molecular markers non-pcr based 1courtesy of carol ritland

10
Molecular markers Non-PCR based 1 courtesy of Carol Ritland

Upload: gillian-johnson

Post on 21-Jan-2016

223 views

Category:

Documents


1 download

TRANSCRIPT

Page 1: Molecular markers Non-PCR based 1courtesy of Carol Ritland

Molecular markers

Non-PCR based1courtesy of Carol Ritland

Page 2: Molecular markers Non-PCR based 1courtesy of Carol Ritland

Ideal properties for molecular markers

• Highly polymorphic• Codominant (2N)• Frequent in genome• Selectively neutral• Easily availability• Highly reproducibility• Easy to exchange between research

groups

2

Page 3: Molecular markers Non-PCR based 1courtesy of Carol Ritland

Genetic Jargons

• Terms– Locus = portion of DNA (plural = loci)

• Not always a gene

– Allele = form that a locus can take: Mendelian• Subjective depending on resolution of

measurement– Nucleotide state difference (sequencing eg. SNPs)– Length difference (microsatellite)– Functional difference (ABO blood group)– Electrophoretic difference (allozyme)

…AGGCGTTCGCTTATGATAA……AGGCGTACGCTTATGATAA……AGGCGTTCACACACACACGCTTATGATAA…

…AGGCGTTCACACACACACACGCTTATGATAA…

3

Page 4: Molecular markers Non-PCR based 1courtesy of Carol Ritland

RFLP• Restriction Fragment Length Polymorphism (Box

1.2)– Digestion of large amount (10ug) of genomic DNA

using R.E.– Run digested fragments into agarose gel– Due to different R.E. sites the fragment lengths will

differ– Require a “known” probe (0.5 to 3.0 kb)– Using Southern blot technique

– Botstein et al. Am J. Hum Genet., 1980 32:314-331

4

Page 5: Molecular markers Non-PCR based 1courtesy of Carol Ritland

Griffiths et al Introduction to genetics 19965

Page 6: Molecular markers Non-PCR based 1courtesy of Carol Ritland

Griffiths et al Introduction to genetics 19966

Page 7: Molecular markers Non-PCR based 1courtesy of Carol Ritland

Sickle cell screening

• Single base change• RE for CTGAGG• Both parents are

carrier• Child 1 = affected• Child 2 = carrier• Child 3 = not affected• Prenatal screening

Saiki, RK; Scharf S, Faloona F, Mullis KB, Erlich HA, Arnheim N (Dec 20 1985). "Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia". Science 230 (4732): 1350–4.

7

Page 8: Molecular markers Non-PCR based 1courtesy of Carol Ritland

VNTR

• Variable Nuclear Tandem Repeat• Minisatellites with repeats of 11 to 60 bp long• Using RFLP method but probing with repeat

probes (Southern Blot)• Looking for fingerprint patterns• Pending of RE used• Scoring for number of bands • Potential to have many allele in a population • Dominant marker with Mendelian inheritance• Jeffrey A. et al. 1985 Nature 314:67-73

8

Page 9: Molecular markers Non-PCR based 1courtesy of Carol Ritland

VNTR

Griffiths et al Introduction to genetics 19969

Page 10: Molecular markers Non-PCR based 1courtesy of Carol Ritland

10