ms ib_dr visu

8/2/2019 MS IB_dr visu

http://slidepdf.com/reader/full/ms-ibdr-visu 1/9

This article was downloaded by: [117.201.17.117]On: 10 January 2012, At: 07:42Publisher: Taylor & FrancisInforma Ltd Registered in England and Wales Registered Number: 1072954 Registered office: MortimerHouse, 37-41 Mortimer Street, London W1T 3JH, UK

Avian PathologyPublication details, including instructions for authors and subscription information:http:/ / www.t andfonline.com/ loi/ cavp20

Effect of a live Mycoplasma synoviae vaccine on the

production of eggshell apex abnormalities induced

by a M. synoviae infect ion preceded by an infect ion

with infectious bronchitis virus D1466A. Feberwee

a, C. J. Morrow

b, S. A. Ghorashi

c, A. H. Noormohammadi

c& W. J. M.

Landmana d

aAnimal Health Service (GD), Arnsbergstraat 7, 7418 EZ, Deventer, the Netherlands

bBiopropert ies Pty Ltd, Ringwood, Vict oria, Aust ralia

c School of Veterinary Science, Universit y of Melbourne, Werri bee, Vict oria, Aust raliad

Depart ment of Farm Animal Healt h, Facult y of Veterinary Medicine, Ut recht Universit y,Yalelaan 7, 3584, CL Utrecht, the Netherlands

Available online: 18 Sep 2009

To cite this article: A. Feberwee, C. J. Morrow, S. A. Ghorashi, A. H. Noormohammadi & W. J. M. Landman (2009):Eff ect of a li ve Mycoplasma synoviae vaccine on the production of eggshell apex abnormali t ies induced by a M. synoviae

infection preceded by an infecti on wit h inf ectious bronchit is virus D1466, Avian Pathology, 38:5, 333-340

To link t o this art icle: htt p:/ / dx.doi.org/ 10.1080/ 03079450903183652

PLEASE SCROLL DOWN FOR ARTICLE

Full terms and conditions of use: http://www.tandfonline.com/page/terms-and-conditions

This article may be used for research, teaching, and private study purposes. Any substantial or systematicreproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form toanyone is expressly forbidden.

The publisher does not give any warranty express or implied or make any representation that the contentswill be complete or accurate or up to date. The accuracy of any instructions, formulae, and drug doses

should be independently verified with primary sources. The publisher shall not be liable for any loss, actions,claims, proceedings, demand, or costs or damages whatsoever or howsoever caused arising directly orindirectly in connection with or arising out of the use of this material.

http://dx.doi.org/10.1080/03079450903183652

http://www.tandfonline.com/page/terms-and-conditions

http://dx.doi.org/10.1080/03079450903183652

http://www.tandfonline.com/loi/cavp20



Effect of a live Mycoplasma synoviae vaccine on theproduction of eggshell apex abnormalities inducedby a M. synoviae infection preceded by an infection

with infectious bronchitis virus D1466A. Feberwee1*, C. J. Morrow2, S. A. Ghorashi3, A. H. Noormohammadi3 andW. J. M. Landman1,4

1Animal Health Service (GD), Arnsbergstraat 7, 7418 EZ, Deventer, the Netherlands, 2Bioproperties Pty Ltd, Ringwood,Victoria, Australia, 3School of Veterinary Science, Uni versity of Melbourne, Werribee, Victoria, Australia, and 4Department of Farm Animal Health, Faculty of Veterinary Medicine,Utrecht Uni versity, Yalelaan 7, 3584 CL Utrecht,the Netherlands

An experimental study was conducted to assess the effect of a live Mycoplasma synoviae vaccine

(Vaxsafe† MS; Bioproperties Pty Ltd, Ringwood, Victoria, Australia) on M. synoviae-induced eggshellapex abnormalities (EAA). Four experimental groups of specified-pathogen-free white laying hens weremade. All groups were inoculated with infectious bronchitis virus D1466 at 18 weeks of age. One group didnot receive further treatment (non-vaccinated non-challenged (NVNC)). Two groups were vaccinated at 14weeks of age against M. synoviae, and one of these groups was also challenged with an EAA-inducingM. synoviae strain 5 days after infectious bronchitis virus challenge (vaccinated non-challenged (VNC) andvaccinated challenged group (VC), respectively). The fourth group was not vaccinated but was challengedwith M. synoviae (non-vaccinated challenged (NVC)). Eggs with EAA were produced only in the NVC andVC groups. However, the proportion of eggs with EAA and the mean daily production of eggs with EAA perchicken was significantly lower (P B0.05) in the VC group (88/741 (11.9%) and 0.0990.01 eggs per hen)compared with the NVC group (148/646 (22.9%) and 0.1490.01 eggs per hen). The mean daily eggproduction per chicken was significantly lower in the NVC group (0.4890.03 eggs) compared with that of

the NVNC group (0.6090.03 eggs), but not significantly different from other groups. The eggshell strengthof eggs with EAA (22.8 N) was significantly lower (P B0.05) than non-affected eggs from the other groups(33.7 to 39.5 N). Furthermore, the eggshell strength of non-affected eggs in the NVC group was significantlylower (P B0.05) compared with that of non-affected eggs from the flock of origin (33.7 versus 41.2 N), butnot different from the other groups. It can be concluded from the present study that vaccination with a liveM. synoviae vaccine reduces the occurrence of M. synoviae-induced EAA significantly.

Introduction

Mycoplasma synoviae is traditionally considered the

second most important avian Mycoplasma species for

commercial chickens from the clinical and economical

point of view. It has been associated with respiratorydisease and subsequent condemnations due to air

sacculitis in broilers and peritonitis and mortality in

commercial layer hens, although subclinical infections of

the respiratory tract seem predominant (Stipkovits &

Kempf, 1996; Kleven, 2003). Furthermore, M. synoviae

is also known to cause synovitis in chickens and turkeys

(Olson et al., 1956; Kleven et al., 1975; Morrow et al.,

1990; Landman & Feberwee, 2001, 2004; van Beek et al.,

2002; Kleven, 2003).Since the year 2000 a novel eggshell apex abnorma-

lity (EAA) has been increasingly found in table egg-

producing chicken flocks in the Netherlands. It was

characterized by altered shell surface, shell thinning and

cracks and breaks. The abnormalities were confined to

a region up to approximately 2 cm from the apex of the

egg, and in most cases there was a very clear demarca-tion zone and increased translucency visible at candling.

Recent field and experimental studies (Feberwee et al.,

2009) showed a causal relationship between the newly-

described EAA and M. synoviae infection, thus further

increasing the economic relevance of this Mycoplasma

species.

In vitro and field studies showed that oxytetracycline

was effective against M. synoviae (Landman et al., 2008)

and M. synoviae-induced EAA (Feberwee et al., 2009).

However, due to the temporary effect of antibiotic

treatment and the risk of residues in eggs for consump-

tion, alternative strategies such as vaccination should be

*To whom correspondence should be addressed: Tel: '31 570 660384. E-mail: [email protected]

Received 6 February 2009

Avian Pathology (October 2009) 38(5), 333 Á 340

ISSN 0307-9457 (print)/ISSN 1465-3338 (online)/09/50333-08 # 2009 Houghton Trust Ltd

DOI: 10.1080/03079450903183652



considered for the control of M. synoviae-induced EAA.Therefore, the effect of a commercial live M. synoviaevaccine (Vaxsafe† MS; Bioproperties Pty Ltd, Ring-wood, Victoria, Australia) on M. synoviae-induced EAAegg production was investigated. It was evaluated using

an animal model described previously by Feberwee et al.(2009). In this model a synergistic effect was foundbetween infectious bronchitis virus (IBV) strain D1466

and a Dutch EAA-inducing M. synoviae isolate, there-fore all experimental groups in the present study wereinoculated with IBV D1466.

Materials and Methods

M. synoviae vaccine. The vaccine used was Vaxsafe† MS (batch MSH

072991A, expiry date October 2010; Bioproperties Pty Ltd). After

arrival at the Animal Health Service (GD) (Deventer, the Netherlands),

the vaccine viability in colony-forming units (CFU) was tested using

Mycoplasma Experience (ME) agar (Mycoplasma Experience, Reigate,

Surrey, UK) 5 days after storage at (708C. After vaccination as

described below, the colour-changing units (CCU) of the retained

vaccine were determined according to the protocol of Meynell &

Meynell (1970) as prescribed by the manufacturer.

M. synoviae EAA and IBV D1466 inocula. Freeze-dried M. synoviae

EAA culture was suspended in 1 ml distilled water and transferred to

50 ml ME broth and incubated at 378C until a change of colour was

observed (within 3 days). For counting the CCU of the retained M.

synoviae EAA inocula, 10-fold dilutions were prepared in ME broth and

incubated for 14 days at 378C. The final M. synoviae concentration was

determined as the highest dilution where a colour change was observed.

It was expressed as CCU per millilitre according to the Spearman Á

Karber method for quantal data (Finney, 1952; Hannan, 2000).

Freeze-dried IBV D1466 (batch number 06500, Animal Health

Service (GD)) in vials containing 2.5 )106.6 median embryo infective

dose (EID50)/5 ml was dissolved in phosphate-buffered saline (PBS) to

produce a concentration of 106 to 107 EID50/ml IBV D1466.

In order to determine the IBV concentration (EID50/ml) of the

inocula, 10-fold dilutions were made and 0.2 ml of each dilution was

injected into the allantoic cavity of five 9-day-old specified-pathogen-

free (SPF) embryos. The virus titre obtained was based on the mortality

of embryos and was calculated according to the formula of Reed &

Muench (1938).

Experimental study. The experimental design is shown in Table 1. At the

start of the experiment 72 SPF white layer chickens, 12 weeks old

(Animal Health Service (GD)), were weighed, divided into weight

classes and allocated into four groups of 18 so that the average weights

were not significantly different. They were housed in negative-pressure

HEPA isolators (194 cm width, 95 cm height and 75 cm depth; Beyer &

Eggelaar, Utrecht, the Netherlands) each containing four laying nests

with plastic curtains. The housing temperature ranged from 23 to 278C.

Throughout the experiment the birds were provided with 16 h of light

per day and feed and drinking water was given ad libitum. The birds

were free of Mycoplasma gallisepticum, M. synoviae and the common

avian pathogens as described elsewhere (Feberwee et al ., 2005). Blood

samples for testing for IBV, M. synoviae and M. gallisepticumantibodies were collected and a pool of six tracheal swabs were tested

per experimental group using the M. synoviae polymerase chain

reaction (PCR) test. The start of the experiment is referred to as day

0 and the experimental period lasted for 18 weeks. The different groups

are defined as: non-vaccinated non-challenged (NVNC), vaccinated

non-challenged (VNC), non-vaccinated challenged (NVC) and vacci-

nated challenged (VC) following the treatments below.

At week 2 of the experiment (14 weeks of age), two groups (NVNC

and NVC) were sham vaccinated by eye drop with ME broth (Â23 ml),

while the two other groups (VNC and VC) were vaccinated by this route

withÂ23 ml live M. synoviae vaccine according to the manufacturer’s

instructions. One dropper was used for all experimental groups and a

single droplet that formed at the tip of the dropper was allowed to fall

onto one of the open eyes.

Blood samples were collected from all groups at week 5 (17 weeks of

age) for IBV and M. synoviae antibodies.

At week 6 of the experiment (18 weeks of age), and 5 days before

M. synoviae challenge, the birds in all four groups were inoculated with

IBV D1466 in allantoic fluid containing 106.7 EID50/ml. Each bird was

inoculated intratracheally (i.t.) with 1 ml fluid, and intramuscularly

with 0.5 ml into the pectoral muscle.

At week 7 (19 weeks of age), one sham-vaccinated group (NVNC)

and one M. synoviae-vaccinated group (VNC) were inoculated with

1 ml ME broth i.t., while the other sham-vaccinated group (NVC) and

vaccinated group (VC) were challenged i.t. with 1 ml ME broth

containing 107 CCU M. synoviae EAA strain/ml.

Egg production and the occurrence of eggs with EAA were recorded

from week 7 until the end of the experiment at week 18. In order to

minimize bias in egg production data and to avoid breakage of eggswith EAA, eggs were collected four times a day as, despite synchroniza-

tion of lay, variation in the time of oviposition can occur. The daily egg

production (including both whole and broken eggs) was recorded. At

the end of the experiment, eggshell strength measurements were

performed on all eggs with EAA that were not broken or cracked and

on non-affected eggs of all experimental groups (n 051 to 57) using an

eggshell compression device (Futura 3/A, OQT-II; Futura-Werner

Furste Gbr, Lohne, Germany). Moreover, measurement was also

performed on 60 non-affected eggs from the original SPF flock (not

infected), which were included as controls.

Table 1. Experimental design

Time* (age of

birds in weeks) NVNC VNC NVC VC

D0 (12) SPF white layers 12 weeks of age, weighed, divided in weight classes and proportionally allocated in each

experimental group (18/group)

D0 (12) M. synoviae and M. gallisepticum RPA & M. synoviae PCR

W2 (14) ME medium

eyedrop

M. synoviae vaccine

eyedrop

ME medium

eyedrop

M. synoviae vaccine

eyedrop

W5 (17) M. synoviae RPA and IBV HI

W6 (18) IBV inoculation i.m. and i.t. (5 days before challenge)

W7 (19) ME medium i.t. ME medium i.t. M. synoviae EAA i.t. M. synoviae EAA i.t.

W7 Á 18 (19 Á 30) Recording of egg production and production of eggs with EAA

W18 (30) Postmortem

M. synoviae RPA and IBV HI

M. synoviae VlhA PCR

Mycoplasma culture oviduct and identification by M. synoviae PCR

*D 0day, W 0weeks

NVNC 0non-vaccinated non-challenged; VNC 0vaccinated non-challenged; NVC 0non-vaccinated challenged; VC0vaccinated

challenged; i.t. 0intratracheally and i.m. 0intramuscularly.

334 A. Feberwee et al .



At the end of the experiment blood samples were collected for IBV

and M. synoviae antibodies, and tracheal swabs were taken from all

birds. Subsequently, 8 to 11 swabs from birds of the VNC, NVC and VC

groups were used to determine the M. synoviae CFU equivalents in the

trachea swabs by PCR. Furthermore, DNA obtained from all tracheal

swabs was used for PCR amplification of the vlhA gene and high-

resolution melt (HRM) curve analysis.

The birds were stunned using CO2'O2 and exsanguinated by

incision of the jugular vein. General routine post-mortem examination

was performed at the time that calcified eggs were expected in the uterus(i.e. between 9 and 10 a.m.) (lay was synchronized) and swabs were

taken from the uterus for general bacteriology and mycoplasma culture.

DNA of M. synoviae culture positive oviducts was also used for PCR

amplification of the vlhA gene and HRM curve analysis.

Serology. M. synoviae serology was performed as described by Feberwee

et al. (2005) using the rapid plate agglutination (RPA) test within 24 h

of collection of blood samples. In short, sera diluted 1:2 were tested with

the RPA antigen (Nobilis MS antigen batch number 01302; Intervet

International, Boxmeer, the Netherlands). If agglutination occurred the

serum was serially diluted from 1:4 to 1:32 in PBS pH 7.2 and re-tested.

If a serum agglutinated at a dilution of 1:8 (titre 3 log2) or higher, it was

considered to be a specific positive for M. synoviae. M. gallisepticum

serology was carried out using RPA (Nobilis MG antigen batch number650 600203; Intervet International) and the haemagglutination inhibi-

tion (HI) test as described previously (Feberwee et al., 2005).

Agglutination and HI at dilution 1:2 (titre 1 log2) or lower was

regarded as a specific negative result. IBV D1466 antibodies were

assessed with the HI test (Alexander & Chettle, 1977; de Wit et al .,

1997).

Culture of the oviduct. The outer surface of the oviduct was first

sterilized with a hot scalpel blade. Then an incision was made with a

sterile scalpel and two sterile cotton swabs were used to swab both the

isthmus and the uterus. One swab was plated out on a 5% sheep blood

agar plate for general bacteriology and the other on a ME agar plate for

mycoplasma culture. The ME agar plates were incubated at 37 8C in a

humid environment and examined for colonies every 2 to 3 days up to

28 days. One well-separated colony was selected and plated out on a

fresh ME agar, and a piece of ME agar, approximately 2 )0.5 cm2,

bearing positive clones was transferred to 5 ml ME broth and incubated

at 378C. Positive mycoplasma cultures were identified as M. synoviae by

PCR as described below.

Molecular identification. Tracheal swabs were eluted per pools of six (at

week 0) or individually (at week 18) in 1 ml PBS and were centrifuged

for 10 min at 16,000 ) g. The pellet was then resuspended in 1 ml PBS

and centrifuged at 16,000 ) g. Subsequently, it was resuspended in 25 ml

PBS, incubated at 1108C for 15 min and cooled on ice for 5 min. After a

final centrifugation for 2 min at 16,000 ) g , supernatants were cooled at

48C and used directly for PCR.

Positive mycoplasma broth cultures (colour change present) were

pelleted for 10 min at 16,000 ) g and the pellets resuspended in 200 ml

sterile PBS. DNAwas extracted using the protocol for Cultured Animal

Cells of the QiaAmp DNA mini kit (Qiagen Benelux B.V., Venlo, the

Netherlands).

The DNA extracts from tracheal swabs were tested quantitatively and

expressed in the calculation of M. synoviae CFU equivalents/ml as

described by Mekkes & Feberwee (2005). In short, for the calculation of

CFU equivalents, aliquots of DNA from serial 10-fold dilutions (101 to

106) stored at (208C were used as standards in the M. synoviae Real-

Time PCR to calculate the M. synoviae concentrations (CFU equiva-

lents/ml) in the samples. The concentration of M. synoviae in CFU

equivalents/ml was calculated using the second derivative method

included in the Light Cycler data analysis software. The DNA extracts

from mycoplasma-positive broths were tested qualitatively by M.

synoviae Real-Time PCR (M. synoviae present or not). The forward

primer 5?-GAGAAGCAAAATAGTGATATCA-3? and the reverse

primer 5?-CAGTCGTCTCCGAAGTTAACAA-3? (GenBank accession

number X52083) were used. These primers amplify a 211 base pair

sequence from the 16S ribosomal RNA gene of M. synoviae.

PCR amplification of the vlhA gene and HRM curve analysis. The

oligonucleotide primers Link (5?-TACTATTAGCAGCTAGTGC-3 ?)

and MSCons-R (5?-AGTAACCGATCCGCTTAAT-3?) were used to

amplify the single-copy conserved 5? end of the vlhA genes as described

before (Jeffery et al ., 2007). A 25 ml reaction mixture consisted of

200 mM each dATP, dCTP, dGTP and dTTP, 2 mM MgSO4, 25 mM

each primer, 1 U High Fidelity Platinium Taq DNA polymerase

(Invitrogen), 2.5 ml 10x Platinium Taq DNA polymerase buffer,

10 mM SYTO† 9 green fluorescent nucleic acid stain (Invitrogen),

and 1 ml extracted M. synov

iae genomic DNA. The reaction mixturewas incubated at 968C for 2 min, then subjected to 40 cycles of 968C for

15 sec, 548C for 15 sec and 688C for 20 sec. DNA was extracted directly

from tracheal swabs and M. synoviae cultures grown from oviducts as

described above. In each set of PCR reactions, negative (H2O) and

positive (M. synoviae vaccine) controls were included.

HRM curve analysis was performed on a Rotor-Gene 6000 using the

software Rotor-Gene 6000 1.7.87 and the HRM algorithm provided as

described before (Jeffery et al ., 2007). Identical volumes of PCR

products were subjected to an increasing temperature from 80 to 908C

at intervals (ramps) of 0.38C/s. All amplicons were tested in triplicate to

detect variations induced by technical errors. Genotypes were defined

by selecting a representative sample from M. synoviae EAA and

M. synoviae vaccine strains. Specimens giving a confidence value of

more than 90% to either of the reference profiles were considered

identical to that profile. The threshold of 90% confidence percentagewas applied according to a previous study (Jeffery et al ., 2007) where a

HRM curve analysis technique for classification of M. synoviae strains

based on their vlhA gene sequence was developed.

DNA sequence analysis. Amplicons from a number of specimens from

each group were purified using the QIAquick† PCR purification kit

(Qiagen) according to the manufacturer’s instructions, eluted in 30 ml

buffer E (Qiagen) and then subjected to automated sequencing

(BigDye† Terminator v3.1; Applied Biosystems) in both directions

using the same primers used for PCR. The sequences were analysed

using DNASTAR software (DNASTAR Inc., Madison, Wisconsin,

USA). The nucleotide sequence of M. synoviae EAA strain was

submitted to the GenBank under accession number FJ495803.

Statistical analysis. The fraction of M. synoviae RPA-positive samples,

the fraction of mycoplasma-positive culture results from oviducts, and

the fraction of eggs with EAA on total egg production were analysed

using the Two-Sample Proportion Test (Statistix†, 2005). Proportions

were considered significantly different if P B0.05.

Weight at week 0, IBV D1466 titres, egg shell strength, egg

production and production of eggs with EAA were analysed by means

of the Kruskal Á Wallis one-way analysis of variance. The Kruskal Á Wallis

all-pairwise comparisons test was performed as post hoc analysis in

order to compare all possible pairwise differences between the means of

the different treatment groups (Statistix†, 2005). Means were consid-

ered significantly different if P B0.05.

Ethical statement. Birds were housed, handled and treated following

approval by the Institutional Animal Experimental Committee inaccordance with the Dutch regulations on experimental animals.

Results

Viability and concentration of M. synoviae vaccine. Thevaccine viability count after 5 days storage at (708Cwas 1.0 )108 CFU/ml, while the viability count as CCU/ml of the retained vaccine was 9.1 )107 CCU/ml.Therefore, one vaccine dose (Â23 ml) contained2.1 )106 CCU, which was in accordance with themanufacturer’s recommendations (per bird ]105.7

CCU living M. synoviae strain MS-H).

Concentration of M. synoviae EAA strain and IBV D1466

inocula. The IBV D1466 and M. synoviae EAA concen-trations calculated from retained samples of the inocula

Vaccination and EAA 335



were 106.7 EID50/ml allantoic fluid and 107 CCU/ml,respectively.

Clinical observations. Inoculation with IBV induced mildrespiratory signs in all experimental groups during 9 to15 days. In total, four birds died during the experiment;one died due to acute pneumonia (VC group), a seconddue to severe osteomalacia (VNC group), a third due to

peritonitis (NVC group), and a fourth had to beeuthanized due to subcutaneous emphysema possiblyinduced by a ruptured air sac (VC group).

The osteomalacia remained confined to a single caseas all other birds, which were physically palpated (two to

three birds per group), showed no signs of it and a feedanalysis showed sufficient concentrations of calcium andphosphorous.

Serology and PCR. At the start of the experiment thebirds were serologically negative for M. gallisepticum andM. synoviae antibodies, and freedom of M. synoviae was

further confirmed by PCR. Before IBV D1466 andM. synoviae EAA inoculation, no specific M. synoviaeand IBV D1466 antibodies were found in any group

(Table 2). In the VNC group onlyone of 18 samplestested

showed agglutination in the RPA test at dilution 1:2.At the end of the experiment, M. synoviae specific

antibodies (agglutination at 1:8 dilution) were detected

only in the M. synoviae-vaccinated and/or M. synoviae-

challenged birds (5/17 birds in the VNC group, 17/17

birds in the NVC group and 11/16 birds in the VC

group). However, in the VNC group, 7/17 samples

showed agglutination at dilution 1:4 while the otherfive samples showed agglutination at dilution 1:2.

All birds were serologically positive for IBV D1466 at

the end of the experiment. There was no significant

difference in mean IBV D1466 HI titre between the

experimental groups (Table 2).The numbers of M. synoviae PCR-positive tracheal

swabs at the end of the experiment were 9/11, 10/11 and 6/

8 for the VNC, NVC and VC groups, respectively. There

was no significant difference between the proportions of

M. synoviae-positive swabs. Although there was a differ-

ence in the average number of tracheal CFU equivalents/

ml per chicken in the different groups (1758 CFU

equivalents/ml in the VNC group, 2455 CFU equiva-

lents/ml in the NVC group and 748 CFU equivalents/ml

Table 2. Serology, PCR, mycoplasma culture oviduct, egg production, production of eggs with EAA and eggshell strength

of the experimental study

Time D0day

W0week

NVNC

n 018

VNC

n 018

NVC

n 018

VC

n 018 SPF Flockl

IBV D1466 HI titrea W5 3 (0) 3 (0) 3 (0) 3 (0) Á

W18 8.7 (0.4)A 9.7 (0.3)A 9.1 (0.4)A 10.3 (0.3)A Á

M. synoviae RPA D0 0/18 0/18 0/18 0/18 Á

positiveb,c W5 0/18 0/18 0/18 0/18 Á

W18 0/17A,g 5/17A,B,h,i 17/17C,h 11/16B,k Á

M. gallisepticum RPA

positive

d

D0 0/18 0/18 0/18 0/18 Á

M. synoviae PCR positiveb D0e 0 0 0 0 Á

W18f Á 9/11A 10/11A 6/8A

Mycoplasma culture

oviductbW18 0/18A 0/17A 10/17B 9/16B

Á

Egg production and production of eggs with EAA

Total egg production W7-W18 826 721 646 741 Á

Mean daily egg

production/chickena

W7-W18 0.60 (0.03)A 0.54 (0.03)A,B 0.48 (0.03)B 0.58 (0.03)A,B Á

Total production of eggs

with EAA

W7-W18 0 0 148 88 Á

Proportion of eggs with

EAA of total egg

production (%)b

W7-W18 0A 0A 22.9C 11.9B Á

Mean daily eggs with

EAA/chickena

W7-W18 0.0 (0.0)A 0.0 (0.0)A,j 0.14 (0.01)C 0.09 (0.01)B Á

Eggshell strength (N)

Non-affected eggs

(n 025 Á 28 per group)aW13 40.8 (1.7)A 35.1 (1.4)A 35.0 (1.6)A 35.1 (1.3)A Á

Non-affected eggs

(n 051 Á 60 per group)aW17-18 39.5 (1.3)A,B 39.3 (0.9)A,B 33.7 (1.3)B 37.0 (1.1)A,B 41.2 (1.0)A

Eggs with EAA (n 0133

and n 088)aW8-W18 Á Á

j 22.8 (0.4)C 22.8 (0.6)C Á

NVNC 0non-vaccinated non-challenged; VNC 0vaccinated non-challenged; NVC 0non-vaccinated challenged and VC 0vaccinated

challenged. Means with the same uppercase superscript letter within the same row (for Eggshell strength also between rows) are

significantly different (P B0.05). aMean (9 SEM) and statistiscal analysis with Kruskal-Wallis one-way analysis of variance. bTwo-

Sample Proportion Test. cAgglutination M. synoviae RPA titres]1:8. dBoth M. gallisepticum RPA and HI titre]1:8. ePer isolator

one pool of 6 trachea swabs. f 8 Á 11 samples were tested. gOne bird not tested. hOne bird died. iAnother 7/15 samples showed

agglutination at dilution 1:4. jOnly one egg with EAA-like outer characteristics was produced, but it had normal eggshell strength(34 N). kTwo birds died. lEggs from the SPF flock from which the experimental birds originated were used as controls for eggshell

strength measurements.




in the VC group), differences were not statisticallysignificant (P !0.05).

Egg production and EAA egg production. In all groups,egg production started within 1 week of M. synoviaechallenge. The mean (9 standard error of the mean)daily egg production per chicken was significantly higher(P B0.05) in the NVNC group than in the NVC group

(0.6090.03 eggs and 0.4890.03 eggs, respectively). Inthe other two groups the mean daily egg production(0.5590.03 eggs (VNC group) and 0.5790.03 eggs (VCgroup)) was not significantly different from the NVNCgroup and the NVC group (Table 2 and Figure 1).

No eggs with EAA were produced in the NVNC andVNC groups, a total egg production of 826 and 721 eggs,

respectively. The NVC and VC groups produced 148 and88 eggs with EAA, respectively, while their total eggproduction was 646 and 741 eggs, respectively. Produc-

tion of eggs in the NVC group and VC group started at 3and 4 weeks after inoculation of M. synoviae EAA,respectively. Eggs with EAA were produced from then on

in both groups; however, the weekly proportion of eggswith EAA in the VC group was lower than in the NVCgroup (Table 2 and Figure 2). In the VNC group, one eggshowed the visual characteristics of EAA; however, thiswas not confirmed by a reduction in eggshell strengthand therefore this egg was not recorded as having EAA.

The proportion of eggs with EAA of the total eggproduction was significantly higher (P B0.05) in theNVC group (148/646 (22.9%)) than that of the VC group(88/741 (11.9%)). Also the mean daily production of eggs

with EAA per chicken was significantly higher (P B0.05)in the NVC group (0.1490.01 eggs) than that of the VCgroup (0.0990.01 eggs) (Table 2).

Eggshell strength. At week 13 the eggshell strength of non-affected eggs did not differ significantly (P !0.05)between the different experimental groups. However, atthe end of the experiment the eggshell strength of non-affected eggs of the NVC group was significantly lower(P B0.05) than that of the eggs derived from the SPFflock of origin, these being 33.791.3 N (n 057) and41.291.0 N (n 060), respectively. There was no signifi-cant difference between the VNC group and the NVNC

group (39.591.3 N; n 055), the VNC group (39.390.9N; n 056) and the VC group (37.091.1 N; n 051)

regarding eggshell strength of non-affected eggs (Table2). Moreover, these three groups did not differ signifi-cantly regarding non-affected eggs from the SPF flock of

origin. The eggshell strength of the eggs with EAA fromthe NVC group and the VC group did not differ

significantly (P B0.05) from each other, being 22.890.4N (n 0133) and 22.890.6 (n 088), respectively; however,both differed significantly (P B0.05) from the eggshellstrength of non-affected eggs of all experimental groups,including that of the SPF flock that served as a control(Table 2).

Post-mortem examination and oviduct culture. At post-mortem examination no gross macroscopic abnormalitiesof the oviduct were observed. In 67% of the birds in theNVNC group, in 47% of the birds in the VNC group, in76% ofthebirdsin the NVC group and in 69% ofthebirdsin the VC group, an egg was present in the uterus.

M. synoviae was not isolated from the oviducts of theNVNC group or the VNC group. However, it wascultured from the oviducts of 10/17 birds in the NVCgroup and from the oviducts of 9/16 birds in the VC

group. In the VC group, one egg with EAA was found inthe oviduct of a hen that was also M. synoviae culture-positive. In the NVC group, six eggs with EAAwere foundin the oviducts * of which five were culture-positive.

The fractions of mycoplasma-positive cultures fromoviducts of the NVC group and the VC group (10/17 and9/16, respectively) were significantly different (P B0.05)from those of the NVNC group and the VNC group(0/18 and 0/17, respectively). There was no significant

difference regarding the proportion of mycoplasma

positive oviducts between the NVNC group and theVNC group. Moreover, there was also no significantdifference (P !0.05) between the NVC group and the VC

group (Table 2). No other pathogenic bacteria wereisolated from oviducts.

PCR amplification of the vlhA gene and HRM curve

analysis. DNA extracted from tracheal swabs from the

NVNC group did not produce a detectable PCRamplicon but those extracted from oviduct culturesand from tracheal swabs from all other groups generatedamplicons that were subjected to HRM curve analysis.In conventional melt curve analysis, two peaks between

828C and 858C were generated from amplicons withcurve shapes that could be categorized into two distinctprofiles, one similar to the M. synoviae vaccine strainand the other to the M. synoviae EAA strain (Figure 3a

NVNC VNC NVC VC

0.0

0.4

0.8

1.2

Figure 1. Box and Whisker Plot showing the mean daily egg

production per chicken per experimental group (NVNC 0non-

vaccinated non-challenged, VNC 0vaccinated non-challenged,

NVC 0non-vaccinated challenged, VC 0vaccinated challenged).

The mean daily egg production per chicken was significantlyhigher (PB0.05) in the NVNC group than in the NVC group. In

the other two, the mean daily egg production was not significantly

different from the NVNC group and the NVC group.

0

10

20

30

40

W1 W3 W5 W7 W9 W11

Weeks p.i. M. synoviae

P r o p o r t i o n o f e g g s w i t h E A A ( % )

NVC

VC

Figure 2. Proportion of eggs with EAA (%) of total weekly egg

production in non-vaccinated challenged (NVC) and vaccinated

challenged group (VC).




to c). All specimens (tracheal samples) from the VNCgroup generated vlhA amplicons that corresponded witheach other and with the M. synoviae vaccine strain. Allother specimens, including tracheal swabs from the NVCand VC groups, and M. synoviae cultures grown fromoviducts from these groups, generated amplicons thatcorresponded with M. synoviae EAA strain. In thenormalized HRM graphs, two distinct curve profileswere displayed, corresponding either to the vaccine orthe M. synoviae EAA strain. The amplicons fromtracheal swabs from group VNC generated normalized

curves that were genotyped as vaccine type, while thosefrom tracheal swabs and/or oviduct cultures from bird

groups NVC and VC generated normalized curves thatgenotyped as M. synoviae EAA strain (Figure 3a to c).

DNA sequence analysis. In order to establish the extentof sequence variability in the PCR products amplifiedfrom each profile, and also to confirm results from vlhA-

PCR HRM curve analysis, amplicons from M. synoviaevaccine and M. synoviae EAA strains as well as thosefrom tracheal swabs and/or oviduct cultures from threeto four birds in each group were subjected to nucleotidesequencing. Comparison of the sequences revealed that

amplicons from tracheal swabs from the VNC group hadidentical nucleotide sequences to the M. synoviae vaccinestrain, while amplicons from tracheal swabs and/oroviduct cultures from the NVC and VC groups had

identical sequences to the M. synoviae EAA strain.Alignment of the M. synoviae vaccine and M. synoviaeEAA strain sequences revealed an insertion of 12 basepairs in the 5? end of the M. synoviae EAA amplicon andeight nucleotide substitutions spread throughout theamplicon (Figure 4).

Discussion

Vaccination with a commercial live M. synoviae vaccine

was investigated in this experimental study as an alter-native strategy for the control of M. synoviae-inducedEAA due to the limited effect of antibiotic treatmentand the risk of residues in eggs for consumption. Theexperimental model used was based on that described byFeberwee et al. (2009) and exploited the synergistic effectbetween IBV D1466 and a Dutch EAA-inducing M.synoviae isolate. Therefore all four experimental groupswere inoculated with IBV D1466. The sample size (n 0

18) used in each group was chosen to obtain enoughpower (0.80 and 95% confidence) to detect significantdifferences, and was also based on previous work(Feberwee et al ., 2009).

The results showed that vaccination could not com-

pletely prevent the occurrence of EAA, although asignificant reduction of EAA egg production (approxi-mately 50%; P B0.05) was found. Moreover, a delay inthe onset of EAA egg production was observed in the

82.4 82.6 82.8 83.0 83.2 83.4 83.6 83.8 84.0 84.2 84.4 84.6 84.8 85.0 85.2 85.4 85.6 85.8

110

100

90

80

70

60

50

40

30

20

10

82.4 82.6 82.8 83.0 83.2 83.4 83.6 83.8 84.0 84.2 84.4 84.6 84.8 85.0 85.2 85.4 85.6 85.8

N o r m a l i s e d F l u o r e s c e n c e

Temperature (°C)

N o r m a l i s e d F l u o r e s c e n c e

Temperature (°C)

d F / d T

d F / d T

Temperature (°C) Temperature (°C)

110

100

90

80

70

60

50

40

30

20

10

86.085.585.084.584.083.583.082.582.081.581.0

3.0

2.5

2.0

1.5

1.0

0.5

0

MSH vaccine strain

Ms EAA strain

VNC

NVC

VC

Oviduct cultures

MSH vaccine strain

Ms EAA strain

VNC

NVC

VC

Oviduct cultures

MSH vaccine strain

Ms EAA strain

VNC

NVC

VC

Oviduct cultures

MSH vaccine strain

Ms EAA strain

VNC

NVC

VC

Oviduct cultures

80.5 81.0 81.5 82.0 82.5 83.0 83.5 84.0 84.5 85.0 85.5 86.0

3.0

2.5

2.0

1.5

1.0

0.5

0.0

(a) (b)

(c) (d)

Figure 3. Individual (a and c) or means (b and d) of conventional (a and b) and normalised (c and d) high resolution melt curves of

vlhA gene amplicons generated from tracheal swabs and oviduct cultures.




vaccinated VC group. Our data are in agreement

with research performed by Markham et al. (1998a),

who showed a reduction in M. synoviae-induced air sac

lesions (from 65 to 12.5%) after a single eye drop

vaccination with 30 ml MS-H vaccine containing

107 CCU/ml.The proportion of EAA eggs in the NVC group

(22.9%) was higher than that of a similar experi-

mental group of an earlier study (14%) where

M. synov

iae-induced eggshell pathology was firstdescribed (Feberwee et al., 2009). A second difference

was that in the present study clinical signs due to IBV

were observed in all groups, and yet another difference

was that the NVC group here showed a significantly

lower eggshell strength (P B0.05) in non-affected eggs

than that of the non-affected eggs of the control SPF

flock. The eggshell strength of unaffected eggs in the

NVC group was also lower than that of unaffected eggs

in the VC group; however, the difference was not

statistically significant. Nevertheless, the results suggest

a positive effect of M. synoviae vaccination on eggshell

strength in M. synoviae EAA-challenged birds. The

differences found between the two studies are possibly

related to the fact that in this experiment SPF birds were

used and not commercial hens.The mean daily egg production per chicken in the

NVC group was lower than in all other groups. It was

significantly lower than that of the NVNC group,

indicating that M. synoviae EAA also has a negative

effect on total egg production. This is consistent with the

findings of the previous study (Feberwee et al., 2009).

Although the mean daily egg production was lower than

that of the VC group, the difference was not statistically

different (P !0.05). However, as with observations for

eggshell strength, the higher egg production results

suggest a positive effect of vaccination on the egg

production of M. synoviae EAA-challenged birds.The post-mortem findings of the birds that died

during the experiment (peritonitis, airsacculitis and

pneumonia) are consistent with descriptions of dual

infections of M. synoviae with IBV (Kleven, 2003). The

presence of IBV antibodies in all groups and the presence

of M. synoviae antibodies, together with M. synoviae-

positive PCR results in the NVC and VC groups, suggest

that IBV inoculation and M. synoviae EAA challenge

were successful. M. synoviae antibodies were not found

in the VNC group at 3 weeks after eye drop vaccination;

however, at the end of the study (11 weeks after

challenge), all samples showed agglutination at dilution

1:2, while seven and five samples were positive atdilutions 1:4 and 1:8, respectively. These results harmo-

nize with a study performed by Markham et al. (1998b),

who showed that the serological response following

MS-H vaccination is slow with the first RPA reactions

occurring 6 weeks after vaccination, and 100% reaction

occurring at 16 to 20 weeks after vaccination. The

development of M. synoviae antibodies and the positive

M. synoviae PCR in the VNC group, and the myco-

plasma counts of the M. synoviae vaccine used, all

suggest that the experimental birds were correctly

vaccinated.The PCR results and the HRM curve analyses showed

that the M. synoviae EAA strain had colonized in the

oviduct and trachea of the VC group. Although the

average CFU equivalents/ml in tracheal samples from

this group was lower than that of the NVC group,

suggesting that vaccination has an effect on the excretion

of the number of mycoplasmas, the difference was not

statistically significant. A possible explanation for the

lack of significance is the relatively low number of

experimental birds used. However, mycoplasma shed-

ding was only determined at the end of the experiment;

had it been determined over the whole experimental

period it would have enabled a better evaluation of

the differences in shedding between vaccinated and

non-vaccinated birds by performing area under the

curve analysis, as was performed previously for a liveM. gallisepticum vaccine (Feberwee et al ., 2006).

A previous study (Jeffery et al ., 2007) reported on the

value of HRM curve analysis for differentiation of pure

1 11 21 31 41 51

consensus AGTGGCCATTGCTCCTGCTGTTATAGCAATTTCATGTGGTGATCAAACTCCAGCACCT C

MS_H ..........................................................G.

MS_EAA ..........................................................A.

61 71 81 91 101 111

consensus TCCA ACACCTGGAAACCCAAATACTGATAATCCTCAAAACCCAAATCC

MS_H ....------------............................................

MS_EAA ....GCACCTACTCCA............................................

121 131 141 151 161 171

consensus AGGAAA CCAGGTACTGATAAT CTCAAAACCCAAATCCAGGAAA CCAGGGGGTGGTACMS_H ......T...............T......................T..............

MS_EAA ......C...............C......................C..............

181 191 201 211 221 231

consensus AGTTGACCCTGTAGAG CTGCTAAAACAGAAGCTAAAAC GCTATTGATGCTTCAGCAGA

MS_H ................G......................C....................

MS_EAA ................A......................T....................

241 251 261 271 281 291

consensus ATTATCAGATTCAGTTAAAGAAGCATTAAAAAGACAAGTTGAAGCAACTACAACAGAA C

MS_H ..........................................................G.

MS_EAA ..........................................................T.

301 311 321 331 341 351

consensus TGCAGCCAGAGATTTAAAAACTAAA CAGAAGCTCTTGTTTCAGCTGTAAAAGC

MS_H .........................A............................

MS_EAA .........................G............................

Figure 4. Comparison of the nucleotide sequences of MS-H vaccine and M. synoviae EAA strains vlhA gene amplicons using

CLUSTALW. Identical nucleotides and deletions are shown by ‘.’ and ‘-’, respectively.




cultures of different M. synoviae strains. The presentwork also demonstrated that this technique has good

potential for identification of M. synoviae strains usingDNA extracted directly from tracheal swabs. Minormelting temperature variations were observed in thepeaks generated from swabs of birds in the same group.However, adjustment of the quantity of DNA templatesgreatly improved the consistency of the curves. DNA

sequencing of the representative amplicons also con-firmed the genotyping results from vlhA HRM curveanalysis and that the minor variations seen in betweenspecimens from the same group were not caused bydifferences in nucleotide sequence.

The identification of EAA was based on the outereggshell characteristics and egg candling in combination

with eggshell strength measurement. Eggs with EAA arecharacterized by an altered shell surface, which isconfined to the top cone of the egg. At candling a cleardemarcation zone separates the altered eggshell from the

normal part and the abnormal eggshell shows increasedtranslucency. Based on visual inspection, one single eggin the VNC group showed the visual characteristics of

EAA; however, the eggshell strength was not lowered (34N) and this egg was therefore not included in the results.Moreover, mycoplasma cultures of oviducts of this groupremained negative. Feberwee et al. (2009) previouslyshowed that production of eggs with EAA was stronglycorrelated with a mycoplasma culture positive oviduct.

Although M. synoviae vaccination significantly re-duced (P B0.05) the occurrence of eggs with EAA in thepresent study, its efficacy may have been underestimatedas in the experimental setting strong challenges with IBV

and/or M. synoviae (necessary to get significance usingsmall groups) may overwhelm the M. synoviae vaccine-induced immunity. Therefore, it would be interesting to

study the efficacy of this vaccine in a transmission modelwhere seeders and/or natural infection by aerosolare used. Such models have been used previously tostudy the effect of vaccination on the transmission of M. gallisepticum, mimicking more closely the situation inthe field (Feberwee et al ., 2006).

Acknowledgements

The authors thank Thea von Banniseht-Wysmuller forher technical assistance to this work. The work wasfunded by Bioproperties Pty Ltd. Funding to carry outvlhA-PCR HRM analysis and nucleotide sequencing was

provided by the Australian Poultry Cooperative ResearchCentre.

References

Alexander, D.J. & Chettle, N.J. (1977). Procedures for the haemagglu-

tination and haemagglutination inhibition tests for avian infectious

bronchitis virus. Avian Pathology, 6 , 9 Á 17.

de Wit, J.J., Mekkes, D.R., Kouwenhoven, B. & Verheyden, J.H.M.

(1997). Sensitivity and specificity of serological tests for detection of

infectious bronchitis virus-induced antibodies in broilers. Avian

Pathology, 26 , 105 Á 118.

Feberwee, A., Mekkes, D.R., de Wit, J.J., Hartman, E.G. & Pijpers, A.

(2005). Comparison of culture, PCR and different serological tests for

detection of Mycoplasma gallisepticum and M. synoviae infections.

Avian Diseases, 49, 260 Á 268.

Feberwee, A., von Bannisseht-Wysmuller, Th.E., Vernooij, J.C.M.,

Gielkens, A.L.J. & Stegeman, J.A. (2006). The effect of a live vaccine

on the horizontal transmission of Mycoplasma gallisepticum. Avian

Pathology, 35, 359 Á 366.

Feberwee, A., de Wit, J.J. & Landman, W.J.M. (2009). Induction of

eggshell apex abnormalities by Mycoplasma synoviae: field and

experimental studies. Avian Pathology, 38, 77 Á 85.

Finney, D. J. (1952). Statistical method in biological assay, 1st edn(pp. 524 Á 530). London: Charles Griffin and Co. Ltd.

Hannan, P.C. (2000). Guidelines and recommendations for antimicro-

bial minimum inhibitory concentration (MIC) testing against veter-

inary mycoplasma species. Veterinary Research, 31, 373 Á 395.

Jeffery, N., Gasser, R.B., Steer, P.A. & Noormohammadi, A.H. (2007).

Classification of Mycoplasma synoviae strains using single-strand

conformation polymorphism and high-resolution melting-curve ana-

lysis of the vlhA gene single-copy region. Microbiology, 153, 2679 Á

2688.

Kleven, S.H. (2003). Mycoplasma synoviae infection. In Y.M. Saif, H.J.

Barnes, J.R. Glisson, A.M. Fadly, L.R. McDougald & D.E. Swayne

(Eds.), Diseases of Poultry, 11th edn (pp. 756 Á 766). Ames: Iowa State

Press.

Kleven, S.H., Fletcher, O.J. & Davis, R.B. (1975). Influence of strain of

Mycoplasma synoviae and route of infection on development of

synovitis or airsacculitis in broilers. Avian Diseases, 19, 126 Á 135.

Landman, W.J.M. & Feberwee, A. (2001). Field studies on the

association between amyloid arthropathy and Mycoplasma synoviae

infection, and experimental reproduction of the condition in brown

layers. Avian Pathology, 30, 629 Á 639.

Landman, W.J.M. & Feberwee, A. (2004). Aerosol-induced Mycoplasma

synoviae arthritis: the synergistic effect of infectious bronchitis virus

infection. Avian Pathology, 33, 591 Á 598.

Landman, W.J.M., Mevius, D.J., Veldman, K.T. & Feberwee, A. (2008).

In vitro antibiotic susceptibility of Dutch Mycoplasma synoviae field

isolates originating from joint lesions and the respiratory tract of

commercial poultry. Avian Pathology, 37 , 415 Á 420.

Markham, J.F., Morrow, C.J. & Whithear, K.G. (1998a). Efficacy of a

temperature-sensitive Mycoplasma synoviae live vaccine. AvianDiseases, 42, 671 Á 676.

Markham, J.F., Scott, P.C. & Whithear, K.G. (1998b). Field evaluation

of the safety and efficacy of a tempertature-sensitive Myoplasma

synoviae live vaccine. Avian Diseases, 42, 682 Á 689.

Mekkes, D.R. & Feberwee, A. (2005). Real-time PCR for the qualitative

and quantitative detection of Mycoplasma gallisepticum. Avian

Pathology, 34, 348 Á 354.

Meynell, G.G. & Meynell, E. (1970). Theory in experimental bacteriol-

ogy, 2nd edn (pp. 232 Á 233). Cambridge: Cambridge University Press.

Morrow, C.J., Bell, I.G., Walker, S.B., Markham, P.F., Thorp, B.H. &

Whithear, K.G. (1990). Isolation of Mycoplasma synoviae from

infectious synovitis of chickens. Australian Veterinary Journal , 67 ,

121 Á 124.

Olson, N.O., Shelton, D.C., Bletner, J.K., Munro, D.A. & Anderson,G.C. (1956). Studies of infectious synovitis in chickens. The American

Journal of Veterinary Research, 17 , 747 Á 754.

Reed, L.J. & Muench, H. (1938). A simple method for estimating fifty

percent endpoints. American Journal of Hygiene, 27 , 493 Á 497.

Statistix† (2005). User’s Manual Analytical software version 8.0.

Tallahassee, Florida.

Stipkovits, L. & Kempf., I. (1996). Mycoplasmosis in poultry. Revue

Scienti fique et Technique (International Office of Epizootics), 15,

1495 Á 1525.

van Beek, P.N.G.M., Feberwee, A., Fabri, T.H.F. & Heijmans,

M.J.H.M. (2002). Longitudinal field study on the presence of

Mycoplasma synoviae in meat-turkey flocks with arthritis. In Pro-

ceedings of the 4th International Symposium on Turkey Diseases

(pp. 177 Á 178). Berlin, Germany.


ms ib_dr visu

Documents