molecular and functional characterization of npr1...
TRANSCRIPT
1
PONTIFICIA UNIVERSIDAD CATÓLICA DE CHILE
Facultad de Ciencias Biológicas Programa de Doctorado en Ciencias Biológicas
Mención Genética Molecular y Microbiología
MOLECULAR AND FUNCTIONAL CHARACTERIZATION OF NPR1 IN
PLANT RESPONSES TO ABIOTIC STRESS CONDITIONS
Thesis submitted to the Pontificia Universidad Católica de Chile as a partial requirement to qualify to the Ph.D. degree in Biological Sciences with mention in
Molecular Genetics and Microbiology
By: EMA OLATE
Thesis directors:
Dra. Loreto Holuigue Dr. Julio Salinas
October, 2017
2
3
ACKNOWLEDGMENTS
First and foremost, I wish to thank my advisor Dra. Loreto Holuigue for receiving me
in her laboratory, support me since the days I began working with her constant patience,
attention and professionalism. She given me the opportunity to collaborate and perform my
thesis in the laboratory of Dr. Julio Salinas. I thank Dr. Salinas for getting involved in my
investigation, directing and teaching me to get the best of it.
I remember my first partners in the Holuigue’s lab, and thank them for sharing the
beginnings of this thesis: Loreto, Eva, Marcela, Javier, Grace, Daniel, Anita, Aldo, Ariel and
my great friend Nathy. I also wish to extend many thanks to Salinas’s lab: Tamara, Raul,
Peter, Carlos, Diego, Almudena and especially to the best post docs: Nandy, Javier and
Rafa, all of them for help me in the emotional and academic field.
Finally, special recognition goes out to my family, for their support, encouragement
and patience during my very long Doctorate: Marcos, Jacqueline and Arturo. To my lovely
husband Rafa, who provided constant encouragement during the entire process.
This research was supported by grants BIO2013-47788-R from MINECO and
BIO2016-79187-R from AEI/FEDER, UE to Julio Salinas and by the FONDECYT regular
projects 1141202 (2014-2017) and 1100656 (2010-2013), and the Millennium Nucleus in
Synthetic Biology and Plant Systems Biology (2015-2017, NC130030), to Loreto Holuigue. I
was supported by the National PhD scholarship and a PhD Thesis Support scholarship
(24121288) from CONICYT and by CSIC, i-COOP+ (COOPA20054). I also received support
for my stay period by Vicerrectoría de Investigación of the Pontificia Universidad Católica de
Chile.
4
SUBJECT INDEX
SUBJECT INDEX
ACKNOWLEDGMENTS_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _3 SUBJECT INDEX _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _4 FIGURE INDEX_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 6 TABLE INDEX _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 7 ABREVIATIONS _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 8 EPIGRAPH _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 10 SUMMARY_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _11 ABSTRACT _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 14 SECTION 1
1. THEORETICAL FRAMEWORK 1.1. Plant responses to stress _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ __ _15 1.2. Acclimation to low temperature in plants _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _16 1.3. Signaling pathways involved in cold acclimation _ _ _ _ _ _ _ _ _ _ _ _ _17 1.4. Common mechanisms in response to cold and other abiotic and biotic
stress _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _20 1.5. Role and molecular mechanism of NPR1 in Arabidopsis _ _ _ _ _ _ _ _ 22
2. REFERENCES _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _25 3. HYPOTHESIS AND OBJECTIVES _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 31 SECTION 2 Manuscript “NPR1 MEDIATES A NOVEL REGULATORY PATHWAY IN COLD ACCLIMATION BY INTERACTING WITH HSFA1 FACTORS IN ARABIDOPSIS THALIANA” 1. INTRODUCTION _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 33 2. RESULTS
2.1. NPR1 accumulates in response to low temperature _ _ _ _ _ _ _ _ _ _ _ 38 2.2. NPR1 positively regulates cold acclimation _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 43 2.3. Low temperature-induced monomerization and nuclear import of NPR1 are required for full development of cold acclimation _ _ _ _ _ _ _ _ _ _ _ _ _ _ _47 2.4. NPR1 activates cold-induced gene expression independently of the TGA transcription factors_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 50 2.5. NPR1 promotes the cold induction of HSFA1-regulated genes_ _ _ _ _ 53 2.6. HSFA1 transcription factors positively regulates cold acclimation by inducing heat stress-responsive gene expression under low temperature conditions _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _56 2.7. NPR1 interacts with HSFA1 transcription factors to activate cold-induced heat stress-responsive gene expression and cold acclimation _ _ _ _ _ _ _ _60
3. DISCUSSION _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 64 4. MATERIALS AND METHODS
5
4.1. Plant materials _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 72 4.2. Growth conditions and treatments _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 74 4.3. Gene expression analysis and RNAseq experiments _ _ _ _ _ _ _ _ _ _ 75 4.4. SA measurements _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 77 4.5. Determination of GUS activity _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 77 4.6. Microscopy analysis _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 77 4.7. Immunoblot analysis and subcellular fractionation _ _ _ _ _ _ _ _ _ _ _ _78 4.8. Pull down assays_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 79 4.9. Statistical analyses_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 80 4.10. Accession numbers _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _81
5. LITERATURE_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 96
SECTION 3 1. Conclusions _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 101 2. Projections _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _104
6
FIGURE INDEX
Figure 1_ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 41 Figure 2 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 45 Figure 3_ _ __ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _49 Figure 4 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 52 Figure 5 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 55 Figure 6 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 59 Figure 7 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 62 Figure 8 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 71 Figure Supplementary 1 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _42 Figure Supplementary 2 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _46 Figure Supplementary 3 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _63 Figure Supplementary 4 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _70
7
TABLE INDEX
Supplemental Data Set 1 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 82 Supplemental Data Set 2 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 87 Supplemental Data Set 3 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 89 Supplemental Data Set 4 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 90 Supplemental Data Set 5 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 93 Supplemental Data Set 6 _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ _ 94
8
ABREVIATIONS
ABA : Abscisic acid ABREs : ABA-responsive elements acd6 : Accelerated cell death 6 as-1 : Activation sequence 1 BOP2 : Blade-on-petiole 2 BRs : Brassinosteroids BTB/POZ : Bric-a-brac/POX virus and Zinc finger CBF : C-Repeat/DRE Binding factor Cks : Cytokinins Col-0 : Columbia COR : Cold-regulated CPR : Constitutive expresser of PR genes CRE : Cold-responsive elements CUL3 : Cullin-3 adapter for ubiquitin ligases proteins
DNA : Deoxyribonucleic acid DRE : Dehydration responsive elements EDTA : Ethylenediaminetetraacetic acid ET : Ethylene Gas : Giberellins GFP : Green fluorescent protein HSFA1s : Heat Shock Transcription Factors 1 HSP : Heat Shock Proteins ICS1 : Isochorismate synthase 1 IPTG : Isopropyl β-D-1-thiogalactopyranoside JA : Jasmonic acid mRNA : Messenger RNA MS : Murashige-Skoog medium NahG : bacterial gene coding for salicylate hydroxylase NPR1 : Nonexpresser of PR Genes 1 PMSF : Phenylmethylsulfonyl fluoride PR : Pathogenesis-related PVDF : Polyvinylidene difluoride qPCR : Quantitative polymerase chain reaction ROS : Reactive oxygen species SA : Salicylic acid SAR : Systemic acquired resistance SDS : Sodium lauryl sulfate Siz : Small ubiquitin-like modifier E3 ligase SnRK2.8 : Snf1-Related Protein Kinase Tfs : Transcription factors TGA : Transcription factor family with conserved bZIP region TRXH3 : Thioredoxin H3
9
TRXH5 : Thioredoxin H5 Ws : Wassilewskija WT : Wild type YFP : Yellow fluorescent protein ZAT6 : Zinc finger of Arabidopsis thaliana 6
10
EPIGRAPH
This scientific work contributed to the molecular knowledge of plant responses
to low temperature, describing a new signaling pathway for regulation of cold
acclimation. This pathway is mediated by Nonexpresser of PR Genes 1 (NPR1), the
master coregulator of the systemic response to pathogens attack. We demonstrate
that NPR1, which is transcriptionally and post-transcriptionally regulated by cold,
interacts with Heat Shock Transcription Factors 1 (HSFA1s), regulating a
transcriptional cascade to promote cold acclimation. Therefore, NPR1 represents an
integration node for pathogen and cold signaling, allowing plants to respond and
adapt to their fluctuating environment.
The first section of this thesis considers a discussion of the background
information that gives context and theoretical support to the main biological questions,
the hypothesis and objectives of this research.
The second section includes the manuscript entitled “NPR1 MEDIATES A
NOVEL REGULATORY PATHWAY IN COLD ACCLIMATION BY INTERACTING
WITH HSFA1 FACTORS IN ARABIDOPSIS THALIANA”, that will be submitted for
publication. This manuscript considers all the work done in this thesis.
Finally, the third section includes the main conclusions and projections of this
thesis work, considering the hypothesis and specific aims that motivated it.
11
SUMMARY
Plants are sessile organisms that throughout evolution have developed
complex mechanisms to survive adverse environmental conditions, such as extreme
temperatures and pathogens attack. Plants exposed to low temperatures are able to
activate different adaptive response. One of them is cold acclimation, by which many
plants from temperate regions increase their constitutive freezing tolerance after
exposure to low, nonfreezing temperatures. Low temperature triggers signaling
pathways that activate transcriptional reprogramming and elicit a variety of
physiological and metabolic changes to promote cold acclimation. In Arabidopsis, two
best understood regulatory pathways involved in the regulation of transcriptional
reprogramming under cold acclimation have been extensively studied, which are
mediated by CBFs and ABA. However, these pathways regulate only a small
proportion of the transcription changes occurring under cold stress. In addition, the
transcriptional reprogramming induced by low temperatures prepare plants for other
abiotic stresses (salt, dehydration and drought) and also for biotic stress, but the
molecular mechanism of the last is poorly understood.
In Arabidopsis, NON EXPRESSER PATHOGENESES RELATED GENES1
(NPR1) is the master regulator that control SA-mediated genes activation in response
to systemic acquired resistance (SAR) activated by pathogens. Under basal
conditions, NPR1 is mainly found in the cytoplasm forming oligomers. When SAR is
activated, NPR1 undergoes posttranslational modifications, an internal disulfide bond
12
is reduced by THIOREDOXIN H3 and H5 (TRXH3 and TRXH5 respectively) and is
phosphorylated by SnRK2.8. These structural changes trigger the transition oligomer-
to-monomer and NPR1 is translocated to the nucleus. NPR1 in to nucleus is
associated TGAs transcription factors (TFs) activating SAR transcriptional response,
including PRs genes. Despite the relationship between SAR and low temperatures,
the role of NPR1 in cold stress is unknown.
Here we report the molecular and functional characterization of NPR1 in
response to cold. We identified that NPR1 is induced by low temperature and we
found that NPR1 is a positive regulator of cold acclimation, controlling cold-induced
gene expression. However, our study shows that SA levels do not increase during
cold acclimation in Arabidopsis, and that mutants deficient in SA are not affected in
their capacity to cold acclimate. Furthermore, we analyzed the post-translational
regulation of NPR1 in response to cold and found that the oligomer-to-monomer
transition occurs, and therefore NPR1 is mainly accumulated in the nucleus in
response to low temperatures. This regulation is controlled by TRXH3, TRXH5 and
SnRK2.8, and like in SAR, are necessary for the nuclear import of NPR1. We
analyzed the role of TGAs transcription factor in the regulation of the genes controlled
for NPR1 in cold. We found that NPR1 does not require TGAs for transcriptional gene
regulation under low temperature. Subsequently, we identified cold-regulated genes
controlled by NPR1 through RNAseq and detected an overrepresentation of heat
shock response genes among the genes downregulated in npr1-1 under cold
conditions. These genes are mainly controlled by a redundant family of four
transcription factors HSFA1s (HSFA1a, HSFA1b, HSFA1d, HSFA1e), and we
13
analyzed the expression of these genes in to hsfa1s quadruple mutant. We found that
these genes are controlled by HSFA1s in cold. Finally, we analyzed the interaction of
NPR1 with HSFA1s and we found that this occurs mainly in the nucleus under cold
conditions. In sum, in this study we described a novel signaling pathway dependent of
NPR1 and HSFA1s factors that is required for cold acclimation.
14
ABSTRACT
NPR1 is a master regulator of plant response to pathogens that confers
immunity through a transcriptional cascade mediated by salicylic acid (SA) and the
TGA transcription factors. Little is known, however, about its implication in plant
response to abiotic stress. Here, we provide genetic and molecular evidence
supporting that Arabidopsis NPR1 plays an essential role in cold acclimation by
regulating cold-induced gene expression independently of SA and TGA factors. Our
results demonstrate that, in response to low temperature, cytoplasmic NPR1
oligomers release monomers that translocate to the nucleus where they interact with
heat shock transcription factors HSFA1 to promote the induction of HSFA1-regulated
genes and cold acclimation. As expected, Arabidopsis mutants deficient in HSFA1
factors display reduced capacity to cold acclimate, and cold induction of heat stress-
responsive genes is required for correct development of cold acclimation. All these
findings unveil an unexpected function for NPR1 in plant response to low
temperature, reveal a new regulatory pathway for cold acclimation mediated by NPR1
and HSFA1 factors, and place NPR1 as a central hub integrating cold and pathogen
signaling for a better adaptation of plants to their ever-changing environment.
15
SECTION 1
1. THEORETICAL FRAMEWORK
1.1. Plant responses to stress
Plants, as sessile organisms, are constantly affected by environmental
changes. Furthermore, the proportion of plants affected by multiple stresses is
expected to rise significantly under a climate change scenario (Ahuja et al., 2010).
Abiotic stresses, particularly drought and temperature fluctuations, are more sever
than ever before and are considered to be the major factors limiting crop productivity.
In fact, it has been estimated that approximately 70% of yield losses are due to
unfavorable environmental conditions, as it has been reported for many
socioeconomically important crop species such as maize, wheat, and rice (Liu et al.,
2014; Johnová et al., 2016). Plants have evolved complex mechanisms to survive
under this kind of adverse environmental conditions. Responses to stress are usually
accompanied by major molecular changes, which finally lead to transcriptional
reprogramming (Kaplan et al., 2004). Recent research has made efficient use of
‘omics’ approaches to identify transcriptional, proteomic and metabolic networks
linked to abiotic stress perception and response. Interestingly, cold, drought and
salinity appear to have common sets of biological and molecular responses. Cold is
one of the most important abiotic stress conditions that limit plant geographical
distribution and crop productivity (Liu et al., 2014; Johnová et al., 2016).
16
1.2. Acclimation to low temperature in plants
In this thesis work, we particularly focused in the mechanisms of cold
acclimation in Arabidopsis. Interestingly, some plant species from temperate regions,
such as Triticum aestivum (wheat), Avena sativa (oats), Hordeum vulgare (barley),
Pisum sativum (pea), and Arabidopsis thaliana, have developed the adaptive capacity
to acclimate to cold (Ruelland et al., 2009). This adaptive process allows plants to
increase their constitutive freezing tolerance after exposure to low nonfreezing
temperatures, preparing them for the consequences produced by freezing (Levitt,
1980).
The perception of cold signal seems to begin with changes in the fluidity of
the plasma membrane, cytoskeletal reorganization and imbalance in the
photosynthetic apparatus (Murata and Los, 1997; Wang and Nick, 2001; Gray et al.,
1997). The signal is detected by sensors such as membrane proteins (Ca2+ channels,
phospholipases, histidine kinases) and photosystem II respectively (Ruelland et al.,
2009). This results in the generation of second messengers including Ca2+ and
reactive oxygen species (ROS) (Solanke and Sharma, 2008). The cold signal is then
perceived by different transduction components (Phosphatases, Calmodulins,
Mitogen activated protein kinases) and results finally in a transcriptional
reprogramming of many genes (Solanke and Sharma, 2008).
In 1970, it was proposed that cold acclimation involves alterations in genes
expression (Weiser, 1970). Today, it is well known that most of the physiological and
biochemical changes necessaries for cold acclimation are triggered by cold via
17
changes in gene expression. These changes produce accumulation of stress-related
proteins (dehydrins, antifreeze and cold shock proteins), increase in the stability of
membranes (higher proportion of unsaturated fatty acids and a decrease of
cerebrosides and free sterols), accumulation of sugars (sucrose, galactinol, fructose,
glucose and threalose), amino acids (Ala, Gly, Pro, Ser), polyamines, and betaines,
modification of the photosynthetic machinery (limiting CO2 assimilation, accumulation
of zeaxanthin and flavonoids), increase of ROS scavenging systems (enzymes,
Vitamin E and other antioxidants), and changes in the cell architecture (cell wall
composition, microtubules stabilization) (Ruelland et al., 2009). In fact, in Arabidopsis,
an intensive transcriptional reprogramming that involves 4,087 of the 27,416 genes
(approximately 15% of the genome) is the reason of all of these changes (Zhao et al.,
2016). This massive transcriptional change alters the expression of diverse classes of
genes with a wide range of biological functions. The identification and
characterization of these genes is contributing to the knowledge of the molecular
circuits involved, and potentially will provide tools that can be used to improve plant
tolerance to low temperature.
1.3. Signaling pathways involved in cold acclimation
Research over the last 30 years, primarily using Arabidopsis thaliana as a
model, has identified a large number of genetic changes that take place during cold
acclimation (Medina et al., 2011; Zhao et al., 2016). Many Cold-Regulated genes
(COR) have been identified and characterized in Arabidopsis and other cold tolerant
plant species (Chinnusamy et al., 2007). The best understood pathway that regulates
18
the expression of COR genes in Arabidopsis is mediated by a family of three AP2-
type transcription factors named C-REPEAT (CRT)/DEHIDRATION (DRE)
RESPONSIVE BINDING FACTORs (CBF1, CBF2 and CBF3) (Medina et al., 2011;
Zhao et al., 2016). The expression of the corresponding CBF genes is induced at
early times after the plant is exposed to low temperatures (Medina et al., 2011; Zhao
et al., 2016). These CBFs recognize the cold- and dehydration-responsive elements
(CRT/DRE) in the promoter of several COR genes, which are considered as the CBF
regulon (Liu et al., 1998; Jaglo-Ottosen et al., 1998). CBFs factors regulate only 10%
of the genes differentially expressed during cold acclimation (414 of the 4087 genes
affected under low temperatures), suggesting that other regulatory pathways are also
involved in this regulation (Zhao et al., 2016).
Recent studies have shown that, in parallel with CBF genes, other genes
coding for transcription factors are also up-regulated at early times of cold treatment
(Park et al., 2015). Analysis of transgenic plants overexpressing some of these
transcription factors, such as HSFC1, ZAT12, ZF, ZAT10, and CZF1, showed that
they are also involved in the regulation of COR genes (Park et al., 2015).
Interestingly, some COR genes were found to be coordinately regulated by two or
more transcription factors (Park et al., 2015; Zhao et al., 2016). These results suggest
that COR genes are regulated by a complex low-temperature regulatory network. In
spite of the importance of these discoveries, the expression of the major percentage
of COR genes is still poorly understood.
Plant hormones are important regulators of stress defense responses. In
Arabidopsis, the regulatory pathway mediated by abscisic acid (ABA) has been
19
extensively studied (Xue-Xuan et al., 2010). This hormone accumulates in plant
exposed to low temperature and mutants affected in ABA biosynthesis and perception
show reduced cold acclimation, indicating that ABA is a positive regulator of this
process (Lang et al., 1994; Llorente et al., 2000). Several studies have suggested that
other hormones are also involved in cold signaling. For example, giberellins (GAs)
and cytokinins (CKs) negatively regulate cold acclimation (Barrero-Gil and Salinas,
2017). Accordingly, plants affected in GAs and CKs perception and signaling show
more cold acclimation capacity (Achard et al., 2008; Jeon et al., 2010; Jeon and Kim,
2013). On the other hand, ethylene (ET), jasmonic acid (JA) and brassinosteroids
(BRs) positively regulate cold acclimation. Accordingly, mutants deficient in
biosynthesis or signaling of these hormones display decreased capacity to cold
acclimate (Catalá et al., 2014; Hu et al., 2013; Eremina et al., 2016).
The role of salicylic acid (SA) in cold acclimation is controversial. It has been
reported that SA levels increase in response to cold in many plant species such as
Arabidopsis, cucumber, wheat, and grape berry (Scott et al., 2004; Wan et al., 2009;
Kosova et al., 2012), suggesting that SA may be involved in cold responses.
Nevertheless, although in Arabidopsis the SA accumulation after cold treatment is
mediated by the isochorismate synthase 1 (ICS1) pathway, the ics1 mutant is not
affected in cold acclimation (Kim et al., 2013). In contrast, it has been reported that
some mutants that accumulate SA, such as small ubiquitin-like modifier (SUMO) E3
ligase (siz1) and accelerated cell death 6 (acd6), are more sensitive to freezing
temperatures after cold acclimation, suggesting a negative control of SA on this
20
process (Miura and Ohta, 2010). In sum, further investigations are needed to precise
the role of SA signaling in plant responses to cold.
1.4. Common mechanisms in response to cold and other abiotic and biotic
stress
As mentioned above, it has been reported that plant responses to cold,
salinity and drought share common regulatory elements (Huang et al., 2012). This is
the case of the phytohormone ABA, which main function seems to be the regulation
of plant water balance and osmotic stress tolerance, influencing therefore the
response to cold, salinity and drought (Xue-Xuan et al., 2010). For instance, ABA
deficient mutants are highly susceptible to drought, salinity and cold stress conditions
(Huang et al., 2012). Furthermore, some stress responsive genes such as COR
genes (COR78/RD29A/LTI78, COR47, COR15a, COR 6.6) show transcriptional
activation in response to dehydration, cold stress and ABA treatments (Huang et al.,
2012). The promoter of these COR genes contain dehydration responsive elements
(DRE), C-Repeats (CRT) or ABA response elements (ABREs) (Yamaguchi-Shinozaki
and Shinozaki, 1994; Stockinger et al., 1997). Furthermore, constitutive or stress-
inducible overexpression of CBF1 or CBF3 in transgenic plants enhance freezing,
drought and salt-stress tolerance in Brassica, tomato, tobacco, wheat and rice
(Huang et al., 2012).
Mutants that have impaired the signaling mediated by other hormones such as ET
and JA, not only are deficient in cold acclimation, but also in defense responses to
salinity and drought stress (Kazan, 2015).
21
Interestingly, common mechanisms in the responses to cold and biotic stress
have been also found. For instance, exposure of plants to low temperatures activates
plant immunity and protects plants to pathogen infection, and vice versa, pathogens
attack provided plant freezing tolerance (Cheng et al., 2013; Seo et al., 2010).
Indeed, some regulated genes activated during transcriptional reprogramming in cold,
show important connection with biotic stresses (Kim et al., 2012). For example,
pathogenesis-related (PR) genes that are activated in response to low temperatures
(Wang et al., 2005; Uknes et al., 1992), such as pathogenesis related gene 1 (PR1),
beta 1,3 glucanase 2 (PR2), and pathogenesis related gene 5 (PR5), have been
described to play an antimicrobial role (Janská et al., 2010; Uknes et al., 1992).
Furthermore, other genes such as constitutive expresser of PR genes 1 and 5 (CPR1,
CPR5) and zinc finger of Arabidopsis thaliana 6 (ZAT6), are positive regulators of
acquired freezing tolerance and resistance against pathogenic bacteria (Bowling et
al., 1994, 1997; Shi et al., 2014; Yang et al., 2010). Other studies showed that some
mutants, such as siz1 and acd6, that are defective in their capacity of cold
acclimation, are also more resistant to bacterial infections (Miura and Ohta, 2010).
This evidence supports the existence of signaling crosstalk that integrate low
temperatures and pathogens infections.
1.5. Role and molecular mechanism of NPR1 in Arabidopsis
This thesis work reports that NPR1, a transcriptional co-activator that control
SA-mediated genes activation in response to pathogens, also plays a crucial role in
the genetic development of cold acclimation.
22
NPR1 belongs to the family of BTB-ankryin proteins, which contain two
conserved protein-protein interaction motifs: a BTB/POZ domain (for Broad Complex,
Tramtrack, and Bric-a-brac/POX virus and Zinc finger) at the N-terminus and four
ankryin motifs near the C-terminus (Khan et al., 2014). The Arabidopsis genome
codes for six BTB-ankryin proteins: NPR1 and three NPR1-like proteins (NPR2,
NPR3 and NPR4) that are involved in the response to pathogens, and BOP1 and
BOP2 (blade-on-petiole 1 and 2) that comprise a separate subclade in the
phylogenetic tree (Khan et al., 2014). NPR1 is the best characterized protein from this
family and is the master coactivator of SA signaling pathway in response to pathogen
infections. NPR1 regulates most of the SA-induced genes, being a key node in the
signaling pathway downstream SA (Wang et al., 2006; Blanco el at., 2009 Fu and
Dong, 2013). NPR1 is transcriptionally activated by SA and this regulation involves
direct binding of WRKY transcription factors to a W-box in NPR1 gene promoter (Yu
et al., 2001). NPR1 is a coactivator that does not have a known DNA-binding
domains, but has BTB/POZ and ANKIRIN domains that are able to interact with other
proteins such as transcription factors (Cao et al., 1997). Interestingly, NPR1 levels
and nuclear translocation in response to pathogens is mainly controlled by
posttranslational modifications, such as reduction of internal disulfide bonds,
phosphorylation, nitrosylation, ubiquitination and sumoylation (Withers and Dong,
2016).
Under basal conditions, NPR1 protein is found mainly in the cytoplasm of cells
as an oligomer (Tada et al., 2008). Upon pathogen attack, SA promotes the reduction
of a disulfide bond formed among two conserved cysteine residues of NPR1 (Mou et
23
al., 2003). This reduction is catalyzed by thioredoxin H3 and H5 (TRXH3 and TRXH5
respectively), and by phosphorylation by SNF1-related protein kinase 2.8 (SnRK2.8),
which allows the transition from oligomeric to monomeric forms (Tada et al., 2008;
Lee et al., 2015). The monomeric form of NPR1 is then translocated from the
cytoplasm to the nucleus, where it activates gene expression (Kinkema et al., 2000).
For this function, it has been described that NPR1 is able to interact with TGA motif-
binding proteins (TGA transcription factors), producing the activation of PR genes
expression (Saleh et al., 2015; Fu and Dong, 2013). The interaction of NPR1 with
TGAs has been extensively studied. In Arabidopsis, the TGA factors family has 10
members, but only redundant class II (TGA2, TGA5, TGA6) showed strong affinity for
NPR1 and are necessary for the induction of NPR1-dependent genes in SAR
(Subramaniam et al., 2001; Fan and Dong, 2002; Zhang et al., 2003). In addition,
recent studies on the NPR1 homologs NPR3 and NPR4, showed that they are
adaptor proteins for the CUL3 E3 ligase, which specifically target NPR1 for
degradation in a SA concentration-dependent manner (Fu et al., 2012). Under basal
conditions, SA levels are low and NPR1 is constantly ubiquitinated through NPR4 and
degraded by CUL3NPR4, but under pathogens attack SA increases and NPR1 interacts
directly with NPR3, then NPR1 degradation is mediated by CUL3NPR3 (Fu et al.,
2012). Nuclear accumulation of NPR1 is required for basal defense gene expression
(Fu et al., 2012).
The role of NPR1 in plant responses to abiotic stress conditions is poorly
understood. It has been described that upon salt stress NPR1 is important for ionic
homeostasis in Arabidopsis roots, but it seems that it does not play a role in salt
24
tolerance (Jayakannan et al., 2015; Hao et al., 2012). In addition, in transcriptomic
data bases NPR1 transcripts do not appears accumulate under in salt and drought
stress conditions, but this is not case under low temperatures where NPR1 mRNAs is
seen to accumulate (Kilian et al., 2007; Seo et al., 2010).
Here, we report the novel molecular and functional characterization of
Arabidopsis NPR1 in the cold acclimation process. Results from this work discovered
a novel signaling pathway controlled by NPR1 in the response to low temperature.
25
2. REFERENCES
Achard, P., Gong, F., Cheminant, S., Alioua, M., Hedden, P., and Genschik, P. (2008). The cold-inducible CBF1 factor-dependent signaling pathway modulates the accumulation of the growth-repressing DELLA proteins via its effect on gibberellin metabolism. Plant Cell 20: 2117–2129.
Ahuja, I., de Vos, R.C.H., Bones, A.M., and Hall, R.D. (2010). Plant molecular
stress responses face climate change. Trends Plant Sci. 15: 664–674. Barrero-Gil, J. and Salinas, J. (2017). CBFs at the Crossroads of Plant Hormone
Signaling in Cold Stress Response. Mol. Plant 10: 542–544. Blanco, F., Salinas, P., Cecchini, N.M.N.M., Jordana, X., Van Hummelen, P.,
Alvarez, M.E.M.E., and Holuigue, L. (2009). Early genomic responses to salicylic acid in Arabidopsis. Plant Mol. Biol. 70: 79–102.
Bowling, S. a, Clarke, J.D., Liu, Y., Klessig, D.F., and Dong, X. (1997). The cpr5
mutant of Arabidopsis expresses both NPR1-dependent and NPR1-independent resistance. Plant Cell 9: 1573–1584.
Bowling, S. a, Guo, a, Cao, H., Gordon, a S., Klessig, D.F., and Dong, X. (1994).
A mutation in Arabidopsis that leads to constitutive expression of systemic acquired resistance. Plant Cell 6: 1845–1857.
Cao, H., Glazebrook, J., Clarke, J.D., Volko, S., and Dong, X. (1997). The
Arabidopsis NPR1 gene that controls systemic acquired resistance encodes a novel protein containing ankyrin repeats. Cell 88: 57–63.
Catalá, R., López-Cobollo, R., Mar Castellano, M., Angosto, T., Alonso, J.M.,
Ecker, J.R., and Salinas, J. (2014). The Arabidopsis 14-3-3 protein RARE COLD INDUCIBLE 1A links low-temperature response and ethylene biosynthesis to regulate freezing tolerance and cold acclimation. Plant Cell 26: 3326–3342.
Cheng, C., Gao, X., Feng, B., Sheen, J., Shan, L., and He, P. (2013). Plant immune
response to pathogens differs with changing temperatures. Nat Commun 4: 2530.
Chinnusamy, V., Zhu, J.-K., and Sunkar, R. (2010). Gene regulation during cold
stress acclimation in plants. Methods Mol. Biol. 639: 39–55. Chinnusamy, V., Zhu, J., and Zhu, J.-K. (2007). Cold stress regulation of gene
expression in plants. Trends Plant Sci. 12: 444–451.
26
Eremina, M., Unterholzner, S.J., Rathnayake, A.I., Castellanos, M., Khan, M., Kugler, K.G., May, S.T., Mayer, K.F.X., Rozhon, W., and Poppenberger, B. (2016). Brassinosteroids participate in the control of basal and acquired freezing tolerance of plants. Proc. Natl. Acad. Sci. U. S. A. 113: E5982–E5991.
Fan, W. and Dong, X. (2002). In vivo interaction between NPR1 and transcription
factor TGA2 leads to salicylic acid-mediated gene activation in Arabidopsis. Plant Cell 14: 1377–1389.
Fu, Z.Q. and Dong, X. (2013). Systemic acquired resistance: turning local infection
into global defense. Annu. Rev. Plant Biol. 64: 839–863. Fu, Z.Q., Yan, S., Saleh, A., Wang, W., Ruble, J., Oka, N., Mohan, R., Spoel, S.H.,
Tada, Y., Zheng, N., and Dong, X. (2012). NPR3 and NPR4 are receptors for the immune signal salicylic acid in plants. Nature 486: 228–232.
Gray, G.R., Chauvin, L.P., Sarhan, F., and Huner, N. (1997). Cold Acclimation and
Freezing Tolerance (A Complex Interaction of Light and Temperature). Plant Physiol. 114: 467–474.
Hao, L., Zhao, Y., Jin, D., Zhang, L., Bi, X., Chen, H., Xu, Q., Ma, C., and Li, G.
(2012). Salicylic acid-altering Arabidopsis mutants response to salt stress. Plant Soil 354: 81–95.
Hu, Y., Jiang, L., Wang, F., and Yu, D. (2013). Jasmonate regulates the inducer of
cbf expression-C-repeat binding factor/DRE binding factor1 cascade and freezing tolerance in Arabidopsis. Plant Cell 25: 2907–2924.
Huang, G.-T., Ma, S.-L., Bai, L.-P., Zhang, L., Ma, H., Jia, P., Liu, J., Zhong, M.,
and Guo, Z.-F. (2012). Signal transduction during cold, salt, and drought stresses in plants. Mol. Biol. Rep. 39: 969–987.
Jaglo-Ottosen, K.R., Gilmour, S.J., Zarka, D.G., Schabenberger, O., and
Thomashow, M.F. (1998). Arabidopsis CBF1 overexpression induces COR genes and enhances freezing tolerance. Science 280: 104–106.
Janská, A., Maršík, P., Zelenková, S., and Ovesná, J. (2010). Cold stress and
acclimation - what is important for metabolic adjustment? Plant Biol. 12: 395–405.
Jayakannan, M., Bose, J., Babourina, O., Shabala, S., Massart, A.,
Poschenrieder, C., and Rengel, Z. (2015). The NPR1-dependent salicylic acid signalling pathway is pivotal for enhanced salt and oxidative stress tolerance in Arabidopsis. J. Exp. Bot. 66: 1865–1875.
Jeon, J. and Kim, J. (2013). Arabidopsis Response Regulator1 and Arabidopsis
27
Histidine Phosphotransfer Protein2 (AHP2), AHP3, and AHP5 Function in Cold Signaling. Plant Physiol. 161: 408–424.
Jeon, J., Kim, N.Y., Kim, S., Kang, N.Y., Novák, O., Ku, S.J., Cho, C., Lee, D.J.,
Lee, E.J., Strnad, M., and Kim, J. (2010). A subset of cytokinin two-component signaling system plays a role in cold temperature stress response in Arabidopsis. J. Biol. Chem. 285: 23371–23386.
Johnová, P., Skalák, J., Saiz-Fernández, I., and Brzobohatý, B. (2016). Plant
responses to ambient temperature fluctuations and water-limiting conditions: A proteome-wide perspective. Biochim. Biophys. Acta - Proteins Proteomics 1864: 916–931.
Kaplan, F., Kopka, J., Haskell, D.W., Zhao, W., Schiller, K.C., Gatzke, N., Sung,
D.Y., and Guy, C.L. (2004). Exploring the Temperature-Stress Metabolome of Arabidopsis. Plant Physiol. 136: 4159–4168.
Kazan, K. (2015). Diverse roles of jasmonates and ethylene in abiotic stress
tolerance. Trends Plant Sci. 20: 219–229. Khan, M., Xu, H., and Hepworth, S.R. (2014). BLADE-ON-PETIOLE genes: Setting
boundaries in development and defense. Plant Sci. 215–216: 157–171. Kilian, J., Whitehead, D., Horak, J., Wanke, D., Weinl, S., Batistic, O., D’Angelo,
C., Bornberg-Bauer, E., Kudla, J., and Harter, K. (2007). The AtGenExpress global stress expression data set: protocols, evaluation and model data analysis of UV-B light, drought and cold stress responses. Plant J. 50: 347–363.
Kim, M.J., Park, M.-J., Seo, P.J., Song, J.-S., Kim, H.-J., and Park, C.-M. (2012).
Controlled nuclear import of the transcription factor NTL6 reveals a cytoplasmic role of SnRK2.8 in the drought-stress response. Biochem. J. 448: 353–363.
Kim, Y., Park, S., Gilmour, S.J., and Thomashow, M.F. (2013). Roles of CAMTA
transcription factors and salicylic acid in configuring the low-temperature transcriptome and freezing tolerance of Arabidopsis. Plant J. 75: 364–376.
Kinkema, M., Fan, W., and Dong, X. (2000). Nuclear Localization of NPR1 Is
Required for Activation of PR Gene Expression. Plant Cell 12: 2339-2350 Kosová, K., Prášil, IT., Vítámvás, P., Dobrev, P., Motyka, V., Floková, K., Novák,
O., Turečková, V., Rolčik, J., Pešek, B., Trávničková, A., Gaudinová, A., Galiba, G., Janda, T., Vlasáková, E., Prášilová, P., Vanková, R. (2012). Complex phytohormone responses during the cold acclimation of two wheat cultivars differing in cold tolerance, winter Samanta and spring Sandra. J. Plant Physiol. 169: 567–576.
28
Lang, V., Mantyla, E., Welin, B., Sundberg, B., and Palva, E.T. (1994). Alterations in Water Status, Endogenous Abscisic Acid Content, and Expression of rab18 Gene during the Development of Freezing Tolerance in Arabidopsis thaliana. Plant Physiol. 104: 1341–1349.
Lee, H.-J., Park, Y.-J., Seo, P.J., Kim, J.-H., Sim, H.-J., Kim, S.-G., and Park, C.-M.
(2015). Systemic Immunity Requires SnRK2.8-Mediated Nuclear Import of NPR1 in Arabidopsis. Plant Cell 1: 3425-3428
Levitt, J. (1980). Responses of Plants to Environmental Stress. Chilling, Freezing,
and High Temperature Stresses, 2nd ed. (New York: Academic Press). Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S., Yamaguchi-Shinozaki, K.,
and Shinozaki, K. (1998). Two Transcription Factors, DREB1 and DREB2, with an EREBP/AP2 DNA Binding Domain Separate Two Cellular Signal Transduction Pathways in Drought- and Low-Temperature-Responsive Gene Expression, Respectively, in Arabidopsis. Plant Cell 10: 1391-1406.
Liu, Y., Yu, D., Su, Y., and Hao, R. (2014). Quantifying the effect of trend,
fluctuation, and extreme event of climate change on ecosystem productivity. Environ. Monit. Assess. 186: 8473–8486.
Llorente, F., Oliveros, J.C., Martínez-Zapater, J.M., and Salinas, J. (2000). A
freezing-sensitive mutant of Arabidopsis, frs1, is a new aba3 allele. Planta 211: 648–655.
Medina, J., Catalá, R., and Salinas, J. (2011). The CBFs: Three arabidopsis
transcription factors to cold acclimate. Plant Sci. 180: 3–11. Miura, K. and Ohta, M. (2010). SIZ1, a small ubiquitin-related modifier ligase,
controls cold signaling through regulation of salicylic acid accumulation. J. Plant Physiol. 167: 555–560.
Mou, Z., Fan, W., and Dong, X. (2003). Inducers of plant systemic acquired
resistance Regulate NPR1 function through redox changes. Cell 113: 935–944.
Murata, N. and Los, D.A. (1997). Membrane Fluidity and Temperature Perception.
Plant Physiol. 115: 875–879. Park, S., Lee, C.M., Doherty, C.J., Gilmour, S.J., Kim, Y., and Thomashow, M.F.
(2015). Regulation of the Arabidopsis CBF regulon by a complex low-temperature regulatory network. Plant J. 82: 193–207.
Ruelland, E., Vaultier, M.N., Zachowski, A., and Hurry, V. (2009). Chapter 2 Cold
Signalling and Cold Acclimation in Plants. Adv. Bot. Res. 49: 35–150.
29
Saleh, A., Withers, J., Mohan, R., Marqués, J., Gu, Y., Yan, S., Zavaliev, R.,
Nomoto, M., Tada, Y., and Dong, X. (2015). Posttranslational modifications of the master transcriptional regulator NPR1 enable dynamic but tight control of plant immune responses. Cell Host Microbe 18: 169–182.
Scott, I.M., Clarke, S.M., Wood, J.E., and Mur, L. a J. (2004). Salicylate
accumulation inhibits growth at chilling temperature in Arabidopsis. Plant Physiol. 135: 1040–1049.
Seo, P.J., Kim, M.J., Park, J.-Y., Kim, S.-Y., Jeon, J., Lee, Y.-H., Kim, J., and
Park, C.-M. (2010). Cold activation of a plasma membrane-tethered NAC transcription factor induces a pathogen resistance response in Arabidopsis. Plant J. 61: 661–671.
Shi, H., Wang, X., Ye, T., Cheng, F., Deng, J., Yang, P., Zhang, Y., and Chan, Z.
(2014). The Cysteine2/Histidine2-Type Transcription Factor ZINC FINGER OF ARABIDOPSIS THALIANA6 Modulates Biotic and Abiotic Stress Responses by Activating Salicylic Acid-Related Genes and C-REPEAT-BINDING FACTOR Genes in Arabidopsis. Plant Physiol. 165: 1367–1379.
Solanke, A.U. and Sharma, A.K. (2008). Signal transduction during cold stress in
plants. Physiol. Mol. Biol. PlantsPhysiol. Mol. Biol. Plants 14: 69–79. Stockinger, E.J., Gilmour, S.J., and Thomashow, M.F. (1997). Arabidopsis thaliana
CBF1 encodes an AP2 domain-containing transcriptional activator that binds to the C-repeat/DRE, a cis-acting DNA regulatory element that stimulates transcription in response to low temperature and water deficit. Proc. Natl. Acad. Sci. U. S. A. 94: 1035–1040.
Subramaniam, R., Desveaux, D., Spickler, C., Michnick, S.W., and Brisson, N.
(2001). Direct visualization of protein interactions in plant cells. Nat. Biotechnol. 19: 769–772.
Tada, Y., Spoel, S.H., Pajerowska-Mukhtar, K., Mou, Z., Song, J., Wang, C., Zuo,
J., and Dong, X. (2008). Plant immunity requires conformational changes [corrected] of NPR1 via S-nitrosylation and thioredoxins. Science 321: 952–956.
Uknes, S., Mauch-Mani, B., Moyer, M., Potter, S., Williams, S., Dincher, S.,
Chandler, D., Slusarenko, A., Ward, E., and Ryals, J. (1992). Acquired resistance in Arabidopsis. Plant Cell 4: 645–56.
Wan, S.B., Tian, L., Tian, R.R., Pan, Q.H., Zhan, J.C., Wen, P.F., Chen, J.Y.,
Zhang, P., Wang, W., and Huang, W.D. (2009). Involvement of phospholipase D in the low temperature acclimation-induced thermotolerance in grape berry. Plant Physiol. Biochem. 47: 504–510.
30
Wang, D., Amornsiripanitch, N., and Dong, X. (2006). A genomic approach to
identify regulatory nodes in the transcriptional network of systemic acquired resistance in plants. PLoS Pathog 2: 1042-1050.
Wang, D., Weaver, N.D., Kesarwani, M., and Dong, X. (2005). Induction of protein
secretory pathway is required for systemic acquired resistance. Science 308: 1036–1040.
Wang, Q.Y. and Nick, P. (2001). Cold acclimation can induce microtubular cold
stability in a manner distinct from abscisic acid. Plant Cell Physiol. 42: 999–1005. Weiser, C.J. (1970). Cold Resistance and Injury in Woody Plants. Science 169.
1269-78 Withers, J. and Dong, X. (2016). Posttranslational Modifications of NPR1: A Single
Protein Playing Multiple Roles in Plant Immunity and Physiology. PLoS Pathog. 12: 1-9.
Xue-Xuan, X., Hong-Bo, S., Yuan-Yuan, M., Gang, X., Jun-Na, S., Dong-Gang, G.,
and Cheng-Jiang, R. (2010). Biotechnological implications from abscisic acid (ABA) roles in cold stress and leaf senescence as an important signal for improving plant sustainable survival under abiotic-stressed conditions. Crit. Rev. Biotechnol. 30: 222–230.
Yamaguchi-Shinozaki, K. and Shinozaki, K. (1994). A novel cis-acting element in
an Arabidopsis gene is involved in responsiveness to drought, low-temperature, or high-salt stress. Plant Cell 6: 251–64.
Yang, H., Shi, Y., Liu, J., Guo, L., Zhang, X., and Yang, S. (2010). A mutant CHS3
protein with TIR-NB-LRR-LIM domains modulates growth, cell death and freezing tolerance in a temperature-dependent manner in Arabidopsis. Plant J. 63: 283–296.
Yu, D., Chen, C., and Chen, Z. (2001). Evidence for an important role of WRKY DNA
binding proteins in the regulation of NPR1 gene expression. Plant Cell 13: 1527–1540.
Zhang, Y., Tessaro, M.J., Lassner, M., and Li, X. (2003). Knockout Analysis of
Arabidopsis Transcription Factors TGA2, TGA5, and TGA6 Reveals Their Redundant and Essential Roles in Systemic Acquired Resistance. Plant Cell 15: 2647–2653.
Zhao, C., Zhang, Z., Xie, S., Si, T., Li, Y., and Zhu, J.-K. (2016). Mutational
Evidence for the Critical Role of CBF Genes in Cold Acclimation in Arabidopsis. Plant Physiol. 171: 2744-2759
31
3. HYPOTHESIS AND OBJECTIVES
HYPOTHESIS
NPR1 regulates abiotic stress responses in Arabidopsis thaliana.
GENERAL AIM
To characterize the role of Arabidopsis NPR1 in abiotic stress responses.
SPECIFIC AIMS: 1. Molecular characterization of NPR1 in response to abiotic stress in Arabidopsis
1.1. To determine the accumulation of NPR1 transcript in response to abiotic stresses.
1.2. To evaluate the subcellular localization of NPR1 under control and low temperature conditions.
2. Functional characterization of NPR1 in the cold acclimation response
2.1. To evaluate the cold acclimation capacity of NPR1 mutants (npr1-1 and npr1-2), complemented mutants (c-npr1), and overexpressing NPR1 (35S-NPR1-GFP) plants.
2.2. To determine the regulatory pathways through which NPR1 regulates cold acclimation.
32
SECTION 2
Short title: NPR1 is a positive regulator of cold acclimation in Arabidopsis thaliana.
TITLE
NPR1 MEDIATES A NOVEL REGULATORY PATHWAY IN COLD
ACCLIMATION BY INTERACTING WITH HSFA1 FACTORS IN ARABIDOPSIS THALIANA
Authors: Ema Olate1,3, José M Jiménez-Gómez2, Loreto Holuigue1. and Julio Salinas3,* 1Departamento de Genética Molecular y Microbiología, Facultad de Ciencias Biológicas, Pontificia
Universidad Católica de Chile. 2Institut Jean-Pierre Bourgin, INRA, AgroParisTech, CNRS, Université Paris-Saclay, RD10, 78026
Versailles Cedex, France 3Departamento de Biología Medioambiental, Centro de Investigaciones Biológicas, CSIC, 28040
Madrid, Spain
* Corresponding author
33
1. INTRODUCTION
Low temperature is a major environmental stress that adversely affects the growth
and development of plants, determines their geographic distribution and limits
crop productivity. Many plants from temperate regions, including Arabidopsis,
have evolved an adaptive process whereby their constitutive freezing tolerance
increases after being exposed to low nonfreezing temperatures (Levitt, 1980). This
process, named cold acclimation, is complex and involves many physiological and
biochemical changes (Ruelland et al., 2009). Research over the last decades has
shown that most of these changes are controlled by low temperature through
changes in gene expression. Arabidopsis, for instance, reprograms its
transcriptome during cold acclimation involving more than 3000 genes (Zhao et
al., 2016). Unfortunately, however, the role that the vast majority of these genes
play in this adaptive process and the signaling pathways through which they
operate remain to be elucidated. The best characterized pathway is mediated by a
family of three transcription factors, named CBF1 to CBF3, that are estimated to
control the induction of around 12% of the Arabidopsis cold-responsive genes (Jia
et al., 2016). Plant hormones also have a significant function in cold signaling.
Low temperature induces changes in the levels of abscisic acid (ABA), ethylene
(ET), jasmonic acid (JA) and gibberellins (GA), and it has been shown that ABA,
ET, JA, GA and brassinosteroids (BRs) signaling contribute to the regulation of
cold acclimation (Barrero-Gil and Salinas, 2017). Salicylic acid (SA) accumulates
34
in response to cold in several species (Miura and Tada, 2014) but its function in
the process still needs further investigation.
In plants, accumulating evidence indicate that low temperature interacts with other
environmental cues. Interestingly, several studies support that cold signals are
closely associated with defense responses. Thus, a number of pathogenesis-
related (PR) proteins, such as β-1,3-glucanases, endochitinases, and thaumatin-
like proteins, accumulate in winter rye during cold acclimation (Hon et al., 1995;
Pihakaski-Maunsbach et al., 2001). It is worth mentioning that these proteins, in
addition of having a role in freezing tolerance, function in pathogen resistance
(Griffith and Yaish, 2004). How low temperature induces their accumulation and
triggers pathogen resistance is still largely unknown. In Arabidopsis, some cold-
regulated transcription factors, including the plasma membrane-bound NAC
transcription factor NTL6 and the C2H2-type Zinc finger transcription factor
AtZAT6, have been reported to directly binding to the promoter regions of PR
genes thus inducing PR expression and enhancing resistance to pathogen
infection (Seo et al., 2010; Shi et al., 2014). Other cold-related proteins from
Arabidopsis, such as the vascular plant one-zinc-finger proteins (VOZs), the
Mediator subunit SFR6/MED16, and the DREB and EAR motif protein 1 (DEAR1),
also control PR expression and promote tolerance to pathogens (Tsutsui et al.,
2009; Wathugala et al., 2012; Nakai et al., 2013). Nonetheless, the molecular
mechanisms whereby these cold-related proteins control the expression of PR
genes to induce defense responses remains to be uncovered. It has been
35
proposed that the accumulation of PR proteins under low temperature conditions
ensures an adequate strategy of defense against the pathogens that frequently
propagate during cold seasons (Griffith and Yaish, 2004). All these data indicate
the existence of a wide range of signaling crosstalk between cold and pathogen
responses.
NONEXPRESSER OF PATHOGENESIS-RELATED GENES 1 (NPR1) is a
master regulator of basal and systemic acquired resistance in plants, which
confers immunity through a transcriptional cascade leading to massive induction
of antimicrobial genes (Fu and Dong, 2013). In unchallenged Arabidopsis, NPR1
is sequestered in the cytoplasm as an oligomer maintained by redox-sensitive
intermolecular disulfide bonds. The oligomerization of NPR1 is preserved by S-
nitrosylation through S-NITROSOGLUTATHIONE (GSNO) (Tada et al., 2008).
Upon pathogen challenge, the levels of SA increase inducing the expression of
NPR1 gene and the accumulation of the NPR1 protein (Fu and Dong, 2013). In
addition, the increase in SA levels generates changes in the cellular redox state,
which, in turn, lead to the reduction of the disulfide bonds in NPR1. The reduction
of the NPR1 oligomers release monomers that translocate to the nucleus where
they activate PR gene expression (Kinkema et al., 2000). The SA-induced NPR1
oligomer-to-monomer reaction is catalyzed by THIOREDOXINS H3 and H5
(TRXH3, TRXH5), as well as by the SNF1-RELATED PROTEIN KINASE 2.8
(SnRK2.8) (Tada et al., 2008; Lee et al., 2015). The NPR1 protein holds, at least,
two domains involved in protein-protein interactions, the BTB/POZ and the
36
ankyrin-repeat domains, and a nuclear localization sequence, but it does not
contain a canonical DNA-binding domain (Fu and Dong, 2013). Consistent with
this structure, monomeric NPR1 acts as a transcriptional coactivator interacting
with bZIP transcription factors of the TGAs family that have been shown to directly
bind to the as-1 elements in the promoters of PR genes to induce their expression
and the subsequent defense response (Fu and Dong, 2013). In addition to
interacting with TGA factors, NPR1 also interacts with NIMIN proteins to attenuate
PR gene expression (Hermann et al., 2013). Monomeric NPR1 is specifically
targeted for degradation by the CUL3 E3 ligase and its adaptors, the NPR1
paralogs NPR3 and NPR4 (Fu et al., 2012).
Intriguingly, despite the tight connections existing between cold and pathogen
responses in plants, any implication of NPR1 in plant response to low temperature
has been overlooked. In this study, we show that Arabidopsis NPR1 positively
regulates cold acclimation by promoting cold-induced gene expression
independently of SA and TGA factors. Our results demonstrate that the
expression of NPR1 is induced in response to low temperature and this induction
is followed by an increase of NPR1 protein that accumulates in the nucleus in its
monomeric form. In the nucleus, NPR1 interacts with HSFA1 transcription factors,
the master regulators of heat shock response, to activate the expression of
HSFA1-regulated genes and, as a consequence, cold acclimation. Indeed, we
further demonstrate that the HSFA1 factors also function as positive regulators of
cold acclimation, and that the cold induction of heat stress-responsive genes is
37
crucial for full development of this adaptive process in Arabidopsis. Collectively,
the data reported here uncover an unanticipated function for NPR1 in cold
response, triggering a new transcriptional cascade through its interaction with the
HSFA1 factors to promote cold acclimation. NPR1, therefore, represents an
integration node for pathogen and cold signaling, allowing plants to better respond
and adapt to a fluctuating environment.
38
2. RESULTS
2.1. NPR1 accumulates in response to low temperature
Given the close relationship that exists between cold and pathogen signaling in
plants, we decided to examine whether the master regulator of pathogen response,
NPR1, could also play a role in cold response. Encouragingly, results from the eFP
Browser database (bar.toronto.ca) indicated that the expression levels of NPR1 gene
from Arabidopsis (At1G64280) increased in response to low temperature (Kilian et al.,
2007). Quantitative PCR (qPCR) experiments confirmed that, in fact, NPR1 mRNAs
accumulated transiently in 2-week-old Col-0 (WT) plants subjected to 4ºC, reaching a
peak after 6 hours of treatment (Figure 1A). This accumulation was mainly detected in
the leaves of adult Arabidopsis plants (Figure 1B). NPR1 transcripts, however, did not
increase in plants exposed to other related abiotic stresses, such as drought (300mM
sorbitol) or high salt (150mM NaCl) (Supplementary Figure 1A, B).
To further investigate the accumulation of NPR1 transcripts in response to low
temperature, we generated Arabidopsis transgenic lines containing a fusion between
a NPR1 promoter fragment (NPR1PRO; -1986 to +3) and the UidA (GUS) reporter
gene (NPR1PRO-GUS). Three independent transgenic lines (L2.4, L3.7, L4.9)
containing a single copy of the fusion in homozygosity were analyzed. In all cases,
the levels of GUS mRNAs increased significantly when exposed to 4ºC, mirroring the
expression pattern of the endogenous NPR1 gene (Figure 1C). As expected,
39
transgenic lines showed weak GUS activity under control conditions, but after 6 h of
exposure to 4ºC strong GUS staining was detected in the leaves of all lines (Figure
1D). These data pointed out that the accumulation of NPR1 mRNAs by low
temperature is regulated at the transcriptional level.
Since the expression of NPR1 is induced by SA (Fu and Dong, 2013), whose levels,
in turn, have been described to increase under cold conditions (Kim et al., 2013a), we
tested the possibility that the accumulation of NPR1 mRNAs by low temperature
could be mediated by SA. This hormone is mainly synthesized from chorismate
through the isochorismate synthase (ICS) pathway (Wildermuth et al., 2001). In
Arabidopsis, ICS is encoded by two genes, ICS1 and ICS2, with ICS1 having the
primary role in cold-induced SA biosynthesis (Kim et al., 2013a). We, therefore,
analyzed the content of NPR1 transcripts in WT plants and mutants sid2-1 and sid2-
2, two loss-of-function alleles of ICS1 (Wildermuth et al., 2001), exposed 6h to 4ºC.
We also analyzed the content of NPR1 transcripts in cold-treated transgenic
Arabidopsis expressing NahG, a bacterial gene encoding a salicylate hydroxylase
that converts SA to catechol, (Lawton et al., 1995). No significant differences were
found between WT, sid2 and NahG plants (Supplementary Figure 1C), evidencing
that messengers corresponding to NPR1 accumulate in response to low temperature
independently of SA. In addition, we investigated whether the cold induction of NPR1
was dependent on the CBF transcription factors and/or on ABA, which mediate the
two main signaling pathways controlling cold-induced gene expression (Xue-Xuan et
al., 2010). Expression analyses in cold-treated CBF- and ABA-deficient Arabidopsis
40
mutants (cbf123-1 and aba2-11; Zhao et al., 2016; González-Guzmán et al., 2002)
revealed that the increase of NPR1 transcripts under low temperature conditions was
also independent of CBFs and ABA (Supplementary Figure 1C).
Next, we assessed if the cold accumulation of NPR1 mRNA was followed by an
increase of the corresponding protein. Western blot (WB) experiments using
Arabidopsis plants containing a single copy of a functional genomic fusion NPR1PRO-
NPR1-MYC (see below) showed that the levels of NPR1-MYC protein were also more
abundant after some hours of cold treatment, correlating with those of NPR1
transcripts (Figure 1E). All in all, these results indicated that the levels of NPR1
augment under low temperature conditions independently of SA, ABA and the CBFs.
41
Figure 1. Arabidopsis NPR1 accumulates in response to low temperature. (A and B) Expression of NPR1 in leaves from 2-week-old Col-0 plants (A), and in leaves, roots, stems and flowers from 6-week-old Col-0 plants (B), exposed to 4ºC for the indicated hours (h). In all cases, transcript levels, determined by qPCR, are represented as relative to the values of leaves at 0h. (C) Expression of NPR1 and GUS in leaves from 2-week-old Col-0 (WT) plants and NPR1PRO-GUS lines, respectively, exposed to 4ºC for the indicated hours (h). Transcript levels, determined by qPCR, are represented as relative to the values at 0h. (D) Histochemical analysis of GUS activity in 3-week-old plants from the NPR1PRO-GUS line L4.9 grown under control conditions (20ºC) or exposed 6h to 4ºC. (E) Levels of NPR1-MYC fusion protein in 2-week-old c-npr1 plants exposed to 4ºC for the indicated hours (h). α-Tubulin (α-TUB) was used as a loading control. Results are representative of 3 independent experiments. In (A), (B) and (C), data represent the mean of three independent experiments and error bars show the SD. Asterisks indicate significant differences (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001) between cold-treated and control (0h) plants, as determined by t-test.
42
Supplementary Figure 1. NPR1 expression is induced by low temperature independently of SA, ABA and CBFs but not by drought or high salt. (A) and (B) Expression of NPR1 in leaves from 2-week-old Col-0 plants exposed to drought (A) or high salt conditions (B) for the indicated hours (h). The efficiency of drought and high salt treatments was controlled by analyzing the expression of RD29A. In all cases, expression levels, determined by qPCR, are represented as relative to the values at 0h. Data represent the mean of 3 independent experiments and error bars show the SD. Asterisks indicate significant differences (**P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001) between cold-treated and control (0h) plants for RD29A expression, as determined by t-test. No significant differences between cold-treated and control (0h) plants were observed in any case for NPR1 expression. (C) Expression of NPR1 in leaves from 2-week-old Col-0 (WT), sid2-1, sid2-2, NahG, aba2-11 and cbf123-1 plants exposed 6h to 4ºC. Expression levels, determined by qPCR, are represented as relative to the value in WT plants under control conditions. Data represent the mean of 3 independent experiments and error bars show the SD. No significant differences between mutants and WT were observed.
43
2.2. NPR1 positively regulates cold acclimation The results described above suggested that NPR1 could be involved in the response
of Arabidopsis to low temperature. To test this assumption, we examined the capacity
of two NPR1 loss-of-function mutant alleles, npr1-1 (Cao et al., 1994) and npr1-2
(Shah et al., 1997), to cold acclimate. Two-week-old mutant plants were cold-
acclimated (7d, 4ºC) and subsequently exposed for 6h to different freezing
temperatures. Survival was scored after 7 days of recovery under controlled growth
conditions. Interestingly, cold acclimated npr1 mutants exhibited a significantly lower
freezing tolerance than cold acclimated WT plants, the LT50 (temperature that causes
50% of lethality) values being -9.4ºC and -10.1ºC, respectively (Figure 2A, C). npr1-1
mutants transformed with the NPR1PRO-NPR1-MYC fusion (c-npr1) recovered the
wild-type capacity to cold acclimate (Figure 2B, D), validating the fusion and
establishing that the decreased capacity of npr1-1 and npr1-2 mutants to cold
acclimate was a direct consequence of the absence of NPR1. Furthermore, we
evaluated the capacity to cold acclimate of an Arabidopsis line containing a 35S-
NPR1-GFP construct (Kinkema et al., 2000). The overexpression of NPR1
significantly increased the freezing tolerance of cold-acclimated Arabidopsis (Figure
2B, D). The LT50 value of 35S-NPR1-GFP plants was estimated to be about -10.5ºC.
Although NPR1 transcripts did not accumulate in Arabidopsis plants exposed to
drought or high salt, we also explored a possible role of NPR1 in Arabidopsis
tolerance to these cold-related abiotic stresses. Drought and high salt tolerance was
examined in 5-day-old npr1-1 and npr1-2 seedlings, one week after being transferred
44
to plates containing 300mM sorbitol or 200mM NaCl. In both cases, mutants exhibited
similar tolerance as WT seedlings as revealed by the quantification of their fresh
weights and main root lengths (Supplementary Figure 2A, B). Together, all these data
provided genetic evidence that NPR1 functions specifically in cold acclimation by
positively regulating this adaptive response in Arabidopsis.
45
Figure 2. NPR1 positively regulates cold acclimation in Arabidopsis (A) and (B) Freezing tolerance of 2-week-old Col-0 (WT), npr1-1 and npr1-2 plants (A), and WT, 35S-NPR1-GFP and c-npr1 plants (B) exposed for 6h to the indicated freezing temperatures after being acclimated for 7d at 4°C. Freezing tolerance was estimated as the percentage of plants surviving each specific temperature after 7d of recovery under control conditions. Data represent the mean of 6 independent experiments and error bars show the SD. Asterisks indicate significant differences (*P ≤ 0.01, **P ≤ 0.001, ***P ≤ 0.0001) from WT plants, as determined by t-test. (C) and (D) Freezing tolerance of representative cold-acclimated plants 7d after being exposed to -10ºC for 6h.
46
Supplementary Figure 2. NPR1 is not involved in drought or salt tolerance. (A) and (B) Drought (A) and salt (B) tolerance of 5-day-old Col-0 (WT), npr1-1 and npr1-2 seedlings. Tolerances were calculated as the relative fresh weights and main root lengths of seedlings exposed 7d to 300mM sorbitol or 200mM NaCl respect to seedlings grown under control conditions. Data represent the mean of 6 independent experiments and error bars show the SD. No significant differences between mutants and WT were observed in any case. (C) Representative seedlings grown on GM or exposed 7d to 300mM sorbitol or 200mM NaCl.
47
2.3. Low temperature-induced monomerization and nuclear import of NPR1 are
required for full development of cold acclimation
As mentioned above, in response to pathogens, cytoplasmic NPR1 oligomers release
monomers by the action of TRXH3, TRXH5 and SnRK2.8 that translocate to the
nucleus where they activate PR gene expression (Tada et al., 2008; Lee et al., 2015).
Thus, we investigated the possibility that low temperature could also trigger the
monomerization and nuclear translocation of NPR1. First, we studied the subcellular
distribution of NPR1 in Arabidopsis plants exposed to control or low temperature
conditions by cell fractionation followed of WB experiments. Cytoplasmic and nuclear
protein extracts were obtained from control and cold-treated c-npr1 plants, and the
NPR1-MYC fusion protein was detected immunologically in each fraction. In plants
grown under standard conditions, NPR1 was primarily localized in the cytoplasm.
After cold exposure, however, NPR1 was clearly detected in the nuclear fraction
(Figure 3A). The cold-induced nuclear accumulation of NPR1 was practically
disrupted in trxh3trxh5 (see Methods) and snrk2.8-1 (Lee et al., 2015) mutants
transformed with the NPR1PRO-NPR1-MYC construct (Figure 3B), evidencing that
TRXH3, TRXH5 and SnRK2.8 are critical for its nuclear import in response to low
temperature. Then, we performed WB assays with total protein extracts from control
and cold-treated c-npr1 plants under non-reducing conditions to determine if low
temperature promoted nuclear accumulation of monomeric NPR1. Indeed, after 24h
of exposure to 4ºC, the levels of monomeric NPR1 were notably higher than at 20ºC
(Figure 3C). When these assays were carried out with extracts from trxh3trxh5 and
48
snrk2.8-1 plants containing the NPR1PRO-NPR1-MYC fusion, the cold-induced
accumulation of monomeric NPR1 in the nucleus was not detected, therefore
indicating that it was mediated by TRXH3, TRXH5 and SnRK2.8 (Figure 3C).
The results described above suggested that the monomerization and nuclear import
of NPR1 could be necessary for proper development of the cold acclimation
response. To test this hypothesis, we analyzed the freezing tolerance of 2-week-old
cold acclimated (7d, 4ºC) WT plants and npr1, trxh3trxh5 and snrk2.8-1 mutants.
After 6h at -10ºC, trxh3trxh5 and snrk2.8-1 mutants exhibited a survival rate
significantly lower than WT plants, similar to that shown by npr1 mutants (Figure 3D).
These data demonstrated that TRXH3, TRXH5 and SnRK2.8 are required to ensure
full development of cold acclimation and, therefore, that the low temperature-induced
monomerization and nuclear import of NPR1 are needed for its function as a positive
regulator of the adaptive response.
49
Figure 3. Monomerization and nuclear localization of NPR1 depends on TRXH3, TRXH5 and SnRK2.8, and are required for cold acclimation. (A) Levels of NPR1-MYC fusion protein in cytoplasmic (Cyt) and nuclear (Nuc) fractions from 2-week-old c-npr1 plants grown under control conditions (20ºC) or exposed to 4ºC for 24h. α-Tubulin (α-TUB) and Histone H3 were used for control of fractionation. (B) Levels of NPR1-MYC fusion protein in cytoplasmic (Cyt) and nuclear (Nuc) fractions from 2-week-old c-npr1 plants and trxh3trxh5 and snrk2.8-1 mutants containing the NPR1PRO-NPR1-MYC fusion grown under control conditions (20ºC) or exposed to 4ºC for 24h. α-TUB and H3 were used for control of fractionation. (C) Levels of oligomeric and monomeric NPR1-MYC fusion protein in 2-week-old c-npr1 plants and trxh3trxh5 and snrk2.8-1 mutants containing the NPR1PRO-NPR1-MYC fusion grown under control conditions (20ºC) or exposed to 4ºC for 24h. α-TUB was used as a loading control. (D) Freezing tolerance of 2-week-old Col-0 (WT), trxh3trxh5, snrk2.8-1 and npr1-1 plants exposed 6h to -10ºC after being acclimated at 4°C for 7d (left panel). Freezing tolerance was estimated as the percentage of plants surviving each specific temperature after 7d of recovery under control conditions. Data represent the mean of 6 independent experiments and error bars show the SD. Asterisks indicate significant differences (***P ≤ 0.001) from WT plants, as determined by t-test. The right panel shows the freezing tolerance of representative cold-acclimated WT, trxh3trxh5, snrk2.8-1 and npr1-1 plants 7d after being exposed to -10ºC for 6h. In (A), (B) and (C), results are representative of 3 independent experiments.
50
2.4. NPR1 activates cold-induced gene expression independently of the TGA
transcription factors
Now, the arising question was how NPR1 positively regulated cold acclimation. Since
cold acclimation involves an extensive transcriptome reprogramming (Chinnusamy et
al., 2007) and NPR1 has been implicated in regulating gene expression (Blanco et al.,
2009), we considered the possibility that it could activate the adaptive response by
promoting cold-induced gene expression. High-throughput RNA sequencing
(RNAseq) was used to estimate the impact of the npr1-1 mutation on the
transcriptome of Arabidopsis plants exposed 24h to 4ºC. To this, we sequenced
cDNA libraries prepared from cold-treated npr1-1 and WT plants. The resulting reads
(2.6 Gb/sample) were mapped to the Arabidopsis genome (TAIR10 version) and gene
expression changes in the mutant were evaluated. The top 200 downregulated genes
in npr1-1, based on fold change ratios with respect to their corresponding controls,
were considered for analysis. The expression levels of these genes in mutant plants
were decreased at least 2-fold compared with the WT (Supplementary Table 1).
Remarkably, 71 out of the 200 downregulated genes (35.5%) had been reported to be
induced (≥2-fold) in response to cold (Kilian et al., 2007) (Supplementary Table 2)
and, therefore, could account for the impaired capacity of npr1-1 to cold acclimate.
These findings were validated analyzing the expression of several downregulated
cold-inducible genes in independent RNA samples from WT, npr1-1 and npr1-2
mutant plants grown at 20ºC or subjected 24h to 4ºC by means of qPCR experiments
(Figure 4A). We concluded that NPR1 is required for cold-induced gene expression.
51
In response to pathogens, NPR1 interacts with class II redundant TGA transcription
factors (TGA2, TGA5 and TGA6) to foster PR gene expression (Fu and Dong, 2013).
To determine whether the role of NPR1 in promoting cold-induced gene expression
was also mediated by the TGA transcription factors, we evaluated the cold induction
of the genes whose downregulated expression in npr1 we had validated by qPCR
assays (Figure 4A) in tga2-1tga5-1tga6-1 (tga2/5/6) triple mutants (Zhang et al.,
2003). Results uncovered that the cold induction of all genes, including PR2, whose
expression by pathogens is mediated by NPR1 through the TGA factors (Fan and
Dong, 2002), was not significantly affected in the triple mutant (Figure 4B). These
observations indicated that NPR1 activates cold-induced gene expression
independently of the class II TGA transcription factors.
52
Figure 4. NPR1 promotes cold-induced gene expression independently of TGA class II transcription factors. (A) and (B) Expression of different cold-inducible genes in 2-week-old plants from Col-0 (WT), npr1-1 and npr1-2 (A), and WT and tga2/5/6 (B) grown under control conditions (C) or exposed to 4ºC for 24h. Transcript levels, determined by qPCR, are represented as relative to their corresponding values in WT plants under control conditions. Data represent the mean of 3 independent experiments and error bars show the SD. Asterisks indicate significant differences (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001) between npr1 mutants and WT exposed to 4ºC, as determined by t-test. No significant differences between tga2/5/6 mutants and WT were observed in any case.
53
2.5. NPR1 promotes the cold induction of HSFA1-regulated genes
Intriguingly, gene ontology (GO) analysis revealed that a significant number of the 71
cold-inducible genes identified in our RNAseq experiments whose expression was
downregulated in npr1 mutants were related with response to heat stress. In fact, out
of the first five enriched GO categories, “response to heat” (GO: 0009408) was the
one with higher value of fold enrichment (fold change=12.2; P=1.2E-6) (Figure 5A).
This category consisted of nine heat stress-inducible genes, including HSFA2,
HSP101, DNAJ, HSP90.1, HSP17.6A, HSP70, HSP17.6II, FES1A and WRKY33. It is
worth noting that the expression of all these genes, except that of WRKY33, had been
described to be regulated by the class A1 heat shock factors (HSFA1s) (Yoshida et
al., 2011), a family of four partially redundant transcriptional activators in Arabidopsis
(HSFA1a, HSFA1b, HSFA1d, HSFA1e), that work as master regulators of the heat
shock response (Liu et al., 2011). More interesting, a detailed analysis of the 71 cold-
inducible genes downregulated in npr1 mutants unveiled that, indeed, 16 (22.5%)
(Supplementary Table 3) belonged to the HSFA1 regulon (Yoshida et al., 2011). That
these genes were really downregulated in npr1 mutants in response to low
temperature, as assumed from the RNAseq data, was confirmed by analyzing their
expression in independent RNA samples from WT, npr1-1 and npr1-2 mutant plants
grown at 20ºC or exposed 24h to 4ºC through qPCR assays (Figure 5B).
Furthermore, as expected, the cold-induction of these genes was independent of the
TGA transcription factors since it was not affected, in any case, in tga2/5/6 triple
mutants (Figure 5C). Therefore, these results provided evidence that NPR1 promotes
54
the cold induction of HSFA1-regulated genes independently of the class II TGA
factors.
55
Figure 5. NPR1 activates the cold-induction of HSFA1-regulated genes.
(A) First five gene ontology (GO) terms enriched in cold-inducible genes downregulated in npr1-1 mutant exposed 24h to 4ºC. (B) and (C) Expression of cold-inducible genes belonging to the HSFA1 regulon in 2-week-old plants from Col-0 (WT), npr1-1 and npr1-2 (B), and WT and tga2/5/6 (C) grown under control conditions or exposed to 4ºC for 24 or 6h. Transcript levels, determined by qPCR, are represented as relative to their corresponding values in WT plants under control conditions. Data represent the mean of 3 independent experiments and error bars show the SD. Asterisks indicate significant differences (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001) between npr1 mutants and WT exposed to 4ºC, as determined by t-test. No significant differences between tga2/5/6 mutants and WT under cold conditions were observed in any case.
56
2.6. HSFA1 transcription factors positively regulates cold acclimation by
inducing heat stress-responsive gene expression under low temperature
conditions
The HSFA1 factors have been reported to play essential roles in other abiotic stress
responses than heat shock, such as water and salt stress responses, by mediating
the induction of heat stress-responsive genes (Liu et al., 2011). Given the very close
relationship existing between these responses and the response to low temperature,
and the results described above, we considered the possibility that the HSFA1 factors
could be involved in cold acclimation by promoting the cold-induced expression of
heat stress-responsive genes. This assumption was first assessed by comparing the
expression levels of the 16 cold-inducible genes that were downregulated in cold-
treated npr1 mutants and belonged to the HSFA1 regulon in a hsfa1a/b/d/e quadruple
knockout mutant (QK) (Liu et al., 2011) and WT plants Wassilewskija (Ws) for hsfa1a
and hsfa1b mutants and Col-0 for hsfa1d and hsfa1e] subjected to 4ºC for 24h. The
cold induction of all genes was significantly lower in the QK mutant than in WT plants,
indicating that, in fact, the HSFA1 factors mediated the induction of heat stress-
responsive genes during cold acclimation (Figure 6A).
The implication of the HSFA1 factors in the adaptive process was definitively
established by examining the capacity of different hsfa1 mutant plants to cold
acclimate. Because of the very small size and pleiotropic phenotype of 3-week-old
QK mutants (Liu et al., 2011), for these experiments we used the four triple mutants,
hsfa1a/b/d (eTK), hsfa1b/d/e (aTK), hsfa1a/b/e (dTK) and hsfa1a/d/e (bTK), which do
57
not show significant morphological differences with WT plants (Liu et al., 2011). The
prefixed letters in the triples represent the remaining functional HSFA1 gene. All
mutants displayed significantly reduced freezing tolerance compared to WT plants
after being acclimated 7d at 4ºC and subsequently exposed 6h to -10ºC (Figure 6B).
The impaired ability to cold acclimate exhibited by all triple mutants was consistent
with the proposed partial functional redundancy for the HSFA1 factors (Liu et al.,
2011). Nonetheless, the different mutants showed different abilities, the most affected
being the eTK mutant (Figure 6B) whose survival percentage (≈30%) was similar to
that of npr1 mutants under the same freezing conditions (Figure 2). The low ability of
the eTK mutant to cold acclimate suggested that factors HSFA1a, HSFA1b and
HSFA1d should play a prominent role in the adaptive process.
Our data, therefore, pointed out that the HSFA1 factors would act as positive
regulators of cold acclimation by inducing the expression of heat stress-responsive
genes. That the heat stress-responsive gene expression regulated by these factors
was indeed involved in cold acclimation was determined by analyzing the ability to
acclimate of two null mutant alleles for HSFA2, hsfa2-1 and hsfa2-2 (Nishizawa et al.,
2006). HSFA2 is one of the 16 cold-inducible genes downregulated in cold-treated
npr1 mutants (Figure 5B), a target of HSFA1 factors (Yoshida et al., 2011) and
encodes a secondary regulator of the heat shock response (Liu et al., 2011).
Compared to WT, cold-acclimated (7d, 4ºC) hsfa2-1 and hsfa2-2 mutants showed a
low percentage of survival (≈40%) after being subjected to -10ºC for 6h (Figure 6C),
evidencing that, indeed, the cold-induced heat stress-responsive gene expression
58
mediated by the HSFA1 factors is essential for full development of cold acclimation.
Taken together, these results demonstrated that HSFA1 factors positively regulate
cold acclimation in Arabidopsis by promoting heat stress-responsive gene expression
under low temperature conditions.
59
Figure 6. HSFA1 factors promote cold acclimation by inducing heat stress-responsive gene expression under low temperature conditions. (A) Expression of cold-inducible genes belonging to the HSFA1 regulon in 2-week-old Col-0 (WT), Wassilewskija (Ws) and QK plants grown under control conditions or exposed to 4ºC for 24 or 6h. Transcript levels, determined by qPCR, are represented as relative to their corresponding values under control conditions. Data represent the mean of 3 independent experiments and error bars show the SD. Asterisks indicate significant differences (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001) between QK mutants and WT and Ws exposed to 4ºC, as determined by ANOVA (Bonferroni’s post hoc test). No significant differences between WT and Ws plants were observed in any case. (B) and (C) Freezing tolerance of 2-week-old plants from WT, Ws, aTK, bTK, dTK and eTK (B), and WT, hsfa2-1 and hsfa2-2 (C) exposed 6h to -10ºC after being acclimated at 4°C for 7d (left panels). Freezing tolerance was estimated as the percentage of plants surviving -10ºC after 7d of recovery under control conditions. Data represent the mean of 6 independent experiments and error bars show the SD. Asterisks indicate significant differences (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001) between TK mutants and WT and Ws, as determined by ANOVA (Bonferroni’s post hoc test) (B), and between hsfa2 mutants and WT, as determined by t-test (C). No significant differences between WT and Ws plants were observed in any case. Right panels show the freezing tolerance of representative cold-acclimated plants from WT, Ws, aTK, bTK, dTK and eTK (B), and WT, hsfa2-1 and hsfa2-2 (C) 7d after being exposed to -10ºC for 6h.
60
2.7. NPR1 interacts with HSFA1 transcription factors to activate cold-induced
heat stress-responsive gene expression and cold acclimation
Taking into account that NPR1 functions as a coactivator of gene expression (Fu and
Dong, 2013) and the capacity of the HSFA1 factors to activate transcription and
interact with other proteins (Scharf et al., 2012), we hypothesized that NPR1 could
activate cold-induced heat stress-responsive gene expression, and consequently the
cold acclimation process, by interacting with HSFA1 factors. The interaction between
NPR1 and HSFA1a, HSFA1b and HSFA1d, the factors with a more relevant role in
the process, was first studied by means of bimolecular fluorescence complementation
(BiFC) analysis in Nicotiana benthamiana leaves exposed 24h to 4ºC. Results
revealed that a significant proportion of cells transformed with nYFP-NPR1 and cYFP-
HSFA1a, cYFP-HSFA1b or cYFP-HSFA1d displayed intense yellow fluorescence
(Figure 7A), denoting interaction between these proteins. Consistent with the
subcellular localization of NPR1 in response to low temperature (Figure 3A, B),
NPR1-HSFA1s interactions were mainly observed in the nuclei of cold-treated N.
benthamiana cells (Figure 7A). These interactions were also detected under control
conditions, but, as expected given the low levels of NPR1 at 20ºC (Figure 1E) and its
main cytoplasmic localization (Figure 3A, B), they were much less evident than those
observed in the cold (Figure 7A). No interaction, however, was noticed between
NPR1 and LSM8, a nuclear protein (Perea-Resa et al., 2012) used as a negative
control in the experiments (Figure 7A). In consonance with these observations, we
found that, paralleling NPR1, the HSFA1 factors also localized preferentially in the
nucleus when transiently expressed in leaves of N. benthamiana under low
61
temperature conditions (Supplementary Figure 3). The interaction between NPR1 and
HSFA1s was confirmed by in vivo pull-down assays using recombinant purified HIS-
HSFA1a, HIS-HSFA1b and HIS-HSFA1d fusion proteins and extracts from c-npr1
plants grown under control conditions or subjected to 4ºC for 24h. As observed in the
BiFC experiments, NPR1 was clearly pulled down by all His-HSFA1 proteins, the
efficiency being higher when using extracts from cold-treated c-npr1 plants (Figure
7B).
Our results suggested that the NPR1/HSFA1s interaction is essential for the cold
induction of the heat stress-responsive gene expression mediated by the HSFA1
transcription factors and, therefore, for the full development of cold acclimation. To
provide further support to this assumption, the expression levels of the 16 cold-
inducible genes downregulated in cold treated npr1 mutants that belonged to the
HSFA1 regulon were analyzed in trxh3trxh5 and snrk2.8-1 plants, which were
deficient in NPR1 oligomer-to-monomer transition and nuclear translocation (Figure
3B, C), exposed 24h to 4ºC. In all cases, the cold induction of these genes was
significantly lower in trxh3trxh5 and snrk2.8-1 than in WT plants (Figure 7C),
indicating that the nuclear localization of NPR1 and, therefore, its interaction with
HSFA1 factors is necessary to activate cold-induced heat stress-responsive gene
expression. Overall, these data demonstrate that NPR1 acts as a coactivator together
with HSFA1 transcription factors to promote cold-induced heat stress-responsive
gene expression and the cold acclimation response.
62
Figure 7. NPR1 interacts with HSFA1 factors to activate cold-induced heat stress-responsive gene expression. (A) In vivo interaction between NPR1 and HSFA1a, HSFA1b and HSFA1d proteins by BiFC assays in N. benthamiana leaf cells under control (20ºC) or cold conditions (4ºC, 24h). Reconstitution of YFP is shown. The interaction of NPR1 with LSM8 was also assayed as a negative control. Scale bars, 75µm. (B) Interactions between NPR1 and HSFA1a, HSFA1b and HSFA1d proteins by in vivo pull down experiments. Input lanes contain protein extracts from c-npr1 plants grown at 20ºC or exposed 24h to 4ºC. Pull down lanes contain reactions using protein extracts from c-npr1 plants grown at 20ºC or exposed 24h to 4ºC and resin-bound recombinant HIS-HSFA1 proteins (HSFA1s) or unbound resin (Resin). Levels of NPR1-MYC were detected by immunoblotting with anti-c-MYC antibody. Anti-α-Tubulin (α-TUB) and anti-HIS antibodies were employed to verify that equal amounts of protein extracts and HSFA1-HIS proteins were used in each reaction, respectively. (C) Expression of cold-inducible genes belonging to the HSFA1 regulon in 2-week-old Col-0 (WT), trxh3trxh5 and snrk2.8-1 plants grown under control conditions or exposed to 4ºC for 24 or 6h. Levels, determined by qPCR, are represented as relative to their corresponding values in WT plants under control conditions. Data represent the mean of 3 independent experiments and error bars show the SD. Asterisks indicate significant differences (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001) between mutants and WT exposed to 4ºC, as determined by t-test. In (A) and (B), results are representative of 3 independent experiments.
63
Supplementary Figure 3. HSFA1 factors localize in the nucleus under low temperature conditions. Subcellular localization of GFP-HSFA1a, GFP-HSFA1b and GFP-HSFA1d fusion proteins in N. benthamiana leaf cells under control (20ºC) or cold conditions (4ºC, 24h). Scale bars, 75µm. Results are representative of 3 independent experiments.
64
3. DISCUSSION
We present genetic and molecular evidence that NPR1, a master regulator of plant
response to pathogen infection, is also involved in regulating plant response to low
temperature. Our results demonstrate that Arabidopsis NPR1 plays a critical role in
cold acclimation by promoting cold-induced gene expression. This role is
accomplished, in part, by interacting with HSFA1 transcriptional activators, the master
regulators of the heat shock response, which leads to the induction of a number of
HSFA1-regulated genes. Consistently, we also demonstrate that the HSFA1 factors
act as positive regulators of cold acclimation and that the cold induction of heat
stress-responsive genes is required to ensure full development of this adaptive
process in Arabidopsis. These findings unveil an unexpected role for NPR1 in plant
adaptation to freezing temperatures that is performed through a novel regulatory
pathway independent from that used by this factor to mediate plant pathogen
response, and suggest that it constitutes an integration node for plant responses to
biotic and abiotic stresses.
Currently, the expression of NPR1 is considered to be exclusively induced in
response to pathogen infection. The expression analysis presented in this work
revealed that in Arabidopsis, NPR1 transcripts also accumulate in response to low
temperature. This accumulation is transient and seems to be stress specific, since
NPR1 transcripts do not accumulate by other cold-related stresses such as drought or
high salt. In contrast to what happens in response to pathogens, SA does not mediate
65
the increase of NPR1 mRNAs by low temperature. Furthermore, the levels of NPR1
transcripts in CBF- and ABA-deficient mutants exposed to 4°C are identical to those
in WT plants, denoting that they increase in response to low temperature through a
CBF- and ABA-independent pathway. We show that the cold accumulation of NPR1
mRNAs is regulated at the transcriptional level and that the cis-acting element(s)
implicated are contained within its proximal promoter region (<2 kb). Intriguingly,
however, this region does not contain any described low-temperature responsive
element. Understanding the molecular mechanisms underlying the induction of NPR1
transcripts by low temperature needs further investigation. As expected from the
expression data, the levels of NPR1 protein also increase after cold treatment,
mirroring those of NPR1 transcripts. According to what has been previously reported
(Tada et al., 2008), we found that under control conditions NPR1 preferentially
localizes to the cytoplasm of Arabidopsis cells in its oligomeric form. Remarkably, in
response to low temperature it accumulates chiefly in the nucleus as monomer.
Phosphorylation and redox modifications of NPR1 by SnRK2.8 kinase and
thioredoxins TRXH3/TRXH5, respectively, have been shown to be necessary for the
oligomer to monomer transition and its subsequent nuclear translocation that occurs
after pathogen infection (Tada et al., 2008; Lee et al., 2015). Our data demonstrate
that SnRK2.8 and TRXH3/TRXH5 also mediate the cold-induced monomerization and
nuclear localization of NPR1.
Consistent with the accumulation of NPR1 in response to low temperature, our
genetic analyses provide evidence that it acts as a positive regulator for cold
66
acclimation. In fact, loss-of-function npr1 mutants show a significantly lower capacity
to cold acclimate compared to WT plants. In line with these results, Arabidopsis
plants with increased levels of NPR1 display increased capacity to cold acclimate.
NPR1, however, does not seem to be implicated in the ability of Arabidopsis to
tolerate other important abiotic stresses such as drought and high salt. Thus, it does
not play a general role in Arabidopsis tolerance to abiotic stresses but seems to have
a specific function in cold acclimation. The cold induction of NPR1 is independent of
SA, which strongly suggests that this phytohormone does not mediate the role of
NPR1 in cold acclimation. This assumption is further supported by the fact that SA
levels do not increase during cold acclimation in Arabidopsis, and that Arabidopsis
mutants deficient in SA are not affected in their capacity to cold acclimate
(Supplementary Figure 4A, B). Still, the role of NPR1 in cold acclimation requires its
monomerization and subsequent nuclear translocation since Arabidopsis mutants
deficient in SnRK2.8 and TRXH3/TRXH5 activities show impaired cold acclimation
ability, similar to that of npr1 mutants.
The global transcriptome profiles indicate that NPR1 positively regulates cold
acclimation in Arabidopsis by promoting cold-induced gene expression. After 24h of
exposure to 4°C, 71 cold-inducible genes display lower induction (≥2.0-fold) in npr1
than in WT plants. The reduced levels of the corresponding transcripts should
account for the reduced capacity of the npr1 mutants to cold acclimate. Unexpectedly,
almost one fourth (16) of the 71 cold-inducible genes whose induction was mediated
by NPR1 corresponded to heat stress-responsive genes belonging to the HSFA1
67
regulon. In Arabidopsis, there are four partially redundant HSFA1 transcription factors
(HSFA1a, b, d, e) that function as the master regulators of the heat shock response
(Liu et al., 2011). The corresponding genes are constitutively expressed (Yoshida et
al., 2011), and it has been estimated that more than 65% of the heat stress-induced
genes are HSFA1 dependent (Liu et al., 2011). It is worth noting that one of the 16
NPR1-mediated cold-inducible genes that belong to the HSFA1 regulon is HSFA2, a
direct target of the HSFA1 factors that encodes a secondary regulator of the heat
shock response (Liu et al., 2011; Yoshida et al., 2011). In addition to activate the heat
shock response, HSFA1 and HSFA2 factors have been described to enhance plant
response to other adverse environmental conditions, including anoxia, salt and
osmotic stresses (Liu et al., 2011). The implication of these transcription factors in
plant response to low temperature, however, has not been still documented. Here, we
show that Arabidopsis plants deficient in HSFA1 or HSFA2 are unable to cold
acclimate properly, evidencing that they also play a positive role in regulating cold
acclimation and that heat stress-responsive gene expression mediated by the HSFA1
factors is required for full development of this adaptive process. In this regard, it has
been proposed that the heat shock proteins operate as buffers against environmental
stresses (Carey et al., 2006). HSFA1 and HSFA2, therefore, represent molecular
integrators of plant responses to extreme temperatures. In the case of HSFA1 factors,
consistent with their functional redundancy, all of them work in promoting cold
acclimation although their contribution to the process is not the same. Our results
suggest that HSFA1a, HSFA1b and HSFA1d have a more relevant role than
HSFA1e.
68
As already mentioned, Arabidopsis NPR1 does not contain a canonical DNA binding
domain and must interact with other transcription factors to act as coactivator to
enhance gene expression (Fu and Dong, 2013). To date, NPR1 has only been
described to interact with transcription factors from the TGA family, principally with
TGA2, TGA5 and TGA6, after pathogen attack to induce PR gene expression and the
subsequent defense response (Fu and Dong, 2013). The data obtained in this work
reveal that the NPR1 function in cold response as coactivator of cold-induced gene
expression is fully independent of the TGA class II factors. Actually, the cold-induced
gene expression that is promoted by NPR1 during cold acclimation is not affected in
tga2/5/6 triple mutants, indicating that NPR1 must interact with different factor(s) than
the TGAs to operate in this process. We present compelling evidence that the HSFA1
factors constitute novel clients of Arabidopsis NPR1 through which cold acclimation is
established. In line with these results, the tomato HSFA1 factors have also been
reported to be able of interacting with coactivator proteins to induce transcription
(Bharti et al., 2004). Our findings demonstrate that NPR1 interacts with HSFA1a,
HSFA1b and HSFA1d transcription factors in the nucleus in response to low
temperature to promote cold-induced heat-stress responsive gene expression and
cold acclimation in Arabidopsis. Nevertheless, in addition to promote the induction of
HSFA1-regulated genes under low temperature conditions, NPR1 also fosters the
induction of other genes related to cold response, indicating that it must have
additional roles in cold acclimation through different regulatory pathways. The nature
69
of these roles and the corresponding underlying molecular mechanisms remain to be
established.
Based on the data described here, a hypothetical model for NPR1 function in
Arabidopsis cold acclimation is proposed in Figure 8. In response to low temperature,
the expression of NPR1 would be induced independently of SA, ABA and the CBFs.
Concomitantly with this induction there would be an increase of NPR1 protein that
would translocate to the nucleus in its monomeric form in a TRXH3/TRXH5-SnRK2.8-
dependent way. In the nucleus, monomeric NPR1 would operate as a coactivator
promoting cold-induced gene expression and, therefore, cold acclimation by
interacting with different transcription factors, including the HSFA1s. The interaction
of NPR1 with the HSFA1 factors would induce the expression of numerous heat
stress-responsive genes encoding chaperones that would act as powerful buffers to
minimize the impact of low temperatures, and would be essential for the full
development of the cold acclimation process. Hence, NPR1 seems to serve as a
regulatory hub where pathways mediating biotic and abiotic stress responses
converge and integrate to guarantee the precise development of Arabidopsis
tolerance to adverse challenging conditions. Identifying the complete repertoire of
clients through which NPR1 mediates cold acclimation, and the molecular
mechanisms that determine NPR1 involvement in pathogen and/or cold signaling
constitutes a remarkable goal for future studies that will provide new insights on how
plants respond and adapt to fluctuating, and often adverse, natural environments.
70
Supplementary Figure 4. The role of NPR1 in cold acclimation is not mediated by SA. (A) Levels of free SA in 2-week-old Col-0 (WT) plants exposed to 4ºC for the indicated hours (h) or days (d). As a positive control, SA levels were also measured in 2-week-old plants of cpr5 mutant grown under control conditions. Data represent the mean of 3 independent experiments and error bars show the SD. Asterisks indicate significant differences (***P ≤ 0.001) between cpr5 and WT plants, as determined by t-test. No significant differences between cold-treated and control (0h) WT plants were observed. (B) Freezing tolerance of 2-week-old WT, sid2-1, sid2-2 and npr1-1 plants exposed 6h to -10ºC after being acclimated at 4°C for 7d (left panel). Freezing tolerance was estimated as the percentage of plants surviving each specific temperature after 7d of recovery under control conditions. Data represent the mean of 6 independent experiments and error bars show the SD. Asterisks indicate significant differences (**P ≤ 0.01) between npr1-1 and the rest of plants analyzed, as determined by t-test). No significant differences between sid2 mutants and WT plants were observed. The right panel shows the freezing tolerance of representative cold-acclimated plants from WT, sid2-1, sid2-2 and npr1-1 plants after being exposed to -10ºC for 6h.
71
Figure 8. Proposed model for the function of NPR1 in cold acclimation response.
72
4. MATERIALS AND METHODS
4.1. Plant materials
Arabidopsis thaliana Col-0 and Ws ecotypes, and mutants npr1-2 (Shah et al., 1997),
sid2-2 (Wildermuth et al., 2001), trxh3 (SALK_111160), trxh5 (SALK_144259),
snrk2.8-1 (SALK_073395), hsfa2-1 (SALK_008978) and hsfa2-2 (GK-650B06) were
obtained from the Nottingham Arabidopsis Stock Centre. The trxh3trxh5 double
mutant was generated by crossing trxh3 and trxh5 single mutants, and homozygous
lines were confirmed by PCR amplification with suitable primers (Supplementary
Table 4). WT transgenic plants containing the fusion 35S-NPR1-GFP (Kinkema et al.,
2000) as well as the npr1-1 and cpr5 mutants (Bowling et al., 1997) were provided by
Xinnian Dong. The sid2-1 mutant (Adie et al., 2007) was procured by Roberto Solano.
The aba2-11 mutant (González-Guzmán et al., 2002) was received from Pedro
Rodriguez. The tga2-1tga5-1tga6-1 triple mutant (Zhang et al., 2003) was obtained
from Xin Li. The aTK, bTK, dTK, eTK and QK mutants (Liu et al., 2011) were
supplied by Yee-Yung Charng. NahG transgenic plants (Lawton et al., 1995) were
furnished by María Elena Alvarez. The cbf123-1 mutant (Zhao et al., 2016) was
obtained from Jian-Kang Zhu. To generate the NPR1PRO-GUS fusion, a 1989-bp
(−1986 to +3) promoter fragment from NPR1 was amplified with appropriate primers
(Supplementary Table 4) and cloned into the pMDC162 Gateway™ binary vector
(Invitrogen). The NPR1PRO-NPR1-MYC fusion was obtained by amplifying the NPR1
genomic region, including the NPR1PRO fragment, with pertinent primers
73
(Supplementary Table 4) and cloning the resulting PCR product into the pGWB616
binary vector (Nakagawa et al., 2007). The NPR1PRO-GUS fusion was then introduced
in WT, and the NPR1PRO-NPR1-MYC fusion in npr1-1 (c-npr1), trxh3trxh5 and
snrk2.8-1 mutants via Agrobacterium tumefaciens (GV3101 strain), using the floral
dip method (Zhang et al., 2006). All transgenic lines were genetically determined to
have the fusions integrated at a single locus in homozygosis. For BiFC assays, full-
length cDNAs corresponding to NPR1, HSFA1a, HSFA1b, HSFA1d and LSM8 genes
were amplified with suitable primers (Supplementary Table 4) and the resulting PCR
products cloned into the pDONOR207 Gateway™ binary vector (Invitrogen)
(Nakagawa et al., 2007). Subsequently, they were transferred to pYFN43 and
pYFC43 binary vectors (Belda-Palazón et al., 2012) using the Gateway™ cloning
system to generate the nYFP-NPR1 and the cYFP-HSFA1a, cYFP-HSFA1b, cYFP-
HSFA1d and cYFP-LSM8 fusions, respectively. For the subcellular localization of
HSFA1a, HSFA1b and HSFA1d factors, the corresponding cDNAs cloned in
pDONOR207 were transferred to the pMDC43 Gateway™ binary vector to obtain
GFP-HSFA1 fusions. Plasmids containing the YFP and GFP fusions were introduced
into Agrobacterium strain GV3101 for agroinfiltration in 3-week-old N. benthamiana
leaves (see below). For in vivo pull-down assays (see below), the HSFA1a, HSFA1b
and HSFA1d cDNAs cloned in pDONOR207 were transferred to the pDEST17
Gateway™ vector, to generate HIS-HSFA1 fusions. All constructs used in this work
were validated by sequencing.
74
4.2. Growth conditions and treatments
Seeds were surface-sterilized, germinated, and grown under standard conditions
[20ºC under long-day photoperiods (16h light, of cool-white fluorescent light, photon
flux of 90 µmol m−2 s−1)] in pots containing a mixture of organic substrate and
vermiculite (3:1, v/v) or in Petri dishes containing Murashige and Skoog medium
supplemented with 1% sucrose (GM) and solidified with 0.9% (w/v) plant agar. Low-
temperature treatments for gene expression and immunoblot analyses were
performed by transferring plants growing in pots or Petri dishes under standard
conditions to a growth chamber set to 4°C for different times under a long-day
photoperiod (16h of cool-white fluorescent light, photon flux of 40µmol m−2 s−1). Water
and salt stress treatments for gene expression assays were accomplished by
transferring plants growing in Petri dishes under standard conditions to plates
containing GM medium supplemented with 300mM sorbitol or 150mM NaCl,
respectively, for different periods of time. In all cases, tissue samples were frozen in
liquid nitrogen after treatment and stored at -80°C until use. For histochemical
analysis of GUS activity, cold treatments were performed on 2-week-old plants
expressing the NPR1PRO-GUS fusion grown under standard conditions and
subsequently transferred to a growth chamber set to 4°C for one additional day.
Tolerance to freezing temperatures was determined on 2-week-old plants grown on
soil under standard conditions and subsequently exposed to 4ºC for 7d (cold
acclimated) as described (Catalá et al., 2011). Tolerance to water and salt stresses
was assessed on 5-day-old seedlings grown on GM medium under standard
conditions and then transferred to new plates containing GM medium supplemented
75
with 300mM sorbitol or 200mM NaCl for one week. In both cases, tolerance was
estimated as the percentage of the main root length and fresh weight of the plants
after treatments. All data reported about tolerances are expressed as standard
deviations of the means of at least three independent experiments with 50 plants
each.
4.3. Gene expression analysis and RNAseq experiments
For gene expression, total RNA was obtained using Purezol™ reagent (Bio-Rad)
according to the manufacturer’s instructions. RNA samples were treated with DNase I
(Roche) and quantified with a Nanodrop spectrophotometer (Thermo Scientific).
cDNA was synthesized from each sample with the iScript™ cDNA synthesis kit (Bio-
Rad), and qPCRs were performed with SsoFast™ EvaGreen Supermix (Bio-Rad) in a
Bio-Rad iQ2 thermocycler. The relative expression values were calculated using the
At4g24610 gene as a reference (Czechowski et al., 2005). Primers used are listed in
Supplementary Table 4. All reactions were realized in triplicate employing three
independent RNA samples.
For RNAseq experiments, total RNA was obtained from 2-week-old WT and npr1-1
plants exposed to 4ºC for 24h using TRIzol™ Reagent (Invitrogen) and cleaned with
the RNeasy Plant Mini Kit (Qiagen). cDNA libraries were generated from three
independent RNA preparations each. RNA quality, library preparation, and
subsequent sequencing were performed by the staff of Life Sequencing (Valencia,
Spain). RNAseq reads were aligned to the TAIR10 WT reference genome using
76
TopHat2 (Kim et al., 2013b) with default parameters. Uniquely mapped reads
(Supplementary Table 5) were counted per representative gene model (excluding
introns) according to the TAIR10 annotation using custom R scripts. Only genes with
reads per kilobase per million >1 in at least one sample were used for differential
expression analysis between WT and npr1-1 plants using DEseq2 (Love et al., 2014).
This package internally estimates size factors for each sample, calculates dispersion
for each gene, and then fits a negative binomial GLM to detect differentially
expressed genes taking into account the size factors and dispersion values.
The Expression Browser tool of The Bio-Analytic Resource for Plant Biology
(http://bar.utoronto.ca) was used to determine the genes from our RNAseq data that,
in addition of being downregulated in the npr1-1 mutant, were cold induced. Selected
settings were “AtGenExpress-stress series” as data set and “cold stress” as research
area (Kilian et al., 2007). All tissue types, growth stages, and time points were
considered, output options were set to “Average of replicate treatments relative to
average of appropriate control”, and induction was only contemplated when fold
change was equal to or higher than 2-fold. Gene ontology (GO) categorization was
done with the ThaleMine data mining tool from Araport (www.araport.org).
Significantly enriched GO terms (P-value ≤ 2E-6) were established using the
Benjamini Hochberg corrected hypergeometric test.
77
4.4. SA measurements
For total SA measurements, leaves from 2-week-old WT and cpr5 plants were frozen
in liquid nitrogen, ground and extracted as previously described (Kim et al., 2013a).
Instrumental set up, data acquisition and calculations were performed as reported
(Pastor et al., 2012).
4.5. Determination of GUS activity
GUS activity in Arabidopsis transgenic plants containing the fusion NPR1PRO-GUS
was detected and measured as described (Medina, 2001).
4.6. Microscopy analysis
Subcellular localization of the NPR1-GFP fusion protein was performed by confocal
microscopy in roots from 6-day-old transgenic seedlings containing the 35S-NPR1-
GFP construct grown in petri dishes under control conditions or exposed 24h to 4ºC.
Transient expression of fusion proteins for BiFC assays and for subcellular
localization of HSFA1 factors was analyzed, also by confocal microscopy, 3d after
agroinfiltration in leaves of 3-week-old N. benthamiana plants exposed to 20°C or 24h
to 4ºC, as reported by English et al. (1997). Microscopy images were collected using
a TCS SP2 confocal laser spectral microscope (Leica Microsystems). The excitation
lines for imaging GFP and YFP fusions were 488 and 514 nm, respectively. All
microscopy analyses were performed, at least, in triplicate with independent samples.
78
4.7. Immunoblot analysis and subcellular fractionation
Total proteins were extracted from 2-week-old c-npr1 plants grown under control
conditions or exposed to 4ºC for different periods of time. Plants were ground in
extraction buffer [50mM TRIS pH 7.5, 150mM NaCl, 5mM EDTA, 0.1% Triton X-100,
0.2% Nonident P-40] with inhibitors [40µM MG132, protease inhibitor cocktail EDTA-
free (Roche), 0.6mM PMSF], and cell debris were pelleted by centrifugation (16000g,
4ºC, 20 min) to obtain clear protein extracts. Protein concentration was determined by
Bradford, using the BioRad Protein Assay (Bio-Rad). Loading buffer containing 6mM
beta-mercaptoethanol was added to protein extracts for visualizing total NPR1 protein
(reducing conditions). To visualize both monomeric and oligomeric NPR1 forms, we
employed loading buffer without beta-mercaptoethanol (non-reducing conditions).
Proteins (50µg) were resolved by electrophoresis on 12% SDS-polyacrylamide gels
and transferred to Hybond P 0.45 PVDF membranes (Amersham), according to the
manufacturer’s protocol. To detect the NPR1-MYC protein, we used anti-c-MYC
monoclonal antibody (sc-40; Santa Cruz Biotechnology). α-Tubulin, employed as a
protein loading control, was detected using anti-α-tubulin monoclonal antibody
(T60T4; Sigma).
Subcellular fractionation was performed as reported previously (Locascio et al., 2013)
using extracts from 2-week-old c-npr1 plants and transgenic trxh3trxh5 and snrk2.8-1
plants containing the NPR1PRO-NPR1-MYC fusion grown under control conditions or
exposed 24h to 4ºC. Isolated proteins were fractionated by electrophoresis,
transferred to membranes as described above, and analyzed by immunoblotting
79
using anti-α-tubulin monoclonal (see above) and anti-Histone H3 polyclonal (sc-
10809, Santa Cruz Biotechnology) antibodies for control of the cytoplasmic and
nuclear fractions, respectively.
In all cases, horseradish peroxidase-conjugated secondary antibodies were used for
primary antibody detection. Signals were always detected with the ECL Western
Blotting Detection Kit (Amersham), and assays were performed in triplicate employing
three independent protein samples.
4.8. Pull down assays
HIS-HSFA1a, HIS-HSFA1b and HIS-HSFA1d constructs were expressed in
Escherichia coli BL21-CodonPlus (DE3). Cells were grown in 250 ml of Terrific Broth
medium at 28ºC until reaching an OD600 0.4-0.5. The induction of fusion proteins
was performed by addition of 0.1mM IPTG and incubation at 28ºC for 12 h. Cells
were then centrifuged at 13000g for 30min at 4ºC and pellet was resuspended in 3
ml/gr of resuspension buffer [50 mM Tris-HCl pH 8.0, 300mM NaCl, 1mM PMSF,
10mM Imidazole and protease inhibitor cocktail EDTA-free (Roche)]. After lysis by
French press and centrifugation (13000g, 4ºC, 30 min), supernatants (70mg of
protein) were mixed with 400 µl of ProBond™ Nickel-Chelating Resin (Thermo Fisher
Scientific) and gently shaken for 2h at 4ºC. Resins were finally washed three times
with resuspension buffer containing 0.5% Nonidet P-40 before used. Two-week-old
WT and c-npr1 plants grown under control conditions or exposed 24h to 4ºC were
ground in liquid nitrogen and homogenized in pull-down extraction buffer [50mM Tris-
80
HCl pH 7.5, 150mM NaCl, 1mM PMSF, 0.5% Nonidet P-40, 0.05% Triton X100, 10%
Glycerol, 25 µM MG132 and protease inhibitor cocktail EDTA-free (Roche)].
Homogenates were centrifuged (13000g, 4ºC, 15 min) and supernatants collected.
For in vivo pull-down assays, 40µl of resin-bound HSFA1-His fusion proteins were
added to 3 mg of total protein extracts and incubated 1h at 4ºC with gentle agitation.
Then, resins were washed 3 times in pull-down extraction buffer, loaded on 12%
SDS-PAGE gels, transferred to Hybond membranes and incubated with anti-His
monoclonal antibody (H1029, Sigma), to verify that equal amounts of HIS-fused
proteins were used in each assay, or with anti-c-MYC monoclonal antibody (see
above), to detect the NPR1-MYC protein recovered in those assays. We employed
anti-α-tubulin monoclonal antibody (see above) to confirm equal protein loading from
control and cold exposed plant extracts in the pull-downs. In all cases, horseradish
peroxidase-conjugated secondary antibodies were used for primary antibody
detection. Pull-down assays were always realized in triplicate employing three
independent protein samples.
4.9. Statistical analyses
The statistical significance of the results was determined by using PRISM 6.0
(GraphPad Software Inc., USA: http://www.graphpad.com). Comparisons between
two groups of data were realized employing Student's t-test. Comparisons between
multiple groups of data were made by means of one-way ANOVA and Bonferroni’s
post hoc test, taking P < 0.05. The values of control conditions or WTs were
considered as references.
81
4.10. Accession numbers
Sequence data from this article can be found in the GenBank/EMBL data libraries
under the accession numbers listed in Supplementary Table 6. The full names of the
genes mentioned in this article are also included in Supplementary Table 6. The
RNAseq data from this article have been submitted to the Gene Expression Omnibus
database (www.ncbi.nlm.nih.gov/geo) and assigned the identifier accession
GSE101483.
82
Supplemental Data Set 1 Top 200 downregulated genes in npr1-1 mutant in response to low temperature
AGI Fold Change Gene Name AT2G26020 -19,9 PLANT DEFENSIN 1.2B (PDF1.2b) AT2G37430 -16,4 AT3G63088 -16,0 ROTUNDIFOLIA LIKE 14 (RTFL14) ATMG00665 -15,5 NADH DEHYDROGENASE 5B (NAD5B) AT1G24000 -14,5 AT1G33055 -14,5 AT3G29370 -14,5 P1R3 (P1R3) AT4G37290 -14,5 AT5G12030 -9,2 HEAT SHOCK PROTEIN 17.6A (HSP17.6A) AT2G14610 -7,3 PATHOGENESIS-RELATED GENE 1 (PR1) AT5G15360 -6,4 AT3G01345 -5,5 AT3G55920 -5,5 AT1G14880 -5,3 PLANT CADMIUM RESISTANCE 1 (PCR1) AT5G12020 -4,9 17.6 KDA CLASS II HEAT SHOCK PROTEIN (HSP17.6II) ATMG00650 -4,8 NADH DEHYDROGENASE SUBUNIT 4L (NAD4L) AT1G07400 -4,5 AT5G52640 -4,4 HEAT SHOCK PROTEIN 90.1 (HSP90.1) AT4G12400 -4,2 HOP3 (Hop3) AT5G48570 -4,0 ROF2 AT3G09940 -3,9 MONODEHYDROASCORBATE REDUCTASE (MDHAR) ATMG01120 -3,9 NADH DEHYDROGENASE 1B (NAD1B) AT5G44430 -3,8 PLANT DEFENSIN 1.2C (PDF1.2c) AT1G53480 -3,8 MTO 1 RESPONDING DOWN 1 (MRD1) AT3G22231 -3,7 PATHOGEN AND CIRCADIAN CONTROLLED 1 (PCC1) AT3G22235 -3,7 AT1G15010 -3,5 ATMG01080 -3,4 MITOCHONDRIAL F0-ATPASE SUBUNIT 9 (ATP9) AT3G26200 -3,4 CYTOCHROME P450, FAMILY 71, SUBFAMILY B,
POLYPEPTIDE 22 (CYP71B22) AT5G44420 -3,4 PLANT DEFENSIN 1.2 (PDF1.2) AT2G22880 -3,2 AT2G01021 -3,2 AT3G12580 -3,2 HEAT SHOCK PROTEIN 70 (HSP70) AT3G22240 -3,2 AT2G07671 -3,1 ATMG00160 -3,1 CYTOCHROME OXIDASE 2 (COX2) AT4G18250 -3,1 ATMG01130 -3,0 ORF106F AT2G24850 -3,0 TYROSINE AMINOTRANSFERASE 3 (TAT3) AT1G13470 -3,0 AT1G53490 -3,0 HOMOLOG OF HUMAN HEI10 ( ENHANCER OF CELL
INVASION NO.10) (HEI10) AT1G74310 -3,0 HEAT SHOCK PROTEIN 101 (HSP101) AT2G14560 -2,8 LATE UPREGULATED IN RESPONSE TO
83
HYALOPERONOSPORA PARASITICA (LURP1) ATMG00080 -2,8 RIBOSOMAL PROTEIN L16 (RPL16) AT2G32030 -2,8 AT1G21326 -2,8 AT1G57630 -2,7 ATMG01190 -2,7 ATP SYNTHASE SUBUNIT 1 (ATP1) AT1G71000 -2,6 DNAJ ATMG00480 -2,5 ORFB AT4G34770 -2,5 AT3G46230 -2,5 HEAT SHOCK PROTEIN 17.4 (HSP17.4) AT2G07707 -2,5 AT3G41762 -2,5 AT3G57460 -2,5 ATMG01360 -2,4 CYTOCHROME OXIDASE (COX1) AT3G50770 -2,4 CALMODULIN-LIKE 41 (CML41) AT1G19960 -2,4 AT2G43570 -2,4 CHITINASE, PUTATIVE (CHI) AT3G28210 -2,4 PMZ AT2G26010 -2,4 PLANT DEFENSIN 1.3 (PDF1.3) AT1G63980 -2,3 AT5G25260 -2,3 ATMG00070 -2,3 NADH DEHYDROGENASE SUBUNIT 9 (NAD9) AT3G20395 -2,3 AT5G45310 -2,3 AT3G26830 -2,2 PHYTOALEXIN DEFICIENT 3 (PAD3) ATMG00060 -2,2 NADH DEHYDROGENASE SUBUNIT 5C (NAD5C) AT2G32680 -2,2 RECEPTOR LIKE PROTEIN 23 (RLP23) AT2G26150 -2,2 HEAT SHOCK TRANSCRIPTION FACTOR A2 (HSFA2) AT5G19100 -2,2 AT1G66700 -2,2 PXMT1 AT2G20560 -2,2 AT2G01008 -2,2 AT4G23150 -2,1 CYSTEINE-RICH RLK (RECEPTOR-LIKE PROTEIN KINASE) 7
(CRK7) AT5G25440 -2,1 ATMG01370 -2,1 ORF111D AT3G14620 -2,1 CYTOCHROME P450, FAMILY 72, SUBFAMILY A,
POLYPEPTIDE 8 (CYP72A8) AT2G39030 -2,1 N-ACETYLTRANSFERASE ACTIVITY 1 (NATA1) ATMG00640 -2,1 ORF25 AT2G18690 -2,1 AT3G26210 -2,1 CYTOCHROME P450, FAMILY 71, SUBFAMILY B,
POLYPEPTIDE 23 (CYP71B23) AT3G57260 -2,1 PATHOGENESIS-RELATED PROTEIN 2 (PR2) AT3G50480 -2,0 HOMOLOG OF RPW8 4 (HR4) ATMG00030 -2,0 ORF107A AT2G07698 -2,0 AT1G52690 -2,0 LATE EMBRYOGENESIS ABUNDANT 7 (LEA7) AT1G63990 -2,0 SPORULATION 11-2 (SPO11-2)
84
AT2G34600 -2,0 JASMONATE-ZIM-DOMAIN PROTEIN 7 (JAZ7) AT1G28640 -2,0 AT1G74929 -2,0 AT4G14365 -1,9 XB3 ORTHOLOG 4 IN ARABIDOPSIS THALIANA (XBAT34) AT3G07195 -1,9 AT4G14400 -1,9 ACCELERATED CELL DEATH 6 (ACD6) AT4G04745 -1,9 AT1G56060 -1,9 AT3G09350 -1,8 FES1A (Fes1A) AT5G59310 -1,8 LIPID TRANSFER PROTEIN 4 (LTP4) AT3G58200 -1,8 AT2G18660 -1,8 PLANT NATRIURETIC PEPTIDE A (PNP-A) AT2G29500 -1,8 AT1G52890 -1,8 NAC DOMAIN CONTAINING PROTEIN 19 (ANAC019) AT5G22380 -1,8 NAC DOMAIN CONTAINING PROTEIN 90 (NAC090) AT2G32160 -1,8 AT4G10910 -1,8 AT4G23140 -1,8 CYSTEINE-RICH RLK (RECEPTOR-LIKE PROTEIN KINASE) 6
(CRK6) AT1G14870 -1,7 PLANT CADMIUM RESISTANCE 2 (PCR2) AT2G15220 -1,7 AT1G35230 -1,7 ARABINOGALACTAN PROTEIN 5 (AGP5) AT4G11890 -1,7 ABA- AND OSMOTIC-STRESS-INDUCIBLE RECEPTOR-LIKE
CYTOSOLIC KINASE1 (ARCK1) AT2G20142 -1,7 AT1G24140 -1,7 AT1G17870 -1,7 ETHYLENE-DEPENDENT GRAVITROPISM-DEFICIENT AND
YELLOW-GREEN-LIKE 3 (EGY3) AT4G11000 -1,7 AT3G44860 -1,7 FARNESOIC ACID CARBOXYL-O-METHYLTRANSFERASE
(FAMT) AT1G65690 -1,7 AT3G45860 -1,7 CYSTEINE-RICH RLK (RECEPTOR-LIKE PROTEIN KINASE) 4
(CRK4) AT3G29000 -1,6 AT2G30770 -1,6 CYTOCHROME P450, FAMILY 71, SUBFAMILY A,
POLYPEPTIDE 13 (CYP71A13) AT1G36622 -1,6 AT1G67810 -1,6 SULFUR E2 (SUFE2) AT4G11521 -1,6 AT2G01170 -1,6 BIDIRECTIONAL AMINO ACID TRANSPORTER 1 (BAT1) AT5G24110 -1,6 WRKY DNA-BINDING PROTEIN 30 (WRKY30) AT3G26230 -1,6 CYTOCHROME P450, FAMILY 71, SUBFAMILY B,
POLYPEPTIDE 24 (CYP71B24) AT5G39670 -1,6 AT2G46430 -1,6 CYCLIC NUCLEOTIDE GATED CHANNEL 3 (CNGC3) AT5G39020 -1,5 AT1G49000 -1,5 AT2G25735 -1,5 AT1G14120 -1,5 AT4G09649 -1,5
85
AT1G11740 -1,5 AT2G17040 -1,5 NAC DOMAIN CONTAINING PROTEIN 36 (NAC036) AT5G45630 -1,5 AT2G18680 -1,5 AT5G44260 -1,5 AT1G66090 -1,5 AT3G18590 -1,5 EARLY NODULIN-LIKE PROTEIN 5 (ENODL5) AT4G20110 -1,5 VACUOLAR SORTING RECEPTOR 7 (VSR7) AT1G51780 -1,5 IAA-LEUCINE RESISTANT (ILR)-LIKE GENE 5 (ILL5) AT2G29350 -1,5 SENESCENCE-ASSOCIATED GENE 13 (SAG13) AT3G17520 -1,5 AT1G21250 -1,5 CELL WALL-ASSOCIATED KINASE (WAK1) AT5G51990 -1,5 C-REPEAT-BINDING FACTOR 4 (CBF4) AT4G16590 -1,5 CELLULOSE SYNTHASE-LIKE A01 (CSLA01) AT1G02920 -1,5 GLUTATHIONE S-TRANSFERASE 11 (ATGSTF11) AT1G19020 -1,5 AT4G39670 -1,5 AT2G04495 -1,5 AT2G39330 -1,5 JACALIN-RELATED LECTIN 23 (JAL23) AT5G49120 -1,5 AT1G47760 -1,4 AGAMOUS-LIKE 102 (AGL102) AT1G51055 -1,4 AT5G10760 -1,4 AT5G25250 -1,4 FLOTILLIN 1 (FLOT1) AT2G15390 -1,4 FUCOSYLTRANSFERASE 4 (FUT4) AT5G16570 -1,4 GLUTAMINE SYNTHETASE 1;4 (GLN1;4) AT5G59220 -1,4 HIGHLY ABA-INDUCED PP2C GENE 1 (HAI1) AT2G47130 -1,4 SHORT-CHAIN DEHYDROGENASE/REDUCTASE 2 (SDR3) AT2G05915 -1,4 AT1G74930 -1,4 ORA47 AT5G20030 -1,4 AT4G35770 -1,4 SENESCENCE 1 (SEN1) AT5G54610 -1,4 ANKYRIN (ANK) AT1G75050 -1,4 AT1G35710 -1,4 AT5G42530 -1,4 AT3G55970 -1,4 JASMONATE-REGULATED GENE 21 (JRG21) AT4G21850 -1,4 METHIONINE SULFOXIDE REDUCTASE B9 (MSRB9) AT5G41750 -1,4 AT5G24530 -1,4 DOWNY MILDEW RESISTANT 6 (DMR6) AT4G23220 -1,4 CYSTEINE-RICH RLK (RECEPTOR-LIKE PROTEIN KINASE) 14
(CRK14) AT5G23830 -1,4 AT1G62580 -1,4 NITRIC OXIDE-DEPENDENT GUANYLATE CYCLASE 1
(NOGC1) AT3G25010 -1,3 RECEPTOR LIKE PROTEIN 41 (RLP41) AT3G04720 -1,3 PATHOGENESIS-RELATED 4 (PR4) AT3G45851 -1,3 AT1G61580 -1,3 R-PROTEIN L3 B (RPL3B)
86
AT4G02520 -1,3 GLUTATHIONE S-TRANSFERASE PHI 2 (GSTF2) AT1G47370 -1,3 AT2G46400 -1,3 WRKY DNA-BINDING PROTEIN 46 (WRKY46) AT2G44290 -1,3 AT1G30755 -1,3 AT5G27420 -1,3 CARBON/NITROGEN INSENSITIVE 1 (CNI1) AT5G52760 -1,3 AT1G26800 -1,3 AT2G02930 -1,3 GLUTATHIONE S-TRANSFERASE F3 (GSTF3) AT2G29460 -1,3 GLUTATHIONE S-TRANSFERASE TAU 4 (GSTU4) AT3G21780 -1,3 UDP-GLUCOSYL TRANSFERASE 71B6 (UGT71B6) AT2G30432 -1,3 TRICHOMELESS1 (TCL1) AT3G06895 -1,3 AT2G38470 -1,3 WRKY DNA-BINDING PROTEIN 33 (WRKY33) AT5G59320 -1,3 LIPID TRANSFER PROTEIN 3 (LTP3) AT5G66650 -1,3 AT1G76650 -1,2 CALMODULIN-LIKE 38 (CML38) AT3G52400 -1,2 SYNTAXIN OF PLANTS 122 (SYP122) AT3G16530 -1,2 AT4G23170 -1,2 EP1 AT1G28370 -1,2 ERF DOMAIN PROTEIN 11 (ERF11)
87
Supplemental Data Set 2 Cold-inducible genes downregulated in npr1-1 mutant in response to low temperature
AGI Gene Name AT5G12020 17.6 KDA CLASS II HEAT SHOCK PROTEIN (HSP17.6II) AT4G11890 ABA- AND OSMOTIC-STRESS-INDUCIBLE RECEPTOR-LIKE
CYTOSOLIC KINASE1 (ARCK1) AT5G10760 APOPLASTIC, EDS1-DEPENDENT 1 (AED1) AT1G35230 ARABINOGALACTAN PROTEIN 5 (AGP5) AT2G01170 BIDIRECTIONAL AMINO ACID TRANSPORTER 1 (BAT1) AT1G76650 CALMODULIN-LIKE 38 (CML38) AT5G27420 CARBON/NITROGEN INSENSITIVE 1 (CNI1) AT1G71000 CHAPERONE DNAJ-DOMAIN SUPERFAMILY PROTEIN (DNAJ) AT2G43570 CHITINASE, PUTATIVE (CHI) AT3G26210 CYTOCHROME P450, FAMILY 71, SUBFAMILY B, POLYPEPTIDE
23 (CYP71B23) AT5G51990 C-REPEAT-BINDING FACTOR 4 (CBF4) AT4G23220 CYSTEINE-RICH RLK (RECEPTOR-LIKE PROTEIN KINASE) 14
(CRK14) AT4G23140 CYSTEINE-RICH RLK (RECEPTOR-LIKE PROTEIN KINASE) 6
(CRK6) AT4G23150 CYSTEINE-RICH RLK (RECEPTOR-LIKE PROTEIN KINASE) 7
(CRK7) AT5G24530 DOWNY MILDEW RESISTANT 6 (DMR6) AT1G28370 ERF DOMAIN PROTEIN 11 (ERF11) AT1G47370 RESPONSE TO THE BACTERIAL TYPE III EFFECTOR PROTEIN
HOPBA1 (RBA1) AT3G44860 FARNESOIC ACID CARBOXYL-O-METHYLTRANSFERASE (FAMT) AT3G09350 FES1A (Fes1A) AT5G25250 FLOTILLIN 1 (FLOT1) AT2G15390 FUCOSYLTRANSFERASE 4 (FUT4) AT1G02920 GLUTATHIONE S-TRANSFERASE 11 (ATGST11) AT1G74310 HEAT SHOCK PROTEIN 101 (HSP101) AT5G12030 HEAT SHOCK PROTEIN 17.6A (HSP17.6A) AT3G12580 HEAT SHOCK PROTEIN 70 (HSP70) AT5G52640 HEAT SHOCK PROTEIN 90.1 (HSP90.1) AT2G26150 HEAT SHOCK TRANSCRIPTION FACTOR A2 (HSFA2) AT5G59220 HIGHLY ABA-INDUCED PP2C GENE 1 (HAI1) AT4G12400 HOP3 (Hop3) AT3G55970 JASMONATE-REGULATED GENE 21 (JRG21) AT2G34600 JASMONATE-ZIM-DOMAIN PROTEIN 7 (JAZ7) AT1G52690 LATE EMBRYOGENESIS ABUNDANT 7 (LEA7) AT1G52890 NAC DOMAIN CONTAINING PROTEIN 19 (ANAC019) AT2G17040 NAC DOMAIN CONTAINING PROTEIN 36 (ANAC036) AT5G22380 NAC DOMAIN CONTAINING PROTEIN 90 (ANAC090) AT1G65690 NDR1/HIN1-LIKE 6 (NHL6) AT1G74930 ORA47 AT3G57260 PATHOGENESIS-RELATED PROTEIN 2 (PR2) AT1G14870 PLANT CADMIUM RESISTANCE 2 (PCR2)
88
AT2G18660 PLANT NATRIURETIC PEPTIDE A (PNP-A) AT3G28210 PMZ AT4G35770 SENESCENCE 1 (SEN1) AT4G34770 SMALL AUXIN UPREGULATED RNA 1 (SAUR1) AT3G52400 SYNTAXIN OF PLANTS 122 (SYP122) AT5G44260 TANDEM CCCH ZINC FINGER PROTEIN 5 (TZF5) AT5G24110 WRKY DNA-BINDING PROTEIN 30 (WRKY30) AT2G38470 WRKY DNA-BINDING PROTEIN 33 (WRKY33) AT2G46400 WRKY DNA-BINDING PROTEIN 46 (WRKY46) AT4G14365 XB3 ORTHOLOG 4 IN ARABIDOPSIS THALIANA (XBAT34) AT2G37430 ZINC FINGER OF ARABIDOPSIS THALIANA 11 (ZAT11) AT2G20142 AT3G17520 AT1G24140 AT2G32030 AT5G45630 AT4G10910 AT1G66090 AT2G18690 AT1G33055 AT5G39670 AT5G52760 AT5G66650 AT1G19020 AT1G75050 AT5G49120 AT4G39670 AT2G25735 AT1G57630 AT1G15010 AT2G20560 AT4G18250
89
Supplemental Data Set 3 Cold-inducible genes whose expression is regulated by HSFA1 transcription factors
AGI Gene Description Primary Gene
Symbol
All Gene Symbols
AT5G45630 senescence regulator (Protein of unknown function, DUF584);(source:Araport11)
AT1G71000 Chaperone DnaJ-domain superfamily protein;(source:Araport11) DNAJ DNAJ
AT1G57630 Toll-Interleukin-Resistance (TIR) domain family protein;(source:Araport11)
AT2G20560 DNAJ heat shock family protein
AT2G18690 transmembrane protein
AT3G28210 Encodes a putative zinc finger protein (PMZ). PMZ PMZ; SAP12
AT5G12020 17.6 kDa class II heat shock protein HSP17.6II HSP17.6II
AT3G09350 Encodes one of the Arabidopsis orthologs of the human Hsp70-binding protein 1 (HspBP-1) and yeast Fes1p: Fes1A (AT3G09350), Fes1B (AT3G53800), Fes1C (AT5G02150). Fes1A is cytosolic and associates with cytosolic Hsp70. Mutants showed increased heat-sensitive phenotype suggestion the involvement of Fes1A in acquired thermotolerance. Does not have nucleotide exchange factor activity in vitro.
FES1A FES1A (Fes1A)
AT1G74310 Encodes ClpB1, which belongs to the Casein lytic proteinase/heat shock protein 100 (Clp/Hsp100) family. Involved in refolding of proteins which form aggregates under heat stress. Also known as AtHsp101. AtHsp101 is a cytosolic heat shock protein required for acclimation to high temperature.
HSP101 HSP101; ATHSP101; HOT1
AT5G12030 Encodes a cytosolic small heat shock protein with chaperone activity that is induced by heat and osmotic stress and is also expressed late in seed development.
HSP17.6A HSP17.6A; AT-HSP17.6A; HSP17.6
AT3G12580 heat shock protein 70 HSP70 HSP70; HSC70-4; ATHSP70
AT5G52640 Encodes a cytosolic heat shock protein AtHSP90.1. AtHSP90.1 interacts with disease resistance signaling components SGT1b and RAR1 and is required for RPS2-mediated resistance. The mRNA is cell-to-cell mobile.
HSP90.1 HSP90.1; HSP83; AtHsp90-1; HSP81-1; ATHS83
AT2G26150 member of Heat Stress Transcription Factor (Hsf) family. Involved in response to misfolded protein accumulation in the cytosol. Regulated by alternative splicing and non-sense-mediated decay.
HSFA2 HSFA2; ATHSFA2
AT4G12400 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins (Prasad 2010, Pubmed ID: 20856808) with potential to interact with Hsp90/Hsp70 as co-chaperones.
HOP3 HOP3
AT1G14870 PCR2 encodes a membrane protein involved in zinc transport and detoxification.
PCR2 PCR2; AtPCR2
AT5G44260 Encodes a Tandem CCCH Zinc Finger protein. Interacts and co-localizes with MARD1 and RD21A in processing bodies (PBs) and stress granules (SGs).
TZF5 TZF5; ATTZF5
90
Supplemental Data Set 4 Specific primers used for gene expression by qPCR Gene AGI Type Sequence (5'- 3') NPR1 AT1G64280 qRT-F TTTGTTCTCGTTTGTCTTC
qRT-R TATGGCGGTTGAATGTAA
GUS qRT-F GCGCGTTACAAGAAAGCCGG
qRT-R AGTCCCGCTAGTGCCTTGTC
ANAC019 AT1G52890 qRT-F CGGTCTTGCGGATACTTCTAACT
qRT-R CGTCTTCAGGTAGCCACAGT
LEA7 AT1G52690 qRT-F GTGAGACACAGAGGAAGTGAAGAG
qRT-R CTCACGAACGCAACAAACACTAATC
XBAT34 AT4G14365 qRT-F GTTGGAGTTGGTTCTGTA
qRT-R GGAGTCATCAATAATCATCAC
ATGST11 AT1G02920 qRT-F CTTTCATCTTCCGCAACCCTTT
qRT-R GTTGGTTTCCTTTGTCTGAGTA
AT2G18690 AT2G18690 qRT-F TTGGCTTTGGCTTCCTCTTCTTT
qRT-R TAGCAAAATAGGACTGAGAGACG
CML38 AT1G76650 qRT-F TCAAGGGAGCGTTTAGACTGTA
qRT-R CTCCATCAGCATTGAGATCAAA
AT1G19020 AT1G19020 qRT-F CGTCGTGAGAAGCAGCGGAAGT
qRT-R GTGGTTTTGTGATACTTGTCCT
PR2 AT3G57260 qRT-F TGGATCACCGAGAAGGCCAGGG
qRT-R TGTCGATCTGGATGAAACAGTCCCCA
FLOT1 AT5G25250 qRT-F GAGCGTCACAGTATTTGGCGAT
qRT-R ACCAATCGTAAAAACAGCGGGA
AT4G39670 AT4G39670 qRT-F TCAACACGCCATTGTCCGTAAT
qRT-R CGACGCTTCCACCAAATCCTTA
AT1G15010 AT1G15010 qRT-F GGACATCACAAAGAATCGCCAC
qRT-R ATGTTCTCGTCCACCGTTCTTC
HSFA2 AT2G26150 qRT-F CTTGGAGTAATGGTCGTA
qRT-R TTGCTATGCTTGAAGTAAC
HSP101 AT1G74310 qRT-F TAGTCTTATTAAGGTCATTCG
qRT-R CATAATCAACTGGTCAACA
DNAJ AT1G71000 qRT-F GTTGGACTCTATGATTCTG
qRT-R CATTGATTGGTTCTGGAA
HSP90.1 AT5G52640 qRT-F TGAGGTTGAAGAAGTTGAT
qRT-R TCTGCTTGTTGATGAGTT
HSP17.6A AT5G12030 qRT-F AACTTCACACCTTCATTC
91
qRT-R CCAGATAGAGAACGAGAA
HSP70 AT3G12580 qRT-F GGTGGTGTTGTTATGACTGTT
qRT-R CTGGTTGTCTGAATAGGTAG
HSP17.6II AT5G12020 qRT-F TTCTCGTTGTTGTTGTGGTCTT
qRT-R ACAATGGATTTAGGAAGGTTT
FES1A AT3G09350 qRT-F TAGTGACGATGCTGAGAT
qRT-R TCTATGCTGCTACTTCCA
PMZ AT3G28210 qRT-F CTTATGGCAGGAGGAGGAACAG
qRT-R ACAGTTATGTGACTTGTATG
TZF5 AT5G44260 qRT-F ATCCCACACTTATCTCTTCCTATC
qRT-R GGGGACTTGAAACTGACGAC
HOP3 AT4G12400 qRT-F ATCAACCTTTCACCAACCAATCA
qRT-R TAAACGCAGCACCTAATCGG
PCR2 AT1G14870 qRT-F GGAGAGACAACAGAATCAAGG
qRT-R TTTCACAACAAGCATTTTTTT
AT1G57630 AT1G57630 qRT-F TCATTTCCTTCATCTTCTTTGTCT
qRT-R GACCGATGAACTCTCCTCTCT
AT2G20560 AT2G20560 qRT-F CAAAGGAACCACCAAAAAGATGA
qRT-R CATCCTGGTTTCACATCAAT
AT2G18690 AT2G18690 qRT-F TACCAAAAACCAATAAGCCAAG
qRT-R AGGGAATACCAAGACTGAGAACA
AT5G45630 AT5G45630 qRT-F CAAGAAACGACGAGAAGAAGGGT
qRT-R AGTCTTATCATCCTCCTCCTCC
RD29A AT5G52310 qRT-F CTGAAGAACGAATCTGATATCG
qRT-R CCAGGTCTTCCCTTCGCCAG
AT4G26410 AT4G26410 qRT-F GAGCTGAAGTGGCTTCCATGAC
qRT-R GGTCCGACATACCCATGATCC
Specific primers used for Gateway constructs
Name Sequence (5'- 3') attb1 NPR1 promoter GGGGACAAGTTTGTACAAAAAAGCA
GGCTCAAGGGTTCCTGTTTATAGTTGAA
attb2 NPR1 promoter GGGGACCACTTTGTACAAGAAAGCTGGGTCAACAGGTTCCGATGAATTGAA
attb1 NPR1 CDS GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGACACCACCATTGATGGATTCG
attb2 NPR1 CDS GGGGACCACTTTGTACAAGAAAGCTGGGTCCCGACGACGATGAGAGAGTTTACGG
attb2 NPR1 CDS+STOP GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACCGACGACGATGAGAGAGTTTACGG
attb1 HSFA1a CDS GGGGACAAGTTTGTACAAAAAAGCAGGCTtcATGTTTGTAAATTTCAAATA
attb2 HSFA1a CDS GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGTGTGTTCTGTTTCTGATG
92
attb1 HSFA1b CDS GGGGACAAGTTTGTACAAAAAAGCAGGCTtcATGGAATCGGTTCCCGAATC
attb2 HSFA1b CDS GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATTTCCTCTGTGCTTCTGAGG
attb1 HSFA1d CDS GGGGACAAGTTTGTACAAAAAAGCAGGCTtcATGGTGTGAGCAAAGTAAC
attb2 HSFA1d CDS GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAAAGGATTTTGCCTTGAGAGAT
Specific primers used for mutant genotyping
Name Sequence (5'- 3') trxh3 TTTATTCACCACCACACAT
trxh5 GTTCACTAATGTTGTCTTCTTC
Left border T-DNA GAACAACACTCAACCCTATCTC
93
Supplemental Data Set 5 Total and mapped reads obtained for each sample by RNAseq experiments
Sample Uniquely mapped Total % mapped
WT_cold 20991650 22055413 95,17686202
npr1-1_cold 26084365 27244452 95,74193307
94
Supplemental Data Set 6 Full names of the genes mentioned in this article
AGI Gene Symbol Brief description AT1G71000 DNAJ Chaperone DnaJ-domain superfamily protein
AT1G19020 AT1G19020 CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase
AT4G39670 AT4G39670 Glycolipid transfer protein (GLTP) family protein
AT5G45630 AT5G45630 Senescence regulator (Protein of unknown function, DUF584)
AT1G57630 AT1G57630 Toll-Interleukin-Resistance (TIR) domain family protein
AT1G15010 AT1G15010 Mediator of RNA polymerase II transcription subunit
AT2G20560 AT2G20560 DNAJ heat shock family protein
AT2G18690 AT2G18690 Transmembrane protein
AT5G06950 TGA2 TGACG sequence-specific binding factor 2
AT3G28210 PMZ Stress-associated protein 12
AT3G57260 PR2 Pathogenesis-related protein 2
AT5G12020 HSP17.6II 17.6 KDA class II heat shock protein
AT1G52340 ABA2 ABA deficient 2
AT4G25490 CBF1 C-repeat/DRE binding factor 1
AT4G25470 CBF2 C-repeat/DRE binding factor 2
AT1G76650 AT1G76650 Calmodulin-like 38
AT4G25480 CBF3 C-repeat/DRE binding factor 3
AT1G74710 ICS1 Isochorismate synthase 1
AT3G09350 FES1A Arabidopsis orthologs of the human Hsp70-binding protein 1 (HspBP-1)
AT5G25250 FLOT1 Flotillin 1
AT1G02920 ATGST11 Arabidopsis glutathione s-transferase 11
AT4G17750 HSFA1a Arabidopsis class A heat shock factor 1a
AT5G16820 HSFA1b Arabidopsis class A heat shock factor 1b
AT1G74310 HSP101 Heat shock protein 101
AT5G12030 HSP17.6A Heat shock protein 17.6A
AT3G12580 HSP70 Arabidopsis heat shock protein 70
AT5G52640 HSP90.1 Heat shock protein 90.1
AT1G32330 HSFA1d Arabidopsis class A heat shock factor 1d
AT3G02990 HSFA1e Arabidopsis class A heat shock factor 1e
AT2G26150 HSFA2 Heat shock transcription factor A2
AT4G12400 HOP3 Encodes one of the 36 carboxylate clamp (CC)-tetratricopeptide repeat (TPR) proteins
AT1G18870 ICS2 Arabidopsis isochorismate synthase 2
AT1G52690 LEA7 Late embryogenesis abundant 7
AT5G52310 RD29A Responsive to desiccation 29A
AT1G52890 ANAC019 NAC domain containing protein 19
AT1G64280 NPR1 Arabidopsis nonexpresser of PR genes 1
95
AT5G06960 TGA5 TGACG sequence-specific binding factor 5
AT1G14870 PCR2 Plant cadmium resistance 2
AT4G26410 RHIP1 RGS1-HXK1 interacting protein 1
AT1G65700 LSM8 Small nuclear ribonucleoprotein family protein
AT1G78290 SnRK2.8 SNF1-related protein kinase 2.8
AT5G44260 TZF5 Tandem CCCH zinc finger protein 5
AT3G12250 TGA6 TGACG sequence-specific binding factor 6
AT5G42980 TRXH3 Thioredoxin H-type 3
AT1G45145 TRXH5 Thioredoxin H-type 5
AT2G38470 WRKY33 WRKY DNA-binding protein 33
AT4G14365 XBAT34 XB3 ortholog 4 in Arabidopsis
96
5. LITERATURE
Adie, B.A.T., Perez-‐Perez, J., Perez-‐Perez, M.M., Godoy, M., Sanchez-‐Serrano, J.-‐J., Schmelz, E.A., and Solano, R. (2007). ABA Is an essential signal for plant resistance to pathogens affecting JA biosynthesis and the activation of defenses in Arabidopsis. Plant Cell 19: 1665–1681.
Barrero-‐Gil, J. and Salinas, J. (2017). CBFs at the crossroads of plant hormone signaling in cold stress response. Mol. Plant 10: 542–544.
Belda-‐Palazón, B., Ruiz, L., Martí, E., Tárraga, S., Tiburcio, A.F., Culiáñez, F., Farràs, R., Carrasco, P., and Ferrando, A. (2012). Aminopropyltransferases involved in polyamine biosynthesis localize preferentially in the nucleus of plant cells. PLoS One 7: e46907.
Bharti, K., Von Koskull-‐Döring, P., Bharti, S., Kumar, P., Tintschl-‐Körbitzer, A., Treuter, E., and Nover, L. (2004). Tomato heat stress transcription factor HsfB1 represents a novel type of general transcription coactivator with a histone-‐like motif interacting with the plant CREB binding protein ortholog HAC1. Plant Cell 16: 1521–1535.
Blanco, F., Salinas, P., Cecchini, M.N., Jordana, X., Van Hummelen, P., Alvarez, M.E. and Holuigue, L. (2009). Early genomic responses to salicylic acid in Arabidopsis. Plant Mol. Biol. 70: 79–102.
Bowling, S. a, Clarke, J.D., Liu, Y., Klessig, D.F., and Dong, X. (1997). The cpr5 mutant of Arabidopsis expresses both NPR1-‐dependent and NPR1-‐independent resistance. Plant Cell 9: 1573–1584.
Cao, H., Bowling, S.A., Gordon, A.S., and Dong, X. (1994). Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. Plant Cell 6: 1583–1592.
Carey, C.C., Gorman, K.F., and Rutherford, S. (2006). Modularity and intrinsic evolvability of Hsp90-‐buffered change. PLoS One 1: e76.
Catalá, R., Medina, J., and Salinas, J. (2011). Integration of low temperature and light signaling during cold acclimation response in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 108: 16475–16480.
Chinnusamy, V., Zhu, J., and Zhu, J.-‐K. (2007). Cold stress regulation of gene expression in plants. Trends Plant Sci. 12: 444–451.
97
Czechowski, T., Stitt, M., Altmann, T., Udvardi, M.K., and Scheible, W.-‐R. (2005). Genome-‐Wide Identification and Testing of Superior Reference Genes for Transcript Normalization in Arabidopsis. Plant Physiol. 139: 5-‐17.
English, J., Davenport, G., Elmayan, T., Vaucheret, H., and Baulcombe, D. (1997). Requirement of sense transcription for homology-‐dependent virus resistance and trans-‐inactivation. Plant J. 12: 597–603.
Fan, W. and Dong, X. (2002). In vivo interaction between NPR1 and transcription factor TGA2 leads to salicylic acid-‐mediated gene activation in Arabidopsis. Plant Cell 14: 1377–1389.
Fu, Z.Q. and Dong, X. (2013). Systemic Acquired Resistance: Turning Local Infection into Global Defense. Annu. Rev. Plant Biol. 64: 839–863.
Fu, Z.Q., Yan, S., Saleh, A., Wang, W., Ruble, J., Oka, N., Mohan, R., Spoel, S.H., Tada, Y., Zheng, N., and Dong, X. (2012). NPR3 and NPR4 are receptors for the immune signal salicylic acid in plants. Nature 486: 228–232.
González-‐Guzmán, M., Apostolova, N., Bellés, J.M., Barrero, J.M., Piqueras, P., Ponce, M.R., Micol, J.L., Serrano, R., and Rodríguez, P.L. (2002). The short-‐chain alcohol dehydrogenase ABA2 catalyzes the conversion of xanthoxin to abscisic aldehyde. Plant Cell 14: 1833–1846.
Griffith, M. and Yaish, M.W.F. (2004). Antifreeze proteins in overwintering plants: A tale of two activities. Trends Plant Sci. 9: 399–405.
Hermann, M., Maier, F., Masroor, A., Hirth, S., Pfitzner, A.J.P., and Pfitzner, U.M. (2013). The Arabidopsis NIMIN proteins affect NPR1 differentially. Front. Plant Sci. 4: 88. doi: 10.3389/fpls.2013.00088.
Hon, W.C., Griffith, M., Mlynarz, A., Kwok, Y.C., and Yang, D.S. (1995). Antifreeze proteins in winter rye are similar to pathogenesis-‐related proteins. Plant Physiol. 109: 879–89.
Jia, Y., Ding, Y., Shi, Y., Zhang, X., Gong, Z., and Yang, S. (2016). The cbfs triple mutants reveal the essential functions of CBFs in cold acclimation and allow the definition of CBF regulons in Arabidopsis. New Phytol. 212: 345–353.
Kilian, J., Whitehead, D., Horak, J., Wanke, D., Weinl, S., Batistic, O., D’Angelo, C., Bornberg-‐Bauer, E., Kudla, J., and Harter, K. (2007). The AtGenExpress global stress expression data set: protocols, evaluation and model data analysis of UV-‐B light, drought and cold stress responses. Plant J. 50: 347–363.
Kim, Y., Park, S., Gilmour, S.J., and Thomashow, M.F. (2013a). Roles of CAMTA transcription factors and salicylic acid in configuring the low-‐temperature transcriptome and freezing
98
tolerance of Arabidopsis. Plant J. 75: 364–376.
Kim, D., Pertea, G., Trapnell, C., Pimentel, H., Kelley, R., and Salzberg, S.L. (2013b). TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 14: R36.
Kinkema, M., Fan, W., and Dong, X. (2000). Nuclear Localization of NPR1 Is Required for Activation of PR Gene Expression. Plant Cell. 12: 2339-‐2350.
Lawton, K., Weymann, K., Friedrich, L., Vernooij, B., Uknes, S., and Ryals, J. (1995). Systemic acquired resistance in Arabidopsis requires salicylic acid but not ethylene. Mol. Plant. Microbe. Interact. 8: 863–870.
Lee, H.-‐J., Park, Y.-‐J., Seo, P.J., Kim, J.-‐H., Sim, H.-‐J., Kim, S.-‐G., and Park, C.-‐M. (2015). Systemic immunity requires SnRK2.8-‐mediated nuclear import of NPR1 in Arabidopsis. Plant Cell 27: 3425–3438.
Levitt, J. (1980). Responses of Plants to Environmental Stress. Chilling, Freezing, and High Temperature Stresses, 2nd ed. (New York: Academic Press).
Liu, H.C., Liao, H.T., and Charng, Y.Y. (2011). The role of class A1 heat shock factors (HSFA1s) in response to heat and other stresses in Arabidopsis. Plant, Cell Environ. 34: 738–751.
Locascio, A., Blázquez, M.A., and Alabadí, D. (2013). Dynamic regulation of cortical microtubule organization through prefoldin-‐DELLA interaction. Curr. Biol. 23: 804–809.
Love, M.I, Huber, W., Anders, S.l. (2014). Moderated estimation of fold change and dispersion for RNA-‐seq data with DESeq2. Genome Biol. 15: 550.
Medina, J., Catala, R., Salinas, J. (2001). Developmental and stress regulation of RCI2A and RCI2B, two cold-‐inducible genes of Arabidopsis encoding highly conserved hydrophobic proteins. Plant Physiol 125: 1655–1666.
Miura, K. and Tada, Y. (2014). Regulation of water, salinity, and cold stress responses by salicylic acid. Front. Plant Sci. 5: 4. doi: 10.3389/fpls.2014.00004.
Nakagawa, T., Suzuki, T., Murata, S., Nakamura, S., Hino, T., Maeo, K., Tabata, R., Kawai, T., Tanaka, K, Niwa Y., Watanabe, Y., Nakamura, K., Kimura, T., Ishiguro, S. (2007). Improved Gateway binary vectors: high-‐performance vectors for creation of fusion constructs in transgenic analysis of plants. Biosci. Biotechnol. Biochem. 71: 2095–2100.
Nakai, Y., Nakahira, Y., Sumida, H., Takebayashi, K., Nagasawa, Y., Yamasaki, K., Akiyama, M., Ohme-‐Takagi, M., Fujiwara, S., Shiina, T., Mitsuda, N., Fukusaki, E., Kubo, Y., Sato, MH.
99
(2013). Vascular plant one-‐zinc-‐finger protein 1/2 transcription factors regulate abiotic and biotic stress responses in Arabidopsis. Plant J. 73: 761–775.
Nishizawa, A., Yabuta, Y., Yoshida, E., Maruta, T., Yoshimura, K., and Shigeoka, S. (2006). Arabidopsis heat shock transcription factor A2 as a key regulator in response to several types of environmental stress. Plant J. 48: 535–547.
Pastor, V., Vicent, C., Cerezo, M., Mauch-‐Mani, B., Dean, J., and Flors, V. (2012). Detection, characterization and quantification of salicylic acid conjugates in plant extracts by ESI tandem mass spectrometric techniques. Plant Physiol. Biochem. 53: 19–26.
Perea-‐Resa, C., Hernandez-‐Verdeja, T., Lopez-‐Cobollo, R., Castellano, M. d. M., and Salinas, J. (2012). LSM proteins provide accurate splicing and decay of selected transcripts to ensure normal Arabidopsis development. Plant Cell 24: 4930–4947.
Pihakaski-‐Maunsbach, K., Moffatt, B., Testillano, P., Risueño, M., Yeh, S., Griffith, M., and Maunsbach, A.B. (2001). Genes encoding chitinase-‐antifreeze proteins are regulated by cold and expressed by all cell types in winter rye shoots. Physiol. Plant. 112: 359–371.
Ruelland, E., Vaultier, M.N., Zachowski, A., and Hurry, V. (2009). Chapter 2 Cold Signalling and Cold Acclimation in Plants. Adv. Bot. Res. 49: 35–150.
Scharf, K.-‐D., Berberich, T., Ebersberger, I., and Nover, L. (2012). The plant heat stress transcription factor (Hsf) family: structure, function and evolution. Biochim. Biophys. Acta 1819: 104–119.
Seo, P.J., Kim, M.J., Park, J.-‐Y., Kim, S.-‐Y., Jeon, J., Lee, Y.-‐H., Kim, J., and Park, C.-‐M. (2010). Cold activation of a plasma membrane-‐tethered NAC transcription factor induces a pathogen resistance response in Arabidopsis. Plant J. 61: 661–671.
Shah, J., Tsui, F., and Klessig, D.F. (1997). Characterization of a Salicylic Acid–Insensitive Mutant (sai1) of Arabidopsis thaliana, identified in a selective screen utilizing the SA-‐inducible expression of the tms2 Gene. 10: 69–78.
Shi, H., Wang, X., Ye, T., Cheng, F., Deng, J., Yang, P., Zhang, Y., and Chan, Z. (2014). The Cysteine2/Histidine2-‐Type transcription factor ZINC FINGER OF ARABIDOPSIS THALIANA6 modulates biotic and abiotic stress responses by activating salicylic acid-‐related genes and C-‐REPEAT-‐BINDING FACTOR genes in Arabidopsis. Plant Physiol. 165: 1367-‐1379.
Tada, Y., Spoel, S.H., Pajerowska-‐Mukhtar, K., Mou, Z., Song, J., Wang, C., Zuo, J., and Dong, X. (2008). Plant immunity requires conformational changes of NPR1 via S-‐nitrosylation and thioredoxins. Science 321: 952–956.
100
Tsutsui, T., Kato, W., Asada, Y., Sako, K., Sato, T., Sonoda, Y., Kidokoro, S.,Yamaguchi-‐Shinozaki, K., Tamaoki, M., Arakawa, K., Ichikawa, T., Nakazawa, M., Seki, M., Shinozaki, K., Matsui, M., Ikeda, A., Yamaguchi, J. (2009). DEAR1, a transcriptional repressor of DREB protein that mediates plant defense and freezing stress responses in Arabidopsis. J. Plant Res. 122: 633–643.
Wathugala, D.L., Hemsley, P.A., Moffat, C.S., Cremelie, P., Knight, M.R., and Knight, H. (2012). The Mediator subunit SFR6/MED16 controls defence gene expression mediated by salicylic acid and jasmonate responsive pathways. New Phytol. 195: 217–230.
Wildermuth, M.C., Dewdney, J., Wu, G., and Ausubel, F.M. (2001). Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 414: 562–565.
Xue-‐Xuan, X., Hong-‐Bo, S., Yuan-‐Yuan, M., Gang, X., Jun-‐Na, S., Dong-‐Gang, G., and Cheng-‐Jiang, R. (2010). Biotechnological implications from abscisic acid (ABA) roles in cold stress and leaf senescence as an important signal for improving plant sustainable survival under abiotic-‐stressed conditions. Crit. Rev. Biotechnol. 30: 222–230.
Yoshida, T,. Ohama, N., Nakajima, J., Kidokoro, S., Mizoi, J., Nakashima, K., Maruyama, K., Kim, JM., Seki, M., Todaka, D., Osakabe, Y., Sakuma, Y., Schöffl, F., Shinozaki, K., Yamaguchi-‐Shinozaki, K. (2011). Arabidopsis HsfA1 transcription factors function as the main positive regulators in heat shock-‐responsive gene expression. Mol. Genet. Genomics 286: 321–332.
Zhang, X., Henriques, R., Lin, S.-‐S., Niu, Q.-‐W., and Chua, N.-‐H. (2006). Agrobacterium-‐mediated transformation of Arabidopsis thaliana using the floral dip method. Nat. Protoc. 1: 641–646.
Zhang, Y., Tessaro, M.J., Lassner, M., and Li, X. (2003). Knockout analysis of Arabidopsis transcription factors TGA2, TGA5, and TGA6 reveals their redundant and essential roles in systemic acquired resistance. Plant Cell 15: 2647–2653.
Zhao, C., Zhang, Z., Xie, S., Si, T., Li, Y., and Zhu, J.-‐K. (2016). Mutational Evidence for the Critical Role of CBF Genes in Cold Acclimation in Arabidopsis. Plant Physiol. 171: 2744-‐59.
101
SECTION 3
1. CONCLUSIONS
Some plants from temperate regions have developed the ability to cold
acclimate, increasing their tolerance to freezing temperatures and other abiotic stress
conditions. This adaptive response involves an extensive transcriptional
reprogramming that is largely unknown. Interestingly, recent studies have related cold
acclimation with biotic stress responses, but the molecular mechanism underlying this
relationship still remains elusive.
The main question that motivated this thesis project was to determine whether
NPR1, the master coregulator that controls most transcriptomic responses in
pathogens resistance, is also implicated in abiotic stress responses. In this work, we
provide molecular and functional evidence that NPR1 is effectively involved in abiotic
stress responses. Specifically, we found implication of NPR1 in the cold acclimation
process in Arabidopsis. In fact, we demonstrate for the first time that NPR1 promotes
this process by activating a novel-signaling pathway. This pathway involves a SA-,
ABA- and CBFs-independent increase of NPR1 levels and the subsequent relocation
of NPR1 from the cytoplasm to the nucleus. Once in the nucleus, NPR1 activates
cold-inducible gene expression by interacting with HSFA1 transcription factors.
Together, these observations indicate that NPR1 constitutes an integration node for
plant responses to both biotic and abiotic stresses.
The first aim of this thesis was the molecular characterization of Arabidopsis
NPR1 in response to abiotic stresses. The main conclusions of this aim were:
102
• The NPR1 gene is upregulated specifically under cold conditions, but not in
response to high salt or drought, and this upregulation occurs principally in leaf
tissues.
• The accumulation of NPR1 transcript levels in response to low temperature
conditions is regulated at the transcriptional level, and is not mediated by SA,
ABA or the CBFs factors.
• Consistent with gene expression results, an increase in NPR1 protein levels
was observed in plants exposed to low temperature.
• NPR1 monomerizes and relocates to the nucleus in Arabidopsis cells under
low temperature. We found that the SnRK2.8 kinase, which phosphorylates
NPR1, and thioredoxins TRXH3/TRXH5, which reduce disulfide bonds in
NPR1 oligomers, are required for NPR1 monomerization and nuclear
localization in the cold.
The second aim of the thesis was the functional characterization of NPR1 in
the cold acclimation process. We obtained the following main conclusions:
• Genetic evidence supports that NPR1 is a positive regulator of the cold
acclimation response.
• Monomerization and nuclear import of NPR1 in response to low temperature is
necessary for full development of cold acclimation.
• Transcriptome analysis revealed that NPR1 operates in cold acclimation by
promoting cold-induced gene expression, including the cold induction of a set
of heat stress-responsive genes belonging to the HSFA1 regulon. This
103
function, unlike the pathogen response, is not mediated by the canonical
pathway controlled by TGA class II transcription factors.
• HSFA1s, a family of four partially redundant transcription factors that have a
role as master regulators of the heat-shock response, regulate heat stress-
responsive gene expression dependent of NPR1 under low temperature
conditions.
• Genetic analyses showed that HSFA1 factors and the cold-induced heat
stress-responsive gene expression are required for cold acclimation.
• HSFA1 transcription factors also localize in the nucleus in response to low
temperature.
• NPR1 interacts with HSFA1 factors and this interaction is crucial to promote
cold-induced heat stress-responsive gene expression and, therefore, cold
acclimation.
Based on our results, we proposed a working model for the novel NPR1 function
in cold acclimation. In response to low temperature, NPR1 gene expression is
transcriptionally activated and NPR1 protein accumulates in the nucleus. Two positive
regulators of cold acclimation, SnRK2.8 and TRXH3/H5, post-translationally modify
NPR1, enabling its oligomer to monomer transition and consequently its nuclear
localization. Here, NPR1 interacts with different transcription factors, including the
HSFA1s, to promote cold-induced gene expression. The NPR1/HSFA1s interaction
specifically leads to the activation of a set of cold-inducible heat stress-responsive
genes that are required for full development of the cold acclimation process. We
104
speculate that the function of NPR1 in this process might offer plants the selective
advantage of activating the defense response under low temperature conditions,
when they are highly sensitive to pathogens. In this context, this work gives novel
insights for understanding of how plants respond to environmental stresses, providing
important novel evidence of NPR1 function in this process, opening new issues for
future evaluation.
2. PROJECTIONS
Several interesting points for future evaluation emerged from this work.
First, we found that NPR1 transcripts accumulate under cold treatment, that
this accumulation is regulated at the transcriptional level, and that it is independent of
SA, ABA and the CBFs. Further investigations are required to unravel which are the
cis- and trans-acting elements involved in this regulation.
Second, we demonstrate that the post-translational regulation of NPR1 in the
cold is mediated by SnRK2.8 and TRXH3/H5, which promote its monomerization and
nuclear localization. Future work should be oriented to investigate whether this
molecular modification is mediated by redox and/or other biochemical changes that
take place during cold acclimation.
105
Third, NPR1 should promote cold-induced gene expression and cold
acclimation by interacting with different transcription factors. Identifying other factors
than HSFA1, would be an important line of research in the next years.
Fourth, in response to low temperature, we show that HSFA1 factors localize
to the nucleus and regulate the induction of a set of cold-induced heat-stress
responsive genes. Determining the molecular mechanisms that control the nuclear
localization of HSFA1 factors in the cold deserves further investigation.
Fifth, NPR1 activity in response to pathogens has been described to be
regulated by multiple posttranslational modifications, including phosphorylation and
ubiquitination. Whether or not these modifications also regulate NPR1 activity in
response to cold, should be the subject of future studies.