molecular characterization and expression pattern of insulin-like growth factor binding protein-3...

Molecular characterization and expression patternof insulin-like growth factor binding protein-3 (IGFBP-3)in common carp, Cyprinus carpio

Wenbo Chen • Haoran Lin • Wensheng Li

Received: 29 February 2012 / Accepted: 15 June 2012 / Published online: 27 June 2012

� Springer Science+Business Media B.V. 2012

Abstract A full-length cDNA encoding the insulin-

like growth factor binding protein-3 (IGFBP-3) was

cloned from the liver of common carp (Cyprinus

carpio) by RT-PCR. The IGFBP-3 cDNA sequence is

1,680 bp long and has an open reading frame of

882 bp encoding a predicted polypeptide of 293 amino

acid residues. The deduced amino acid sequence

contains a putative signal peptide of 25 amino acid

residues resulting in a mature protein of 268 amino

acids. A single band of approximate 1.9 kb was found

in liver by Northern blot analysis. IGFBP-3 mRNA

was observed in all regions of brain with high levels.

In peripheral tissues, high levels of IGFBP-3 mRNA

were found in retina, red muscle, liver, heart, posterior

intestine, spleen, and testis. Relatively lower levels

were found in white muscle, kidney, thymus gland,

and ovary, while in head kidney, blood, skin, gill,

middle intestine, and anterior intestine, the IGFBP-3

mRNA levels were much lower. IGFBP-3 mRNA was

first detected in the blastula stage with significantly

high level. The level sharply decreased in gastrula

stage, and it became to increase in the following

stages. During the reproductive cycle, the abundance

of IGFBP-3 mRNA significantly decreased between

the recrudescing stage and the matured stage in ovary,

although in testis, IGFBP-3 mRNA expression level

did not exhibit a significant change. The mRNA

expression profiles in the present study imply that the

IGFBP-3 may play important physiological functions

in common carp development and reproduction.

Keywords Cyprinus carpio � Insulin-like growth

factor binding protein-3 � cDNA cloning � mRNA

expression

Introduction

Insulin-like growth factor (IGF) system, including

IGF-I and IGF-II, IGF receptors, and IGF-binding

proteins (IGFBPs), is important for cell growth,

proliferation, and differentiation. To date, six IGFBPs

(IGFBP-1 to IGFBP-6) have been cloned and charac-

terized in mammals (Jones and Clemmons 1995; Hwa

et al. 1999). These IGFBPs can bind IGFs with an

affinity equal to or greater than that of IGF receptors.

Many studies have been pointed that IGFBPs not only

have essential roles in controlling and regulating the

biological activities of IGFs but also IGF-independent

W. Chen � H. Lin � W. Li (&)

State Key Laboratory of Biocontrol, Institute of Aquatic

Economic Animals and Guangdong Provincial Key

Laboratory for Aquatic Economic Animals, School

of Life Sciences, Sun Yat-Sen University,

Guangzhou 510275, China

e-mail: [email protected]

W. Chen

Department of Biology, Institute of Resources

and Environment, Henan Polytechnic University,

Jiaozuo 454000, China

123

Fish Physiol Biochem (2012) 38:1843–1854

DOI 10.1007/s10695-012-9681-6

actions via their putative receptor on cell membrane or

direct nuclear actions by transporting into the nucleus

(Andress 1998; Schedlich et al. 2000; Firth and Baxter

2002).

Of the six IGFBPs, IGFBP-3 is the most abundant

IGFBP in plasma and carries the majority of the IGFs

in the circulation in a 150 kDa form complexed with

IGFs and an acid-labile subunit (Baxter and Martin

1989). In mammals, IGFBP-3 mRNA is mainly

synthesized in liver by non-parenchymal cells, while

in many other extrahepatic tissues, IGFBP-3 mRNA

also has moderate expression levels, suggesting its

endocrine and autocrine/paracrine functions (Clem-

mons 1997).

In the circulation of variety of teleost fishes, the

40–50 kDa IGFBP, postulated to be fish IGFBP-3,

has been detected using Western ligand blotting

(Kelley et al. 1992, 2001; Fukazawa et al. 1995; Park

et al. 2000; Bauchat et al. 2001; Gracey et al. 2001),

and some results show that fish IGFBP-3 is up-

regulated by growth hormone (GH), decreased by

fasting and correlate with fish somatic growth (Kelley

et al. 1992, 2001; Park et al. 2000). These results

show a similar regulation pattern as mammalian

IGFBP-3. Recently, full or partial length sequences of

fish IGFBP-3 cDNA have been cloned and charac-

terized in tilapia (Oreochromis mossambicus) (Cheng

et al. 2002), zebrafish (Danio rerio) (Chen et al.

2004), and yellowtail (Seriola quinqueradiata) (Pedr-

oso et al. 2009). Alignment of these amino acid

sequences indicates that the overall structure of fish

IGFBP-3s is conserved with high degree to their

mammalian counterparts. In striped bass (Morone

saxatilis) serum, the 35-kDa (IGFBP-3) protein is the

predominant IGFBP and its concentration is not

significantly altered by fasting and refeeding although

the levels tend to be reduced (Siharath et al. 1996).

However, little is known regarding the ontogeny of

fish IGFBP-3 mRNA and its possible involvement or

roles in fish reproduction.

To further understand the roles of IGFBPs in fish

development and reproduction, we utilized common

carp (Cyprinus carpio), one of the most economically

important fish in China, cloned and characterized the

IGFBP-3 cDNA, and determined its tissue distribu-

tion, expression patterns during early developmen-

tal stages and gonadal developmental stages using

semi-quantitative and real-time quantitative RT-PCR

analysis respectively.

Materials and methods

Fish and sample preparation

Common carps with body weight ranging from 500 to

1,200 g were collected from the local fishery center of

Guangzhou and then were cultured in a circulating

fresh water tank kept at 22–25 �C under natural

photoperiod and fed twice daily. Six male and female

fish at three different stages of reproductive cycle were

obtained, respectively, from July 2007 to February

2008 (6 9 6 = 36 fish in total). Tissue samples for

gene cloning, tissue distribution, and gonadal devel-

opment were collected after the animals had been

anesthetized on ice. Unfertilized eggs, embryos and 1-

to 30-day-old larval carps were obtained during

reproductive season from February to March 2007.

Samples were immediately frozen in liquid nitrogen

and stored at -80 �C before RNA extraction. All the

animal experiments were in accordance with the

guidelines and approval of Sun Yat-Sen University

Animal Care and Use Committee.

Cloning of common carp IGFBP-3 cDNA

Total RNA was extracted from the common carp liver

with Trizol� Reagent (Invitrogen, USA). The concen-

tration of the total RNA was estimated by measuring

the absorbance at 260 nm. Five micrograms of total

RNA from liver was used to synthesize the first-strand

cDNA using the SuperScriptTM III First-Strand Syn-

thesis System (Invitrogen, USA) following the man-

ufacturers’ instructions.

For cloning common carp IGFBP-3 partial cDNA

fragment, two pairs of degenerate primers were

designed according to comparison between the pub-

lished IGFBP-3 cDNA sequences. The forward primers

located about the evolutionarily conserved amino-

terminal (about the first 25–76 amino acid residues)

regions of zebrafish counterpart, and the reverse primers

were located on the carboxyl terminal (about the last

233–272 amino acid residues). In the first-round PCR,

1 ll RT product was used as template, ccBP3F1 and

ccBP3R1 as primers. Thirty-five cycles of amplification

were performed using a cycle profile of 94 �C for

3 min, 94 �C for 30 s, 55 �C for 30 s, 72 �C for 1 min.

The extension time was increased to 10 min in the last

cycle. Then, 2 ll of 100-fold diluted first-round PCR

product was subjected to a nested PCR, and the primers

1844 Fish Physiol Biochem (2012) 38:1843–1854

123

were replaced with ccBP3F2 and ccBP3R2. Thirty-five

cycles of amplification were performed using the same

profile as that using for the first-round PCR. Basing on

the sequenced partial fragment, the gene-specific prim-

ers for cloning 30-end and 50-end were designed. Two

round PCR with the similar procedure as described

above were performed with adaptor primers (AP,

AUAP and AAP) and gene-specific primers. All the

primers used were listed in the Table 1.

The amplification products were separated by

electrophoresis on 1.5 % agarose gel. The bands of

desired size were excised, purified using E.Z.N.A�

Gel Extraction Kit (Omega BioTek, USA), and

subcloned into the pTZ57R/T vector (Fermentas,

USA). Positive colonies were identified by color

screening on LB plates containing X-gal and Amp.

The plasmid DNA was identified by PCR amplifica-

tion and restriction enzyme digestion. And then, the

positive clones were sequenced.

Sequence analysis

The three fragments were assembled together by

DNAssist 2.0. The potential open reading frame

(ORF) was analyzed using DNAtools 6.0 and trans-

lated into the corresponding amino acids. The cDNA

sequence and the deduced amino acid sequence were

compared with the sequences in the GenBank database

using BLAST program available for the NCBI inter-

net website (http://www.ncbi.nlm.nih.gov). Multiple

alignments of amino acid sequences were achieved

using the programs of DNAstar and Clustalx 1.83. The

phylogenetic tree of vertebrate IGFBP-3 s was con-

structed using Mega 3.1 with Neighbor-Joining

method.

RNA extraction and reverse transcription (RT)

Total RNAs from 25 tissues, embryos, and larvae were

isolated, respectively, using Trizol� Reagent (Invit-

rogen, USA) and resuspended in DEPC-treated water.

The quality of RNAs was assessed by electrophoresis

on 0.8 % agarose gel based on integrity of 28S and 18S

RNA bands. 1 lg of total RNA was incubated with

DNase I (Invitrogen, USA) and then reverse-tran-

scribed into cDNA using Oligo (dT)18 primer by

RevertAidTM H Minus M-MuLV reverse transcrip-

tase kit (MBI Fermentas, USA) according to the

Table 1 Nucleotide

sequences of the primers used

for partial fragment, 30-RACE, 50-RACE, RT-PCR,

and real-time PCR of the

common carp IGFBP-3

cDNA

Primers Sequences

Primers for partial fragment

ccBP3F1 50 TGGT(C/G)CGCTGCGA(A/G)CC(A/G)TGC 30

ccBP3F2 50 TGCGG(A/C)(A/G)T(C/G)TACAC(C/G)G(A/G)GCG 30

ccBP3R1 50 CCCTT(C/T)T(G/T)GTC(A/G)CAGTT(G/T)GG 30

ccBP3R2 50 CC(A/G)TACTT(A/G)TCCAC(A/G)CACCA 30

Primers for 30 and 50-RACE PCR

ccBP3F3 50 CACGGACACGATAACCCTGAGG 30

ccBP3F4 50 CAGTGGGGTTCATACAGATA 30

ccBP3R3 50 ATGAACCCCACTGGAAACTG 30

ccBP3R4 50 CTCTTGGGTTCAGCACATTTG 30

AP 50 GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT 30

AUAP 50 GGCCACGCGTCGACTAGTAC 30

AAP 50 GGCCACGCGTCGACTAGTACGGGGGGGGGG 30

Primers for RT-PCR

ccBP3F3 50 CACGGACACGATAACCCTGAGG 30

ccBP3R4 50 CTCTTGGGTTCAGCACATTTG 30

18S-F 50 CCTGAGAAACGGCTACCACATCC 30

18S-R 50 AGCAACTTTAGTATACGCTATTGGAG 30

Primers for real-time PCR

qBP3F 50 GGGTATGATGGAAAGGAGAAAG 30

qBP3R 50 AGTGTAAAGTGAGTTGCTGGTC 30

Fish Physiol Biochem (2012) 38:1843–1854 1845

123

http://www.ncbi.nlm.nih.gov

manufacture’s instructions. The first-strand cDNAs

were used as templates for PCR with IGFBP-3-

specific primers. The primers and PCR conditions

were optimized by preliminary experiments to avoid

dimmer formation and unspecific amplifications.

Semi-quantitative RT-PCR analysis

The tissue distribution of IGFBP-3 was analyzed by

semi-quantitative RT-PCR. RT-PCR was conducted

in a 20 ll total reaction mixture containing 2 ll

10 9 MBI PCR buffer with (NH4)2SO4, 1.6 ll of

25 mM MgCl2, 0.4 ll of 10 mM dNTPs Mix, 0.4 ll of

10 lM each primer, 14.1 ll of double distilled water,

0.5 U Taq polymerase (MBI Fermentas, USA), and

1 ll of each first-strand cDNA. The PCR conditions

consisted of a denaturation cycle of 94 �C for 3 min,

followed by 35 PCR cycles each consisted of 15 s

denaturation (94 �C), 15 s annealing (56 �C), 30 s

extension (72 �C). Extension time in the last cycle was

increased to 5 min. A fragment of common carp 18S

rRNA (GenBank Accession No. AF133089) was

amplified as an internal control. The PCR conditions

for 18S rRNA were the same as the common carp

IGFBP-3 PCR, except for using the 30 cycles instead

of 35 cycles. Negative control was performed without

cDNA template. Five microliters of each PCR product

was electrophoresed through 1.5 % agarose gel and

stained with EB, and then detected under UV light

with Gel Doc 2000 (BioRad, USA).

Real-time quantitative RT-PCR analysis

The levels of IGFBP-3 mRNA during the embryonic

stages, early developmental stages, and gonadal

developmental stages were performed on an ABI

PRISM� 7900 Sequence Detection System (Applied

Biosystems). Real-time specific primers for IGFBP-3

were designed (Table 1). The 20 ll real-time PCR

reactions contained 10 ll Platinum� SYBR� Green

qPCR SuperMix-UDG (Invitrogen, USA), 0.4 ll

ROX Reference Dye, 1.0 ll of RT product, and

0.2 lM of each forward and reverse primer. The PCR

amplification was carried out as follow: 50 �C for

2 min for UDG incubation, initial denaturation 95 �C

for 2 min, 40 cycles of 95 �C for 15 s, 55.5 �C for

15 s, 72 �C for 30 s. After amplification, a melting

curve was performed at the end of the reaction to

analyze the melting peaks of the PCR products

generated. Standard curves were generated between

cycle threshold (CT) value and logarithm of vector

dilutions using serial dilutions of quantified pTZ57R/T

vector containing the fragments of IGFBP-3 and 18S

rRNA, respectively. 18S rRNA was used as internal

control in order to standardize the results by eliminat-

ing variations in mRNA and cDNA quantity and

quality. We firstly tested the stability of 18S rRNA

during development and gonadal developmental

stages based on the reports of Ye et al. (2010). The

expression of 18S rRNA showed stable values during

our assay. Quantitative results were expressed as the

ratio of target gene/18S rRNA.

Northern blot analysis

Twenty micrograms of total RNA isolated from the

common carp liver with RNA loading dye was

electrophoresed in a 1 % denatured agarose gel

containing 0.66 % Formaldehyde in 1 9 MOPS

(0.02 M MOPS, 2 mM NaAcetate, 1 mM EDTA,

PH7.0) and separated at 5v/cm over a period of 2.5 h.

After the run, the gel was rinsed briefly with

0.5 9 TBE buffer. The RNA was blotted from the

gel by electric transfer and cross-linked to Hybond-

Nylon membrane (Roche, Germany). It was fixed by

UV cross linking (12,000 Mj/cm2 for 2 min, twice).

The membrane was then hybridized with the common

carp IGFBP-3 Dig-labeled cDNA probe prepared by

PCR (PCR DIG Probe Synthesis Kit, Roche, Ger-

many). The hybridized and detection procedure were

as described in our previous report (Chen et al. 2005).

Signal was captured in Syngene Genenome (Syngene,

England).

Fig. 1 Alignment of amino acid sequences of common carp

IGFBP-3 and other species IGFBP-3 s (Clustalx 1.83). The

identical, highly conserved and less conserved amino acid

residues are indicated by asterisk, colon, dot, respectively. The

first amino acid residue of the predicted mature protein and the

conserved motif sequences (GCGCC 9 9C and CWCV) are

shaded with dark. The nuclear localization sequence was noted

by box. IGFBP-3 amino acid sequences used for analysis are

extracted from GenBank database, and their accession numbers

are: human (Homo sapiens): X64875; bovine (Bos taurus):

M76478; mouse (Mus musculus): X81581; rat (Rattus norvegi-cus): M33300; pig (Sus scrofa): NM001005156; zebrafish

(Danio rerio): NM205751; yellowtail (Seriola quinqueradiata):

ACD11356; Chinook salmon (Oncorhynchus tshawytscha):

AEC33113; channel catfish (Ictalurus punctatus): ACN41860;

common carp (Cyprinus carpio): FJ424519

c


123


123

Statistical analysis

Quantitative data were expressed as mean ± SEM.

Statistical differences were estimated by one-way

ANOVA followed by the Tukey multiple comparison

test; a probability level of 0.05 was used to indicate

significance. All statistics were performed using SPSS

13.0 (SPSS, Chicago, IL, USA).

Results

Cloning and characterization of the common carp

IGFBP-3 cDNA

Using the first-strand cDNA as template synthesized

from the RNA from the common carp liver, and the two

pairs of degenerate primers (ccBP3F1 and ccBP3R1;

ccBP3F2 and ccBP3R2), a cDNA fragment, approxi-

mate 536 bp in length, was amplified by two rounds

PCR. 30-RACE and 50-RACE PCR revealed products of

approximate 900 and 790 bp, respectively. Assembly of

the three cDNA fragments resulted in a 1,680-bp cDNA

of common carp IGFBP-3 (GenBank Accession No.

FJ424519). The common carp IGFBP-3 cDNA con-

tained an ORF of 882 bp, encoding a predicted

polypeptide of 293 amino acid residues, a 198-bp

5-untranslated region (UTR), and a 600 bp 3-UTR

containing the consensus polyadenylation signal AAT

AAA. The predicted polypeptide sequence contained a

putative signal peptide of 25 amino acid residues

resulting in a mature protein of 268 amino acids. The

mature protein had an estimated molecular mass of

29.7 kDa with three putative N-glycosylation sites

(114NPS; 132NDT; 203NFS) (Fig. 1). The overall

sequence identity of the entire protein with six known

human IGFBPs was 27.8 % (IGFBP-1), 27.0 % (IG-

FBP-2), 47.2 % (IGFBP-3), 27.9 % (IGFBP-4), 40.4 %

(IGFBP-5), and 31.2 % (IGFBP-6). The homology

analysis based on the amino acid sequences revealed

that the predicted common carp IGFBP-3 displayed

significant identities to other vertebrates. It showed that

the highest homology of 80.1 % to zebrafish, the

relatively higher identities to salmon (60.4 %), catfish

(62.8 %), and yellowtail (62.9 %), while it had lower

identities to pig (48.5 %), rat (47.4 %), mouse

(45.5 %), bovine (45.7 %), and human (47.2 %).

Like other vertebrate IGFBPs, common carp

IGFBP-3 also had two highly conversed regions: the

cysteine-rich N-terminal domain (18 cysteines) and

the cysteine-rich C-terminal domain (6 cysteines).

Within the N-terminal domain, the motif, GCGC

CXXC, is well conserved in vertebrate IGFBPs,

indicating that it may be important in interaction with

IGFs (Hwa et al. 1999). In common carp IGFBP-3, the

motif was also present and the sequence was

GCGCCMTC. The other conserved motif, CWCV,

was at position 266–269 (Fig. 1).

To ascertain the relationship of common carp

IGFBP-3 gene to those of other vertebrate IGFBP-3s,

Bovine IGFBP3

Pig IGFBP3

Human IGFBP3

Mouse IGFBP3

Rat IGFBP3

Zebrafish IGFBP3

Common carp IGFBP3

Channel catfish IGFBP3

Chinook salmon IGFBP3

Yellowtail IGFBP3

100

98

72

100

99

77100

0.1

Fig. 2 Phylogenetic tree of vertebrates IGFBP3. The full-

length amino acid sequences of various IGFBP3 were extracted

from GenBank and analyzed using the Neighbor-Joining

bootstrap method by MEGA 3.1 with 1,000 bootstrap replicates.

The number shown at each branch indicates the bootstrap values

(%). The common carp IGFBP-3 was noted by triangle


123

we constructed the vertebrate IGFBP-3s phylogenetic

tree (Fig. 2). The results showed that the common carp

IGFBP-3 belongs to the branch of fish and related to

zebrafish IGFBP-3 with 100 % bootstrap value.

Northern blot analysis showed a single faint band of

approximately 1.9 kb with IGFBP-3 probe in the adult

common carp liver total RNA sample (Fig. 3). We

also noticed that the length of the mRNA (1.9 kb)

detected by northern blotting was longer than those of

the composite cDNA sequence (nearly 1.7 kb)

obtained from the RACE PCR. The reason may be

that the cDNA obtained from RACE was not con-

tained fully 3- or 5-UTR sequence.

Tissue distribution of common carp IGFBP-3 gene

To examine the distribution of IGFBP-3 in central

nervous system and the peripheral tissues of adult

common carp, its expression levels were analyzed in

twenty-five dissected tissues by semi-quantitative

RT-PCR. An internal control was achieved by perform-

ing PCR on the same samples with 18S rRNA primers.

Different regions of common carp brain, including

medulla oblongata, pituitary, cerebellum, diencepha-

lon, olfactory bulb, telencephalon, hypothalamus, and

spinal cord, were dissected. As shown in Fig. 4a,

IGFBP-3 mRNA was observed in all regions of brain

with high levels. The higher level was in olfactory

bulb, while the lower level was in pituitary.

IGFBP-3 mRNA was observed in all peripheral

tissues examined (Fig. 4b). High levels were found in

retina, red muscle, liver, heart, posterior intestine, spleen,

and testis. Relatively lower levels were found in white

muscle, kidney, thymus gland, and ovary, while in head

kidney, blood, skin, gill, middle intestine, and anterior

intestine, the IGFBP-3 mRNA levels were much lower.

The RT-PCR analysis of 18S rRNA was performed

and shown in the lower panel of Fig. 4. The levels of

18S rRNA were similar among the different tissues.

No PCR product was detected in the negative control

(PCR without cDNA template).

Expression of IGFBP-3 mRNA during embryonic

and larval development

The presence of IGFBP-3 mRNA during early development

wasexaminedbyreal-timequantitativePCR.And, the results

were presented in Fig. 5. No IGFBP-3 mRNA expression

was detected in the unfertilized eggs and eight-cell stage. Its

mRNA was first observed in the blastula stage with

significantly high level. The level sharply decreased in

Fig. 3 Northern blot

analysis of IGFBP-3 mRNA

in the common carp liver.

15 lg total RNA from an

adult common carp liver was

electrophoresed on a 1 %

agarose gel, transferred onto

a nylon membrane, and

hybridized with DIG-

labeled IGFBP-3 cDNA.

Arrow indicates position of

1.9 kb IGFBP-3 mRNA

Fig. 4 mRNA expression in different tissues of adult common

carp. a RT-PCR analysis of the expression of IGFBP-3 gene in

the common carp central nervous system and pituitary. 18S

rRNA was used as an internal control for the relative

quantification of cDNA in PCR reactions. Double distilled

water was used as negative control. M marker; 1 medulla

oblongata; 2 pituitary; 3 cerebellum; 4 diencephalon; 5 olfactory

bulb; 6 telencephalon; 7 hypothalamus; 8 spinal cord; ncnegative control. b RT-PCR analysis of the expression of

IGFBP-3 gene in the peripheral tissues of adult common carp.

18S rRNA was used as an internal control for the relative

quantification of cDNA in PCR reactions. Double distilled water

was used as negative control. M marker; 1 retina; 2 red muscle; 3white muscle; 4 kidney; 5 thymus gland; 6 ovary; 7 head kidney;

8 liver; 9 blood; 10 heart; 11 skin; 12 gill; 13 posterior intestine;

14 middle intestine; 15 anterior intestine; 16 spleen; 17 testis; ncnegative control


123

gastrula stage, and it became to increase in the following

stages. Other significantly increasing point of IGFBP-3

mRNA level was in blood cycling stage. Subsequently, the

levelof IGFBP-3mRNAdecreased inpre-hatchingstageand

increased in hatching stage and 1-day-post-hatching larvae.

After 1-day-post-hatching, a significant decrease was found

in 10-day-post-hatching larvae, and then a gradually increase

was observed in the following day-post-hatching larvae.

Expression pattern of IGFBP-3 mRNA in gonad

during the reproductive cycle

Interesting, IGFBP-3 mRNA was observed in the ovary

and testis with relatively high level (Fig. 4b). This caused a

question that whether the IGFBP-3 plays an important role

during the reproductive cycle. So, we next examined the

IGFBP-3 gene expression at different gonadal develop-

mental stages with real-time quantitative PCR. As shown

in Fig. 6a, IGFBP-3 mRNA abundance was significantly

decreased at matured stage in ovary. Subsequently, at

regressed stage, the mRNA abundance of IGFBP-3

mRNA remained low in ovary. In contract, IGFBP-3

mRNA abundance did not exhibit a significant change

throughout the reproductive cycle in testis (Fig. 6b).

Discussion

In the present study, we have cloned the full-length

cDNA encoding IGFBP-3 from the common carp liver

0

0.01

0.02

0.03

0.04

0.05

0.06

0.07

0.08

unfer

tilize

d egg

eight-

cell

stage

blastu

la

gastr

ula

body

segm

ent s

tage

optic

vesic

le sta

ge

lens f

ormati

on st

age

heart

-bea

ting s

tage

blood

cycli

ng st

age

pre-h

atchin

g stag

e

hatch

ing st

age

1dph

10dp

h

15dp

h

20dp

h

25dp

h

Rel

ativ

e co

ncen

trat

ion

of I

GFB

P3

Fig. 5 Expression of

IGFBP-3 mRNA during

embryonic and larval

developmental stages of

common carp. mRNA

expression level was

qualified by real-time

quantitative PCR,

respectively. Data were

represented as

mean ± SEM (three

replicates of pooled

embryos). dph day of post-

hatching

Fig. 6 Expression profiles

of IGFBP-3 mRNA in gonad

during the reproductive

cycle. mRNA expression

level was qualified by real-

time quantitative PCR,

respectively. Bars sharing

the same letter are not

significantly different

(n = 6, P \ 0.05)


123

and determined its mRNA expression patterns of

tissue-specific, embryonic, and early developmental

stages and gonadal developmental stages. The com-

mon carp IGFBP-3 cDNA sequence was 1,860 bp

long and had an ORF of 882 bp long encoding a

predicted polypeptide of 293 amino acids. Like other

IGFBP-3 s, common carp IGFBP-3 also had cysteine-

rich N- and C-terminal domains that were highly

conserved among species, and a central domain with

no cysteine residues. Previous study had validated that

the conserved N- and C-terminal domains of IGFBPs

are important and required for IGFs binding (Hwa

et al. 1999; Baxter 2000) and the central region,

L-domain, which amino acid sequence is highly

variable with shared lower similarity, acts structurally

as a hinge between N- and C-terminal domains (Hwa

et al. 1999). However, the L-domain is also the sites of

post-translation modification such as glycosylation

(Firth and Baxter 2002). Although the glycosylation

does not affect IGF binding, it has the potential to

modulating IGF’s cell-binding ability (Firth and

Baxter 1999). In common carp IGFBP-3, there were

three putative N-glycosylation sites. Collectively,

these results indicated that common carp IGFBP-3

may be structurally and functionally conservative like

its mammalian counterpart.

IGFBP-3 has been shown to directly induce apop-

tosis in some cancer cells independently of the IGF–

IGF receptor system (Gill et al. 1997; Rajah et al.

1997; Firth and Baxter. 2002; Hong et al. 2002). One

of possible reasons is that IGFBP-3 can locate in the

nucleus of certain cells via its nuclear localization

sequence (NLS). Nuclear localization of IGFBP-3 has

been demonstrated in a variety of cellular models (Li

et al. 1997; Jaques et al. 1997; Wraight et al. 1998; Liu

et al. 2000). The sequence, 215KKGFYKKKQCRP

SKGRKR232, existing in the human IGFBP-3, has

been considered as the NLS, mediating its nuclear

localization (Radulescu 1994). Liu et al. (2000) had

been validated that nuclear IGFBP-3 could bind the

nuclear retinoid X receptor-a (RXR-a) regulating gene

transcription and cellular apoptosis. It is noteworthy

that common carp IGFBP-3 also contains the consen-

sus sequence of the putative NLS. In common carp

IGFBP-3, this sequence was 221QKGFYKKKQCSP

SKGRRR238, only three amino acid residues differing

from human IGFBP-3. Furthermore, IGFBP-3 had

been shown to adhere to cell surfaces, and this binding

interaction is believed to be mediated through

proteoglycans (Clemmons 1997). It had shown that

proteoglycan binding results in disruption of the IGF/

IGFBP-3/ALS complex (Baxter 1990). After IGFBP-3

binding to cell surfaces, tenfold reduction in IGFBP-3

affinity of IGF-I was occurred, and the adherence

enhanced the stimulating effect of IGF-I (Conover

1992). The reason why IGFBP-3 could adhere to the

cell surfaces was that the 18 amino acids

(221QKGFYKKKQCSPSKGRRR238) also contained

heparin binding domain (HSD), resulting in heparin

and certain other glycosaminoglycans apparently

change the conformation of IGFBP-3 (Arai et al.

1994).

IGFBP-3 is the most abundant IGFBP in serum and

is an important modulator of IGF-I in circulation or

extracellular fluids. More than 90 % of IGF-I in

circulation is associated with IGFBP-3 in mammals.

Previous study had validated that IGF-I expressed in

various tissues and the most abundant was in liver in

common carp (Tse et al. 2002). In this study, common

carp IGFBP-3 mRNA was also expressed in all

examined tissues with different levels. The pattern of

expression in various tissues suggests that common

carp IGFBP-3 is being synthesized locally and may

modulate the local actions of IGFs. However, our

results showed that the expression levels in heart, post-

intestine, spleen, and testis were equal or relatively

higher than that of in liver. Similarly, whole mount in

situ hybridization did not detect the IGFBP-3 mRNA

in the liver in zebrafish embryos and larvae (Li et al.

2005). Unlike IGF-I, the expression pattern of IGFBP-

3 mRNA was slightly different from previous mam-

malian reports. In mammals, IGFBP-3 mRNA was

mainly expressed in liver and endothelium (Booth

et al. 1990). What causes the different IGFBP-3

mRNA expression level in liver between fish and

mammals? In mammals, IGFBP-3 in the liver is

mainly produced by Kupffer cells, but how about in

fish? Which type of cells in liver can produce the

IGFBP-3 in fish? Whether the different liver structure

results in the different tissue expression pattern. The

exact reasons await further investigations.

Significant levels of IGFBP-3 mRNA were found in

all regions of common carp brain and pituitary. These

observations were consistent with previous studies. In

human cerebrospinal fluid, several different IGF-

binding proteins and IGFs have been identified

including IGFBP-3 (Binoux et al. 1991). IGFBP-3

mRNA was also found in brain of tilapia (Chen et al.


123

2004). Previous result suggested that IGFBP-3 may be

synthesized locally by glial cells and neurons and not

derived from plasma by crossing the blood–brain

barrier (Ocrant et al. 1990). Moreover, in rat MtT/S

cells, IGF-I could cause an ultrasensitive reduction in

GH mRNA levels via an extracellular mechanism

involving IGFBPs (Voss et al. 2001). We detected

relatively high level of IGFBP-3 mRNA in pituitary

indicting that IGFBP-3 may be involved in the IGF

feedback regulation pituitary GH mRNA expression.

In spleen and thymus gland, we also detected IGFBP-3

mRNA, implying that it may also play a role in

immune system.

Previous study had reported that IGFBP-3 mRNA

was expressed in embryonic stages in zebrafish (Chen

et al. 2004; Li et al. 2005). In the present study, we

detected the expression of IGFBP-3 mRNA in blastula

and the following embryonic stages. These results

suggest that IGFBP-3 may be involved in the fish early

development. Like in zebrafish (Chen et al. 2004), we

also found that the expression level of IGFBP-3

mRNA was significantly increased at blastula stage.

At blastula stage what resulted in the sharp increase of

IGFBP-3 mRNA expression level and which kind or

kinds of cells were benefited from the increased

IGFBP-3 mRNA were obscure. Additionally, IGF-I

and IGF-II were also detected in the early develop-

ment of common carp (Tse et al. 2002). Together these

results, we supposed that IGFBP-3 may be involved in

the early development through regulating the IGFs

bioavailability.

IGF system is important on the reproduction in

vertebrate animals. As the most abundant IGFBP,

IGFBP-3 protein or mRNA had been detected in

human follicular fluid (Giudice et al. 1990), porcine

ovarian granulosa cells in vivo (Wandji et al. 2000)

and in vitro (Mondschein et al. 1990) and purified rat

Leydig cells (Lin et al.1993). To our interest, in the

present study, IGFBP-3 mRNA was detected in testis

with great abundance, while relatively lower level in

ovary and its mRNA expression level altered in

different stages of gonadal development. Meanwhile,

in zebrafish, the most abundance of IGFBP-3 mRNA

was detected in ovary by real-time PCR (Chen et al.

2004). These results indicate that IGFBP-3 may play

important roles in the common carp gonadal develop-

ment. In ovary, we observed a significant decrease

between the recrudescing stage and the matured stage.

At this period, the level of estradiol was decreased

while 17,20 b-dihydroxy-4-pregnen-3-one (17, 20bP)

was increased. There were only a few studies exam-

ining the effects of sex steroids on IGFBP-3 expres-

sion. 17b-estradiol treatment of ewes down-regulated

expression of IGFBP-3 protein and mRNA in the

endometrium (Peterson et al. 1998). Estradiol could

significantly decreased IGFBP-3 mRNA level in cattle

theca cells (Voge et al. 2004). Furthermore, follicle-

stimulating hormone, a key regulator of follicular

development and steroidogenesis, has been shown up-

regulatory effect on IGFBP-3 mRNA expression level

in porcine and bovine granulose cells (Voge et al.

2004; Ongeri et al. 2004). So, we supposed that the

abundance of IGFBP-3 mRNA was subjected to the

sex steroid hormones correlating with the specific

development stage in different cells. The increased or

decreased IGFBP-3 production would result in a

change of the amount of bioavailable IGFs and thus

influence gonadal growth and development.

In conclusion, we cloned and characterized the full

length of the common carp IGFBP-3 cDNA. Its

expression patterns of tissue-specific, embryonic, and

early developmental stages and gonadal developmen-

tal stages suggest that IGFBP-3 may play important

roles in the reproduction and development by modu-

lating the actions of the local IGF. However, addi-

tional studies focusing on the exact physiological

functions are needed.

Acknowledgments This work was supported by the National

Basic Research Program (973 program, No. 2004CB117402,

2010CB126302), the National Natural Science Foundation of

China (No. 31072194), and the Guangdong Provincial Science

and technology Program (No. 2006B36501006) and the

Fundamental Research Funds for the Central Universities to

Dr. Wensheng Li.

References

Andress DL (1998) Insulin-like growth factor-binding protein-5

(IGFBP-5) stimulates phosphorylation of the IGFBP-5

receptor. Am J Physiol 274:E744–E750

Arai T, Parker A, WJr Busby, Clemmons DR (1994) Heparin,

heparan sulfate, and dermatan sulfate regulate formation of

the insulin-like growth factor-I and insulin-like growth

factor-binding protein complexes. J Biol Chem

269(32):20388–20393

Bauchat JR, Busby WH Jr, Garmong A, Swanson P, Moore J,

Lin M, Duan C (2001) Biochemical and functional analysis

of a conserved IGF-binding protein isolated from rainbow

trout (Oncorhynchus mykiss) hepatoma cells. J Endocrinol

170(3):619–628


123

Baxter RC (1990) Glycosaminoglycans inhibit formation of the

140 kDa insulin-like growth factor-binding protein com-

plex. Biochem J 271(3):773–777

Baxter RC (2000) Insulin-like growth factor (IGF)-binding

proteins: interactions with IGFs and intrinsic bioactivities.

Am J Physiol Endocrinol Metab 278(6):E967–E976

Baxter RC, Martin JL (1989) Binding proteins for the insulin-

like growth factors: structure, regulation and function. Prog

Growth Factor Res 1(1):49–68

Binoux M, Roghani M, Hossenlopp P, Whitechurch O (1991)

Cerebrospinal IGF binding proteins: isolation and charac-

terization. Adv Exp Med Bio 293:161–170

Booth BA, Bar RS, Boes M, Dake BL, Bayne M, Cascieri M

(1990) Intrinsic bioactivity of insulin-like growth factor-

binding proteins from vascular endothelial cells. Endocri-

nology 127(6):2630–2638

Chen JY, Chen JC, Huang WT, Liu CW, Hui CF, Chen TT, Wu

JL (2004) Molecular cloning and tissue-specific, develop-

mental-stage-specific, and hormonal regulation of IGFBP3

gene in zebrafish. Mar Biotechnol (NY) 6(1):1–7

Chen R, Li W, Lin H (2005) cDNA cloning and mRNA expres-

sion of neuropeptide Y in orange spotted grouper, Epi-nephelus coioides. Comp Biochem Physiol B 142(1):79–89

Cheng R, Chang KM, Wu JL (2002) Different temporal expres-

sions of Tilapia (Oreochromis mossambicus) insulin-like

growth factor-I and IGF binding protein-3 after growth

hormone induction. Mar Biotechnol (NY) 4(3):218–225

Clemmons DR (1997) Insulin-like growth factor binding pro-

teins and their role in controlling IGF actions. Cytokine

Growth Factor Rev 8(1):45–62

Conover CA (1992) Potentiation of insulin-like growth factor

(IGF) action by IGF-binding protein-3: studies of under-

lying mechanism. Endocrinology 130(6):3191–3199

Firth SM, Baxter RC (1999) Characterisation of recombinant

glycosylation variants of insulin-like growth factor binding

protein-3. J Endocrinol 160(3):379–387

Firth SM, Baxter RC (2002) Cellular actions of the insulin-like

growth factor binding proteins. Endocr Rev 23(6):824–854

Fukazawa Y, Siharath K, Iguchi T, Bern HA (1995) In vitro

secretion of insulin-like growth factor-binding proteins

from liver of striped bass, Morone saxatilis. Gen Comp

Endocrinol 99(2):239–247

Gill ZP, Perks CM, Newcomb PV, Holly JM (1997) Insulin-like

growth factor-binding protein (IGFBP-3) predisposes

breast cancer cells to programmed cell death in a non-IGF-

dependent manner. J Biol Chem 272(41):25602–25607

Giudice LC, Farrell EM, Pham H, Rosenfeld RG (1990) Iden-

tification of insulin-like growth factor-binding protein-3

(IGFBP-3) and IGFBP-2 in human follicular fluid. J Clin

Endocrinol Metab 71(5):1330–1338

Gracey AY, Troll JV, Somero GN (2001) Hypoxia-induced

gene expression profiling in the euryoxic fish Gillichthysmirabilis. Proc Natl Acad Sci U S A 98(4):1993–1998

Hong J, Zhang G, Dong F, Rechler MM (2002) Insulin-like

growth factor (IGF)-binding protein-3 mutants that do not

bind IGF-I or IGF-II stimulate apoptosis in human prostate

cancer cells. J Biol Chem 277(12):10489–10497

Hwa V, Oh Y, Rosenfeld RG (1999) The insulin-like growth

factor-binding protein (IGFBP) superfamily. Endocr Rev

20(6):761–787

Jaques G, Noll K, Wegmann B, Witten S, Kogan E, Radulescu

RT, Havemann K (1997) Nuclear localization of insulin-

like growth factor binding protein 3 in a lung cancer cell

line. Endocrinology 138(4):1767–1770

Jones JI, Clemmons DR (1995) Insulin-like growth factors and

their binding proteins: biological actions. Endocr Rev

16(1):3–34

Kelley KM, Siharath K, Bern HA (1992) Identification of

insulin-like growth factor-binding proteins in the circula-

tion of four teleost fish species. J Exp Zool 263(2):220–224

Kelley KM, Haigwood JT, Perez M, Galima MM (2001) Serum

insulin-like growth factor binding proteins (IGFBPs) as

markers for anabolic/catabolic condition in fishes. Comp

Biochem Physiol B: Biochem Mol Biol 129:229–236

Li W, Fawcett J, Widmer HR, Fielder PJ, Rabkin R, Keller GA

(1997) Nuclear transport of insulin-like growth factor-I and

insulin-like growth factor binding protein-3 in opossum

kidney cells. Endocrinology 138(4):1763–1766

Li Y, Xiang J, Duan C (2005) Insulin-like growth factor-binding

protein-3 plays an important role in regulating pharyngeal

skeleton and inner ear formation and differentiation. J Biol

Chem 280(5):3613–3620

Lin T, Wang D, Nagpal ML, Shimasaki S, Ling N (1993)

Expression and regulation of insulin-like growth factor-

binding protein-1, -2, -3, and -4 messenger ribonucleic

acids in purified rat Leydig cells and their biological

effects. Endocrinology 132(5):1898–1904

Liu B, Lee HY, Weinzimer SA, Powell DR, Clifford JL, Kurie

JM, Cohen P (2000) Direct functional interactions between

insulin-like growth factor-binding protein-3 and retinoid X

receptor-alpha regulate transcriptional signaling and

apoptosis. J Biol Chem 275(43):33607–33613

Mondschein JS, Smith SA, Hammond JM (1990) Production of

insulin-like growth factor binding proteins (IGFBPs) by

porcine granulosa cells: identification of IGFBP-2 and -3

and regulation by hormones and growth factors. Endocri-

nology 127(5):2298–2306

Ocrant I, Fay CT, Parmelee JT (1990) Characterization of insulin-

like growth factor binding proteins produced in the rat

central nervous system. Endocrinology 127(3):1260–1267

Ongeri EM, Zhu Q, Verderame MF, Hammond JM (2004)

Insulin-like growth factor-binding protein-3 in porcine

ovarian granulosa cells: gene cloning, promoter mapping,

and follicle-stimulating hormone regulation. Endocrinol-

ogy 145(4):1776–1785

Park R, Shepherd BS, Nishioka RS, Grau EG, Bern HA (2000)

Effects of homologous pituitary hormone treatment on

serum insulin-like growth-factor-binding proteins (IG-

FBPs) in hypophysectomized tilapia, Oreochromis mos-sambicus, with special reference to a novel 20-kDa IGFBP.

Gen Comp Endocrinol 117(3):404–412

Pedroso FL, Fukada H, Masumoto T (2009) Molecular char-

acterization, tissue distribution patterns and nutritionalregulation of IGFBP-1, -2, -3 and -5 in yellowtail, Seriolaquinqueradiata. Gen Comp Endocrinol 161(3):344–353

Peterson AJ, Ledgard AM, Hodgkinson SC (1998) Oestrogen

regulation of insulin-like growth factor binding protein-3

(IGFBP-3) and expression of IGFBP-3 messenger RNA in

the ovine endometrium. Reprod Fertil Dev 10(3):241–

247


123

Radulescu RT (1994) Nuclear localization signal in insulin-like

growth factor-binding protein type 3. Trends Biochem Sci

19(7):278

Rajah R, Valentinis B, Cohen P (1997) Insulin-like growth

factor (IGF)-binding protein-3 induces apoptosis and

mediates the effects of transforming growth factor-beta1

on programmed cell death through a p53- and IGF-inde-

pendent mechanism. J Biol Chem 272(18):12181–12188

Schedlich LJ, Le Page SL, Firth SM, Briggs LJ, Jans DA, Baxter

RC (2000) Nuclear import of insulin-like growth factor-

binding protein-3 and -5 is mediated by the importin beta

subunit. J Biol Chem 275(31):23462–23670

Siharath K, Kelley KM, Bern HA (1996) A low-molecular-

weight (25-kDa) IGF-binding protein is increased with

growth inhibition in the fasting striped bass, Moronesaxatilis. Gen Comp Endocrinol 102(3):307–316

Tse MC, Vong QP, Cheng CH, Chan KM (2002) PCR-cloning

and gene expression studies in common carp (Cyprinuscarpio) insulin-like growth factor-II. Biochim Biophys

Acta 1575(1–3):63–74

Voge JL, Santiago CA, Aad PY, Goad DW, Malayer JR, Spicer

LJ (2004) Quantification of insulin-like growth factor

binding protein mRNA using real-time PCR in bovine

granulosa and theca cells: effect of estradiol, insulin, and

gonadotropins. Domest Anim Endocrinol 26(3):241–258

Voss TC, Flynn MP, Hurley DL (2001) IGF-I causes an ultra-

sensitive reduction in GH mRNA levels via an extracellular

mechanism involving IGF binding proteins. Mol Endocri-

nol 15(9):1549–1558

Wandji SA, Gadsby JE, Simmen FA, Barber JA, Hammond JM

(2000) Porcine ovarian cells express messenger ribonucleic

acids for the acid-labile subunit and insulin-like growth

factor binding protein-3 during follicular and luteal phases

of the estrous cycle. Endocrinology 141(7):2638–2647

Wraight CJ, Liepe IJ, White PJ, Hibbs AR, Werther GA (1998)

Intranuclear localization of insulin-like growth factor

binding protein-3(IGFBP-3) during cell division in human

keratinocytes. J Invest Dermatol 111(2):239–242

Ye X, Zhang L, Dong H, Tian Y, Lao H, Bai J, Yu L (2010)

Validation of reference genes of grass carp Ctenophar-yngodon idellus for the normalization of quantitative real-

time PCR. Biotechnol Lett 32(8):1031–1038


123

molecular characterization and expression pattern of insulin-like growth factor binding protein-3...

Documents