almost certainly requires a dedicated transporter. Two identified

putative peptide exporters in the IMM are ATP-binding cassette (ABC) B8 (ABCB8) and

ABCB10, which belong to a highly heterogeneous subfamily of ABC half transporters

involved in intracellular trafficking and compartmentalization of peptides223. ABCB10 and

its orthologues are the better studied of the pair. Studies have shown that the ABCB10

orthologues, multi-drug resistance-like (MDL1) from Saccharomyces cerevisiae and HAF-

1 from Caenorhabditis elegans, are conserved in their function as mitochondrial peptide

exporters224–227. Peptides exported by the yeast MDL1 are estimated to be approximately

0.6-2.1 kDa, the upper limit of which is comparable to Pβ’s expected molecular weight224.

To determine whether ABCB8 and/or ABCB10 facilitates Pβ efflux from mitochondria,

either transporter may be knocked down by siRNA or knocked out by CRISPR/Cas9 gene

editing. Resultant Pβ localization may be observed by subcellular fractionation and

western blot.

Data from this thesis and others show that Pβ is strongly detected in the nuclear

fraction in HEK293s under all conditions except when treated with the highest

concentrations of OlA, which depletes mitochondrial ATP. Under this condition, reduced

Pβ production was observed despite increased PARL β cleavage. We hypothesize that

60

the paradoxical reduction in Pβ detection at high levels of mitochondrial stress reduces

Pβ-mediated mitochondrial biogenesis in response to significant mitochondrial damage,

in part because mitochondrial biogenesis is a highly energy-consuming process. If ATP-

dependent ABCB8/10 are Pβ exporters, nuclear Pβ reduction may be a result of impaired

efflux from the mitochondrial matrix due to mitochondrial ATP depletion followed by Pβ

degradation by proteases in the matrix.

Mitochondrial matrix peptide export is largely focused on traversing the IMM.

Peptides are hypothesized to exit mitochondria by diffusion through OMM porins or TOM,

although these mechanisms require clarification223,228–230. As a mitochondrial peptide, Pβ

may be exported across the OMM in a similar fashion.

4.4.3 Does Pβ Undergo any Post-Cleavage Modifications?

A consistent observation when visualizing Pβ by western blot is the recognition of

two specific bands. Importantly, these bands ran at a similar molecular weight to purified

phosphorylated and unphosphorylated Pβ (Fig.4-2). This led us to speculate that Pβ

exists in two populations in the nucleus – phosphorylated and unphosphorylated. When

A B

Figure 4-2: Pβ doublet and phosphorylated/unphosphorylated Pβ run at similar molecular weights: A Western blot of PARL β cleavage and Pβ production in HEK293s expressing WT PARL or β PARL. A Pβ doublet is detectable in cells expressing WT PARL, which undergoes β cleavage, but not in cells expressing β PARL, which does not undergo β cleavage. B Western blot of purified synthetic phosphorylated and unphosphorylated Pβ, which run at a similar molecular weight as the Pβ doublet detected in cell lysates.

61

attached to PARL, Pβ’s phosphorylation sites, S65, T69, S70, additively inhibit PARL β

cleavage178. Thus, we hypothesize that putative Pβ phosphorylation likely occurs post-

cleavage. To determine whether the upper Pβ-specific band is due to phosphorylation,

cell lysates may be dephosphorylated by incubation with non-specific phosphatases such

as calf intestinal alkaline phosphatase (CIAP) or protein phosphatase-1 (PP1) prior to

SDS-PAGE and monitored for decrease of the upper Pβ-specific band by western blot.

Alternatively, PARL constructs where phosphorylation sites have been mutated to non-

phosphorylatable alanine may be generated and monitored by western blot to determine

whether Pβ produced by these constructs is visualized as a doublet or a singlet. As a

more unbiased approach, Pβ may be immunoprecipitated from cell lysates prepared

using strong detergents and post-translational modifications may be identified by mass

spectrometry231,232.

If a subpopulation of Pβ is phosphorylated, an immediate concern, aside from the

identity of the putative kinase, is whether phosphorylation alters Pβ activity. To this end,

future experiments should include conditions where Pβ phosphorylation is inhibited. As

overexpression data in HEK293s differs from endogenous data in SH-SY5Ys, it would be

necessary to generate cell lines wherein PARL phosphorylation sites are mutated to

alanine rather than rely on overexpression systems. These missense mutations may be

generated via the CRISPR-Cas9 gene-editing system and homologous repair

incorporating templates containing our mutations of interest.

4.4.4 Does Pβ Interact with Other Proteins?

One method to determine Pβ mechanism and function is to identify its potential

protein interactors. As Pβ associates with chromatin, an immediate question is whether

this interaction is mediated by other proteins. While certain peptides are proposed to bind

62

directly to DNA to inhibit transcription, we cannot negate the possibility that Pβ’s putative

role in transcriptional regulation may be mediated by association with transcription

factors, modulators, scaffolds, or other proteins202,217,218. Ideally, Pβ interactors would be

identified by Pβ immunoprecipitation followed by mass spectrometry analysis (IP-MS).

However, I have been unable to successfully immunoprecipitate Pβ from chromatin-

associated fractions (data not shown). It is possible that the epitope that Pβ antibody

recognizes is sterically unavailable when Pβ is bound to its interactor. This likelihood is

increased due to Pβ’s comparatively small size. Alternatively, Pβ interactors may be

identified by affinity chromatography. Briefly, synthesized Pβ may be immobilized on

resin, followed by pull down assays with whole cell lysates. Eluted proteins may be

identified by MS and validated for physiological Pβ interaction by co-IP. To determine

what residues or post-translational modifications mediate these interactions, parallel

experiments may be conducted with Pβ synthesized with mutated key residues or

additional modifications.

Another method to identify Pβ interactors involves size exclusion chromatography

(SEC) in cells where Pβ is expressed or abolished. Proteins in SEC fractions where Pβ

is expected to be eluted may be identified by MS and compared to identify putative Pβ

interactors, which would then be validated by co-IP. A benefit of this approach in

comparison to affinity chromatography is the likelier identification of physiological

interactors.

In addition to identifying putative facilitators of Pβ chromatin association, both

suggested methods should recognize interactors that may be involved in Pβ transport

and stability in the mitochondria, cytosol and nucleus. Depending on the sensitivity of

63

these assays, Pβ modulators, such as its putative kinase or phosphatase, may also be

identified.

4.4.5 What Genes Associate with Pβ?

Another immediate goal that arises from observations of Pβ chromatin association

is to identity Pβ-binding sequences. While human myotubes transfected with Pβ showed

increased expression of select mitochondrial biogenesis and fusion genes (PGC-1β,

NRF1, MFN1/2), it is unclear whether upregulation of these genes is due to direct or

indirect activation. To identify Pβ-associated genes, chromatin immunoprecipitation

(ChIP) experiments may be conducted to identify Pβ-associated DNA sequences via

high-throughput sequencing (ChIP-seq). This data will help to determine Pβ DNA-binding

specificity and characterize possible Pβ consensus sequences or motifs. Importantly, the

category of associated genes will shed light on Pβ’s control of mitochondrial biogenesis.

Furthermore, this data will determine whether Pβ regulates multiple mitochondrial

biogenesis genes or mediates their upregulation indirectly by associating with master

regulator genes like PGC-1β.

Of note, I was unable to immunoprecipitate endogenous Pβ from SH-SY5Ys

treated with 0.75% or 1% formaldehyde using a protocol adapted from Donner et al. using

Pβ-specific antibody233. A possible solution is to express a tagged version of Pβ, such as

Pβ-GFP, which has been demonstrated to localize to the nucleus. Using this system, Pβ

may be immunoprecipitated by its epitope tag. Importantly, tagged Pβ must be validated

for nuclear localization and chromatin association as tags may interfere with these

activities. For instance, Pβ tagged with 3XFLAG at the N- or C-terminus is exclusively

cytosolic (data not shown) and thus is a poor construct to characterize Pβ.

64

Chromatin fractionations and ChIP experiments are not reliable methods to

establish direct Pβ DNA binding, despite novel proposed bioinformatics methods to

distinguish direct and indirect interactions from ChIP-seq data218. To determine whether

Pβ can directly associate with DNA, an in vitro electrophoretic mobility shift assay (EMSA;

also known as gel shift assay) may be conducted with synthesized Pβ and labelled DNA

probes whose sequences are identified by ChIP-Seq as putative Pβ-associated sites. If

Pβ directly associates with these sequences, a band shift should be apparent when both

Pβ and the probe are present compared to the probe alone.

If Pβ-DNA direct interaction is verified by EMSA, this technique will be a powerful

tool to identify the core amino acid and nucleotide residues responsible for Pβ chromatin

association. As both Pβ peptide and the DNA probe would be synthesized, both may be

systematically mutated and tested by EMSA for changes in band shifts. Additional post-

translational modifications, such as phosphorylation, may also be manipulated.

4.4.6 What is the Effect of Pβ on Mitochondrial Biogenesis?

Although Civitarese et al. have identified a handful of mitochondrial genes whose

increased expression is dependent on Pβ, the full scope of Pβ-mediated gene expression

remains to be elucidated. To better clarify Pβ’s role in mitochondrial biogenesis, we

propose to employ RNA-sequencing (RNA-Seq), which is a less biased approach to

compare transcriptome profiles of Pβ-expressing and Pβ-deficient cells. As

overexpressed Pβ does not appear to associate with chromatin, I intend to pursue this

endeavor in cells expressing endogenous levels of Pβ. For comparison, cell lines with

abolished Pβ expression must be established. Using the CRISPR/Cas9 gene-editing

system combined with homologous repair using designed templates, PARL β cleavage,

and thus Pβ production, may be abolished by introducing the PD-linked substitution S77N

65

(generating full length PARL) or by deleting Pβ sequence in-frame (generating β-PARL).

Alternatively, mutations of Pβ’s putative NLS (R54T, K55S, R58T, K59S177) may be

introduced to prevent nuclear Pβ localization while simultaneously maintaining PARL β

cleavage and protease activity. The transcriptome profiles of these cell lines in

comparison to WT cells will also help delineate transcriptional changes due to Pβ

production versus PARL activity. Upregulated mitochondrial gene transcripts should be

validated for consequent increases in mitochondrial protein expression by western blot.

In turn, Pβ-dependent increases in mitochondrial biogenesis should be verified by various

mitochondrial biogenesis assays as described by Civitarese et al180.

4.5 Conclusions

The importance of PARL β cleavage in mitochondrial and cellular health is

emphasized by the PD-linked mutation, S77N, which abolishes this N-terminal cleavage

event and expression of its products. One of these products, the 25 amino acid peptide

Pβ, is suggested to localize to the nucleus to regulate mitochondrial biogenesis. In this

thesis, I have demonstrated that endogenous Pβ is exported from mitochondria and

accumulates in the nucleus. Additionally, data suggests that Pβ associates with

chromatin, offering a potential mechanism of mitochondrial biogenesis regulation. These

exciting advances in characterizing Pβ peptide are accompanied by new, pressing

questions whose imminent answers will shed light on coordination of mitochondrial quality

control pathways to maintain mitochondrial health, and ultimately cellular and human

health.

66

REFERENCES

1. Ernster, L. & Schatz, G. Mitochondria: a historical review. J. Cell Biol. 91, 227s–

255s (1981).

2. Friedman, J. R. & Nunnari, J. Mitochondrial form and function. Nature 505, 335–343 (2014).

3. Camilleri, A. & Vassallo, N. The centrality of mitochondria in the pathogenesis and treatment of Parkinson’s disease. CNS Neurosci. Ther. 20, 591–602 (2014).

4. Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. Molecular biology of the cell (4th ed.). (Garland Science, 2003).

5. Bonen, L., Cunningham, R.S., Gray, M.W. & Doolittle, W.F. Wheat embryo mitochondrial 18S ribosomal RNA: evidence for its prokaryotic nature. Nucleic Acids Res. 4, 663–671 (1977).

6. Yang, D., Oyaizu, Y., Oyaizu, H., Olsen, G.J. & Woese, C.R. Mitochondrial origins. Proc. Natl. Acad. Sci. U. S. A. 82, 4443–4447 (1985).

7. Schwartz, W., & Lynn Margulis, Origin of eukaryotic cells. Evidence and research implications for a theory of the origin and evolution of microbial, plant, and animal cells on the Precambrian earth. Journal of Basic Microbiology. 13 (2), (1973).

8. Archibald, J.M. Endosymbiosis and eukaryotic cell evolution. Curr. Biol. 25, R911–R921 (2015).

9. Taanman, J.W. The mitochondrial genome: structure, transcription, translation and replication. Biochim. Biophys. Acta BBA - Bioenerg. 1410, 103–123 (1999).

10. Hällberg, B.M. & Larsson, N.G. Making proteins in the powerhouse. Cell Metab. 20, 226–240 (2014).

11. Gustafsson, C.M., Falkenberg, M. & Larsson, N.G. Maintenance and expression of mammalian mitochondrial DNA. Annu. Rev. Biochem. 85, 133–160 (2016).

12. Kayal, E., Bentlage, B., Collins, A. G., Kayal, M., Pirro, S. & Lavrov, D. V. Evolution of linear mitochondrial genomes in medusozoan cnidarians. Genome Biol. Evol. 4, 1–12 (2012).

13. Anderson, S., Bankier, A.T., Barrell, B.G., de Bruijn, M.H., Coulson, A.R., Drouin, J., Eperon, I.C., Nierlich, D.P., Roe, B.A., Sanger, F., Schreier, P.H., Smith, A.J., Staden, R. & Young, I.G. Sequence and organization of the human mitochondrial genome. Nature 290, 457–465 (1981).

14. Palade, G.E. The fine structure of mitochondria. Anat. Rec. 114, 427–451 (1952).

15. Palade, G.E. An electron microscope study of the mitochondrial structure. J. Histochem. Cytochem. Off. J. Histochem. Soc. 1, 188–211 (1953).

67

16. Sjöstrand, F.S. The ultrastructure of the outer segments of rods and cones of the eye as revealed by the electron microscope. J. Cell. Comp. Physiol. 42, 15–44 (1953).

17. Sjostrand, F.S. Electron microscopy of mitochondria and cytoplasmic double membranes. Nature 171, 30–32 (1953).

18. Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., and Walter, P. The Mitochondrion Molecular biology of the cell (4th ed.). (Garland Science, 2003).

19. Kühlbrandt, W. Structure and function of mitochondrial membrane protein complexes. BMC Biol. 13, (2015).

20. Vögtle, F.N., Wortelkamp, S., Zahedi, R.P., Becker, D., Leidhold, C., Gevaert, K., Kellermann, J., Voos, W., Sickmann, A., Pfanner, N. & Meisinger, C. Global Analysis of the Mitochondrial N-Proteome Identifies a Processing Peptidase Critical for Protein Stability. Cell 139, 428–439 (2009).

21. Chacinska, A., Koehler, C.M., Milenkovic, D., Lithgow, T. & Pfanner, N. Importing mitochondrial proteins: machineries and mechanisms. Cell 138, 628–644 (2009).

22. Paradies, G., Paradies, V., De Benedictis, V., Ruggiero, F.M. & Petrosillo, G. Functional role of cardiolipin in mitochondrial bioenergetics. Biochim. Biophys. Acta BBA - Bioenerg. 1837, 408–417 (2014).

23. Kulawiak, B., Höpker, J., Gebert, M., Guiard, B., Wiedemann, N. & Gebert, N. The mitochondrial protein import machinery has multiple connections to the respiratory chain. Biochim. Biophys. Acta BBA - Bioenerg. 1827, 612–626 (2013).

24. Akram, M. Citric acid cycle and role of its intermediates in metabolism. Cell Biochem. Biophys. 68, 475–478 (2014).

25. Sorriento, D., Pascale, A.V., Finelli, R., Carillo, A.L., Annunziata, R., Trimarco, B. & Iaccarino, G. Targeting Mitochondria as Therapeutic Strategy for Metabolic Disorders. Sci. World J. 2014, (2014).

26. Mitchell, P. Coupling of phosphorylation to electron and hydrogen transfer by a chemi-osmotic type of mechanism. Nature 191, 144–148 (1961).

27. Mitchell, P. & Moyle, J. Estimation of membrane potential and pH difference across the cristae membrane of rat liver mitochondria. Eur. J. Biochem. 7, 471–484 (1969).

28. Higgins, G.C. & Coughlan, M.T. Mitochondrial dysfunction and mitophagy: the beginning and end to diabetic nephropathy? Br. J. Pharmacol. 171, 1917–1942 (2014).

29. Bhola, P.D. & Letai, A. Mitochondria – judges and executioners of cell death sentences. Mol. Cell 61, 695–704 (2016).

30. Tait, S.W.G. & Green, D.R. Mitochondrial regulation of cell death. Cold Spring Harb. Perspect. Biol. 5, (2013).

31. Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 35, 495–516 (2007).

68

32. Gross, A., Jockel, J., Wei, M.C. & Korsmeyer, S.J. Enforced dimerization of BAX results in its translocation, mitochondrial dysfunction and apoptosis. EMBO J. 17, 3878–3885 (1998).

33. Wei, M.C., Lindsten, T., Mootha, V.K., Weiler, S., Gross, A., Ashiya, M., Thompson, C.B. & Korsmeyer, S.J. tBID, a membrane-targeted death ligand, oligomerizes BAK to release cytochrome c. Genes Dev. 14, 2060–2071 (2000).

34. Tait, S.W.G. & Green, D.R. Caspase-independent cell death: leaving the set without the final cut. Oncogene 27, 6452–6461 (2008).

35. Government of Canada, S.C. Leading Causes of Death in Canada. (2012). at <http://www5.statcan.gc.ca/olc-cel/olc.action?ObjId=84-215-X&ObjType=2&lang=en&limit=0>.

36. Ryan, B.J., Hoek, S., Fon, E.A. & Wade-Martins, R. Mitochondrial dysfunction and mitophagy in Parkinson’s: from familial to sporadic disease. Trends Biochem. Sci. 40, 200–210 (2015).

37. Demetrius, L.A. & Simon, D.K. An inverse-Warburg effect and the origin of Alzheimer’s disease. Biogerontology 13, 583–594 (2012).

38. Villacé, P., Mella, R.M. & Kortazar, D. Mitochondria in the context of Parkinson’s disease. Neural Regen. Res. 12, 214–215 (2017).

39. Langston, J.W., Ballard, P., Tetrud, J.W. & Irwin, I. Chronic Parkinsonism in humans due to a product of meperidine-analog synthesis. Science 219, 979–980 (1983).

40. Burns, R.S., LeWitt, P.A., Ebert, M.H., Pakkenberg, H. & Kopin, I.J. The clinical syndrome of striatal dopamine deficiency. Parkinsonism induced by 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP). N. Engl. J. Med. 312, 1418–1421 (1985).

41. Bose, A. & Beal, M.F. Mitochondrial dysfunction in Parkinson’s disease. J. Neurochem. 139 Suppl 1, 216–231 (2016).

42. Liang, C.L., Wang, T.T., Luby-Phelps, K. & German, D.C. Mitochondria mass is low in mouse substantia nigra dopamine neurons: implications for Parkinson’s disease. Exp. Neurol. 203, 370–380 (2007).

43. Dauer, W. & Przedborski, S. Parkinson’s disease: mechanisms and models. Neuron 39, 889–909 (2003).

44. Marcillat, O., Zhang, Y., Lin, S.W. & Davies, K.J. Mitochondria contain a proteolytic system which can recognize and degrade oxidatively-denatured proteins. Biochem. J. 254, 677–683 (1988).

45. Soubannier, V., Rippstein, P., Kaufman, B.A., Shoubridge, E.A. & McBride, H.M. Reconstitution of mitochondria derived vesicle formation demonstrates selective enrichment of oxidized cargo. PLOS ONE 7, e52830 (2012).

46. Ding, W.X. & Yin, X.M. Mitophagy: mechanisms, pathophysiological roles, and analysis. Biol. Chem. 393, 547–564 (2012).

69

47. Lewis, M.R., & Lewis, W.H. Mitochondria (and other cytoplasmic structures) in tissue cultures. Developmental Dynamics. 17 (3), 339-401 (1915).

48. Twig, G. & Shirihai, O.S. The interplay between mitochondrial dynamics and mitophagy. Antioxid. Redox Signal. 14, 1939–1951 (2011).

49. Tanaka, A., Harwig, M., Xu, S., P Narendra, D., Suen, D.F., Karbowski, M. & Youle, R. Proteasome and p97 mediate mitophagy and degradation of mitofusins induced by Parkin. J. Cell Biol. 191, 1367–80 (2010).

50. Toyama, E. Q., Herzig, S., Courchet, J., Lewis, T.L., Losón, O.C., Hellberg, K., Young, N.P., Chen, H., Polleux, F., Chan, D.C. & Shaw, R.J. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Science 351, 275–281 (2016).

51. Ehses, S., Raschke, I., Mancuso, G., Bernacchia, A., Geimer, S., Tondera, D., Martinou, J.-C., Westermann, B., Rugarli, E.I. & Langer, T. Regulation of OPA1 processing and mitochondrial fusion by m-AAA protease isoenzymes and OMA1. J. Cell Biol. 187, 1023–1036 (2009).

52. Head, B., Griparic, L., Amiri, M., Gandre-Babbe, S. & Bliek, A.M. van der. Inducible proteolytic inactivation of OPA1 mediated by the OMA1 protease in mammalian cells. J. Cell Biol. 187, 959–966 (2009).

53. Gegg, M.E., Cooper, J.M., Chau, K.Y., Rojo, M., Schapira, A.H.V. & Taanman, J.W. Mitofusin 1 and mitofusin 2 are ubiquitinated in a PINK1/parkin-dependent manner upon induction of mitophagy. Hum. Mol. Genet. 19, 4861–4870 (2010).

54. Chan, N.C., Salazar, A.M., Pham, A.H., Sweredoski, M.J., Kolawa, N.J., Graham, R.L.J., Hess, S. & Chan, D.C. Broad activation of the ubiquitin–proteasome system by Parkin is critical for mitophagy. Hum. Mol. Genet. 20, 1726–1737 (2011).

55. Poole, A.C., Thomas, R.E., Yu, S., Vincow, E.S. & Pallanck, L. The mitochondrial fusion-promoting factor mitofusin is a substrate of the PINK1/parkin pathway. PLOS ONE 5, e10054 (2010).

56. Praefcke, G.J.K. & McMahon, H.T. The dynamin superfamily: universal membrane tubulation and fission molecules? Nat. Rev. Mol. Cell Biol. 5, 133–147 (2004).

57. Lee, J.E., Westrate, L.M., Wu, H., Page, C. & Voeltz, G.K. Multiple dynamin family members collaborate to drive mitochondrial division. Nature 540, 139–143 (2016).

58. Friedman, J.R., Lackner, L.L., West, M., DiBenedetto, J.R., Nunnari, J. & Voeltz, G.K. ER tubules mark sites of mitochondrial division. Science 334, 358–362 (2011).

59. Losón, O.C., Song, Z., Chen, H. & Chan, D.C. Fis1, Mff, MiD49, and MiD51 mediate Drp1 recruitment in mitochondrial fission. Mol. Biol. Cell 24, 659–667 (2013).

60. Pryde, K.R., Smith, H.L., Chau, K.Y. & Schapira, A.H.V. PINK1 disables the anti-fission machinery to segregate damaged mitochondria for mitophagy. J. Cell Biol. 213, 163–171 (2016).

70

61. Kageyama, Y., Hoshijima, M., Seo, K., Bedja, D., Sysa-Shah, P., Andrabi, S. A., Chen, W., Höke, A., Dawson, V. L., Dawson, T. M., Gabrielson, K., Kass, D. A., Iijima, M. & Sesaki, H. Parkin-independent mitophagy requires Drp1 and maintains the integrity of mammalian heart and brain. EMBO J. 33, 2798–2813 (2014).

62. Prudent, J., Zunino, R., Sugiura, A., Mattie, S., Shore, G. C. & McBride, H. M. MAPL SUMOylation of Drp1 stabilizes an ER/Mitochondrial platform required for cell death. Mol. Cell 59, 941–955 (2015).

63. Lemasters, J. J. Selective mitochondrial autophagy, or mitophagy, as a targeted defense against oxidative stress, mitochondrial dysfunction, and aging. Rejuvenation Res. 8, 3–5 (2005).

64. Palikaras, K., Daskalaki, I., Markaki, M. & Tavernarakis, N. Mitophagy and age-related pathologies: Development of new therapeutics by targeting mitochondrial turnover. Pharmacol. Ther. 178, 157–174 (2017).

65. McWilliams, T. G., Prescott, A. R., Montava-Garriga, L., Ball, G., Singh, F., Barini, E., Muqit, M. M. K., Brooks, S. P. & Ganley, I. G. Basal mitophagy occurs independently of PINK1 in mouse tissues of high metabolic demand. Cell Metab. 0, (2018).

66. Kitada, T., Asakawa, S., Hattori, N., Matsumine, H., Yamamura, Y., Minoshima, S., Yokochi, M., Mizuno, Y. & Shimizu, N. Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature 392, 605–608 (1998).

67. Valente, E. M., Abou-Sleiman, P. M., Caputo, V., Muqit, M. M. K., Harvey, K., Gispert, S., Ali, Z., Del Turco, D., Bentivoglio, A. R., Healy, D. G., Albanese, A., Nussbaum, R., González-Maldonado, R., Deller, T., Salvi, S., Cortelli, P., Gilks, W. P., Latchman, D. S., Harvey, R. J., Dallapiccola, B., Auburger, G. & Wood, N. W. Hereditary early-onset Parkinson’s disease caused by mutations in PINK1. Science 304, 1158–1160 (2004).

68. Fitzgerald, J. C. & Plun-Favreau, H. Emerging pathways in genetic Parkinson’s disease: autosomal-recessive genes in Parkinson’s disease--a common pathway? FEBS J. 275, 5758–5766 (2008).

69. Clark, I. E., Dodson, M. W., Jiang, C., Cao, J. H., Huh, J. R., Seol, J. H., Yoo, S. J., Hay, B. A. & Guo, M. Drosophila pink1 is required for mitochondrial function and interacts genetically with parkin. Nature 441, 1162–1166 (2006).

70. Park, J., Lee, S. B., Lee, S., Kim, Y., Song, S., Kim, S., Bae, E., Kim, J., Shong, M., Kim, J.-M. & Chung, J. Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by parkin. Nature 441, 1157–1161 (2006).

71. Yang, Y., Gehrke, S., Imai, Y., Huang, Z., Ouyang, Y., Wang, J.-W., Yang, L., Beal, M. F., Vogel, H. & Lu, B. Mitochondrial pathology and muscle and dopaminergic neuron degeneration caused by inactivation of Drosophila Pink1 is rescued by Parkin. Proc. Natl. Acad. Sci. U. S. A. 103, 10793–10798 (2006).

72. Greene, J. C., Whitworth, A. J., Kuo, I., Andrews, L. A., Feany, M. B. & Pallanck, L. J. Mitochondrial pathology and apoptotic muscle degeneration in Drosophila parkin mutants. Proc. Natl. Acad. Sci. U. S. A. 100, 4078–4083 (2003).

71

73. Narendra, D., Tanaka, A., Suen, D.F. & Youle, R. J. Parkin is recruited selectively to impaired mitochondria and promotes their autophagy. J. Cell Biol. 183, 795–803 (2008).

74. Kim, Y., Park, J., Kim, S., Song, S., Kwon, S.K., Lee, S.H., Kitada, T., Kim, J.M. & Chung, J. PINK1 controls mitochondrial localization of Parkin through direct phosphorylation. Biochem. Biophys. Res. Commun. 377, 975–980 (2008).

75. Exner, N., Treske, B., Paquet, D., Holmström, K., Schiesling, C., Gispert, S., Carballo-Carbajal, I., Berg, D., Hoepken, H.-H., Gasser, T., Krüger, R., Winklhofer, K. F., Vogel, F., Reichert, A. S., Auburger, G., Kahle, P. J., Schmid, B. & Haass, C. Loss-of-function of human PINK1 results in mitochondrial pathology and can be rescued by parkin. J. Neurosci. Off. J. Soc. Neurosci. 27, 12413–12418 (2007).

76. Fallaize, D., Chin, L.S. & Li, L. Differential submitochondrial localization of PINK1 as a molecular switch for mediating distinct mitochondrial signalling pathways. Cell. Signal. 27, 2543–2554 (2015).

77. Jin, S. M., Lazarou, M., Wang, C., Kane, L. A., Narendra, D. P. & Youle, R. J. Mitochondrial membrane potential regulates PINK1 import and proteolytic destabilization by PARL. J. Cell Biol. 191, 933–942 (2010).

78. Shi, G., Lee, J. R., Grimes, D. A., Racacho, L., Ye, D., Yang, H., Ross, O. A., Farrer, M., McQuibban, G. A. & Bulman, D. E. Functional alteration of PARL contributes to mitochondrial dysregulation in Parkinson’s disease. Hum. Mol. Genet. 20, 1966–1974 (2011).

79. Deas, E., Plun-Favreau, H., Gandhi, S., Desmond, H., Kjaer, S., Loh, S. H. Y., Renton, A. E. M., Harvey, R. J., Whitworth, A. J., Martins, L. M., Abramov, A. Y. & Wood, N. W. PINK1 cleavage at position A103 by the mitochondrial protease PARL. Hum. Mol. Genet. 20, 867–879 (2011).

80. Meissner, C., Lorenz, H., Weihofen, A., Selkoe, D. J. & Lemberg, M. K. The mitochondrial intramembrane protease PARL cleaves human Pink1 to regulate Pink1 trafficking. J. Neurochem. 117, 856–867 (2011).

81. Takatori, S., Ito, G. & Iwatsubo, T. Cytoplasmic localization and proteasomal degradation of N-terminally cleaved form of PINK1. Neurosci. Lett. 430, 13–17 (2008).

82. Fedorowicz, M. A., de Vries-Schneider, R. L. A., Rüb, C., Becker, D., Huang, Y., Zhou, C., Alessi Wolken, D. M., Voos, W., Liu, Y. & Przedborski, S. Cytosolic cleaved PINK1 represses Parkin translocation to mitochondria and mitophagy. EMBO Rep. 15, 86–93 (2014).

83. Chaugule, V. K., Burchell, L., Barber, K. R., Sidhu, A., Leslie, S. J., Shaw, G. S. & Walden, H. Autoregulation of Parkin activity through its ubiquitin-like domain. EMBO J. 30, 2853–2867 (2011).

84. Pickrell, A. M. & Youle, R. J. The roles of PINK1, parkin, and mitochondrial fidelity in Parkinson’s disease. Neuron 85, 257–273 (2015).

72

85. Lazarou, M., Jin, S. M., Kane, L. A. & Youle, R. J. Role of PINK1 binding to the TOM complex and alternate intracellular membranes in recruitment and activation of the E3 ligase Parkin. Dev. Cell 22, 320–333 (2012).

86. Matsuda, N., Sato, S., Shiba, K., Okatsu, K., Saisho, K., Gautier, C. A., Sou, Y.-S., Saiki, S., Kawajiri, S., Sato, F., Kimura, M., Komatsu, M., Hattori, N. & Tanaka, K. PINK1 stabilized by mitochondrial depolarization recruits Parkin to damaged mitochondria and activates latent Parkin for mitophagy. J. Cell Biol. 189, 211–221 (2010).

87. Kondapalli, C., Kazlauskaite, A., Zhang, N., Woodroof, H. I., Campbell, D. G., Gourlay, R., Burchell, L., Walden, H., Macartney, T. J., Deak, M., Knebel, A., Alessi, D. R. & Muqit, M. M. K. PINK1 is activated by mitochondrial membrane potential depolarization and stimulates Parkin E3 ligase activity by phosphorylating Serine 65. Open Biol. 2, 120080 (2012).

88. Shiba-Fukushima, K., Imai, Y., Yoshida, S., Ishihama, Y., Kanao, T., Sato, S. & Hattori, N. PINK1-mediated phosphorylation of the Parkin ubiquitin-like domain primes mitochondrial translocation of Parkin and regulates mitophagy. Sci. Rep. 2, 1002 (2012).

89. Kane, L. A., Lazarou, M., Fogel, A. I., Li, Y., Yamano, K., Sarraf, S. A., Banerjee, S. & Youle, R. J. PINK1 phosphorylates ubiquitin to activate Parkin E3 ubiquitin ligase activity. J. Cell Biol. 205, 143–153 (2014).

90. Kazlauskaite, A., Kondapalli, C., Gourlay, R., Campbell, D. G., Ritorto, M. S., Hofmann, K., Alessi, D. R., Knebel, A., Trost, M. & Muqit, M. M. K. Parkin is activated by PINK1-dependent phosphorylation of ubiquitin at Ser65. Biochem. J. 460, 127–139 (2014).

91. Koyano, F., Okatsu, K., Kosako, H., Tamura, Y., Go, E., Kimura, M., Kimura, Y., Tsuchiya, H., Yoshihara, H., Hirokawa, T., Endo, T., Fon, E. A., Trempe, J.-F., Saeki, Y., Tanaka, K. & Matsuda, N. Ubiquitin is phosphorylated by PINK1 to activate parkin. Nature 510, 162–166 (2014).

92. Ordureau, A., Sarraf, S. A., Duda, D. M., Heo, J.-M., Jedrychowski, M. P., Sviderskiy, V. O., Olszewski, J. L., Koerber, J. T., Xie, T., Beausoleil, S. A., Wells, J. A., Gygi, S. P., Schulman, B. A. & Harper, J. W. Quantitative proteomics reveal a feedforward mechanism for mitochondrial PARKIN translocation and ubiquitin chain synthesis. Mol. Cell 56, 360–375 (2014).

93. Kazlauskaite, A., Martínez-Torres, R. J., Wilkie, S., Kumar, A., Peltier, J., Gonzalez, A., Johnson, C., Zhang, J., Hope, A. G., Peggie, M., Trost, M., van Aalten, D. M. F., Alessi, D. R., Prescott, A. R., Knebel, A., Walden, H. & Muqit, M. M. K. Binding to serine 65-phosphorylated ubiquitin primes Parkin for optimal PINK1-dependent phosphorylation and activation. EMBO Rep. 16, 939–954 (2015).

94. Kumar, A., Aguirre, J. D., Condos, T. E. C., Martinez-Torres, R. J., Chaugule, V. K., Toth, R., Sundaramoorthy, R., Mercier, P., Knebel, A., Spratt, D. E., Barber, K. R., Shaw, G. S. & Walden, H. Disruption of the autoinhibited state primes the E3 ligase parkin for activation and catalysis. EMBO J. 34, 2506–2521 (2015).

73

95. Wauer, T., Simicek, M., Schubert, A. & Komander, D. Mechanism of phospho-ubiquitin-induced PARKIN activation. Nature 524, 370–374 (2015).

96. Yamano, K., Queliconi, B. B., Koyano, F., Saeki, Y., Hirokawa, T., Tanaka, K. & Matsuda, N. Site-specific interaction mapping of phosphorylated ubiquitin to uncover parkin activation. J. Biol. Chem. 290, 25199–25211 (2015).

97. Neutzner, A., Benard, G., Youle, R. J. & Karbowski, M. Role of the ubiquitin conjugation system in the maintenance of mitochondrial homeostasis. Ann. N. Y. Acad. Sci. 1147, 242–253 (2008).

98. Bragoszewski, P., Turek, M. & Chacinska, A. Control of mitochondrial biogenesis and function by the ubiquitin–proteasome system. Open Biol. 7, (2017).

99. Wang, X., Winter, D., Ashrafi, G., Schlehe, J., Wong, Y. L., Selkoe, D., Rice, S., Steen, J., LaVoie, M. J. & Schwarz, T. L. PINK1 and parkin target miro for phosphorylation and degradation to arrest mitochondrial motility. Cell 147, 893–906 (2011).

100. Liu, S., Sawada, T., Lee, S., Yu, W., Silverio, G., Alapatt, P., Millan, I., Shen, A., Saxton, W., Kanao, T., Takahashi, R., Hattori, N., Imai, Y. & Lu, B. Parkinson’s disease–associated kinase PINK1 regulates miro protein level and axonal transport of mitochondria. PLOS Genet. 8, e1002537 (2012).

101. Kazlauskaite, A., Kelly, V., Johnson, C., Baillie, C., Hastie, C. J., Peggie, M., Macartney, T., Woodroof, H. I., Alessi, D. R., Pedrioli, P. G. A. & Muqit, M. M. K. Phosphorylation of parkin at serine65 is essential for activation: elaboration of a miro1 substrate-based assay of Parkin E3 ligase activity. Open Biol. 4, 130213 (2014).

102. Chen, Y. & Dorn, G. W. PINK1-phosphorylated mitofusin 2 is a parkin receptor for culling damaged mitochondria. Science 340, 471–475 (2013).

103. Sarraf, S. A., Raman, M., Guarani-Pereira, V., Sowa, M. E., Huttlin, E. L., Gygi, S. P. & Harper, J. W. Landscape of the PARKIN-dependent ubiquitylome in response to mitochondrial depolarization. Nature 496, 372–376 (2013).

104. Yamano, K., Matsuda, N. & Tanaka, K. The ubiquitin signal and autophagy: an orchestrated dance leading to mitochondrial degradation. EMBO Rep. 17, 300–316 (2016).

105. Lazarou, M., Sliter, D. A., Kane, L. A., Sarraf, S. A., Wang, C., Burman, J. L., Sideris, D. P., Fogel, A. I. & Youle, R. J. The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Nature 524, 309–314 (2015).

106. Heo, J.-M., Ordureau, A., Paulo, J. A., Rinehart, J. & Harper, J. W. The PINK1-PARKIN mitochondrial ubiquitylation pathway drives a program of OPTN/NDP52 recruitment and TBK1 activation to promote mitophagy. Mol. Cell 60, 7–20 (2015).

107. Glick, D., Barth, S. & Macleod, K. F. Autophagy: cellular and molecular mechanisms. J. Pathol. 221, 3–12 (2010).

74

108. Narendra, D. P., Jin, S. M., Tanaka, A., Suen, D.-F., Gautier, C. A., Shen, J., Cookson, M. R. & Youle, R. J. PINK1 is selectively stabilized on impaired mitochondria to activate Parkin. PLoS Biol. 8, e1000298 (2010).

109. Kubli, D. A. & Gustafsson, Å. B. Mitochondria and mitophagy: the yin and yang of cell death control. Circ. Res. 111, 1208–1221 (2012).

110. Palikaras, K. & Tavernarakis, N. Mitochondrial homeostasis: the interplay between mitophagy and mitochondrial biogenesis. Exp. Gerontol. 56, 182–188 (2014).

111. Garnier, A., Fortin, D., Zoll, J., N’Guessan, B., Mettauer, B., Lampert, E., Veksler, V. & Ventura-Clapier, R. Coordinated changes in mitochondrial function and biogenesis in healthy and diseased human skeletal muscle. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 19, 43–52 (2005).

112. Shiota, T., Traven, A. & Lithgow, T. Mitochondrial biogenesis: cell-cycle-dependent investment in making mitochondria. Curr. Biol. 25, R78–R80 (2015).

113. Kelly, D. P. & Scarpulla, R. C. Transcriptional regulatory circuits controlling mitochondrial biogenesis and function. Genes Dev. 18, 357–368 (2004).

114. Uittenbogaard, M. & Chiaramello, A. Mitochondrial biogenesis: a therapeutic target for neurodevelopmental disorders and neurodegenerative diseases. Curr. Pharm. Des. 20, 5574–5593 (2014).

115. Villena, J. A. New insights into PGC-1 coactivators: redefining their role in the regulation of mitochondrial function and beyond. FEBS J. 282, 647–672 (2015).

116. Martínez-Redondo, V., Pettersson, A. T. & Ruas, J. L. The hitchhiker’s guide to PGC-1α isoform structure and biological functions. Diabetologia 58, 1969–1977 (2015).

117. Ramamoorthy, T. G., Laverny, G., Schlagowski, A.-I., Zoll, J., Messaddeq, N., Bornert, J.-M., Panza, S., Ferry, A., Geny, B. & Metzger, D. The transcriptional coregulator PGC-1β controls mitochondrial function and anti-oxidant defence in skeletal muscles. Nat. Commun. 6, ncomms10210 (2015).

118. Fernandez-Marcos, P. J. & Auwerx, J. Regulation of PGC-1α, a nodal regulator of mitochondrial biogenesis. Am. J. Clin. Nutr. 93, 884S–90 (2011).

119. Scarpulla, R. C. Transcriptional paradigms in mammalian mitochondrial biogenesis and function. Physiol. Rev. 88, 611–638 (2008).

120. Puigserver, P., Wu, Z., Park, C. W., Graves, R., Wright, M. & Spiegelman, B. M. A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92, 829–839 (1998).

121. Esterbauer, H., Oberkofler, H., Krempler, F. & Patsch, W. Human peroxisome proliferator activated receptor gamma coactivator 1 (PPARGC1) gene: cDNA sequence, genomic organization, chromosomal localization, and tissue expression. Genomics 62, 98–102 (1999).

122. Lin, J., Puigserver, P., Donovan, J., Tarr, P. & Spiegelman, B. M. Peroxisome proliferator-activated receptor gamma coactivator 1beta (PGC-1beta ), a novel

75

PGC-1-related transcription coactivator associated with host cell factor. J. Biol. Chem. 277, 1645–1648 (2002).

123. Andersson, U. & Scarpulla, R. C. Pgc-1-related coactivator, a novel, serum-inducible coactivator of nuclear respiratory factor 1-dependent transcription in mammalian cells. Mol. Cell. Biol. 21, 3738–3749 (2001).

124. Wu, Z., Puigserver, P., Andersson, U., Zhang, C., Adelmant, G., Mootha, V., Troy, A., Cinti, S., Lowell, B., Scarpulla, R. C. & Spiegelman, B. M. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 98, 115–124 (1999).

125. Handschin, C., Kobayashi, Y. M., Chin, S., Seale, P., Campbell, K. P. & Spiegelman, B. M. PGC-1alpha regulates the neuromuscular junction program and ameliorates Duchenne muscular dystrophy. Genes Dev. 21, 770–783 (2007).

126. Shao, D., Liu, Y., Liu, X., Zhu, L., Cui, Y., Cui, A., Qiao, A., Kong, X., Liu, Y., Chen, Q., Gupta, N., Fang, F. & Chang, Y. PGC-1 beta-regulated mitochondrial biogenesis and function in myotubes is mediated by NRF-1 and ERR alpha. Mitochondrion 10, 516–527 (2010).

127. Srivastava, S., Barrett, J. N. & Moraes, C. T. PGC-1alpha/beta upregulation is associated with improved oxidative phosphorylation in cells harboring nonsense mtDNA mutations. Hum. Mol. Genet. 16, 993–1005 (2007).

128. Wareski, P., Vaarmann, A., Choubey, V., Safiulina, D., Liiv, J., Kuum, M. & Kaasik, A. PGC-1α and PGC-1β regulate mitochondrial density in neurons. J. Biol. Chem. 284, 21379–21385 (2009).

129. Gleyzer, N., Vercauteren, K. & Scarpulla, R. C. Control of mitochondrial transcription specificity factors (TFB1M and TFB2M) by nuclear respiratory factors (NRF-1 and NRF-2) and PGC-1 family coactivators. Mol. Cell. Biol. 25, 1354–1366 (2005).

130. Blesa, J. R., Prieto-Ruiz, J. A., Hernández, J. M. & Hernández-Yago, J. NRF-2 transcription factor is required for human TOMM20 gene expression. Gene 391, 198–208 (2007).

131. Scarpulla, R. C. Transcriptional activators and coactivators in the nuclear control of mitochondrial function in mammalian cells. Gene 286, 81–89 (2002).

132. Scarpulla, R. C. Nuclear control of respiratory gene expression in mammalian cells. J. Cell. Biochem. 97, 673–683 (2006).

133. Virbasius, J. V. & Scarpulla, R. C. Transcriptional activation through ETS domain binding sites in the cytochrome c oxidase subunit IV gene. Mol. Cell. Biol. 11, 5631–5638 (1991).

134. Su, X., Chu, Y., Kordower, J. H., Li, B., Cao, H., Huang, L., Nishida, M., Song, L., Wang, D. & Federoff, H. J. PGC−1α promoter methylation in Parkinson’s disease. PLoS ONE 10, (2015).

135. Taherzadeh-Fard, E., Saft, C., Akkad, D. A., Wieczorek, S., Haghikia, A., Chan, A., Epplen, J. T. & Arning, L. PGC-1alpha downstream transcription factors NRF-1 and

76

TFAM are genetic modifiers of Huntington disease. Mol. Neurodegener. 6, 32 (2011).

136. Kuroda, Y., Mitsui, T., Kunishige, M., Shono, M., Akaike, M., Azuma, H. & Matsumoto, T. Parkin enhances mitochondrial biogenesis in proliferating cells. Hum. Mol. Genet. 15, 883–895 (2006).

137. Shin, J.-H., Ko, H. S., Kang, H., Lee, Y., Lee, Y.-I., Pletinkova, O., Troconso, J. C., Dawson, V. L. & Dawson, T. M. PARIS (ZNF746) repression of PGC-1α contributes to neurodegeneration in Parkinson’s disease. Cell 144, 689–702 (2011).

138. Zhang, Y., Gao, J., Chung, K. K., Huang, H., Dawson, V. L. & Dawson, T. M. Parkin functions as an E2-dependent ubiquitin- protein ligase and promotes the degradation of the synaptic vesicle-associated protein, CDCrel-1. Proc. Natl. Acad. Sci. U. S. A. 97, 13354–13359 (2000).

139. Chung, K. K. K., Thomas, B., Li, X., Pletnikova, O., Troncoso, J. C., Marsh, L., Dawson, V. L. & Dawson, T. M. S-nitrosylation of parkin regulates ubiquitination and compromises parkin’s protective function. Science 304, 1328–1331 (2004).

140. Yao, D., Gu, Z., Nakamura, T., Shi, Z.-Q., Ma, Y., Gaston, B., Palmer, L. A., Rockenstein, E. M., Zhang, Z., Masliah, E., Uehara, T. & Lipton, S. A. Nitrosative stress linked to sporadic Parkinson’s disease: S-nitrosylation of parkin regulates its E3 ubiquitin ligase activity. Proc. Natl. Acad. Sci. U. S. A. 101, 10810–10814 (2004).

141. Ko, H. S., Kim, S. W., Sriram, S. R., Dawson, V. L. & Dawson, T. M. Identification of far upstream element-binding protein-1 as an authentic Parkin substrate. J. Biol. Chem. 281, 16193–16196 (2006).

142. Ko, H. S., Lee, Y., Shin, J.-H., Karuppagounder, S. S., Gadad, B. S., Koleske, A. J., Pletnikova, O., Troncoso, J. C., Dawson, V. L. & Dawson, T. M. Phosphorylation by the c-Abl protein tyrosine kinase inhibits parkin’s ubiquitination and protective function. Proc. Natl. Acad. Sci. U. S. A. 107, 16691–16696 (2010).

143. Vandiver, M. S., Paul, B. D., Xu, R., Karuppagounder, S., Rao, F., Snowman, A. M., Ko, H. S., Lee, Y. I., Dawson, V. L., Dawson, T. M., Sen, N. & Snyder, S. H. Sulfhydration mediates neuroprotective actions of parkin. Nat. Commun. 4, 1626 (2013).

144. Dawson, T. M. & Dawson, V. L. Parkin plays a role in sporadic Parkinson’s disease. Neurodegener. Dis. 13, 69–71 (2014).

145. Tsunemi, T., Ashe, T. D., Morrison, B. E., Soriano, K. R., Au, J., Vázquez Roque, R. A., Lazarowski, E. R., Damian, V. A., Masliah, E. & La Spada, A. R. PGC-1α rescues Huntington’s disease proteotoxicity by preventing oxidative stress and promoting TFEB function. Sci. Transl. Med. 4, 142ra97 (2012).

146. Vainshtein, A., Tryon, L. D., Pauly, M. & Hood, D. A. Role of PGC-1α during acute exercise-induced autophagy and mitophagy in skeletal muscle. Am. J. Physiol. - Cell Physiol. 308, C710–C719 (2015).

77

147. Komen, J. C. & Thorburn, D. R. Turn up the power - pharmacological activation of mitochondrial biogenesis in mouse models. Br. J. Pharmacol. 171, 1818–1836 (2014).

148. Jäger, S., Handschin, C., St-Pierre, J. & Spiegelman, B. M. AMP-activated protein kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-1alpha. Proc. Natl. Acad. Sci. U. S. A. 104, 12017–12022 (2007).

149. Cantó, C., Gerhart-Hines, Z., Feige, J. N., Lagouge, M., Noriega, L., Milne, J. C., Elliott, P. J., Puigserver, P. & Auwerx, J. AMPK regulates energy expenditure by modulating NAD+ metabolism and SIRT1 activity. Nature 458, 1056–1060 (2009).

150. Egan, D., Kim, J., Shaw, R. J. & Guan, K.-L. The autophagy initiating kinase ULK1 is regulated via opposing phosphorylation by AMPK and mTOR. Autophagy 7, 643–644 (2011).

151. Egan, D. F., Shackelford, D. B., Mihaylova, M. M., Gelino, S., Kohnz, R. A., Mair, W., Vasquez, D. S., Joshi, A., Gwinn, D. M., Taylor, R., Asara, J. M., Fitzpatrick, J., Dillin, A., Viollet, B., Kundu, M., Hansen, M. & Shaw, R. J. Phosphorylation of ULK1 (hATG1) by AMP-activated protein kinase connects energy sensing to mitophagy. Science 331, 456–461 (2011).

152. Garcia, D. & Shaw, R. J. AMPK: Mechanisms of cellular energy sensing and restoration of metabolic balance. Mol. Cell 66, 789–800 (2017).

153. Jürgens, G., Wieschaus, E., Nüsslein-Volhard, C. & Kluding, H. Mutations affecting the pattern of the larval cuticle inDrosophila melanogaster : II. Zygotic loci on the third chromosome. Wilhelm Rouxs Arch. Dev. Biol. 193, 283–295 (1984).

154. Urban, S., Lee, J. R. & Freeman, M. A family of Rhomboid intramembrane proteases activates all Drosophila membrane-tethered EGF ligands. EMBO J. 21, 4277–4286 (2002).

155. Wasserman, J. D., Urban, S. & Freeman, M. A family of rhomboid-like genes: Drosophila rhomboid-1 and roughoid/rhomboid-3 cooperate to activate EGF receptor signaling. Genes Dev. 14, 1651–1663 (2000).

156. Lee, J. R., Urban, S., Garvey, C. F. & Freeman, M. Regulated intracellular ligand transport and proteolysis control EGF signal activation in Drosophila. Cell 107, 161–171 (2001).

157. Urban, S., Lee, J. R. & Freeman, M. Drosophila rhomboid-1 defines a family of putative intramembrane serine proteases. Cell 107, 173–182 (2001).

158. Koonin, E. V., Makarova, K. S., Rogozin, I. B., Davidovic, L., Letellier, M.-C. & Pellegrini, L. The rhomboids: a nearly ubiquitous family of intramembrane serine proteases that probably evolved by multiple ancient horizontal gene transfers. Genome Biol. 4, R19 (2003).

159. Strisovsky, K. Rhomboid protease inhibitors: Emerging tools and future therapeutics. Semin. Cell Dev. Biol. 60, 52–62 (2016).

160. Urban, S. A guide to the rhomboid protein superfamily in development and disease. Semin. Cell Dev. Biol. 60, 1–4 (2016).

78

161. Wang, Y., Zhang, Y. & Ha, Y. Crystal structure of a rhomboid family intramembrane protease. Nature 444, 179–180 (2006).

162. Wu, Z., Yan, N., Feng, L., Oberstein, A., Yan, H., Baker, R. P., Gu, L., Jeffrey, P. D., Urban, S. & Shi, Y. Structural analysis of a rhomboid family intramembrane protease reveals a gating mechanism for substrate entry. Nat. Struct. Mol. Biol. 13, 1084–1091 (2006).

163. Ben-Shem, A., Fass, D. & Bibi, E. Structural basis for intramembrane proteolysis by rhomboid serine proteases. Proc. Natl. Acad. Sci. U. S. A. 104, 462–466 (2007).

164. Jeyaraju, D. V., McBride, H. M., Hill, R. B. & Pellegrini, L. Structural and mechanistic basis of Parl activity and regulation. Cell Death Differ. 18, 1531–1539 (2011).

165. Bondar, A.-N., del Val, C. & White, S. H. Rhomboid protease dynamics and lipid interactions. Struct. Lond. Engl. 1993 17, 395–405 (2009).

166. Erez, E., Fass, D. & Bibi, E. How intramembrane proteases bury hydrolytic reactions in the membrane. Nature 459, 371–378 (2009).

167. Ha, Y. Structure and mechanism of intramembrane protease. Semin. Cell Dev. Biol. 20, 240–250 (2009).

168. Esser, K., Tursun, B., Ingenhoven, M., Michaelis, G. & Pratje, E. A novel two-step mechanism for removal of a mitochondrial signal sequence involves the mAAA complex and the putative rhomboid protease Pcp1. J. Mol. Biol. 323, 835–843 (2002).

169. McQuibban, G. A., Saurya, S. & Freeman, M. Mitochondrial membrane remodelling regulated by a conserved rhomboid protease. Nature 423, 537–541 (2003).

170. Herlan, M., Vogel, F., Bornhovd, C., Neupert, W. & Reichert, A. S. Processing of Mgm1 by the rhomboid-type protease Pcp1 is required for maintenance of mitochondrial morphology and of mitochondrial DNA. J. Biol. Chem. 278, 27781–27788 (2003).

171. Chan, E. Y. L. & McQuibban, G. A. The mitochondrial rhomboid protease: Its rise from obscurity to the pinnacle of disease-relevant genes. Biochim. Biophys. Acta BBA - Biomembr. 1828, 2916–2925 (2013).

172. McQuibban, G. A., Lee, J. R., Zheng, L., Juusola, M. & Freeman, M. Normal Mitochondrial Dynamics Requires Rhomboid-7 and Affects Drosophila Lifespan and Neuronal Function. Curr. Biol. 16, 982–989 (2006).

173. Rahman, M. & Kylsten, P. Rhomboid-7 over-expression results in Opa1-like processing and malfunctioning mitochondria. Biochem. Biophys. Res. Commun. 414, 315–320 (2011).

174. Whitworth, A. J., Lee, J. R., Ho, V. M.-W., Flick, R., Chowdhury, R. & McQuibban, G. A. Rhomboid-7 and HtrA2/Omi act in a common pathway with the Parkinson’s disease factors Pink1 and Parkin. Dis. Model. Mech. 1, 168–174; discussion 173 (2008).

79

175. Pellegrini, L., Passer, B. J., Canelles, M., Lefterov, I., Ganjei, J. K., Fowlkes, B. J., Koonin, E. V. & D’Adamio, L. PAMP and PARL, two novel putative metalloproteases interacting with the COOH-terminus of Presenilin-1 and -2. J. Alzheimers Dis. 3, 181–190 (2001).

176. Spinazzi, M. & De Strooper, B. PARL: The mitochondrial rhomboid protease. Semin. Cell Dev. Biol. 60, 19–28 (2016).

177. Sík, A., Passer, B. J., Koonin, E. V. & Pellegrini, L. Self-regulated cleavage of the mitochondrial intramembrane-cleaving protease PARL yields Pbeta, a nuclear-targeted peptide. J. Biol. Chem. 279, 15323–15329 (2004).

178. Jeyaraju, D. V., Xu, L., Letellier, M.-C., Bandaru, S., Zunino, R., Berg, E. A., McBride, H. M. & Pellegrini, L. Phosphorylation and cleavage of presenilin-associated rhomboid-like protein (PARL) promotes changes in mitochondrial morphology. Proc. Natl. Acad. Sci. U. S. A. 103, 18562–18567 (2006).

179. Shi, G. & McQuibban, G. A. The Mitochondrial Rhomboid Protease PARL Is Regulated by PDK2 to Integrate Mitochondrial Quality Control and Metabolism. Cell Rep. 18, 1458–1472 (2017).

180. Civitarese, A. E., MacLean, P. S., Carling, S., Kerr-Bayles, L., McMillan, R. P., Pierce, A., Becker, T. C., Moro, C., Finlayson, J., Lefort, N., Newgard, C. B., Mandarino, L., Cefalu, W., Walder, K., Collier, G. R., Hulver, M. W., Smith, S. R. & Ravussin, E. Regulation of skeletal muscle oxidative capacity and insulin signaling by the mitochondrial rhomboid protease PARL. Cell Metab. 11, 412–426 (2010).

181. Seibel, N. M., Eljouni, J., Nalaskowski, M. M. & Hampe, W. Nuclear localization of enhanced green fluorescent protein homomultimers. Anal. Biochem. 368, 95–99 (2007).

182. Cipolat, S., Rudka, T., Hartmann, D., Costa, V., Serneels, L., Craessaerts, K., Metzger, K., Frezza, C., Annaert, W., D’Adamio, L., Derks, C., Dejaegere, T., Pellegrini, L., D’Hooge, R., Scorrano, L. & De Strooper, B. Mitochondrial rhomboid PARL regulates cytochrome c release during apoptosis via OPA1-dependent cristae remodeling. Cell 126, 163–175 (2006).

183. Ishihara, N., Fujita, Y., Oka, T. & Mihara, K. Regulation of mitochondrial morphology through proteolytic cleavage of OPA1. EMBO J. 25, 2966–2977 (2006).

184. Anand, R., Wai, T., Baker, M. J., Kladt, N., Schauss, A. C., Rugarli, E. & Langer, T. The i-AAA protease YME1L and OMA1 cleave OPA1 to balance mitochondrial fusion and fission. J. Cell Biol. 204, 919–929 (2014).

185. Saita, S., Nolte, H., Fiedler, K. U., Kashkar, H., Venne, A. S., Zahedi, R. P., Krüger, M. & Langer, T. PARL mediates Smac proteolytic maturation in mitochondria to promote apoptosis. Nat. Cell Biol. 19, 318–328 (2017).

186. Sekine, S., Kanamaru, Y., Koike, M., Nishihara, A., Okada, M., Kinoshita, H., Kamiyama, M., Maruyama, J., Uchiyama, Y., Ishihara, N., Takeda, K. & Ichijo, H. Rhomboid protease PARL mediates the mitochondrial membrane potential loss-induced cleavage of PGAM5. J. Biol. Chem. 287, 34635–34645 (2012).

80

187. Wang, Z., Jiang, H., Chen, S., Du, F. & Wang, X. The mitochondrial phosphatase PGAM5 functions at the convergence point of multiple necrotic death pathways. Cell 148, 228–243 (2012).

188. Zhuang, M., Guan, S., Wang, H., Burlingame, A. L. & Wells, J. A. Substrates of IAP ubiquitin ligases identified with a designed orthogonal E3 ligase, the NEDDylator. Mol. Cell 49, 273–282 (2013).

189. Yoshioka, H., Katsu, M., Sakata, H., Okami, N., Wakai, T., Kinouchi, H. & Chan, P. H. The role of PARL and HtrA2 in striatal neuronal injury after transient global cerebral ischemia. J. Cereb. Blood Flow Metab. Off. J. Int. Soc. Cereb. Blood Flow Metab. 33, 1658–1665 (2013).

190. Meissner, C., Lorenz, H., Hehn, B. & Lemberg, M. K. Intramembrane protease PARL defines a negative regulator of PINK1- and PARK2/Parkin-dependent mitophagy. Autophagy 11, 1484–1498 (2015).

191. Mirzoeva, O. K. & Petrini, J. H. J. DNA replication-dependent nuclear dynamics of the Mre11 complex1 1 NIH GM56888 and the DOE ER62859. Mol. Cancer Res. 1, 207–218 (2003).

192. Huang, J., Huen, M. S. Y., Kim, H., Leung, C. C. Y., Glover, J. N. M., Yu, X. & Chen, J. RAD18 transmits DNA damage signalling to elicit homologous recombination repair. Nat. Cell Biol. 11, 592–603 (2009).

193. Wessel, D. & Flügge, U. I. A method for the quantitative recovery of protein in dilute solution in the presence of detergents and lipids. Anal. Biochem. 138, 141–143 (1984).

194. Krishna, A., Biryukov, M., Trefois, C., Antony, P. M. A., Hussong, R., Lin, J., Heinäniemi, M., Glusman, G., Köglsberger, S., Boyd, O., van den Berg, B. H. J., Linke, D., Huang, D., Wang, K., Hood, L., Tholey, A., Schneider, R., Galas, D. J., Balling, R. & May, P. Systems genomics evaluation of the SH-SY5Y neuroblastoma cell line as a model for Parkinson’s disease. BMC Genomics 15, 1154 (2014).

195. Filograna, R., Civiero, L., Ferrari, V., Codolo, G., Greggio, E., Bubacco, L., Beltramini, M. & Bisaglia, M. Analysis of the catecholaminergic phenotype in human SH-SY5Y and BE(2)-M17 neuroblastoma cell lines upon differentiation. PloS One 10, e0136769 (2015).

196. Huang, H.C., Lee, C.P., Liu, H.K., Chang, M.F., Lai, Y.H., Lee, Y.C. & Huang, C. Cellular nuclear export factors TAP and Aly are required for HDAg-L-mediated assembly of hepatitis delta virus. J. Biol. Chem. 291, 26226–26238 (2016).

197. Lee, C. S., Han, E. S., Park, E. S. & Bang, H. Inhibition of MG132-induced mitochondrial dysfunction and cell death in PC12 cells by 3-morpholinosydnonimine. Brain Res. 1036, 18–26 (2005).

198. Radke, S., Chander, H., Schäfer, P., Meiss, G., Krüger, R., Schulz, J. B. & Germain, D. Mitochondrial protein quality control by the proteasome involves ubiquitination and the protease Omi. J. Biol. Chem. 283, 12681–12685 (2008).

81

199. Han, Y. H., Moon, H. J., You, B. R. & Park, W. H. The effect of MG132, a proteasome inhibitor on HeLa cells in relation to cell growth, reactive oxygen species and GSH. Oncol. Rep. 22, 215–221 (2009).

200. Maharjan, S., Oku, M., Tsuda, M., Hoseki, J. & Sakai, Y. Mitochondrial impairment triggers cytosolic oxidative stress and cell death following proteasome inhibition. Sci. Rep. 4, srep05896 (2014).

201. Schneider, L., Giordano, S., Zelickson, B. R., Johnson, M., Benavides, G., Ouyang, X., Fineberg, N., Darley-Usmar, V. M. & Zhang, J. Differentiation of SH-SY5Y cells to a neuronal phenotype changes cellular bioenergetics and the response to oxidative stress. Free Radic. Biol. Med. 51, 2007–2017 (2011).

202. Gianfranceschi, G. L., Barra, D., Bossa, F., Coderoni, S., Paparelli, M., Venanzi, F., Cicconi, F. & Amici, D. Small peptides controlling transcription in vitro are bound to chromatin DNA. Biochim. Biophys. Acta BBA - Gene Struct. Expr. 699, 138–148 (1982).

203. Liew, C. C. Progress in Nonhistone Protein Research. (CRC Press, 1985).

204. Shen, Z., Sathyan, K. M., Geng, Y., Zheng, R., Chakraborty, A., Freeman, B., Wang, F., Prasanth, K. V. & Prasanth, S. G. A WD-repeat protein stabilizes ORC binding to chromatin. Mol. Cell 40, 99–111 (2010).

205. Paggi M.G., Felsani, A., & Giordano, A. Growth control by the retinoblastoma gene family. Tumor Suppressor Genes - Volume 1: Pathways and Isolation . 3-19 (Springer, 2003).

206. Guo, R., Xu, D. & Wang, W. Identification and analysis of new Proteins involved in the DNA Damage Response network of Fanconi anemia and Bloom syndrome. Methods San Diego Calif 48, 72–79 (2009).

207. Ross, R. A., Spengler, B. A. & Biedler, J. L. Coordinate morphological and biochemical interconversion of human neuroblastoma cells. J. Natl. Cancer Inst. 71, 741–747 (1983).

208. Encinas, M., Iglesias, M., Liu, Y., Wang, H., Muhaisen, A., Ceña, V., Gallego, C. & Comella, J. X. Sequential treatment of SH-SY5Y cells with retinoic acid and brain-derived neurotrophic factor gives rise to fully differentiated, neurotrophic factor-dependent, human neuron-like cells. J. Neurochem. 75, 991–1003 (2000).

209. Kovalevich, J. & Langford, D. Considerations for the use of SH-SY5Y neuroblastoma cells in neurobiology. Neuronal Cell Cult. 9–21 (Springer, 2013).

210. Hashimoto, Y., Niikura, T., Tajima, H., Yasukawa, T., Sudo, H., Ito, Y., Kita, Y., Kawasumi, M., Kouyama, K., Doyu, M., Sobue, G., Koide, T., Tsuji, S., Lang, J., Kurokawa, K. & Nishimoto, I. A rescue factor abolishing neuronal cell death by a wide spectrum of familial Alzheimer’s disease genes and Abeta. Proc. Natl. Acad. Sci. U. S. A. 98, 6336–6341 (2001).

211. Lee, C., Zeng, J., Drew, B. G., Sallam, T., Martin-Montalvo, A., Wan, J., Kim, S.-J., Mehta, H., Hevener, A. L., de Cabo, R. & Cohen, P. The mitochondrial-derived

82

peptide MOTS-c promotes metabolic homeostasis and reduces obesity and insulin resistance. Cell Metab. 21, 443–454 (2015).

212. Cobb, L. J., Lee, C., Xiao, J., Yen, K., Wong, R. G., Nakamura, H. K., Mehta, H. H., Gao, Q., Ashur, C., Huffman, D. M., Wan, J., Muzumdar, R., Barzilai, N. & Cohen, P. Naturally occurring mitochondrial-derived peptides are age-dependent regulators of apoptosis, insulin sensitivity, and inflammatory markers. Aging 8, 796–809 (2016).

213. Guo, B., Zhai, D., Cabezas, E., Welsh, K., Nouraini, S., Satterthwait, A. C. & Reed, J. C. Humanin peptide suppresses apoptosis by interfering with Bax activation. Nature 423, 456–461 (2003).

214. Ikonen, M., Liu, B., Hashimoto, Y., Ma, L., Lee, K.-W., Niikura, T., Nishimoto, I. & Cohen, P. Interaction between the Alzheimer’s survival peptide humanin and insulin-like growth factor-binding protein 3 regulates cell survival and apoptosis. Proc. Natl. Acad. Sci. U. S. A. 100, 13042–13047 (2003).

215. Lee, C., Yen, K. & Cohen, P. Humanin: a harbinger of mitochondrial-derived peptides? Trends Endocrinol. Metab. TEM 24, 222–228 (2013).

216. Lee, C., Kim, K. H. & Cohen, P. MOTS-c: A novel mitochondrial-derived peptide regulating muscle and fat metabolism. Free Radic. Biol. Med. 100, 182–187 (2016).

217. Maloney, B. & Lahiri, D. K. The Alzheimer’s amyloid β-peptide (Aβ) binds a specific DNA Aβ-interacting domain (AβID) in the APP, BACE1, and APOE promoters in a sequence-specific manner: characterizing a new regulatory motif. Gene 488, 1–12 (2011).

218. Barucker, C., Harmeier, A., Weiske, J., Fauler, B., Albring, K. F., Prokop, S., Hildebrand, P., Lurz, R., Heppner, F. L., Huber, O. & Multhaup, G. Nuclear translocation uncovers the amyloid peptide Aβ42 as a regulator of gene transcription. J. Biol. Chem. 289, 20182–20191 (2014).

219. Multhaup, G., Huber, O., Buée, L. & Galas, M.-C. Amyloid precursor protein (APP) metabolites APP intracellular fragment (AICD), Aβ42, and tau in nuclear roles. J. Biol. Chem. 290, 23515–23522 (2015).

220. Maj, M. C., Cameron, J. M. & Robinson, B. H. Pyruvate dehydrogenase phosphatase deficiency: orphan disease or an under-diagnosed condition? Mol. Cell. Endocrinol. 249, 1–9 (2006).

221. Huang, B., Gudi, R., Wu, P., Harris, R. A., Hamilton, J. & Popov, K. M. Isoenzymes of pyruvate dehydrogenase phosphatase. DNA-derived amino acid sequences, expression, and regulation. J. Biol. Chem. 273, 17680–17688 (1998).

222. Huang, B., Wu, P., Popov, K. M. & Harris, R. A. Starvation and diabetes reduce the amount of pyruvate dehydrogenase phosphatase in rat heart and kidney. Diabetes 52, 1371–1376 (2003).

223. Herget, M. & Tampé, R. Intracellular peptide transporters in human-compartmentalization of the ‘peptidome’. Pflugers Arch. 453, 591–600 (2007).

83

224. Young, L., Leonhard, K., Tatsuta, T., Trowsdale, J. & Langer, T. Role of the ABC transporter Mdl1 in peptide export from mitochondria. Science 291, 2135–2138 (2001).

225. Augustin, S., Nolden, M., Müller, S., Hardt, O., Arnold, I. & Langer, T. Characterization of peptides released from mitochondria; evidence for constant proteolysis and peptide efflux. J. Biol. Chem. 280, 2691–2699 (2005).

226. Kambacheld, M., Augustin, S., Tatsuta, T., Müller, S. & Langer, T. Role of the novel metallopeptidase MoP112 and saccharolysin for the complete degradation of proteins residing in different subcompartments of mitochondria. J. Biol. Chem. 280, 20132–20139 (2005).

227. Haynes, C. M., Yang, Y., Blais, S. P., Neubert, T. A. & Ron, D. The matrix peptide exporter HAF-1 signals a mitochondrial UPR by activating the transcription factor ZC376.7 in C. elegans. Mol. Cell 37, 529–540 (2010).

228. Mannella, C. A. The ‘ins’ and ‘outs’ of mitochondrial membrane channels. Trends Biochem. Sci. 17, 315–320 (1992).

229. Hill, K., Model, K., Ryan, M. T., Dietmeier, K., Martin, F., Wagner, R. & Pfanner, N. Tom40 forms the hydrophilic channel of the mitochondrial import pore for preproteins [see comment]. Nature 395, 516–521 (1998).

230. Arnold, I., Wagner-Ecker, M., Ansorge, W. & Langer, T. Evidence for a novel mitochondria-to-nucleus signalling pathway in respiring cells lacking i-AAA protease and the ABC-transporter Mdl1. Gene 367, 74–88 (2006).

231. Larsen, M. R., Trelle, M. B., Thingholm, T. E. & Jensen, O. N. Analysis of posttranslational modifications of proteins by tandem mass spectrometry. BioTechniques 40, 790–798 (2006).

232. Parker, C. E., Mocanu, V., Mocanu, M., Dicheva, N. & Warren, M. R. Mass spectrometry for post-translational modifications. Neuroproteomics (CRC Press/Taylor & Francis, 2010).

233. Donner, A. J., Ebmeier, C. C., Taatjes, D. J. & Espinosa, J. M. CDK8 is a positive regulator of transcriptional elongation within the serum response network. Nat. Struct. Mol. Biol. 17, 194–201 (2010).

84

APPENDIX

Pβ Deletion Outline Using CRISPR/Cas9 System

score sequence

Guide #1 80 GTCCCTGGGTCTGATCTTCGAGG

Guide #2 78 AACCTCGAAGATCAGACCCAGGG

Guide #3 76 AACCTCGAAGATCAGACCCAGGG

Guide #4 73 TATGCTTCACCACTTGTCCCTGG

tgtgtgtcaccttttccagaaaggttgaattttgtggctttgaattctgtctgagagtaggagtcttggctgtttttggact

gtagagtgagaataaattgagatggtgatgatgcaggccaagtggaggttcatagaagttgatatttgcaagacgctactgt

gtttctcatctgttatttttgccccatagGTTTAACTTCTTTATTCAACAAAAATGCGGATTCAGAAAAGCACCCAGGAAGG

TTGAACCTCGAAGATCAGACCCAGGGACAAGTGGTGAAGCATACAAGAGAAGTGCTTTGATTCCTCCTGTGGAAGAAACAGTCTTTTATCCTTCTCCCTATCCTATAAGGAGTCTCATAAAACCTTTATTTTTTACTGTTGGGgtaagagctcactttgctag

gagttacctaccttgctagaaatgcagtgttaaagtactttgtcccatttgggctcccttaaagtaaggacaggtagagggg

ggatcaaaaagagctgggctcatgaattctaattatagagtctgaatttttttttttttttttgagacggagtctcactctg

Appendix 1-1: Pβ-targeted gRNAs knock down overexpressed PARL-FLAG in HEK293s: A Top CRISPR gRNA design hits for second exon of PARL, which includes Pβ nucleotide sequence, as generated by the CRISPR Design Tool (http://crispr.mit.edu/). Scores are calculated by faithfulness of on-target activity minus off-target hit scores. B PARL second exon is highlighted. Pβ nucleotide sequence is underlined. The estimated Cas9 cleavage site if Guide #1 or #2 is used is coloured corresponding to the gRNA in A. C pX458 plasmids containing Cas9-GFP and Pβ-targeted gRNAs corresponding to Guides #1 (gRNA1.1 and 1.2) and #2 (gRNA 2.1 and 2.2) were cotransfected with PARL-FLAG in HEK293s. Pβ-targeted gRNAs decrease PARL-FLAG expression in comparison to cells cotransfected with pX458 alone (empty).

A

B

C

http://crispr.mit.edu/

85

β PARL ssODN: gacgctactgtgtttctcatctgttatttttgccccataggtttaacttctttattcaacaaaa

atgcggagctttgattcctcctgtggaagaaacagtcttttatccttctccctatcctataagg

agtctcataaaac

S77N PARL ssODN: ttttatgagactccttataggatagggagaaggataaaagactgtttcttccacaggaggaatc

aaagcatttctcttgtatgcttcaccacttgtgcctgggtctgatcttcgaggttcaaccttcctgggtgcttttc

Appendix 1-2: Pβ deletion homologous repair templates: A A homologous repair template to selectively delete Pβ sequence and generate β PARL was designed by sequencing a single-stranded oligodeoxynucleotides (ssODN) combining the 70 nucleotides immediately upstream and downstream of Pβ sequence. B A homologous repair template to introduce S77N mutation which abolishes β cleavage and generates full-length PARL was produced from a 140 nucleotide sequence encompassing S77, the expected Cas9 cleavage site, gRNA PAM sequence. Two point mutations were introduced: CT (resulting in S77N mutation) and CG (to mutate gRNA PAM sequence to inhibit Cas9 cleavage after homologous repair).

A

B

86

tgtgtgtcaccttttccagaaaggttgaattttgtggctttgaattctgtctgagagtaggagtcttggctgtttttggact

gtagagtgagaataaattgagatggtgatgatgcaggccaagtggaggttcatagaagttgatatttgcaagacgctactgt

gtttctcatctgttatttttgccccatagGTTTAACTTCTTTATTCAACAAAAATGCGGATTCAGAAAAGCACCCAGGAAGG

TTGAACCTCGAAGATCAGACCCAGGGACAAGTGGTGAAGCATACAAGAGAAGTGCTTTGATTCCTCCTGTGGAAGAAACAGT

CTTTTATCCTTCTCCCTATCCTATAAGGAGTCTCATAAAACCTTTATTTTTTACTGTTGGGgtaagagctcactttgctagg

agttacctaccttgctagaaatgcagtgttaaagtactttgtcccatttgggctcccttaaagtaaggacaggtagaggggg

gatcaaaaagagctgggctcatgaattctaattatagagtctgaatttttttttttttttttgagacggagtctcactctgg

Pb pcr for: ggc caa gtg gag gtt cat ag Pb pcr rev: ggt agg taa ctc cta gca aag tga Length: 20nt Tm: 55.4C GC%: 55.0% Length: 24nt Tm: 55.8C GC%: 45.8% Pb pcr2 fwd: gca aga cgc tac tgt gtt tct c Pb pcr2 rev: ccc cct cta cct gtc ctt act t Length: 22nt Tm: 56.1C GC%: 50% Length: 22nt Tm: 57.6C GC%: 54.5% Pb possible rev: tcc aca gga gga atc aaa gc Length: 20nt Tm: 60.2C GC%: 50%

Appendix 1-3: Genomic DNA primer test was designed to validate β PARL clones: A PARL second exon is CAPITALIZED. Pβ nucleotide sequence is highlighted. Primers were designed to flank Pβ upstream and downstream and are colour-coded and mapped to PARL second exon and immediately surrounding intron region. B Primer pairs amplified fragments from WT SH-SY5Y genomic DNA at sizes corresponding to expected sizes. If Pβ nucleotide sequence is deleted in β PARL clones, bands are expected to run roughly 75 bp faster.

A

B

mitochondrial peptide pβ - university of toronto t-space...ii characterization of the mitochondrial...

Documents