The Prostate 46:76^85 (2001)

MolecularAnalysis of the Prostate-SpecificAntigenUpstreamGeneEnhancer

George Farmer,1* E. Sander Connolly Jr.,2 J. Mocco,2 and Leonard P. Freedman1

1Cell Biology Program,Memorial Sloan-KetteringCancer Institute,NewYork,NewYork2DepartmentofNeurological Surgery,College of Physiciansand Surgeons,ColumbiaUniversity,

NewYork,NewYork

BACKGROUND. Our objective was to identify factors other than androgen receptor that bindto and regulate the prostate-speci®c antigen (PSA) upstream gene enhancer (PSE).METHODS. DNAse I footprinting and electromobility shift assays (EMSA) were performedover the PSE using lysates from PSA-producing cell lines, LNCaP and LAPC4, and non-producing PSA cell lines, PC-3 cells, U937 monocytes, and Namalwa B cells. Mutationalanalysis and transient transfection assays were used to determine the contributions made bydifferent elements towards the regulation of the enhancer.RESULTS. Three distinct regions surrounding androgen response elements of the PSE werefound to bind unknown ubiquitous and cell type-speci®c proteins. These regions, whenmutated in a PSE reporter construct, were shown to be required for maximal activation inLNCaP cells.CONCLUSIONS. These results correlate unknown sequence-speci®c DNA binding proteinswith androgen-mediated regulation of a prostate-speci®c gene, thus providing further insightinto the mechanism of PSA gene expression. Prostate 46:76±85, 2001. ß 2001 Wiley-Liss, Inc.

KEY WORDS: PSA; androgen; enhancer; transcription

INTRODUCTION

Androgens, in serving as ligands for the androgenreceptor (AR), have been shown to regulate the ex-pression of several prostate-related genes, includingthe one encoding prostate-speci®c antigen (PSA) [1,2].Elevated levels of PSA in the blood are indicative ofprostate disease and demonstrate the direct correla-tion between androgen-regulated PSA expression andprostate cell growth [3]. Almost inevitably, however,despite administration of various androgen-ablationtherapies, tumors become hormone-refractory andeventually fatal [4]. To study this problem, we havebeen using the PSA gene to investigate the molecularbiology of prostate cell growth beyond the level ofandrogen dependency.

PSA promoter activity has been studied extensivelyin the androgen-dependent LNCaP prostate cancercell line. Early studies showed that in these cells, PSAactivity was directly regulated by AR via three dis-tinct androgen response elements, AREI, AREII, andAREIII [5±8]. Importantly, transient transfection data

demonstrated that the PSA promoter is most active inLNCaP cells compared to other nonprostatic cell linessuch as HeLa and CV-1, and in cell lines from higher-grade prostate malignancies such as PC-3 and DU-145[6,8,9]. This holds true despite exogenous expressionof AR in these cells. This suggests that although AR isnecessary, it is not suf®cient for maximal stimulationof the PSA promoter, indicating that other factorspresent in LNCaP cells are also involved.

AREIII, the most important ARE involved in PSAexpression, resides in an upstream enhancer region 4.3kb from the start of PSA transcription. This enhancer,known as the PSA upstream enhancer (PSE), has beenshown to be both necessary and suf®cient for maximaland cell type-speci®c PSA expression [6±10]. Forexample, when subcloned into a luciferase reporter

Grant sponsor: Cap CURE.

*Correspondence to: George Farmer, now at the GlenoldenLaboratory, DuPont Pharmaceuticals Co., Glenolden, PA 19036.E-mail: george.e.farmer@dupontpharma.com

Received 3 May 2000; Accepted 23 August 2000

ß 2001Wiley-Liss, Inc.

construct, the PSE was suf®cient in transient transfec-tion assays to confer androgen induction in LNCaPcells but, consistent with the tissue-speci®c expressionpattern of PSA, was much less responsive to androgenin four other cell types despite the cotransfection of anAR expression plasmid. Recently, ®ve additional low-af®nity AREs close to AREIII have been identi®edwithin a 170-bp region of the PSE that appear toparticipate in cooperative binding of multiple ARmolecules to the enhancer [11]. To different degrees,all six AREs were shown to contribute to activation ofthe PSE, but as shown here, we believe that othertranscription factors, including those expressed solelyin PSA-producing cell lines, may be contributing tocell-type speci®c regulation of this enhancer as well.

Indeed, precedent has already been established forthe involvement of prostate-speci®c transcriptionfactors in prostate gene expression. Patrikainen et al.identi®ed an element in the promoter of the ratprobasin prostate-speci®c gene that interacts with aprostate-speci®c DNA binding activity and that isessential for maximal activation in a transient trans-fection assay [12]. Furthermore, a prostate-speci®cmember of the ets family of transcription factors wasrecently implicated in the regulation of the PSA genepromoter [13]. We have undertaken a similar studywith the PSE and have found three regions close toAREIII that are required for its androgen-mediatedactivation in LNCaP cells. Identi®cation of the proteinsthat bind these sequences should aid us in theunderstanding of what is required for both maximaland tissue-speci®c expression of the PSE, and shouldprovide further insight into androgen-mediated generegulation in the prostate.

MATERIALSANDMETHODS

Transient TransfectionAnalysis

LNCaP cells (University of Colorado HealthSciences Center, Denver, CO) were maintained inRPMI media supplemented with 5% fetal calf serum.Sixteen hours before transfection, 2.5 � 105 cells wereplated into 60-mm dishes in 4 ml of DMEM supple-mented with 5% charcoal-stripped fetal calf serum.Cells were transfected via calcium phosphate pre-cipitation methods, as previously described [5]. Twomicrograms of luciferase reporter plasmid, 0.5 mg ofpCMV-b-galactosidase, and 2 mg of pCMV (as non-speci®c carrier) were included in all transfections.Transfections were performed in duplicate. Luciferaseactivity was normalized to b-galactosidase activity tonormalize for transfection ef®ciency, and plotted ongraphs.

Preparation of Cell Extracts

LNCaP cells were grown in RPMI media supple-mented with 5% fetal calf serum. PC-3 prostatecarcinoma cells, U937 monocytes, MCF-7 breastcarcinoma cells, and Namalwa B-cell lymphoma cells(all from ATCC, Manassas, VA) were grown in DMEMsupplemented with 5% fetal calf serum. Approxi-mately 1� 107 cells were harvested, washed twice inPBS, and suspended in ice cold 300 ml N100 buffer (100mM NaCl, 10 mM HEPES, pH 7.5, 1 mM EDTA, 10%glycerol, 1 mM DTT, and 0.5 mM PMSF), supplemen-ted with 0.1% Nonidet P-40. Suspensions remained onice for 15 min and were spun at 14,000 rpm for 10 min.Supernatants were removed and either used immedi-ately or frozen in liquid nitrogen and stored at ÿ 70�Cfor future use.

DNAse IFootprintingAssay

To identify potential regulatory elements within thePSE, 100 ng of pPSEwt-luc were added to a solutioncontaining 1.5 mg pUC19 DNA, 10 mM TRIS-HCl (pH7.5), 5 mM MgCl2, 100 mM NaCl, 10% glycerol, 0.5 mMspermidine, 1 mM DTT, 4 mg of cell extract, and waterto 50 ml. This mixture was allowed to sit for 30 min atroom temperature. A 2.5-mg/ml solution of DPRFDNAse I (Worthington Biochemical, Lakewood, NJ) inwater was diluted 1:5,000 in D buffer (100 mM NaCl,30 mM CaCl2, 10 mM TRIS-HCl, pH 7.5, 10% glycerol,1 mM EDTA, and 1 mM DTT), and 5 ml were added tomixtures and incubated 90 sec at 23�C. Reactions werestopped with 250 ml S buffer (250 mM NaCl, 0.1% SDS,and 10 mM EDTA), and the DNA was puri®ed byphenol-chloroform extraction followed by ethanolprecipitation. DNA was resuspended in 20 ml of water.DNAse digestion products were analyzed via primerextension analysis via the following method: 2.5� 105

cpm of 5 0 P32 end-labeled DNA oligonucleotide(5 0CTCTCAGATCCAGGCTTGCTTACTGTCC) wasused in a primer extension analysis using exo-VentDNA polymerase (New England Biolabs, Beverly,MA), 1 � Vent polymerase buffer, 1.5 mM MgSO4, 0.5mM dNTPs, and 10 ml of resuspended DNAse-treatedDNA in a 20-ml volume. Extensions were carried out ina thermocycler for 11 cycles (30 sec, 95�C; 30 sec, 65�C;and 30 sec, 72�C), preceded by a 95�C denaturationstep for 4 min. Twenty microliters of formamide stopsolution (95% formamide, 1 mM EDTA, 0.25% xylenecyanol, and 0.25% bromophenol blue) were added toreactions and then incubated at 95�C for 5 min. Twentymicroliters of mix were loaded onto a prerun 6%polyacrylimide gel containing 50% urea in TBE andrun until the xylene cyanol front was halfway downthe gel. The gel was dried and exposed to XOMAT ®lm

Regulation of PSAGene Enhancer 77

(Kodak, Rochester, NY) overnight and then for 3 daysat ÿ 70�C with an intensifying screen.

PhosphocelluloseChromatographyofNamalwaB-CellNuclear Extract

After growth in rotating ¯asks to a density of 2� 106

cells/ml in 6 l of DMEM plus 5% fetal calf serum,Namalwa cell nuclear extract was prepared essentiallyas described [14]. Approximately 30 mg of a Namalwanuclear extract were loaded onto a 5-ml phosphocel-lulose column equilibrated with K100 buffer (100 mMKCl, 10 mM HEPES, pH 7.5, 1 mM EDTA, 10%glycerol, 1 mM DTT, and 0.5 mM PMSF), using anFPLC apparatus (Amersham-Pharmacia Biotech, Pis-cataway, NJ). The ¯ow-through was set aside and thecolumn was washed extensively with K100 bufferuntil no protein eluted from the column. Three columnvolumes of K300 (same as K100 but containing 300mM KCl) were used for protein elution, following acolumn wash with K300 until no protein was detected.The same procedure was repeated with K500.

Electromobility Shift Assays

Double-stranded oligonucleotides corresponding tofp3 binding region of the PSE (5 0GGATTGAAA-ACAGACCTACTCTGG), or oligonucleotides con-taining two point mutations in box A (5 0GGATTGA-AAACCAACCTACTCTGG) or three point mutationsin box B (5 0GGCAGGAAAACAGACCTACTCTGG),were synthesized and radiolabled using Klenowfragment and P32-g-dATP (New England Nuclear,Boston, MA). For analysis of fp4 and fp6, double-stranded oligonucleotides corresponding to the fp4region (5 0GTCTCTGATGAAGATATTA) and the fp6region (5 0GTCCTTGACAGTAAACAAATCTGTTG-TAAG) were used. Stocks were diluted to 40,000cpm/ml, and 20,000 cpm (about 0.5 ml) were mixed in a®nal volume of 10 ml with 10 mM TRIS-HCl (pH 7.5), 5mM MgCl2, 100 mM KCl, 10% glycerol, 1 mM DTT,500 ng poly dI:dC (Boehringer-Mannheim, Indiana-polis, IN), and 2 ml of cell lysates (either straight ordiluted in N100 buffer). Mixtures were allowed to sitfor 30 min at room temperature, and complexes wereresolved on 6% polyacrylimide gels containing 5%glycerol and 0.25 � TBE at 4�C. Gels were dried andexposed to XOMAT ®lm, using an intensifying screenat ÿ 70�C.

Plasmids

PSEwt-luc was constructed by subcloning a 1.53HindIII-XbaI fragment of the PSE into the HindIII and

NheI sites of pE1B-luc, a pGL2 (Promega, Madison,WI) derivative containing the E1B TATA box. A PCRmutagenesis approach was used to construct fp3, fp4,and fp6 deletion mutants, PSED3-luc, PSED4-luc, andPSED6-luc, respectively. To make PSED3-luc, oligo-nucleotides with an XbaI site at the 5 0 end were syn-thesized corresponding to the 3 0 border (5 0CGCTC-TAGATACTCTGGAGGAACATATTGTATCG) andthe 5 0 border (5 0CGCTCTAGAATCCAAGATCAT-GAAGATAATATC) of the fp3 deletion, and used inseparate PCR reactions with primer spanning theE1B TATA box (containing a unique HindIII site(5 0CTCTAGAGTCGACCTGCAGGCATGC) and aregion upstream in the PSE (containing a uniqueMluNI site, 5 0CTCTATTCCCAGCTGGCCAGTGC-AG), respectively. PSEwt-luc was used as the DNAtemplate. PCR products were cut with XbaI and eitherHindIII (for the ®rst product) or MluNI (for thesecond). A ligation was performed using the digestedPCR products and linearized PSEwt-luc, with theMluNI-HindIII 700-bp fragment of the PSE excised.After transformants were grown up, deletion mutantcandidates were analyzed by XbaI digestion andcon®rmed by dideoxy-sequencing analysis to ruleout the presence of PCR-generated mutations. Thesame approach was used to create PSED4-luc andPSED6-luc, using oligonucleotides for the 3 0 boundaryof fp4 (5 0CGCTCTAGATTATCTTCATGATCTTGGA-TTGAAAAC), the 5 0 boundary of fp4 (5 0CGCTCT-AGAGACAAAGGCTGAGCAGGTTTGCAAG), the 3 0

boundary of fp6 (5'CGCTCTAGAATCTGTTGTAA-GAGACATTATCTTTAT), and the 5 0 boundary of fp6(5 0CGCTCTAGAGTCAAGGACAATCGATACAAT-ATGTTCC).

Point mutations in PSEwt-luc were created to makePSEmtA-luc and PSEmtB-luc, using a QuikChangeSite-Directed Mutagenesis Kit (Stratagene, La Jolla,CA) as described by the manufacturer. Complemen-tary oligonucleotides were used to create mutations inbox A (5 0CTTCATGATCTTGGATTGAAAACCAAC-CTACTCTGGAGGAAC) and box B (5 0GATATTA-TCTTCATGATCTTGGCAGGAAAACAGACCTACT-CTGG).

RESULTS

DNAse IFootprintingOver the PSERevealsBothNonspecific andCell Type-Specific

Patterns of Protection

In transient transfection assays, the PSE has beenshown to be most active in LNCaP cells compared toother cell types [6,8,9]. This is consistent with thepattern of PSA expression and that of a transgene

78 Farmeret al.

containing the PSE, both of which are con®ned tothe prostatic epithelium [10]. Therefore, LNCaP cellsshould contain factors, other than AR, that areresponsible for maximal expression of PSE. BesidesAREIII residing in the middle of the enhancer, as wellas ®ve other newly discovered AREs situated through-out [11], we reasoned that sequences surroundingthese AREs might be involved in PSE regulation. Tosearch for candidate sequences, we compared DNAseI protection patterns over the PSE generated by lysatesfrom LNCaP cells (Fig. 1A, lanes 3 and 4) with thosegenerated by lysates from PC-3 cells (Fig. 1A, lanes 5and 6) and U937 monocytes (Fig. 1A, lanes 7 and 8).Primer extension analysis used to visualize DNAse Idigested products surrounding AREIII revealed com-mon patterns of protection after using all three lysates.One of them, designated fp4 (at position ÿ 4195),resided 41 bp 5 0 to AREIII, while another, designatedfp6 (at position ÿ 4116), resided 13 bp 3 0 to AREIII.What we interpret as protection over fp6 by cell lysatesmay otherwise be the loss of a DNAse I hypersensitivesite in this region of the PSE. Nevertheless, somechange occurred over fp6 in the presence of cell extractwhich was probably due to direct binding of a factor(s)to this region (see Fig. 3A).

Of particular interest was the region designated fp3(at position ÿ 4164) residing 15 bp 5 0 to AREIII, whichwas protected solely by the LNCaP cell lysate and notby lysates from either PC-3 or U937 cells. Theseregions of protection are distinct from the ®ve otherAREs (Fig. 1B). AREIII itself was also protected by allthree lysates, which could be due to the contribution ofAR in LNCaP extracts and/or ubiquitously expressedfactors in all three cell lysates [15]. Thus, this DNAse Ifootprint pattern indicates that both LNCaP-speci®cfactors and those with broader expression patternsinteract with the PSE.

DNAse IProtected Regions of the PSEDefineRegulatory Sequences

To determine if the protected regions specifyregulatory elements within the PSE, we constructeda luciferase reporter construct containing a 1.45-kbfragment comprising the PSE upstream from anadenovirus E1B TATA box (PSEwt-luc). Sequencescorresponding to the footprinted regions fp3, fp4, andfp6 (Fig. 1B) were individually deleted from this plas-mid to create PSED3-luc, PSED4-luc, and PSED6-luc,respectively. These plasmids were transiently trans-fected into LNCaP cells to assay their responsivenessto androgen. As shown in Figure 2A, PSEwt-luc wasinduced 25-fold over basal level when the syntheticandrogen, R1881, was included in the culture media.

Fig. 1. DNA binding activities over the PSA upstream enhancer(PSE). A: DNAse I protection assay involving various cell lysates.Each lysate is tested in duplicate.Lanes1and 2, no lysate.Lanes 3and 4, 4 mg LNCaP cell lysate.Lanes 5 and 6, 4 mg PC-3 cell lysate.Lanes 7 and8,4mgU937 cell lysate.Dideoxy-sequencingreactionswererun alongside to determine sequences ofregions ofprotection(not shown). B: A region of the prostate-specific antigen up-stream enhancer containing androgen response element (ARE) III[8], newly discovered AREs [11] (dotted lines), and DNAse I pro-tected regions fp3, fp4, and fp6 (solid lines). ARE IIIB and VI are notnoted on this figure.Numbers correspond to positions within thePSA genepromoter [8].

Regulation of PSAGene Enhancer 79

Reductions of 83%, 93%, and 95% in androgen-mediated activity were measured from PSED3-luc,PSED4-luc, and PSED6-luc, respectively, compared tothe control, PSEwt-luc. These results indicate that thesequences comprising the LNCaP-speci®c region ofprotection, fp3, as well as those comprising thenonspeci®c regions of protection, fp4 and fp6, arenecessary for maximal androgen-mediated activationof the PSE.

Sequence analysis of the fp3 sequence revealedconsensus binding sites for members of the Smadfamily of proteins [16] (Fig. 2B, box A) and humanFast-2 [17] (Fig. 2B, box B). These proteins have beenshown to be downstream effectors of TGF-b signal

transduction pathways [18]. In electromobility shiftassays described below, we attempted to generate``super-shifted'' complexes using Smad-speci®c andFast-speci®c antibodies. However, these experimentswere not conclusive, and hence we were unable toprove a role for either of these proteins in theregulation of PSE (data not shown). Nevertheless, asshown in Figure 2A, individual mutations of box A (5 0-CAGAC to 5 0-CCAAC) and box B (5 0-GATTG to 5 0-GCAGG), creating PSEmtA-luc and PSEmtB-luc,respectively, reduced androgen-mediated activationin LNCaP cells by 66% and 75%, respectively, relativeto the control (Fig. 2A). Although the point mutationsdid not completely abolish activity, we believe theseresults to be signi®cant, since the remaining 1.45 kb ofthe PSE reporter plasmids remained intact.

FactorsThat Bind fp4 and fp6Do So in aSequence-SpecificManner

We next wanted to further examine the nature ofthe DNA binding proteins over these regulatorysequence regions using an electromobility shift assay(EMSA). First, to investigate the nature of proteinbinding to fp4 and fp6, we compared extracts fromLNCaP cells and Namalwa B cells in their ability toshift radiolabled oligonucleotides containing thesesites. We chose Namalwa cells as a generic source ofhuman material since we predicted, based on thefootprinting data, that factors binding fp4 and fp6were expressed ubiquitously. Furthermore, Namalwacells are easy to cultivate and provide a plentifulsource of material for protein puri®cation. As shownin Figure 3A, using a radiolabled oligo correspondingto the fp6 region of the PSE, several complexes weredetected that could be speci®cally competed away byan unlabeled fp6 oligo but not by an oligo of unrelatedsequence (Fig. 3A, arrows; compare lanes 2 and 9 with3±8 and 10±15).

Using the same assay, DNA binding activity overthe fp4 region was also tested, employing chromato-graphically prepared extracts. Due to the large amountof material required for this chromatographic step,Namalwa cells again proved to be a reliable source ofmaterial. As shown in Figure 3B, the fp4 oligo wasshifted by crude Namalwa cell lysates (Fig. 3B, lane 1),which was signi®cantly decreased by inclusion of anunlabeled fp4 oligo (Fig. 3B, lane 2) and only slightlydecreased by inclusion of an oligo of nonspeci®csequence (Fig. 3B, lane 3). Substituting crude lysatewith material prepared after partial puri®cation of theNamalwa cell extract enhanced the differencesbetween inclusion of the cold fp4 and nonspeci®coligos. The eluate from the 0.5 M potassium chloride

Fig. 2. DeletionsinPSAupstreamenhancer (PSE) reduce andro-gen-mediated activation in LNCaP cells.A:Transient transfectionin LNCaP cells. Cells were transfected with plasmids PSEwt-luc,PSED4-luc, PSED6-luc, PSED3-luc, PSEmtA-luc, and PSEmtB-lucand treatedwith either 0.5 nMR1881or an equal volume of ethanolas vehicle control (see Materials and Methods). Luciferase activityfrom each point was normalized to b-galactosidase expression asinternal control (X-axis). B: Sequence of fp3/AREIII regulatoryregion of PSE. Thick lines indicate fp3 and AREIII. Sites for box Aand box B are represented by dotted lines. Sequence correspond-ing to radiolabled oligonucleotide (asterisked line) representsprobe used in electromobility shift assay experiments over fp3(see Fig.4).

80 Farmeret al.

wash of a phosphocellulose column loaded withNamalwa cell extract shifted the radiolabled fp4 oligo(Fig. 3B, lane 4), which could be completely competedaway by excess cold fp4 oligo, and not by excess oligoof an unrelated sequence (Fig. 3B, compare lanes 5 and6). Due to dif®culties in cultivating large amountsof LNCaP cells for the same assay, this procedurewas not performed using LNCaP-derived material.Together, the data indicate that the fp6 and fp4 oligosbind sequence-speci®c DNA binding proteins presentin Namalwa cells. This con®rms our footprinting andtransient transfection data demonstrating that theseregions encode PSE-regulatory elements.

Cell Type-Specific Binding to fp3

Employing EMSA, we next wanted to furtherinvestigate the LNCaP-speci®c DNA binding activitythat interacted with the fp3 regulatory region of thePSE. Using a radiolabled oligonucleotide comprising aregion of the PSE that contains sequences includingfp3 and excluding the AREs (see Fig. 2B), two speci®ccomplexes were generated by LNCaP cell lysates, 1and 2 (Fig. 4A, lanes 1 and 2), that were not generatedby PC-3 (Fig. 4A, lanes 3 and 4) or U937 cell lysates(not shown). Occasionally, a third complex, 3, was alsodetected using this assay (see Fig. 4C). It is not knownwhy we do not consistently detect this complex.Complexes 1 and 2 were also detected using lysatesfrom LAPC4 cells (Fig. 4A, lanes 5 and 6) [19], anotherprostate cell line known to express PSA. Speci®city forbinding to fp3 can be seen in Figure 4B. Formationof complex 1 over the radiolabled fp3 oligo wascompletely inhibited by inclusion of an unlabeled fp3oligo (compare Fig. 4B, lane 1 with lanes 2 and 3) butmuch less so by an oligo of unrelated sequence(compare Fig. 4B, lane 1 with lanes 4 and 5). Formationof complex 2 was affected similarly but to a lesserdegree. Together, these data demonstrate that asequence-speci®c DNA binding activity that interactswith the fp3 sequence is preferentially expressed incell lines that express PSA (e.g., LNCaP and LAPC4)and is not expressed in cell lines that do not (e.g., PC-3and U937).

Transient transfection experiments indicated thatmutations of boxes A and B reduced androgen-mediated activation of the PSE. To determine whetherDNA binding by the fp3-speci®c DNA protein(s) wasaffected by these mutations, we utilized oligos con-taining mutations corresponding to those made inboxes A and B in PSEmtA-luc and PSEmtB-luc,respectively. As shown in Figure 4C, LNCaP-speci®ccomplexes 1, 2, and 3 were detected using the wild-type fp3 oligo (Fig. 4C, lane 4). If the DNA binding

Fig. 3. Ubiquitously expressed sequence-specific DNA bindingproteins interact with fp6 and fp4 of the PSA upstream enhancer(PSE) in electromobility shift assays (EMSA). A: EMSA of an fp6oligo.Lane1, no lysate.Lanes 2^ 8, 2 mg LNCaP lysate.Lanes 9 ^15, 2.0mgNamalwaB cell lysate.Reactionsweremixedalone (lanes2 and 9) or with 0.2 pmol of either the unlabeled fp6 oligo(5 0GTCCTTGACAGTAAACAAATCTGTTGTAAG) (lanes 3 and10), 2.0 pmol fp6 oligo (lanes 4 and11), or 20.0 pmol fp6 oligo (lanes5 and 12), or with 0.2 pmol of a nonspecific oligo (ns) (5 0CTGCC-CACTGCATCCAGCTGGGTCCCCTCCTA) (lanes 6 and 13), 2.0pmol of the nonspecific oligo (lanes 7 and 14), or 20.0 pmol of thenonspecific oligo (lanes 8 and15). Arrows represent sequence-spe-cific DNA/protein interactions over fp6.B: EMSA of an fp4 oligo.Lanes1^3, 2 mg of crudeNamalwa cell lysate.Lanes 4 ^ 6, 300 ng0.5 M KCl phosphocellulose eluate.Lane 7, no protein. Reactionswere supplemented with either 20 pmol of unlabeled fp4 oligo(5 0GTCTCTGATGAAGATATTA) (lanes 2 and 5) or 20 pmol of un-labelednonspecific oligo (ns) (lanes 3 and 6).Freeprobewas run offthe gel to resolve specific (arrow) andnonspecific complexes.

Regulation of PSAGene Enhancer 81

activity over fp3 was involved in regulation of the PSE,then one would expect mutation of the element toaffect DNA binding. Indeed, formation of thesecomplexes was affected by mutations in both boxesA and B. Complexes 1 and 2 were completely abo-lished after mutation of box B (compare Fig. 4C, lanes 4and 5), but only slightly reduced after mutation of boxA (compare Fig. 4C, lanes 4 and 6). However,formation of complex 3 was more strongly inhibitedafter mutation of box A than after mutation of box B

(compare Fig. 4C, lane 4 with lanes 5 and 6). Thus,these data directly correlate DNA binding to fp3 bytwo distinct elements within this region to theregulation of the PSE in LNCaP cells.

DISCUSSION

DNAse I footprinting analysis led to the identi®ca-tion of three regulatory regions of the PSE. Two appear

Fig. 4. Electromobility shift assays of fp3 reveal cell type-specific complexes.Aradiolabledoligonucleotide corresponding to the fp3 regionof the PSAupstreamenhancer (5 0GGATTGAAAACAGACCTACTCTGG)was incubatedwithvarious cell lysates; complexeswereresolvedon 6%polyacrylimidegels. A: Specific complexes1and 2, detectedin LNCaPcells (arrows).Lanes1and 2, 0.02, 0.2, and 2.0mg, respectively,ofLNCaPcell lysate.Lanes 3 and4,0.02,0.2, and2.0mg, respectively, ofPC-3cell lysate.Lanes 5 and6,0.2, and2.0mg, respectively,ofLAPC4cell lysate. B: Sequence-specific DNA binding over fp3. All lanes contain 2.0 mg of LNCaP cell lysate.Lane1, lysate alone.Lanes 2 and 3,inclusion of 0.2 and 2.0 pmol, respectively, of unlabeled fp3 oligo.Lanes 4 and 5, inclusion of 0.2 and 2.0 pmol, respectively, of an oligo ofunrelated sequence (ns). C: Effect ofmutations in boxes A and B onDNAbinding of prostate-specific fp3 binding activity.Radiolabledwild-type fp3 oligo (lanes1and 4) or an oligo containingmutations inbox B (5 0GGCAGGAAAACAGACCTACTCTGG) (lanes 2 and 5) or boxA(5 0GGATTGAAAACCAACCTACTCTGG) (lanes 3 and 6) were used in EMSA. Lanes1^3, no lysate. Lanes 4 ^ 6, 2.0 mg LNCaP cell lysate.Arrows representprostate-specific complexes1^3 over fp3.

82 Farmeret al.

to bind widely expressed factors, while one bindsfactors expressed in two cell lines that normally ex-press PSA. All of these sequences, comprising theprotected regions fp3, fp4, and fp6, proved to berequired for maximal androgen-mediated activationof the PSE. Subsequent ``®ne tuning'' of our approachusing point mutagenesis was successful in furthercharacterization of the fp3 regulatory region.

In light of the recent evidence demonstrating theexistence of low-af®nity AREs surrounding AREIII ofthe PSE, Huang et al. demonstrated that this, incombination with high levels of AR in the prostate,could contribute to the mechanism behind prostate-speci®c PSA gene regulation [11]. However, webelieve this to be only part of the mechanism, sincehigh levels of AR exist in other tissues that do notexpress PSA. For example, only the epithelia, and notthe stroma, of prostatic carcinoma express PSA, eventhough both tissues express equal amounts of AR [20].AR levels are also high in the human testis [21], whichalso does not express PSA. This means that while highlevels of AR in prostatic epithelia may be necessary forprostate-speci®c gene expression of PSA, these levelsare not suf®cient, and that other factors, includingthose that we have discovered here, are also involved.In further support of this notion, others have dis-covered a prostate-speci®c ets transcription factor,named PDEF, that binds throughout the PSA promo-ter and upregulates its activity when overexpressed[13]. Interestingly, this transcription factor may alsodirectly interact with AR to potentiate its activity.

Searches of data bases of transcription factorbinding sites did not reveal clues as to what proteinscould be binding fp4 and fp6. However, it was recentlyobserved that members of the GATA family of trans-cription factors bind to the PSE at various sites, in-cluding two inverted locations at position ÿ 4190 towhere fp4 maps. Point mutation of these sites appearsto have a similar effect on decreasing androgeninducibility of the PSE, as does deletion of fp4 or fp6[15]. Therefore, it is certainly possible that a GATAfactor is binding to fp4 in our footprint and EMSAexperiments.

In search of candidate LNCaP-expressed proteinsthat might interact with the fp3 region, point muta-genesis was carried out in sequences based onhomology to binding sites for known transcriptionfactors. Mutations of box A and box B in the fp3 sequ-ence inhibited to similar degrees androgen induci-bility of the PSE in LNCaP cells, whereas only a pointmutation of box B completely inhibited DNA bindingto the fp3 oligo. This suggests, but certainly does notprove, that a multiprotein complex binds fp3 via twodistinct contacts with boxes A and B. Perhaps oneDNA binding partner binding to box B is suf®cient todetect the complex in vitro, while in vivo bothsequences are required for its functional interactionwith DNA.

Perhaps the activity binding fp3 is not comprised of``classical'' DNA-binding transcriptional activatorswith intrinsic activation domains. Rather, this activitymay operate in another way, maybe by serving anarchitectural role coordinating the interaction of other

Fig. 4. (Continued )

Regulation of PSAGene Enhancer 83

transcription factors binding to PSE. The proximity ofeach of the newly discovered regulatory elements (fp3,fp4, and fp6) to each other and to the other AREs (allwithin a 365-bp range) suggests that regulation of PSEresembles those of enhancers found in the interferonbeta and T-cell receptor alpha promoters. At these loci,members of the high-mobility group family of proteins(HMG) play architectural roles by contorting DNA asto allow for other transcription factors to cooperativelybind on relatively short sequences [22±24]. Suchnucleoprotein complexes have been dubbed ``enhan-cesomes'' and may be a model for other types of celltype-speci®c gene expression [25]. A precedent doesexist for the involvement of HMG proteins in geneactivation by other steroid receptors [26,27], suggest-ing that the PSE could certainly be regulated by similarmeans.

The prostate-speci®c DNA binding activity recentlydiscovered to interact with sequences necessary forprobasin gene regulation [12] is probably not the sameas the activity binding fp3 of the PSE. Interestingly,sequence similarity (5 0-GAAAA-3 0) does exist be-tween the probasin element and the fp3 element.However, this similarity is probably not signi®cant,since the remaining 3 0 sequence of the probasinelement (5 0-TATGATA-3 0) is quite divergent fromthe fp3 3 0 sequence (5 0-CAGACCT-3 0). Furthermore,there is no similarity between 5 0 ¯anking sequences ofthe 5 0-GAAAA-3 0 motif of the probasin promoter andthe 5 0 ¯anking sequence of fp3. Other distinctions existbetween the fp3 binding activity and the probasinenhancer binding activity: 1) probasin enhancerbinding activity is present in both LNCaP and PC-3cells, while fp3 binding activity is only present inLNCaP cells [12], 2) the probasin enhancer is equallyactive in both LNCaP and PC-3 [28,29], while PSE ismuch more active in LNCaP cells [6,8,9], and 3) theprobasin enhancer element that binds prostate-speci®cDNA binding activity is relatively close to the start ofprobasin transcription (position 251) compared to thefp3 element in the PSE (position 4268) [12]. Similarly,the fp3 region probably does not interact with PDEF,since the fp3 region is distinct from the regionsreported to interact with this factor [13].

From the data presented here, at least some of thefactors that bind the fp3 region of PSE are present intwo cell lines, LNCaP and LAPC4 (Fig. 4B), which arederived from moderate-grade prostate tumors and areknown to be androgen-responsive and to express PSA.In contrast, we ®nd that the DNA binding complex isabsent in PC-3 cells, which are derived from a muchmore advanced tumor type [30]. These cells are notresponsive to androgens, do not express PSA, and donot strongly support PSE activity, even when AR isexogenously expressed. This correlation lends cre-

dence to the future possibility that expression of fp3binding proteins might be able to serve as markers forparticular grades of prostate tumors.

ACKNOWLEDGMENTS

We thank Dr. Gary Miller and Kirsten Moffatt forthe LNCaP cell line, Drs. Duc Do and Charles Sawyersfor the LAPC4 cell line, and Dr. Howard Scher forhelpful discussions.

REFERENCES

1. Henntu P, Liao S, Vikho P. Androgens upregulate the humanprostate speci®c antigen messenger ribonucleic acid, but down-regulate the prostatic phosphatase mRNA in LnCaP cells.Endocrinology 1992;130:766±772.

2. Luke MC, Coffey DS. Human androgen receptor binding to theandrogen response element of prostate speci®c antigen. JAndrol 1994;15:41±51.

3. Oesterling JE. Prostate speci®c antigen: a critical assessment ofthe most useful tumor marker for adenocarcinoma of theprostate. J Urol 1991;145:907±923.

4. DiPaola RS. Approaches to the treatment of patients withhormone-sensitive prostate cancer. Semin Oncol [Suppl] 1999;26:24±27.

5. Cleutjens KBJM, van Eekelen CCEM, van der Korput HAGM,Brinkmann AO, Trapman J. Two androgen response regionscooperate in steroid hormone regulated activity of the prostate-speci®c antigen promoter. J Biol Chem 1996;271:6379±6388.

6. Cleutjens KBJM, van der Korput HAGM, van Eekelen CCEM,van Rooij HCJ, Faber PW, Trapman J. An androgen responseelement in a far upstream enhancer region is essential for high,androgen-regulated activity of the prostate-speci®c antigenpromoter. Mol Endocrinol 1997;11:148±160.

7. Pang S, Dannull J, Kaboo R, Xie Y, Tso CL, Michel K, deKernionJB, Belldegrun AS. Identi®cation of a positive regulatoryelement responsible for tissue-speci®c expression of prostate-speci®c antigen. Cancer Res 1997;57:495±499.

8. Schuur ER, Henderson GA, Kmetec LA, Miller JD, LamparskiHG, Henderson D. Prostate-speci®c antigen expression is regu-lated by an upstream enhancer. J Biol Chem 1996; 271:7043±7051.

9. Brookes DE, Zandvliet D, Watt F, Russell PJ, Molloy PL.Relative activity and speci®city of promoters from prostate-expressed genes. Prostate 1998;35:18±26.

10. Cleutjens KBJM, van der Korput HAGM, Ehren-van EekelenCC, Sikes RA, Fasciana C, Chung LW, Trapman J. A 6-kbpromoter fragment mimics in transgenic mice the prostate-speci®c and androgen-regulated expression of the endogenousprostate-speci®c antigen gene in humans. Mol Endocrinol1997;11:1256±1265.

11. Huang W, Shostak Y, Tarr P, Sawyers C, Carey M. Cooperativeassembly of androgen receptor into a nucleoprotein complexthat regulates the prostate-speci®c antigen enhancer. J BiolChem 1999;274:25756±25768.

12. Patrikainen L, Shan J, Porvari K, Vihko P. Identi®cation of thedeoxyribonucleic acid-binding site of a regulatory proteininvolved in prostate-speci®c and androgen receptor-dependentgene expression. Endocrinology 1999;140:2063±2070.

84 Farmeret al.

13. Oettgen P, Finger E, Sun Z, Akbarali Y, Thamrongsak U, BoltaxJ, Grall F, Dube A, Weiss A, Brown L, Quinn G, Kas K, EndressG, Kunsch C, Libermann TA. PDEF, a novel prostate epithe-lium-speci®c ets transcription factor, interacts with the andro-gen receptor and activates prostate-speci®c antigen geneexpression. J Biol Chem 2000;275:1216±1225.

14. Dignam JD, Lebovitz RM, Roeder RG. Accurate transcriptioninitiation by RNA polymerase II in a soluble extract fromisolated mammalian nuclei. Nucleic Acids Res 1983;11:1475±1489.

15. Perez-Stable C, del Las Pazos A, Roos BA. A role for GATAtranscription factors in the androgen regulation of the pro-state-speci®c antigen gene enhancer. Mol Cell Endocrinol2000;167:43±53.

16. Shi Y, Wang Y, Jayaraman L, Yang H, Massague J, Pavletich NP.Crystal structure of a Smad MH1 domain bound to DNA:insights on DNA binding in TGF-beta signaling. Cell1998;94:585±594.

17. Zhou S, Zawel L, Lengauer C, Kinzler KW, Vogelstein B.Characterization of human FAST-1, a TGF beta and activinsignal transducer. Mol Cell 1998;1:611±617.

18. Massague J. TGF-beta signal transduction. Annu Rev Biochem1998;67:753±791.

19. Klein KA, Reiter RE, Redula J, Moradi H, Zhu XL, BrothmanAR, Lamb DJ, Marcelli M, Belldegrun A, Witte ON, Sawyers CL.Progression of metastatic human prostate cancer to androgenindependence in immunode®cient SCID mice. Nat Med1997;3:402±408.

20. Mohler JL, Chen Y, Hamil K, Hall SH, Cidlowski JA, Wilem EM,French FS, Sar M. Androgen and glucocorticoid receptors in thestroma and epithelium of prostatic hyperplasia and carcinoma.Clin Cancer Res 1996;2:889±895.

21. Suarez-Quian CA, Martinez-Garcia F, Nistal M, Regadera J.Androgen receptor distribution in adult human testis. J ClinEndocrinol Metab 1999;84:350±358.

22. Thanos D, Maniatis T. The high mobility group protein HMG-1(Y) is required for NF-KB dependent virus induction of thehuman IFN-b gene. Cell 1992;71:777±789.

23. Giese K, Kingsley C, Kirshner JR, Grosschedl R. Assembly andfunction of a TCRa enhancer complex is dependent on LEF-1-induced DNA bending and multiple protein-protein interac-tions. Genes Dev 1995;9:995±1008.

24. Falvo JV, Thanos D, Maniatis T. Reversal of intrinsic DNAbends in the IFN beta gene enhancer by transcription factorsand the architectural protein HMG I(Y). Cell 1995;83:1101±1111.

25. Tjian R, Maniatis T. Transcriptional activation: a complexpuzzle with few easy pieces. Cell 1994;77:5±8.

26. Boonyaratanakornkit V, Melvin V, Prendergast P, Altmann M,Ronfani L, Bianchi ME, Taraseviciene L, Nordeen SK, AllegrettoEA, Edwards DP. 1998 High-mobility group chromatin proteins1 and 2 functionally interact with steroid hormone receptors toenhance their DNA binding in vitro and transcriptional activityin mammalian cells. Mol Cell Biol 1998;18:4471±4487.

27. Onate SA, Prendergast P, Wagner JP, Nissen M, Reeves R,Pettijohn DE, Edwards DP. The DNA-bending protein HMG-1enhances progesterone receptor binding to its target DNAsequences. Mol Cell Biol 1994;14:3376±3391.

28. Rennie PS, Bruchovsky N, Leco KJ, Sheppard PC, McQueen SA,Cheng H, Snoek R, Hamel A, Bock ME, MacDonald BS, NickelBE, Chang CLS, Cattini PA, Matusik RJ. Characterization of twocis-acting DNA elements involved in the androgen regulationof the probasin gene. Mol Endocrinol 1993;7:23±36.

29. Snoek R, Bruchovsky N, Kasper S, Matusik RJ, Gleave M, SatoN, Mawji NR, Rennie PS. Differential transactivation by theandrogen receptor in prostate cancer cells. Prostate 1998;36:256±263.

30. Kaighn ME, Lechner JF, Narayan KS, Jones LW. Prostatecarcinoma: tissue culture cell lines. NCI Monogr 1978;49:17±21.

Regulation of PSAGene Enhancer 85