MILrrARY MEDICINE. 172. 8:860. 2007

Molecular Identification of the Biowarfare SimulantSerratia marcescens from a 50-Year-Old Munition Buried

at Fort Detrick, Maryland

Guarantor: Chris A. Whitehouse. PhDContributors: Chris A. Whitehouse, PhD: Carson Baldwin, MS; Leonard Wasieloski. PhD: John Kondig, BS;LTC John Scherer. MSC USA

serratia marcescens are Gram-negative bacteria that were of-ten used by the U.S. military and others to track movement ofbacteria in the environment. As part of ongoing constructionat Fort Detrick, Maryland, what appeared to be a small bombletwas found buried in the ground at the site of an old test grid. Asample of a clear, straw-colored liquid was aseptically removedfrom the plastic reservoir; the results of routine cultures onstandard bacteriological media were negative. DNA was ex-tracted from the sample and found to be 99% identical to S.marcescens. These results demonstrate the ability to identifythe contents of a biological munition that had been buried for-50 years.

Introduction

Serratia marcescens is a Gram-negative, saprophytic bacil-lus classified as a member of the Enierobacteriaceae family.

It was originally considered to be an innocuous nonpathogenicorganism and was frequently used as a biological marker be-cause of its characteristic production of a red pigment, prodigi-osin. which produced easily recognized red colonies wben grownon artificial media. For these reasons. S. marcescens (along withBacillus globigii^ was commonly used by the U.S. military as abioweapon (BW) simulant in a variety of open-air. mock-BWattack exercises from the 1940s through the 1960s.' Since thattime. S. marcescens has been identified as an important cause ofnosocomial infections of the past 30 years, predominantly inimmunocompromised patients, and its use as a biologicalmarker in the environment has ceased.^

Today. Fort Detrick, Maryland, is home to the U.S. ArmyMedical Research Institute of Infectious Diseases and is thecenter of the military's biodefense research efforts. Before 1969.however. Fort Detrick was the site of the U.S. offensive BWprogram. As part of that program, open-air tests using S. marc-escens and B. globigii were conducted in "area B." an areaestablished as a proving ground for outdoor testing. Area B waslaid out in a circular grid, with a series of seven concentriccircles, and was designed to test the flow of materials throughthe air. In its history, area B was also used as a sanitary landfill,a disposal site, and a working farm.̂ At no time was area B everused to test the release of actual BW agents.

Diagnostic Systems Division. U.S, Army Medical Research Institute of InfectiousDiseases. Fort Detrick, Frederick, MD 21702,

The views, opinions, and findings contained herein are those of the authors andshould not be construed as an oificial Uepartment of the Army position, policy, ordecision unless so designated by other documentation.

This manuscript was received for review in October 2006. The revised manuscriplwas accepted for pubiicalion in May 2007,

Case Report

As part of ongoing construction at Fort Detrick, multiplepieces of a biological munition were uncovered at the formerlocation of the area B test grid. These pieces included castings,an impinger and aerosol disperser, and a plastic biological res-ervoir, which contained --30 mL of a clear, straw-colored liquid(Fig. 1|, The volume and appearance of the liquid were consis-tent with what would be expected for this type of vessel (W.Patrick, unpublished data). Tlie reservoir was lying on top of thesoil, intact, with no visible signs of leakage. By using a pair ofsterile surgical gloves, the reservoir was placed in a sealed bag,which was placed inside a 3-inch-diameter. stainless steel con-tainer with a lid: the container was sealed and then safely trans-ported to the Diagnostic Systems Division. U.S. Army MedicalResearch Institute of Infectious Diseases, for analysis.

Laboratory Testing

When the reservoir was received in the laboratory, it wasplaced in a biological safety cabinet and removed from the sec-ondary packaging for inspection. The reservoir was initially cov-ered with soil residue but appeared otherwise intact. The soilwas wiped off with a 10% bleach solution, which revealed thatthe thick, opaque, plastic reservoir was still sealed, with novisible cracks. An aliquot of the liquid bomb fill was removedaseptically by using a needle and syringe and was cultured bothaerobically and anaerobically on routine bacteriological media.Total DNA was extracted from a 200-^L aliquot of the sample byusing a QIAamp DNA mini kit (Qiagen, Valencia, California),according to the manufacturer's instructions. All oligonucleo-

Casings

Biological

Impinger andaerosol disperser

Fig. 1. Recovered pieces of the biological munition found buried in the groundat Fort Detrick. An aliquot of liquid bomb fill was sterilely removed from thebiological reservoir for DNA extraction.

Mililary Medicine, Vol. 172. August 2007 860

Report Documentation Page Form ApprovedOMB No. 0704-0188

Public reporting burden for the collection of information is estimated to average 1 hour per response, including the time for reviewing instructions, searching existing data sources, gathering andmaintaining the data needed, and completing and reviewing the collection of information. Send comments regarding this burden estimate or any other aspect of this collection of information,including suggestions for reducing this burden, to Washington Headquarters Services, Directorate for Information Operations and Reports, 1215 Jefferson Davis Highway, Suite 1204, ArlingtonVA 22202-4302. Respondents should be aware that notwithstanding any other provision of law, no person shall be subject to a penalty for failing to comply with a collection of information if itdoes not display a currently valid OMB control number.

1. REPORT DATE 01 AUG 2007

2. REPORT TYPE N/A

3. DATES COVERED -

4. TITLE AND SUBTITLE Molecular detection of the biowarfare simulant Serratia marcescens froma 50-year-old munition buried at Fort Detrick, Maryland. MilitaryMedicine 172:860-863

5a. CONTRACT NUMBER

5b. GRANT NUMBER

5c. PROGRAM ELEMENT NUMBER

6. AUTHOR(S) Whitehouse, CA Baldwin, C Wasieloski, LP Kondig, J Scherer, J

5d. PROJECT NUMBER

5e. TASK NUMBER

5f. WORK UNIT NUMBER

7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) United States Army Medical Research Institute of Infectious Diseases,Fort Detrick, MD

8. PERFORMING ORGANIZATIONREPORT NUMBER TR-07-048

9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10. SPONSOR/MONITOR’S ACRONYM(S)

11. SPONSOR/MONITOR’S REPORT NUMBER(S)

12. DISTRIBUTION/AVAILABILITY STATEMENT Approved for public release, distribution unlimited

13. SUPPLEMENTARY NOTES

14. ABSTRACT Serratia marcescens are gram-negative bacteria that were often used by the U.S. military and others totrack movement of bacteria in the environment. As part of ongoing construction at Fort Detrick, whatappeared to be a small bomblet was found buried in the ground at the site of an old test grid. A sample ofclear, straw-colored liquid was aseptically removed from the plastic reservoir and routine culture onstandard bacteriological media was negative. DNA was extracted from the sample and found to be 99%identical to S. marcescens. These results demonstrate the ability to identify the contents of a biologicalmunition that had been buried for approximately 50 years.

15. SUBJECT TERMS Serratia marcescens, old munition, buried munition, identification, DNA extraction

16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT

SAR

18. NUMBEROF PAGES

5

19a. NAME OFRESPONSIBLE PERSON

a. REPORT unclassified

b. ABSTRACT unclassified

c. THIS PAGE unclassified

Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18

Serratia marcescens from Munition 861

tide primers used in this study are summarized in Table 1.Primers were chosen to amplify the majority of the bacterial 16SrRNA gene'* or a portion of the RNA polymerase /3-subunit-encoding gene rpoB.̂ All primers were obtained from InvitrogenLife Technologies (Carlsbad, California), Polymerase chain reac-tion (PCR) was carried out with a FTC-100 thermal cycler (MJResearch, Ramsey. Minnesota). For the 16S rRNA PCR. reac-tions were assembled in 50-ju.L volumes and consisted of 1 xPCR buffer, 0.8 mM dNTPs. 1.5 mM MgClj. 5 U of AmpliTaq Gold(Applied Biosystems. Foster City. California), and 250 nM levelsof each primer, PCR amplification was performed by using thefollowing cycling conditions: 10 minutes at 95°C. followed by

TABLE I

PCR PRIMER SEQUENCES USED IN THIS STUDY

Primer Name

16S rRNA27f355f338r556r787r806r926r930f1175r1371r1525r

rpoB359f359r

Primer Sequence (5' to 3')

AGAGnTGATi^iTGGCTCAGACTCCTACGGGAGGCAGCGCTGCCTCCCGTAGGAGTCTITACCCCCARTRAWTCCGGGACTACCAGGGTATCTAATATTAGATACCCTGGTAGTCCAAACITAAAKGAATl'GACGGTCAAAKGAATTGACGGGGGCACGTCATCCCCACCTTCCTCAGGCCCGGGAACGTATTCACAAGGAGGTGWTCCARCC

TTATCGCTCAGGCGAACTCCAACTGCTGGATTCGCCnTGCTACG

Position"

8-27338-355338-355556-575787-806787-806907-926911-930

1.175-1.1941.390-1.3711.525-1.541

1.286-1.3081,185-1.206

Location in Eschertchia coU genes.

eight cycles of 95°C for 30 seconds. 48°C for 30 seconds, and72X for 30 seconds and then 37 cycles of 95°C for 15 seconds,56X for 20 seconds, and 72°C for 20 seconds. For the rpoB PCR.reactions were carried out in a AO-jiL volume containing 1 x PCRbuffer. 0,32 mM dNTPs. 1.5 mM MgCla. 3 U of FastStart Taq(Roche Applied Science. Indianapolis. Indiana), and 250 nMlevels of each primer. PCR amplification was performed underthe following cycling conditions: 10 minutes at 95X. followed byeight cycles of 95X for 30 seconds. 48X (increasing 0.9X percycle) for 30 seconds, and 72°C for 30 seconds and then 37cycles of 95X for 15 seconds. 56T for 20 seconds, and 72°C for20 seconds. Eiectrophoresis was performed on 4% NuSieve 3:1agarose gels (Cambrex, E. Rutherford. New Jersey) by using 1 xTris/borate/ethylenediaminetetraacetie acid buffer at 120 V for30 minutes. Gels were imaged with an Alphalmager (Alpha In-notech. San Leandro. California) to determine whether the ap-propriate amplicon was present for sequencing. PCR ampliconswere purified by using a QIAquick PCR purification kit (Qiagen.Chatsworth. California), according to the manufacturer's in-structions. Approximately 10 ng of purified DNA was used as thetemplate in BigDye Terminator vl.l Cycle Ready Reactions(Applied Biosystems) with the primers in Table I; sequencingwas performed with an ABI Prism 3100 genetic analyzer (AppliedBiosystems) according to the manufacturer's instructions. Forthe 16S rRNA gene, sequences were assembled into a singlecontiguous sequence consisting of 1.469 nucleotides withDNAStar SeqManll software (DNAStar. Madison, Wisconsin).Sequences were compared with those available in GenBank byusing the Basic Local Alignment Search Tool.'' Phylogenetic re-lationships were inferred by comparing partial sequences of the16S rRNA and rpoB genes. Sequences were aligned by using themultisequence alignment program GeneDoc (version 2,6.02)

oM

015.Eran

CJ1 -0.

o1 -z

ea.En

t/l

O(-0.

va.

P E» - mZ U)

o

Fig, 2, Agarose gel eiectrophoresis of 16S rRNA PCR products amplified from the liquid bomb fill. M, molecular weight marker; NTC, no-template control (water); PTC.positive template control [Escherichia coli].

Military Medicine. Vol. 172. August 2007

862 Serratia marcescens from Munition

84

0.02

98

54

54

62

100

Serratia marcescens {AB061685)

Serratia marcescens {AF124038)

Serratia marcescens (AY566180)

Recovered sample

— Citrobacter freundll (AJ233408)

95

78

^ Klebslella pneumoniae (Y17656)

- Enterobacter cloacae (AJ251469)

821 Escherichia coil (DQ118017)

Serratia rubidaea {AJ233436)

1— Serratia odorifera {AJ233432)

52 p Serratia entomophiia (AJ233427)

81 Serratia ficaria (AJ233428)

— Serratia piymuthica (AJ233433)

I— Serratia fonticoia (AJ233429)

66r Serratia grimesii (AJ233430)

^H- Serratia proteamacuians (AJ233434)

57L Serratia liquefaciens (AY253924)

Baciiius subtiiis (AM110948)

Pseudomonas fiuorescens (DQ207731)

Bacillus cereus {DQ207729)

IOOL Baciiius anthracis (AY920253)

Fig, 3, Phylogenetic tree derived from the 16S rRNA gene sequences. The lengths of the horizontal branches are proportional to the number of nucleotide differencesbetween bacterial species. Bootstrap values above 50%. obtained from 500 replicates of the analysis, are shown at the appropriate branch points. The GenBank accessionnumbers of the bacterial species are shown in parentheses. Scale bar. 2% divergence.

86 I Recovered sample

Serratia marcescens {U77449)

E. coii (U77436)

Shigeiia dysenteriae (U77448)

' — Klebsieiia pneumoniae (U77443)

I— Saimonella typhi (AF008577)

^\\ Citrobacter freundii (U77434)

76' Enterobacter cloacae (U77435)

Legionelia pneumophila {AF367748)Yersinia enterocotitica (U77453)

Proteus mirabiiis (U77445)- Pseudomonas fluorescens{AJ717451)

Staphyiococcus aureus (AF325894)

E"~cilius thuringiensis (AF205346)

Baciiius anthracis (AF205319)

Q1 Ljdciiius cereus (AF205339)

Fig, 4. Phylogenetic tree derived from the partial rpoB gene sequences. The lengths of the horizontal branches are proportional to the number of nucleotide differencesbetween bacterial species. Bootstrap values above 50%, obtained from 500 replicates of the analysis, are shown at the appropriate branch paints. The GenBank accessionnumbers of the bacterial species are shown in parentheses. Scale bar, 10% divergence.

Militaiy Medicine. Vol. 172. August 2007

Serratia marcescens from Munition 863

and were analyzed with a neighbor-Joining method with Kimuratwo-parameter distanees by using MEGA software (version 2.1),The 16S and rpoB sequences for the recovered S. marcescenssample were deposited in the GenBank database under acces-sion numbers D9501957 and DQ520586. respectively.

Attempts at culturing the liquid bomb iill both aerobically andanaerobically. on routine microbiological media, yielded nega-tive results. DNA was extracted from an aliquot of the liquid andsubjected to 16S rRNA PCR. Multiple overlapping ampliconsthat covered the majority of the bacterial 16S rRNA gene weregenerated (Fig. 2), The sequences of the individual 16S rRNAamplicons were assembled into a 1.469-base pair contiguoussequence and submitted to a Basic Local Alignment Search Tooldatabase search, which showed 99,86% similarity to two S.marcescens entries. The closest matches were to S. marcescenssubsp, sakuensis (GenBank accession no. AB06161851, aunique, spore-forming. S. marcescens strain originally isolatedfrom a wastewater treatment tank in Japan/ and S. marcescens(GenBank accession no. AB0616851. which was part of the bac-terial flora of the sheep scab mite,^ The presence of S. marc-escens in the sample was confirmed by perlbrming PCR andsequencing an additional gene target [rpoB]. The q)oB gene en-codes the bacterial RNA polymerase /3-subunit and has beenextensively used for sequence-based identification and molecu-lar phylogeny of bacterial pathogens,^''^ PCR using primerstargeting conserved regions of the rpoB gene yielded an ampli-con of the expected size (data not shown). Sequence analysis ofthe amplicon revealed 100% (42 of 42 positions) nucteotidesequence identity to S. marcescens (GenBank accession no.U77449). Phylogenetic analysis showed the relationships of thesequence recovered from the liquid bomb fill to other bacterial16S rRNA (Fig. 3) and rpoB (Fig. 4) sequences.

Discussion

This study represents the first comprehensive examination ofthe contents of a biological munition recovered from the time ofthe U.S, offensive BW program (1942-1969), Although the exactage of the munition is not known, the munition was estimated tobe between 46 and 52 years old. based on when this type ofmunition was used at Fort Detrick (W. Patrick, personal com-munication).

Multiple precautions were taken to avoid cross-contamina-tion of samples, including conducting sample processing, PCR,and post-PCR analysis in separate rooms. Other precautionswere taken from recently published criteria for the authentica-tion of molecular data in paleomicrobiology'̂ and included (i)not using a positive control, (ii) using a new primer sequencethat had not previously been amplified in the laboratory, (iii)sequencing the amplicon to confirm its identity, and (iv) con-firming a positive result by ampliiying and sequencing a secondtarget.

S. marcescens, which was once thought to be an innocuoussoil bacterium, was often used as a biological marker during theU.S, offensive BW program, In fact, this is not the first time a BWsimulant has been identified from the liquid bomb fill of a buriedbiological munition. In 1995. construction workers at Wright-Patterson Air Force Base, near Dayton, Ohio, uncovered a bur-ied cache of biological munitions, which were shown to containnonviable Bmcella suis.' ̂ To our knowledge, however, this is thefirst report of S. marcescens being identified from a biologicalmunition buried in the ground for -50 years. Our results areconsistent with S. marcescens being used as a BW simulant andhighlight the use of molecular techniques to detect and to iden-tify bacterial organisms from the past that can no longer becultivated.

Acknowledgment

We thank William Bnibaker Ibr supplying the photographs of themunition and for tectiiiical discussions regarding Uiis project.

References

1- Yu VL: Scnatia marcescens: iiisioricai perspective and clinical review-, N EnglJMed 1979:300:887-93.

2, Hejazi A. Faikiner FR: 1997 Serratla marcescens. J Med Microbiol 1997: 46:903-12,

3, Covert NM: Ciitlirifj Edge: A History of Fort Detrick, Maryland- Fort Uetrick, MD.Public Aflairs Office, U.S, Army Garrison. 1997,

4, Maiwaid M: Broad range PCR for detection and identiilcation of bacteria, ln;Molecuiar Microbiology: Diagnostic Principles and Practice, pp 379-90. Edited byPersing DH, Washington, DC, ASM Press, 2004,

5, Hofstadler SA, Siimpath R, Blyn LB, et al: TIGER: the universal biosensor, Int JMass Spectrom 2005: 242: 23-41,

6, Altschiil SF, Gish W, Miller W, Myers EW. Upman DJ: Basic Local AlignmentSearch Too!. J Mol Biol 1990; 215: 403-10,

7, Ajithkumar B. Ajllhkumar VP, Iriye R, Dol Y, Sakai T: Spore-forming Serratiamarcescens subsp, saMiensLs subsp, noti, isoiated from a domestic wastewatertreatment tank, Int J Syst Evoi Microbiol 2003: 53: 253-8.

S. Hogg JC, U'hane MJ: Identilkation of bacterial species associated with the sheepscab mite [Psoroples ovis] by using amplified genes coding for 16S rRNA. ApplEnviron Mit-roblol 1999: 65: 4227-9,

9. Ait Tayeb L, Ageron E, Grimont F, Grimont PA: Molecular phylogeny of the genusPseudomonas based OTI rpoB sequences and application for the identificalion ofisolates. Res Microbiol 2005: 156: 763-73,

10. Draricoiirt M, Raoult D: rpoB gene sequence-based identification of Stapiiylococ-cus species, J Clin Microbiol 2002: 40: 1333-S.

11. Ko KS, Lee HK. Park MY. et al: Application of RNA polymerase ,a-subunit gene[rpoBI sequences for the molecular ditTerenUation of Legtonelia species, J ClinMicrobiol 2002; 40: 2653-8,

!2, Korczak B. Christensen H, Eniler S, Frey J. Kuhnert P; Phylogeny of the familyPastewellaceae based on rpoB sequences. Int J Syst Evol Microbiol 2004; 54:1393-9,

13, Mollet C, Drancourt M, Raouli D: rpoB sequence analysis as a novel basis forbacterial iden till cat ion. Mo! Microbiol 1997: 26: 1005-11,

14, Drancouri M. Raoult D: Palaeomicrobiology: current issues and perspectives, NatRev Microbiol 2005: 3: 23-35,

15, Christopher GW, Eitzen EM Jr: Air evacuation under high-leve! biosafety con-tainment: the aeroniedlcal isolation team. Emerg Infect Dis 1999: 5: 241-6.

Military Medicine, Vol, 172. August 2007