Modern Genetics

Textbook Chapters 12-13

Review Book Topic 3

Cellular Genetics

• How do we know DNA is our cells genetic material?

• By 1950, based on the work of many scientists, we knew chromosomes carried our hereditary information

• Hereditary information on chromosomes is in the form of genes

• Friedrich Miescher (1869)

– Isolated material from the nuclei of fish sperm

– Composed of carbon, hydrogen, oxygen, nitrogen and phosphorous

– Named it “nucleic acid”

– Later we discovered there were two forms: DNA (in nucleus) & RNA (in cytoplasm)

• By 1920

– We knew chromosomes contained DNA & proteins

– Structure of DNA is unknown

– Scientists believed proteins not DNA carried the genetic material !!

Proteins vs. Nucleic Acids

• Frederick Griffith (1928)

– English bacteriologist

– Trying to find a vaccine against pneumonia

– He knew there were two types of bacteria

•Type S – Bacteria was surrounded by a capsule– Causes severe pneumonia

•Type R– No capsule– Does not cause pneumonia

• If injected bacteria into mice:

– Type S: pneumonia and death (a)

– Type R: no effect (b)

– Dead Type S: no effect (c)

– Dead Type S + live Type R: pneumonia and death (d)

• Tissues of dead mouse showed live Type S

• When combined some factor from dead Type S changed Type R bacteria into Type S

• Avery, MacLeod & McCarty (1944)

– Identified the transforming material in Griffith’s experiment as DNA

– DNA produced the new inherited traits in Type R bacteria when mixed with dead Type S

– Most scientists still thought proteins carried hereditary information

• Hershey & Chase (1952)

– Used bacteriophages (viruses that infect bacteria)

– Has DNA within a protein coat

– Use bacteria cell to reproduce viruses

– Was it the protein coat or the DNA which was used to produce the new viruses?

– Tagged DNA and protein with different radioactive elements

– Tested infected bacteria’s cytoplasm for radioactivity

– Showed radioactive DNA was present, not radioactive protein

– DNA is the genetic material of a cell

Hershey-Chase Experiment Animation

Deoxyribonucleic Acid (DNA)

• Each DNA molecule consists of a chain of nucleotides

• Composition of a nucleotide

– Sugar: deoxyribose (5-carbon)

– Phosphate group

– Nitrogenous base• Adenine• Guanine• Cytosine• Thymine

• Structure

– James Watson & Francis

Crick (1953)

• American biochemist &

English physicist

– Used information from other scientists

• Maurice Wilkins & Rosalind Franklin

–X-ray images of DNA showing a

helical form

–Took numerous tries which were rejected by

other scientists

– Watson, Crick, and Wilkins received the

Nobel Prize in 1962

– Two chains of a sugar phosphate backbone running parallel to each other (5’ to 3’ end)

– Pairs of nitrogenous bases link the chains together

– Helix was twisted and coiled forming a double helix (looked like a spiral staircase or twisted ladder)

– Complementary bases between the strands

• Adenine pairs only with thymine

• Guanine pairs only with cytosine

DNA Replication (DNA DNA)

• Weak bonds between the bases that connect the two strands together are broken

• Strands separate, exposing each base

• Free floating bases in the nucleus match and bond to the exposed bases on the DNA strand

– A goes with T

– C goes with G

• When bases join together, a complete complementary strand is made

– One strand is old DNA, one strand is new DNA

• Two double stranded DNA copies are produced

• Replication occurs at the same time at many different points on the DNA allowing it to occur faster

• Enzymes are used to link the smaller segments of DNA together to create one large strand

– DNA helicase: unwinds and unzips DNA

– DNA polymerase: adds nucleotides of the new strand and fixes any mistakes in the DNA

– DNA ligase: used to connect fragments of new strand together

Replication Animation

Complex Replication

Textbook Animations

Replication Practice

ACCTAGCATTGGCACTGACTGA

TGGATCGTAACCGTGACTGACT

• If this double stranded DNA molecule was replicated, what would the resulting strands look like?

ACCTAGCATTGGCACTGACTGA

TGGATCGTAACCGTGACTGACT

ACCTAGCATTGGCACTGACTGA

TGGATCGTAACCGTGACTGACT

• Try this one….create the complementary strand:

TCGATCGATTTACGTAGCTACGTAACCTAC

TCGATCGATTTACGTAGCTACGTAACCTAC

AGCTAGCTAAATGCATCGATGCATTGGATG

• Replicate this double-stranded DNA segment….

TACGTTGACTGTAACGTACGGATCGATGCA

ATGCAACTGACATTGCATGCCTAGCTACGT

TACGTTGACTGTAACGTACGGATCGATGCA

ATGCAACTGACATTGCATGCCTAGCTACGT

TACGTTGACTGTAACGTACGGATCGATGCA

ATGCAACTGACATTGCATGCCTAGCTACGT

Central Dogma

• DNA serves as a genetic code for the synthesis of proteins

– Proteins are our bodies structural and functional building blocks

• DNA RNA Protein

Ribonucleic Acid (RNA)

• Sugar: Ribose

• Base uracil replaces thymine

• Single stranded

• Types:

– Messenger RNA (mRNA)

– Ribosomal RNA (rRNA)

– Transfer RNA (tRNA)

Name mRNA rRNA tRNA

Function • Copied from

DNA

• Travels from

nucleus to

cytoplasm

• Is translated

into a protein

• Part of a

ribosome

• Transports

amino acids to

the ribosome

Example

Transcription (DNA RNA)

• Occurs in the nucleus

• Process of copying a segment of DNA (gene) to produce a complementary strand of RNA

• Enzyme used: RNA polymerase

• RNA polymerase binds to the start of a gene on the DNA strand (unwinds and separates DNA)

• RNA polymerase uses one side of the DNA as a template to make a complementary segment of RNA– C : G– A : U

• RNA detaches, DNA “re-zips”

itself back together

• RNA is then processed and

released into the cytoplasm

Transcription Practice

• Given the DNA strand below, construct the complementary RNA strand

ACTTGCTGGATGCTACCGCACGTA

ACTTGCTGGATGCTACCGCACGTA

UGAACGACCUACGAUGGCGUGCAU

Replication versus Transcription

• Similarities:

– Both occur in the nucleus

– Unwind DNA with DNA helicase

– Use polymerases to attach nucleotides together

– Use complementary base pairing rules

• Differences:

– Replication makes a complete copy of DNA

• Transcription only copies segments of DNA

– Replication occurs only once

• Transcription occurs over and over again

Translation (RNA Protein)

• Cells translate RNA into amino acids (the building blocks of proteins)

• A chain of amino acids is known as a polypeptide

• Polypeptide chains are created by a ribosome and tRNA

• Genes (segments of DNA) describe how to make proteins by putting the correct amino acids in order

• Translation (“language of proteins”) uses 20 amino acids (“words”)

– Considered the “universal” genetic code which suggests common ancestry among all organisms

– Scientists can insert a gene from one organism into another organism to make a functional protein !

• Codon

– A sequence of three nucleotides that codes for an amino acid

– An amino acid can be represented by more than one codon

– Start codon (AUG) signals the start of translation

• Always begins with the amino acid methionine (Met)

– Stop codons signal the end of the amino acid chain

– Read in a series of three nucleotides (reading frame)

• If changed, resulting protein changes

Translation Practice

• Using the mRNA strand below, decode the following into its corresponding amino acid sequence

UGAACGACCUACGAUGGCGUGCAU

AUG-ACC-UAC-GAU-GGC-GUG-CAU-UGA

START-Thr-Tyr-Asp-Gly-Val-His-STOP

Codon Bingo

• On your bingo board, list all 20 of the amino acids

• Each row must have ONLY 1 free space

• I will call out three nucleotides

• Using your codon chart, identify the amino acid

• Use colored paper bingo chips to mark the amino acid called

• When you get bingo SHOUT IT!!

• Protein Synthesis

• Complex Translation and Translation

Mutations

• When mistakes or changes occur in an organism’s DNA, they are called mutations

• Cells have evolved a variety of methods to deal with or even prevent mutations

• Some mutations affect a single gene, while others affect an entire chromosome

Gene Mutations

• Usually happens during replication

• Point mutation

– One nucleotide is substituted for another

– Can be fixed by DNA polymerase

– Can change an organism’s DNA permanently

• Frameshift mutation

– Insertion or deletion of a nucleotide

– Causes more of an affect than a point mutation

– Shift the entire sequence of nucleotides (changes amino acids being coded for)

– THE CAT ATE THE RAT (Letter E is deleted from the first codon) : THC ATA TET HER AT…

Chromosomal Mutations

• Usually happens during meiosis

– Chromosomes do not align properly (non-homologous pair up during prophase)

– Gene duplication – one chromosome may have two copies of a gene

– Translocation – non-homologous chromosomes exchange segments with each other

Mutations Continued

• Mutations may or may not affect how an organism looks

– Depends on the number of genes involved and the location of the mutation

– Loss of gene function or creation of new hybrid gene can occur

– Silent mutation – does not affect the resulting protein (amino acid has multiple codon variations)

– Mutations in body cells affect only the organism in which it occurs

– Mutations in gametes may be passed on to offspring• Source of genetic variation among organisms• Can be beneficial or harmful

• Mutations can be caused by several factors

– Mutations are not uncommon during an organisms lifetime

• Events and substances can make mutations happen faster than the body’s repair system can handle (aging)

– Replication errors• DNA polymerase has a built-in proofreading

function• Small replication errors are not always fixed

Mutagens

• Agents in the environment that can change DNA– Speed up the rate of replication errors– Can break DNA strands

• Some occur naturally– UV light in sunshine

• Some are artificial– Industrial chemicals– X-ray machines

• If ruin repair mechanisms, may result in cancer

– Some cancer drugs cause mutations in cancer cells at such a high rate the cancer cells can no longer function

Mutation Type Analogy Example of Genetic Disease

Normal THE BIG FAT CAT ATE THE WET RAT

Substitution – Point THE BIZ FAT CAT ATE THE WET RAT Muscular DystrophySickle-Cell Anemia

Deletion – Frameshift THB IGF ATC ATA TET HEW ETR AT Cystic Fibrosis

Insertion - Frameshift THE BIG ZFA TCA TAT ETH EWE TRA Crohn’s Disease

Duplication THE BIG FAT FAT CAT ATE THE WET RAT

Fragile-X Syndrome

Repeats THE BIG FAT CAT CAT CAT ATE THE WET CAT

Huntington’s Disease

Genetic Engineering

• Cloning

• Genetically Modified Foods and Organisms