molecular evolution
DESCRIPTION
Molecular Evolution. Lecture 3. Origins of variation: mutation. Different molecular regions, different rates. DNA distant from genes evolves very quickly (at about one substitution per 10 8 years), Flanking regions upstream and downstream from a gene evolve less quickly than that, - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/1.jpg)
Molecular Evolution
Lecture 3. Origins of variation: mutation
![Page 2: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/2.jpg)
Different molecular regions, different rates
• DNA distant from genes evolves very quickly (at about one substitution per 108 years),
• Flanking regions upstream and downstream from a gene evolve less quickly than that,
• Introns evolve less quickly than those, though not much less,
• Third positions of codons evolve less quickly than introns,
• First and second positions of codons evolve less quickly than that,
![Page 3: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/3.jpg)
Within a protein:– active sites evolve very slowly,– sites that bind heme, or interact with other proteins evolve a bit faster but
also very slowly,– interior sites evolve less quickly than exterior sites,– substitutions that involve less radical changes of the amino acid (i.e. that
change to a rather similar amino acid) happen more readily.
Of base changes, transitions (A -> G or C -> T) happen several times more readily than transversions (all other changes).
Between protein-coding loci, some (fibrinopeptide, for example) evolve rapidly, some less so (hemoglobins, cytochromes), and some (histones, for example) change very slowly.
Different molecular regions, different rates
![Page 4: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/4.jpg)
Rates and causes of molecular evolution
• Different parts of the genome are useful for answering different problems. Fast evolving sequences are useful for recent events, but become saturated and unrecognizable when comparing more distant relatives. Slow evolving sequences are useful around the base of the tree, but don’t have any variability at all among close relatives.
![Page 5: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/5.jpg)
Effects of replication timing...
• Genes near replication origins are duplicated early and hence experience greater copy number than those replicated last
• Copy # correlates with expression• Expression inversely correlates with
evolutionary rate• So: genes replicated first evolve more slowly
![Page 6: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/6.jpg)
Kinds of mutations:
1. Point mutations (Base substitutions)
2. Reading frame shifts
3. Large scale insertions (Bacteriophage; Transposons)
4. Large scale deletions
5. Thymine (pyrimidine) dimers
6. Gross damage - X-rays, gamma rays, etc.
(Some mutations are caused by improper [template-free]DNA repair - i.e. SOS repair)
![Page 7: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/7.jpg)
1. Point Mutations(Base substitutions)
![Page 8: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/8.jpg)
Substitutions (base-pair substitutions)
Two Types1. Transitions - purine for a purine
G A- pyrimidine for a pyrimidine
C T2. Transversions - purine for
pyrimidineG CG T- pyrimidine for purine
![Page 9: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/9.jpg)
SILENTSILENT = bp change does not affect the amino acid that is encoded. e.g. UGC -> UGU is silent because both are codons for cysteine.
AUGCCCGGGUACUGCUGCCGAGUG
MetProGlyTyrCysArgVal
AUGCCCGGGUACUGUUGUCGAGUG
MetProGlyTyrCysArgVal
C T transition in DNA sequence resulted in C U change in mRNA
**
![Page 10: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/10.jpg)
MISSENSE (replacement)MISSENSE (replacement) = bp change alters the amino acid that is encoded. The severity of the mutation depends on the nature of the change. e.g. the change GAA -> GAU will change glutamic acid to aspartic acid.
AUGCCCGGGUACGAAGAACGAGUG
MetProGlyTyrGluArgVal
AUGCCCGGGUACGAUGAUCGAGUG
MetProGlyTyrAspArgVal
However, the change GAA -> AAA would be significant since it replaces glutamic acid with lysine which is very different.
AUGCCCGGGUACGAAGAACGAGUG
MetProGlyTyrGluArgVal
AUGCCCGGGUACAAAAAACGAGUG
MetProGlyTyrLysArgVal
**
**
![Page 11: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/11.jpg)
NONSENSENONSENSE = bp change results in the creation of a stop codon. Proteins will be truncated as a result of this type of mutation.
e.g. the change UAC -> UAG.
AUGCCCGGGUACUACGAACGAGUG
MetProGlyTyrGluArgVal
AUGCCCGGGUAGUAGGAACGAGUG
MetProGlySTOPSTOP
Truncated proteins usually have no function and can be detrimental to the cell
**
![Page 12: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/12.jpg)
Nonsense Mutations
mRNA
mRNA
Wildtype gene
Nonsense Mutation
Inactive peptide fragment
Start Stop
StopStart
![Page 13: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/13.jpg)
2. Reading frame shifts:
![Page 14: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/14.jpg)
3’3’
5’5’
Transcription
Translation
gene Bgene Bgene Agene A gene Cgene C
5’
3’3’
5’5’
Transcription
Translation
gene Bgene Bgene Agene A gene Cgene C
5’
Stop codon
Transcription and Translation are coupled in bacteria, so nonsense substitutions have *polar* effects (polarity)
![Page 15: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/15.jpg)
Slipped strand mispairing
http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=hmg.figgrp.1097
![Page 16: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/16.jpg)
Holliday junction / crossing over
• http://engels.genetics.wisc.edu/Holliday/holliday3D.html
![Page 17: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/17.jpg)
3. Transposition; transposon mutagenesis; “jumping genes”
![Page 18: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/18.jpg)
Mutations (insertions) caused by IS elements and Transposons:
Antibiotic resistance gene(s)
Transposase gene
![Page 19: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/19.jpg)
Rates of MutationA. Spontaneous mutation
• result from errors in replication • frequency of 10-7 to 10-10 per bp per
generation
B. Induced mutation
• result from application of chemical and physical agents (mutagens)
• increase the frequency of a mutation
![Page 20: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/20.jpg)
Is the mutation rate optimal or minimal?
![Page 21: Molecular Evolution](https://reader035.vdocuments.net/reader035/viewer/2022062304/56813691550346895d9e1b17/html5/thumbnails/21.jpg)
A comparison of mutation rates