mutations are the basis of

diversitywe will learn THIS:

[mutations happen and add diversity to a population. A/G, presence/absence,

red/white]

such diversity is temporary. in a finite population a single genetic

polymorphismwill eventually disappear

through drift, but selection, non-random mating, and migration

will modify that rate

sciencedaily.com

offspring = heredity

•bacteria, archaea divide (literally) into two daughter cells

•most eukaryotes make it more complicated: sexual reproduction

•DNA packed into chromatids

centromere

coiled DNA

•DNA packed into chromatids

•sister chromatids contain homologous stretches of DNA and bound at centromere

•each chromatid was inherited from different parent

•homologous regions (LOCUS or LOCI) found on each chromatid are ALLELES

• they may be different at one or more nucleotides or other forms of mutation

• so: LOCUS descended from single ancestral region of genome; ALLELES represent the diversity of that locus

ACTTCAGATACTTCAGAT ACTTCAGATACTTCAGAT

GGTCATATATGGTCATATAT GGTCAGGTCACCATATATAT

so: each sexually producedoffspring is unique because:

mutations AND

genetic recombination

this diversity is what weare exploring!

so: each sexually producedoffspring is unique because:

mutations AND

genetic recombination

this diversity is what weare exploring!

diversity•diversity of GENOTYPE (combination

of alleles at one or more LOCI) is one contribution to the organism PHENOTYPE (what it looks like, manifestation of genotype)

•genes are inherited; phenotype is complex, involving genotype at one or more loci AND environmental contributions

Gamete production

Independent assortment

Expected proportions andCombinations

some phenotypes depend almost entirely on genotypeat single locus

(illustrated by Punnett squares)

some phenotypes are not controlled by genotype

?

normal distributions

• “bell” curves, Gaussian, tend to have a mean (location of peak) and symmetric variance (the width of the distribution)

• why do we see it so much? why does it apply to quantitative traits?

• “central limit theorem”: sum of many random variables is distributed normally

18aa Aa AA

how do we find these many

genes?•human body height, flower corolla

length, many genes (quantitative) but where are they?

•quantitative trait loci (QTL)

•association studies allow us to find the markers that tend to be found in individuals with a given trait

LOD: log (ratio) of odds, e.g.

LOD of 2 means that a genetic

marker is 102 or 100 times more

likely associated with trait than not

meaning, marker and trait show up

together more often than

expected by chance

variation matters

•dominant, recessive, homozygosity, heterozygosity, allelic variation of all types

•important component of variation is the average effect of alleles (e.g. having allele GATGAT generates red pigment; GACGAT white pigment; heterozygotes are pink)

•allele symbol discussion: A is not dominant to a (necessarily), just traditional symbols, ANY SYMBOL COULD BE USED

additive genetic varianceadditive genetic variancesymbolized as Var(A)symbolized as Var(A)

variance in phenotype due to variance in phenotype due to average effects average effects of allelesof alleles

models

•all models are wrong

•some are useful

• science attempts to find the simplest set of interactions that explains the most complex observations

• “How do these genes combine to determine the phenotype of an individual? The simplest model is to assume that genes act additively with each other both within and between loci, but of course they may interact to show dominance or epistasis, respectively.”

– Hill et al. (2008) PLOS Genetics, showing that additive genetic variance comprises the largest component of genetic variance that contributes to phenotype, much more than gene interactions or allelic interactions

“additional resources” on wiki

chapter 5 is done

•you should understand mutational diversity

•what is a gene? a locus? an allele?

•how are phenotype and genotype related?

drift and selectionmoving into Ch 6

how fast can a population change?

•1969: French government starts spraying organophosphate insecticides along Mediterranean coast

how fast can a population change?•what we know so far: populations

are variable (traits, alleles)...some of this variation is heritable

•not all offspring survive; those that do can pass along heritable traits

•if you change the environment, the variation present may change in response

Nice, France

how fast can a population change?•1969: French government starts

spraying organophosphate insecticides along Mediterranean coast

•mosquito population fell dramatically but started growing again by 1972

•mosquitoes near coastline were resistant to insecticide!

Ester locus

•encodes enzyme esterase, can detoxify organophosphates, but not normally enough to tolerate insecticide

•allele called Ester1 produce more esterase

what connections can you make?

•Luria-Delbruck

•HIV example

•straight-up natural selection at work!

population genetics

•you cannot follow the fate of a single allele without reference to others

•the frequency of Ester1 increased in some locations (meaning frequency of others DOWN)

•we study allele frequencies through space and time, and what causes them to change

evolution = change

• if allele frequencies and genotype frequencies do not change, population is not evolving

• Hardy-Weinberg equilibrium requires a set of conditions so that population is not evolving

• (if population is evolving, one or more of these is NOT TRUE)...

• random mating with respect to locus/loci being studied

• population infinitely large (very big)

• no mutation (!)

• no selection/differential fitness

• no migration

“with respect to the loci being

studied”• the NULL hypothesis is the boring one: that you, as a scientist, are studying a portion of the genome that is of no evolutionary interest

•we KNOW some traits are important for fitness and evolution, but first must reject that null hypothesis

•example: GENE 3000 students and 810 numbers

allele frequencies

• if 9 out of 10 dentists chew sugarless gum, there are 2 types of dentists, one type at frequency 0.9, the other at frequency 0.1

• this is algebra: d1+d2 = 0.9 + 0.1 = 1

• any symbols may be used for alleles or allele frequencies, but frequencies sum to...

• ONE! (1) uno un ein etc.

• important: may be >2 alleles

genotype frequencies

•genotype is just the composition of alleles describing an individual

•if haploid, there is only one allele

•if diploid, there are 2

•above that, it gets complicated

genotype frequencies

•diploid individual genotype indicated for a locus by listing both alleles, e.g. A1A1 or A1A2

•genotype frequency is just the proportion of individuals with that genotype, AGAIN SUMMING TO ONE (1).

•A1A1 0.4, A1A2 0.5, A2A2 0.1; freqs sum to 1

• if Hardy-Weinberg holds, allele frequencies and genotype frequencies predict each other

probabilities• d1+d2 = 0.9 + 0.1 = 1

• independent assortment of alleles: father has probability 0.9 of contributing d1, 0.1 of d2

•mother same odds

• d1d1 genotype should be in 0.9x0.9=0.81 of offspring, d2d2 in 0.01, what about heterozygotes?