nadila haryani bt osman_3130198_a comparison between using
TRANSCRIPT
![Page 1: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/1.jpg)
A COMPARISON BETWEEN USING PERIPHERAL WHOLE
BLOOD AND BUCCAL SWAB FOR RED CELL GENOTYPING
AMONGST MULTIPLY-TRANSFUSED THALASSAEMIA
PATIENTS
Nadila Haryani Binti Osman
UNIVERSITI SAINS ISLAM MALAYSIA
![Page 2: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/2.jpg)
A COMPARISON BETWEEN USING PERIPHERAL WHOLE
BLOOD AND BUCCAL SWAB FOR RED CELL GENOTYPING
AMONGST MULTIPLY-TRANSFUSED THALASSAEMIA
PATIENTS
Nadila Haryani Binti Osman
(Matric No. 3130198)
Thesis submitted in fulfilment for the degree of
MASTER OF SCIENCE
Faculty of Medicine and Health Sciences
UNIVERSITI SAINS ISLAM MALAYSIA
Nilai
May 2016
![Page 3: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/3.jpg)
AUTHOR DECLARATION
I hereby declare that the work in this thesis is my own except for quotations and
summaries which have been duly acknowledged.
Date: 17th
May 2016 Signature:
Name: Nadila Haryani Bt Osman
Matric No: 3130198
Address: No. 40, Jalan Mawar 3,
Taman Air Mawang,
73100 Johol,
Negeri Sembilan Darul Khusus.
![Page 4: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/4.jpg)
ii
BIODATA OF AUTHOR
Nadila Haryani Bt Osman (3130198) was born on the 17th
May 1987. She previously
was a student of Management and Science University (MSU) and obtained the
Diploma in Medical Laboratory Technology and the Bachelor in Biomedical Science
(Hons) from the Faculty of Health and Life Sciences. After earning her first degree,
she worked as a Temporary Research Assistant at the Institute of Public Health, Kuala
Lumpur and then as a Temporary Research Officer at the Department of
Haematology, Ampang Hospital in Selangor. She is at present a master student of
Universiti Sains Islam Malaysia (USIM) under the Faculty of Medicine & Health
Sciences.
![Page 5: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/5.jpg)
iii
ACKNOWLEDGEMENTS
Alhamdulillah, all praise to Allah S.W.T who is the most Gracious, most
Compassionate for giving me the strength, wisdom and perseverance to endure all
problems encountered during my Masters journey. This thesis may have never seen
the light without the help of many generous people.
My sincerest appreciation must go to my supervisor, Dr. Asral Wirda Binti Ahmad
Asnawi, who bravely took the risk of supervising me as her first master student who
has always given her problems from the first day of being under her supervision until
the end of my Masters journey. Many thanks for her brilliance, guidance, advice,
patience and constant care; which I am grateful to have received from her and it will
be a priceless experience that I will never forget. We faced many obstacles at the
beginning and today, we managed to solve it all, together. Surely I will miss all of the
moments.
Special thanks to my respected co-supervisors, Prof. Datuk Dr. Ainoon Binti Othman
and Assoc. Prof. Dr. Noor Fadzilah Binti Zulkifli for their guidance, help and
constructive comments during the conduct of my study. It was a great and valuable
experience having you that are knowledgeable and have a lot of experience in the
research field.
My thanks is also extended to the co-researchers, Assoc. Prof Dr. Leong Choi Fun &
Assoc. Prof Dr. Raja Zahratul Azma Binti Raja Sabudin from the Pathology
Department, Faculty of Medicine, UKMMC and Dr. Jameela Binti Sathar from the
Haematology Department, Hospital Ampang for giving me permission to conduct this
study that involved their patients and using the facilities at the designated venue of
study. Thank you also to all staffs at the Blood Bank and Thalassaemia Clinic of
Hospital Ampang and also staffs at the Molecular Unit, UKMMC in helping me to
collect the samples and guiding me in doing the lab works. I am also thankful to all
the study participants and volunteers that were involved in this study. Without their
willingness, this study would be meaningless.
To the Ministry of Higher Education (MOHE) Malaysia, thank you for the scholarship
and project funding. Without these two financial sources, I would have never been
able to finish my Masters course on time. To FPSK USIM‟s staff, especially to the lab
staffs and other lecturers who have always helped and motivated me during my time
of need, thank you very much.
My utmost thanks is also dedicated to all my fellow colleagues especially to my best
“partners-in-crime” in the research lab, Atikah, Zahidah and Syahida and my one and
only senior, Asmalita for the bond of friendship, the wholesome working environment
and assistance throughout my toughest days in USIM. Thank you all for being great
companions and friends in need.
![Page 6: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/6.jpg)
iv
Finally yet importantly, I would like to convey my deepest thanks to my family for
their love, support and never-ending prayers.
Now it‟s time for me to move on and think about my future. Being amongst the
pioneer batch of postgraduate study of the faculty is quite challenging and the
experience while studying here taught me the meaning of life. I really hope that this
thesis is not just being evaluated as a thesis only but actually as something valuable
that can give benefit in the future. Last but not least, to those who have made
contributions directly or indirectly and cannot all be named, thank you very much.
May Allah S.W.T bless your life. I love you all.
Sincerely,
Nadila Haryani Binti Osman
17th
May 2016.
![Page 7: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/7.jpg)
v
ABSTRAK
Darah sentiasa menjadi sampel utama dalam penentuan pelbagai jenis kumpulan
darah. Walau bagaimanapun, pada pesakit yang berulang kali menjalani transfusi,
penentuan sel darah merah yang tepat daripada kaedah serologi menjadi masalah yang
berterusan disebabkan oleh pendedahan kepada darah penderma di dalam badan
pesakit yang membuatkan keputusan tidak boleh dipercayai. Untuk mengatasi masalah
ini, sumber dan teknik lain diperlukan dalam penentuan jenis darah. Tujuan utama
kajian ini adalah untuk mengkaji genotip sel darah untuk RH (C, c, E, e), KEL (Kell,
Celano), Kidd (JKA, JKB) dan Duffy (FYA, FYB) dengan menggunakan calitan sel
pipi dan darah periferi di kalangan pesakit talasemia yang berulang kali transfusi.
Enam puluh tiga pesakit talasemia yang berulang kali transfusi dari Klinik Talasemia
Hospital Ampang dan Pusat Perubatan Universiti Kebangsaan Malaysia telah
mengambil bahagian di dalam kajian ini. Sampel berpasangan yang terdiri daripada
darah periferi dan calitan sel pipi telah dikumpulkan sebelum pemindahan darah yang
telah dijadualkan dan pada hari ke 7 selepas pemindahan darah. Sampel darah
tertakluk kepada serologi fenotip dengan kaedah tiub dan DNA genotip manakala
calitan sel pipi adalah tertakluk kepada DNA genotip sahaja. Genotip darah dilakukan
dengan menggunakan kaedah cerakinan TaqMan® polimorfisme nucleotida tunggal
tindak balas berantai polimerase masa sebenar (SNP RT-PCR) untuk sistem kumpulan
darah RhEe, RHCc, KEL, Kidd dan Duffy. Data yang lengkap hanya diperolehi
daripada 33 pesakit sahaja. Perbezaan keputusan didapati di antara keputusan fenotip
dan genotip untuk semua kumpulan darah yang diuji di dalam kedua-dua jenis sampel
sebelum dan selepas transfusi. Walau bagaimanapun, keputusan genotip di antara
sampel sebelum dan selepas transfusi didapati sepadan. Apabila membandingkan
keputusan genotip daripada kaedah persampelan yang berbeza, didapati keputusan
daripada sampel darah dan sampel calitan pipi adalah sepadan. Penentuan profil
antigen sel darah yang tepat adalah penting untuk pesakit yang memerlukan transfusi
yang kerap. Platform SNP RT-PCR adalah alternatif kepada kaedah konvensional
yang boleh dipercayai. Sampel calitan sel pipi menawarkan alternatif kepada kaedah
pengumpulan yang mudah dan murah yang boleh digunakan untuk menentukan
kumpulan darah yang tepat apabila sampel darah tidak menyediakannya.
![Page 8: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/8.jpg)
vi
ABSTRACT
Blood has always been the main sample in determining the different blood group
types. However, in multiply-transfused patients, accurate red cell antigen typing by
serology is a constant problem due to the exposure to donor‟s blood in patient‟s
circulation making results unreliable. To overcome these problems, another source
and technique for blood typing is needed. The main aim of this study was to
investigate the genotype of red cells for RH (C, c, E, e), KEL (Kell, Celano), Kidd
(JKA, JKB) and Duffy (FYA, FYB) using buccal swab and peripheral whole blood
amongst multiply-transfused thalassaemia patients. Sixty-three of multiply-transfused
thalassaemia patients from the Thalassaemia Clinic of Ampang Hospital and
Universiti Kebangsaan Malaysia Medical Centre participated in this study. Paired
samples consisting of peripheral whole blood and buccal swab samples were collected
prior to the scheduled blood transfusion and on day 7 after the transfusion. Blood
samples were subjected to serological phenotyping by tube method and DNA
genotyping while buccal swab was subjected to DNA genotyping only. Blood
genotyping was performed using TaqMan® Single Nucleotide Polymorphism Real
Time Polymerase Chain Reaction (SNP RT-PCR) assays for RHEe, RHCc, Kidd,
KEL and Duffy blood group systems. Complete data was available in 33 patients only.
Discrepancies were found between the phenotype and genotype results for all blood
groups tested in both pre- and post-transfusion samples. However, a full concordance
of genotyping result between pre- and post-transfusion samples was observed. When
comparing the genotyping results between different sampling methods, blood and
buccal swab samples showed concordant results. Accurate red blood cell antigen
profiling is important for patients requiring multiple transfusions. The SNP RT-PCR
platform is a reliable alternative to the conventional method. Buccal samples offer a
simple and inexpensive alternative collection method that may be used for accurate
blood group genotyping when blood samples are unavailable.
![Page 9: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/9.jpg)
vii
ثملخص البح
ؼتبش اذ اؼ اشئست استخذت فى تحذذ فصائ اذ اختفت، غ ره فتحذذ
اجس اعاد خالا اذ احشاء ػ غشك االصاي فى اشظى از ؼا
ره بسبب اتؼشض ذ اشخص اتبشع م اذ اتىشس شىت دائت ،
حممت، تغب ػى ز اشىت البذ اتائج غشفى اذسة اذت ا جؼ
اذف اشئس اذساست تمت جذذة تحذذ فصائ اذ. صذس آخش
اتؼشف ػى اشوب اساث ؼا اشصس خالا اذ احشاء باستخذا اسحت
ػت . م اتىشس ذاشذلت ػاث اذ شظى اثالسا از ؼا ا
( حا شظى اثالسا از ؼا م اذ 36اذساست ثالثت ست )
اتىشس )ت تجغ احاالث اؼاداث اتخصصت ف ستشفى االباك اشوض
ػت ,اطب جاؼت ااض اغت( حث ت تجغ ػت و شط
لب ػت م اذ تىشاس ره بؼذ ػت ام ,اسحت اشذلت اذ ػت
ت تح اػ اظاشي ؼاث اذ باطشمت االببت وا ت اتح بسبؼت اا.
اساث حط اي. باسبت ؼاث ات ت أخزا ػ غشك اسحت اشذلت
وا ت اجشاء اتح اساث ؼاث اذ ت اتح اساث حط اي فمػ ،
SNP RT-PCR) (TaqManباستخذا ®
) (RHEeRHCc)) فحص
( Kidd) ( KEL)جػت اذ Duffy) ( ةت تجغ ابااث ؼذد الث ث
ون الث باءا ػى اتائج وا ان تفاث ب تائج اتح حات فمػ. (66) وث
اساث تح اػ اظاشي جغ فصائ اذ ات ت تحا لب بؼذ ام.
ى وا ان تافك ف تائج اتح اساث ؼاث لب بؼذ ام. ػذ ماست
ا اذ ػاث اسح اشذلت تائج اتح اساث ب اؼاث ات ت جؼ
وا ان تافك ف اتائج. اتحذذ اذلك عاداث خالا اذ احشاء ظشسي
( ؼتبش بذ (SNP RT-PCR. شظى از حتاج م اذ بصفت تىشسة
اسحت اشذلت تؼتبش غشمت ست سخصت ى ,ثق طشق اتمذت
تحذذ اساث اذلك فصائ اذ ػذا ال تتفش ػاث د.استخذاا
![Page 10: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/10.jpg)
viii
CONTENT PAGE
Contents Page
AUTHOR DECLARATION i
BIODATA OF AUTHOR ii
ACKNOWLEDGEMENTS iii
ABSTRAK v
ABSTRACT vi
MULAKHKHAS AL-BAHTH vii
CONTENT PAGE viii
LIST OF TABLES xiv
LIST OF FIGURES xvi
LIST OF APPENDICES xvii
ABBREVIATION xviii
CHAPTER I: INTRODUCTION 20
1.1 BACKGROUND OF THE STUDY 20
1.2 OBJECTIVES OF THE STUDY 24
1.2.1 General objective 24
1.2.2 Specific objectives 24
1.3 RESEARCH HYPOTHESES 25
CHAPTER II: LITERATURE REVIEW 26
2.1 BLOOD GROUPS 26
2.1.1 Rhesus blood group 28
2.1.1.1 Antigens and antibodies 29
2.1.1.2 Genetics and biochemistry 33
2.1.2 KEL blood group 35
2.1.2.1 Antigens and antibodies 35
2.1.2.2 Genetics and biochemistry 38
2.1.3 Kidd blood group 39
2.1.3.1 Antigens and antibodies 40
2.1.3.2 Genetics and biochemistry 41
2.1.4 Duffy blood group 42
2.1.4.1 Antigens and antibodies 43
![Page 11: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/11.jpg)
ix
2.1.4.2 Genetics and biochemistry 44
2.2 THALASSAEMIA: DEFINITIONS AND BACKGROUND 47
2.3 RBC IMMUNIZATION IN THALASSAEMIA 49
2.4 DETERMINATION OF BLOOD GROUP ANTIGENS 51
2.4.1 The haemagglutination technique 51
2.4.2 Red blood cell genotyping by molecular analysis 54
2.4.2.1 Assays based on conventional PCR (low-throughput) 55
2.4.2.2 Medium to high-throughput PCR 57
2.4.2.2.1 Single Nucleotide Polymorphisms Real-
Time Polymerase Chain Reaction (SNP RT-
PCR) 57
2.5 BUCCAL CELLS AS AN ALTERNATIVE SAMPLE SOURCE FOR
GENETIC STUDIES 61
CHAPTER III: RESEARCH METHODOLOGY 65
3.1 STUDY DESIGN 65
3.2 POPULATIONS STUDY 66
3.2.1 Study subjects 66
3.2.1.1 Subjects selection 66
3.2.1.2 Inclusion criteria 66
3.2.1.3 Exclusion criteria 67
3.2.1.4 Sample size calculation 67
3.2.2 Control group 68
3.2.2.1 Control selection 68
3.2.2.2 Inclusion criteria 68
3.2.2.3 Exclusion criteria 68
3.2.2.4 Sample size calculation 69
3.3 ETHICAL CONSIDERATION AND FUNDING 69
3.4 SAMPLING METHODS 69
3.4.1 Preparation before sampling 69
3.4.1.1 Blood sample collection 69
3.4.1.2 Buccal swab sample collection 70
3.4.2 Sampling on study subjects 70
3.4.2.1 Day 0 sampling: before transfusion 70
3.4.2.2 Day 7 sampling: 1 week post-transfusion 70
3.4.3 Sampling on control group 71
3.5 LABORATORY METHODS 72
3.5.1 Serological test using peripheral whole blood 72
3.5.1.1 Procedure for wash packed red cells 73
3.5.1.2 Procedure for preparation of 4% red cell suspension 73
3.5.1.3 Procedure for forward blood group test (tube method) 74
![Page 12: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/12.jpg)
x
3.5.1.4 Procedure for reverse blood group test (tube method) 74
3.5.1.5 Procedure for antibody screening (tube method) 74
3.5.1.6 Procedure of red cell phenotype by Direct Antiglobulin
Test method for Rhesus, Kidd and Kell phenotype 75
3.5.1.7 Procedure of red cell phenotype by Indirect
Antiglobulin Test method for Cellano and Duffy
phenotype 75
3.5.1.8 Procedure for Direct Coombs test 76
3.5.1.8.1 Polyspecific AHG 76
3.5.1.8.2 Monospecific Anti-IgG 76
3.5.1.8.3 Monospecific Anti-C3d 76
3.5.1.9 Test reaction 77
3.5.2 Molecular technique 77
3.5.2.1 DNA extraction 77
3.5.2.1.1 Peripheral whole blood sample 77
3.5.2.1.2 Buccal swab sample 79
3.5.2.1.2.1 Preparation of Phosphate
Buffered Saline (PBS) 10X 79
3.5.2.1.2.2 Preparation of Phosphate
Buffered Saline (PBS) 1X 80
3.5.2.1.2.3 Procedure of DNA extraction
from buccal swab samples 80
3.5.2.2 DNA quantification 82
3.5.2.3 Conventional Polymerase Chain Reaction (PCR)
methodology 82
3.5.2.3.1 Buffers and solutions 82
3.5.2.3.1.1 Tank buffer and gel buffer 82
3.5.2.3.2 2% Agarose gel preparation 82
3.5.2.3.3 BAGene DNA-SSP Kits – Conventional
PCR 83
3.5.2.3.4 PCR cycling program 84
3.5.2.3.5 Gel electrophoresis 85
3.5.2.3.6 Documentation and interpretation of result 85
3.5.2.4 Single Nucleotide Polymorphisms Real Time –
Polymerase Chain Reaction (SNP RT-PCR)
methodology 86
3.5.2.4.1 Selection of suitable assay for SNP RT-PCR
methodology 86
3.5.2.4.2 TaqMan® SNP genotyping assay 88
![Page 13: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/13.jpg)
xi
3.5.2.4.2.1 Custom TaqMan® SNP
genotyping assay – RHCE and
KEL blood group antigens 91
3.5.2.4.2.2 Pre-Designed TaqMan® SNP
genotyping assay – Kidd and
Duffy blood group antigens 93
3.5.2.4.3 TaqMan® GTXpress
™ master mix 94
3.5.2.4.4 PCR reaction mix components 95
3.5.2.4.5 PCR cycling program 95
3.5.2.4.6 Interpretation of results 96
3.5.2.4.7 Sequencing 97
3.6 DATA COLLECTION 98
3.7 DATA ANALYSIS 98
CHAPTER IV: FINDINGS 100
4.1 RESULTS FOR STUDY SUBJECTS 100
4.1.1 Demographic data 100
4.1.2 Frequency of ABO, RHD blood group, antibody screening and
Direct Coombs Test. 101
4.1.3 Frequency of transfusion and types of red blood cell product
transfused 103
4.1.4 Red cell phenotype using peripheral blood: pre- and post-
transfusion samples 105
4.1.5 Blood group genotype by SNP RT-PCR using peripheral blood:
pre- and post-transfusion samples 107
4.1.6 Blood group genotype by SNP RT-PCR using peripheral blood
and buccal swab: pre-transfusion sampling 109
4.1.7 Phenotype-genotype frequencies detected on pre-transfusion
peripheral blood samples 111
4.1.8 Phenotype-genotype frequencies detected on post-transfusion
peripheral blood samples 112
4.1.9 Correlation of blood group genotype results between peripheral
blood and buccal swab samples: pre-transfusion sampling 114
4.1.10 Correlation between phenotype and genotype results 115
4.1.10.1 Phenotype-genotype discrepancies of pre-transfusion
sampling 115
4.1.10.2 Phenotype-genotype discrepancies of post-transfusion
sampling 117
4.1.11 Prevalence of donor leukocyte contamination in post-transfusion
peripheral blood samples 119
![Page 14: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/14.jpg)
xii
4.1.12 Comparison of DNA yields and purity between buccal swab and
peripheral blood samples 120
4.2 RESULTS FOR CONTROL GROUP 121
4.2.1 Demographic data 121
4.2.2 PCR results 122
4.2.2.1 Conventional results 122
4.2.2.2 SNP RT-PCR results 127
4.2.2.2.1 Results for RH C/c blood group system by
using different assay names and IDs 128
4.2.2.2.2 Sequencing results 130
4.2.3 Phenotype-genotype frequencies using peripheral blood samples
133
4.2.4 Blood group genotype frequencies between peripheral blood and
buccal swab samples by conventional PCR and SNP RT-PCR 134
4.2.5 Comparison of DNA yields and quality between buccal swab and
peripheral blood samples 135
CHAPTER V: ANALYSIS AND DISCUSSIONS 137
5.1 INTRODUCTION 137
5.2 DEMOGRAPHIC DATA 139
5.3 THE IMPORTANCE OF DOING PATIENTS‟ EXTENDED RED CELL
BLOOD GROUP GENOTYPE 142
5.3.1 Primer designation for determination of RHCcEe and KEL blood
group antigens 143
5.3.2 Primer designation for determination of Kidd and Duffy blood
group antigens 144
5.4 CORRELATION BETWEEN PHENOTYPE AND GENOTYPE
RESULTS IN PRE- AND POST-TRANSFUSION SAMPLES 145
5.5 THE USEFULNESS OF SNP MOLECULAR GENOTYPING IN
RESOLUTION OF PHENOTYPE DISCREPANCIES ISSUES 150
5.6 BUCCAL SWAB AS AN ALTERNATIVE SOURCE IN BLOOD
GENOTYPING 153
CHAPTER VI: CONCLUSIONS AND RECOMMENDATIONS 156
6.1 LIMITATIONS 157
6.1.1 Samplings 157
6.1.2 Methodology 157
BIBLIOGRAPHY 159
APPENDIX A: ETHICAL APPROVAL LETTER FROM MEDICAL
RESEARCH ETHICAL COMMITTEE (MREC) 170
![Page 15: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/15.jpg)
xiii
APPENDIX B: ETHICAL APPROVAL LETTER FROM UNIVERSITI
KEBANGSAAN MALAYSIA MEDICAL CENTRE (UKMMC) 171
APPENDIX C: PATIENT INFORMATION SHEET AND CONSENT FORM
172
APPENDIX D: BAGene DNA-SSP KITS WORKSHEET AND EVALUATION
DIAGRAM 175
APPENDIX E: LIST OF PRESENTATIONS 177
APPENDIX F: AWARDS & ACHIEVEMENTS 179
Best Paper Award 179
Young Scientist Award Competition 180
Young Investigator‟s Award 181
APPENDIX G: PROCEEDINGS / PUBLICATIONS 182
Malaysian J Pathol 2015; 37(2): pp. 198 182
Malaysian J Pathol 2014; 36: Supplement A: pp. 63. ISSN 0126-8635 183
Malaysian J Pathol 2014; 36: Supplement A: pp. 102-103. ISSN 0126-8635 184
Journal of Contemporary Issues and Thought, Vol 6, 2016. 186
![Page 16: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/16.jpg)
xiv
LIST OF TABLES
Page
Table 2.1: Blood group systems acknowledged by the International Society of
Blood Transfusion 27
Table 2.2: Frequency of Rh antigens 29
Table 2.3: Possible haplotype arrangements of Rh genes by Fisher-Race
Terminology 30
Table 2.4: Wiener‟s Rh Terminology 31
Table 2.5: Rh types by Three Nomenclatures 32
Table 2.6: Five major Rh antigens in four nomenclatures 33
Table 2.7: KEL blood group system phenotypes and prevalence 37
Table 2.8: Phenotypes and frequencies in the Kidd system 40
Table 2.9: Frequencies of Duffy phenotypes 44
Table 2.10: Frequencies of antibodies amongst repeatedly-transfused thalassaemia
patients of Hospital Ampang, Malaysia 47
Table 2.11: Correlation between fluorescence signals and sequences 59
Table 3.1: Composition of the master mix depending on the number of reaction
mixes 84
Table 3.2: PCR Cycling Program using BAGene DNA-SSP Kits 85
Table 3.3: Specifics of selected genotyping assays 89
Table 3.4: Assay for RHCc blood group antigens (1) 92
Table 3.5: Assay for RHCc blood group antigens (2) 92
Table 3.6: Assay for RHEe blood group antigens 93
Table 3.7: Assay for KEL blood group antigens 93
Table 3.8: Assay for Kidd blood group antigens 94
Table 3.9: Assay for Duffy blood group antigens 94
Table 3.10: PCR reaction mix components 95
Table 3.11: PCR Cycling Program for Applied Biosystems® 7500 Fast Real Time
PCR Systems 96
Table 3.12: Data domains that were collected in this study 98
Table 4.1: Types of thalassaemia according to race 101
Table 4.2: Phenotypic frequencies of blood group in ABO and Rhesus system
according to gender 102
Table 4.3: Antibody screening and DCT results 103
Table 4.4: Frequency of transfusion 104
Table 4.5: Blood group phenotype frequencies on pre- and post-transfusion using
peripheral blood samples 107
![Page 17: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/17.jpg)
xv
Table 4.6: Blood group genotype frequencies on pre- and post-transfusion of
peripheral blood samples by using SNP RT-PCR method 108
Table 4.7: Blood group genotype frequencies which were determined on
peripheral blood and buccal swab pre-transfusion samples (D0) by
using SNP RT-PCR 110
Table 4.8: Phenotype-genotype frequencies for pre-transfusion peripheral blood
samples 112
Table 4.9: Phenotype-genotype frequencies for post-transfusion peripheral blood
samples 114
Table 4.10: Genotype result between pre-transfusion peripheral blood and buccal
swab samples 115
Table 4.11: Discrepancies of red cell blood group detected between serology and
SNP RT-PCR method for pre-transfusion peripheral blood samples 117
Table 4.12: Discrepancies of red cell blood group detected between serology and
SNP RT-PCR method for post-transfusion peripheral blood samples 119
Table 4.13: Blood genotype result of pre- and post-transfusion peripheral blood
samples 120
Table 4.14: Comparison of DNA yields and purity according to different types of
samples 121
Table 4.15: List of Allele 1 and Allele 2 for RH E/e, Kidd, Duffy and KEL blood
group system 128
Table 4.16: List of Allele 1 and Allele 2 for RH C/c blood group system 130
Table 4.17: List of the blood group results based on the SNP sequences 132
Table 4.18: Phenotype-genotype frequencies using peripheral blood samples 133
Table 4.19: Genotype frequencies between peripheral blood and buccal swab
samples 135
Table 4.20: Comparison of DNA yields and quality between buccal swab and
peripheral blood samples 136
![Page 18: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/18.jpg)
xvi
LIST OF FIGURES
Page
Figure 2.1: The Rh genes, showing the 10 exons of RHD and RHCE in opposite
orientation on the chromosome, SMP1 in between and Rh boxes
flanking RHD. 34
Figure 2.2: The D and CcEe polypeptides span the membrane 12 times and have
internal N- and C-termini and 6 extracellular loops. The amino acid
substitutions for C/c polymorphism in the second loop and E/e
polymorphism in fourth loop. 35
Figure 2.3: Kell and Kx proteins 38
Figure 2.4: Domain structure of Kidd transporter. 42
Figure 2.5: Domain structure of Duffy protein. 45
Figure 2.6: The complementary TaqMan® probe fluoresces after anneals to the
template and after cleavage by AmpliTaq Gold DNA Polymerase, Ultra
Pure (UP). 60
Figure 3.1: Workflow of the study subjects 71
Figure 3.2: Workflow of the control group 72
Figure 3.3: Information searching from the NCBI website for selection of the
suitable assay 87
Figure 3.4: Workflow of searching the assay type 90
Figure 3.5: Interpretation of the SNP result 97
Figure 4.1: Distribution of the study subjects according to gender and race 101
Figure 4.2: Phenotypic frequencies of blood group in ABO and Rhesus system 102
Figure 4.3: Frequency of transfusion based on types of thalassaemia 104
Figure 4.4: Types of red blood cell product received during transfusion 105
Figure 4.5: Distribution of the control groups according to gender and race 122
Figure 4.6: Conventional result by BAGene DNA SSP-Kits 123
Figure 4.7: SNP RT-PCR allelic plot results 128
Figure 4.8: SNP RT-PCR allelic plot results for RH C/c (rs45493401) 129
Figure 4.9: SNP RT-PCR allelic plot results for RH C/c (rs676785) 129
Figure 4.10: Construct map for the cloning process 130
Figure 4.11: Detailed sequence of the whole construct 131
![Page 19: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/19.jpg)
xvii
LIST OF APPENDICES
Page
A Ethical Approval Letter From Medical Research Ethical
Committee (MREC)
170
B Ethical Approval Letter From Universiti Kebangsaan
Malaysia Medical Centre (UKMMC)
171
C Patient Information Sheet and Consent Form 172
D BAGene DNA-SSP Kits Worksheet and Evaluation Diagram 175
E List of Presentations 177
F Awards & Achievements 179
G Proceedings/Publications 182
![Page 20: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/20.jpg)
xviii
ABBREVIATION
% percent
≥ More than
µl microliter
L Litre
ml millilitre
ng nanogram
nm nanometre oC degree celcius
Tm melting temperature
V volt
V/cm volt per centimetre
α Alpha
β Beta
AABB American Association of Blood Banks
AET 2-aminoethylisothiouronium
AHG Anti Human Globulin
AIHA Autoimmune Haemolytic Anaemia
AS-PCR Allele Specific Polymerase Chain Reaction
BCPPC Buffy-Coat Poor Packed Cells
bp base pair
CCC Coombs Control Cell
DARC Duffy Antigen Receptor for the chemokines
DAT Direct Antiglobulin Test
DCT Direct Coombs Test
DTT Dithiothreitol
DHTR Delayed Haemolytic Transfusion Reaction
DNA Deoxynucleic Acid
ERGS Exploratory Research Grant Scheme
FBC Full Blood Count
FRBC Filtered Red Blood Cells
G6PD Glucose-6-Phosphate Dehydrogenase
gDNA genomic DNA
GVHD Graft-versus-host disease
HDFN Haemolytic Disease of Fetus and Newborn
HLA Human Leukocyte Antigen
HTR Haemolytic Transfusion Reaction
IgG Immunoglobulin G
IgM Immunoglobulin M
IS Intermediate Spin
ISBT International Society of Blood Transfusion
K2EDTA di-potassium ethylenediaminetetraacetic acid
kbp kilobasepair
KCl Potassium Chloride
KH2PO4 Monopotassium Phosphate
![Page 21: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/21.jpg)
xix
LISS Low Ionic Strength Solution
LR Leukocyte Reduced
MALDI-TOF MS Matrix-assisted laser desorption/ionization time-of-flight mass
spectrometry
MC microchimerism
MGB Minor Groove Binder
MNPs Multinucleotide polymorphisms
MOHE Ministry of Higher Education
MREC Medical Research Ethical Committee
Na2HPO4.7H2O Sodium Monohydrogen Phosphate Heptahydrate
NaCl Natrium Chloride
NFQ Non-Fluorescent Quencher
NHFTR Nonhemolytic febrile transfusion reactions
PBS Phosphate Buffered Solution
PC Packed Cell
PCR Polymerase Chain Reaction
PCR-SSP Polymerase Chain Reaction – Sequence Specific Priming
PPUKM Pusat Perubatan Universiti Kebangsaan Malaysia
RBC Red Blood Cell
RFLP Restriction Fragment Length Polymorphism
Rh Rhesus
RM Ringgit Malaysia
rpm revolution per minute
SNP Single Nucleotide Polymorphism
SNP-RT PCR Single Nucleotide Polymorphism- Real Time Polymerase Chain
Reaction
SPSS Statistical Package for the Social Science
TA-MC Transfusion-associated microchimerism
U/µl Unit per microliter
UKMMC Universiti Kebangsaan Malaysia Medical Centre
UP Ultra-Pure
USIM Universiti Sains Islam Malaysia
UV Ultraviolet
WBC White Blood Cell
xg relative centrifugal force
![Page 22: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/22.jpg)
20
CHAPTER I
INTRODUCTION
1.1 BACKGROUND OF THE STUDY
Thalassaemia is a common haemoglobin disorder in Malaysia and is considered a
major public health problem. This disease is caused by the reduction or absent
production of haemoglobin chain and patients suffers from the effects of chronic
anaemia. Life-long red blood cell (RBC) transfusions are the recommended treatment
for thalassaemia. However, repeated exposure to donor RBC provokes the patient‟s
immune system to produce antibodies towards the donor‟s red cell surface antigens
that it does not recognize placing the patients at risk of alloimmunization, a part from
other complications (Sadeghian et al., 2009). Alloimunization is a response by the
body‟s immune system to infusion of donated blood, bone marrow or a transplanted
organ from another individual, where the recipient‟s body will develop antibody, the
proteins that attack and destroy foreign substances that target the donated material.
Alloimmunization to red cell antigens is one of clinical importance in the practice of
transfusion. Because of the large number of polymorphic antigens and the large
number of epitopes on each antigen, every red cell transfusion will introduce many
foreign alloantigens resulting in antibody formation. These antibodies may cause
destruction of red cells. This form of haemolysis is immune-mediated whereby the
transfused donor red cells are attacked by the antibodies formed by the recipient from
![Page 23: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/23.jpg)
21
the previous transfusion (Vamvakas & Blajchman, 2009) and further complicates
management of thalassaemia patients as it limits the availability as well as the safety
of subsequent RBC transfusions (George, 2013). For repeatedly-transfused patients,
supplying blood that matches beyond ABO and RhD type is a necessity (Vamvakas &
Blajchman, 2009). The current practice in hospitals in Malaysia is to supply blood
according to the blood group phenotype A, B, O, AB and according to the presence or
absence of the RHD phenotype. More than 98% of the Malaysian population are RHD
positive. Nevertheless, most hospital blood banks are not capable of providing an
extended phenotype-match of the KEL, Kidd and Duffy blood group antigens on a
routine basis, especially to patients that require repeated red cell transfusions to
survive (Malaysia, 2009).
To date, The International Society of Blood Transfusion (ISBT) has acknowledged 35
blood group systems with more than 300 blood group antigens described on the
surface of the human red cell that are encoded by various alleles (Anstee, 2009;
Transfusion, 2015). More blood group antigens are added from time to time. Some of
these antigens stimulate antibodies of clinical significance by causing haemolytic
transfusion reactions, fetal and neonatal anaemia and in some instances autoimmune
haemolytic anaemia. Blood group antigens that are usually implicated are ABO, RH,
KEL, Duffy and Kidd (Klein & Anstee, 2006; Higgins & Sloan, 2008; Transfusion,
2015). In certain populations, specific antibodies are more often seen due to the
different antigen frequencies observed within the populations. Supplying the accurate
phenotyping of blood group antigen is necessary to prevent alloimmunization from
occurring in susceptible patients.
![Page 24: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/24.jpg)
22
Red cell antigen profile can be determined by serological and molecular methods. For
many years, the agglutination method has been the gold standard for red blood cell
antigen detection. The method relies on the use of monoclonal antibodies designed to
detect specific epitopes of the red cell antigen on its surface. A positive test will result
in agglutination or haemolysis. However, haemagglutination has many limitations.
This is seen in patients that have been recently or multiply-transfused with donor red
cells where the results may not be reliable (Reid et al., 2000; Rožman et al., 2000;
Castilho et al., 2002a; Castilho et al., 2002b; Ribeiro et al., 2009; Guelsin et al., 2010).
Accurate phenotyping of red cells amongst these patients are problematic due to the
presence of transfused donor red cells in the circulation of the recipient (Reid &
Yazdanbakhsh, 1998) unless phenotyping is performed prior to the initiation of
transfusion. Serological determination of red cell genotype is also unreliable in
individuals with a positive Direct Coombs Test (DCT) (Monteiro et al., 2011) due to
in-vivo sensitization. These can be the sign that the conventional serological method
by haemagglutination in determining the presence of blood group phenotype and
hence assuming its genotype is no longer reliable in multiply-transfused individuals.
Thus, RBC genotyping by DNA analysis is the only approach (Anstee, 2009).
Currently, the molecular basis of almost all the major blood group antigens has been
determined. The blood group genotype reflects antigen expression on the red cell,
which is the phenotype. The molecular identification and characterization of blood
group genes has made it possible to predict blood group phenotypes of clinically
important blood group antigens from tests on genomic DNA with a high degree of
accuracy (Westhoff, 2006; Moulds, 2010). Methods for Polymerase Chain Reaction
(PCR) use purified genomic DNA isolated from leukocytes extracted from whole
![Page 25: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/25.jpg)
23
blood samples. However, in patients who are frequently transfused, the presence of
donor leukocytes during sampling cannot be eliminated. The determination of the
gene or allele that is relevant and prevalent in a particular population is also a
challenge. Little is documented on the extended blood group genotypes in transfusion-
dependent patients in Malaysia.
Not much is known regarding the presence or clearance of donor leukocytes in a
recipient after a blood transfusion. A study on the clearance of donor leukocytes in
orthopaedic surgery patients after a blood transfusion found that the concentration of
donor leukocytes in recipient blood increases transiently post-transfusion (Lee et al.,
1995). However, this is in contrast with one study which showed that DNA from the
post-transfusion sample can be used for blood group genotyping without the risk of
detecting microchimerism (Reid et al., 2000). Other study also showed that patients‟
white blood cell (WBC) samples can be used to determine a blood group
polymorphism by Polymerase Chain Reaction (PCR)-based assays even though the
post-transfusion blood samples are used as the source of DNA (Rios et al., 1999; Reid
et al., 2000).
To avoid this potential problem, alternative source of samples to collect the DNA is
needed to determine the blood group genotype. Buccal swab to collect epithelial cells
offers a simple and inexpensive alternative collection method ideal for whole-genome
amplification (Hosono et al., 2003). A study by Rios et al., (1999) compared the
genotyping results from buccal swab and urine sediments in donors with the results of
phenotyping using standard serological techniques by demonstrating
![Page 26: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/26.jpg)
24
haemagglutination performed on red cells. The study concluded that the results were
concordant (Rios et al., 1999).
Development of alternative sampling or testing methods to determine blood group is
not just of academic interest. There are situations in which genotyping is a superior, or
the only approach (Mercier et al., 1990). Although serology may be sufficient for
some blood group typing, genotyping assays offer a good alternative for problems
encountered by serology.
1.2 OBJECTIVES OF THE STUDY
1.2.1 General objective
To determine the phenotype and genotype of red cells for RH (C, c, E, e), KEL (Kell,
Cellano), Kidd (JKA, JKB) and Duffy (FYA, FYB) using buccal swab and peripheral
whole blood in normal healthy donors and multiply-transfused thalassaemia patients.
1.2.2 Specific objectives
1. To establish the Single Nucleotide Polymorphism (SNP) analysis
by TaqMan®
Real-Time PCR method for red blood cell genotype
RH, KEL, Duffy and Kidd.
2. To compare the red cell blood group serological phenotype and
genotyping in normal healthy donors and multiply-transfused
thalassaemia patients.
![Page 27: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/27.jpg)
25
3. To compare the genotype profile of red cells between buccal swab
and peripheral whole blood analysis in multiply-transfused
thalassaemia patients.
1.3 RESEARCH HYPOTHESES
1. There is a discrepancy in the blood group in multiply-transfused
thalassaemia patients between serology and genotype by PCR
method.
2. There is a discrepancy in red cell genotyping of RH (C, c, E, e),
KEL (Kell, Cellano), Kidd (JKA, JKB) and Duffy (FYA, FYB)
between buccal swab and peripheral whole blood analysis in
multiply-transfused thalassaemia patients.
3. SNP analysis by PCR is a useful tool for red cell genotyping.
![Page 28: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/28.jpg)
26
CHAPTER II
LITERATURE REVIEW
2.1 BLOOD GROUPS
Currently, The International Society of Blood Transfusion (ISBT) has acknowledged
35 blood group systems comprising over 300 antigens (Transfusion, 2015) (Table
2.1). ABO was the first blood group system discovered by Karl Landsteiner in 1900
(Landsteiner, 1900) and this marked as the beginning of blood banking and
transfusion medicine.
![Page 29: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/29.jpg)
27
Table 2.1: Blood group systems acknowledged by the International Society of
Blood Transfusion
No. Name (Symbol) Gene name(s) No. of antigens
001 ABO ABO 4
002 MNS GYPA, GYPB 48
003 P1PK A4GALT 3
004 Rh (RH) RHD, RHCE 54
005 Lutheran (LU) LU 21
006 Kell (KEL) KEL 35
007 Lewis (LE) LE (FUT3) 6
008 Duffy (FY) FY (DARC) 5
009 Kidd (JK) JK (SLC14A1, HUT1
1A),
3
010 Diego (DI) DI (SLC4A1, AE1,
EPB3)
22
011 Yt (YT) YT (ACHE) 2
012 Xg (XG) XG (PBDX) 2
013 Scianna (SC) SC (ERMAP) 7
014 Dombrock (DO) DO (ART4) 8
015 Colton (CO) CO (AQP1) 4
016 Landsteiner-Wiener (LW) LW (ICAM4, CD242) 3
017 Chido-Rodgers (CH/RG) CH (C4B), RG (C4A) 9
018 H (H) H (FUT1) 1
019 Kx (XK) XK 1
020 Gerbich (GE) GE (GYPC) 11
021 Cromer (CROM) CROM (DAF) 18
022 Knops (KN) KN (CR1) 9
023 Indian (IN) IN (CD44) 4
024 Ok (OK) OK (BSG, EMPRIN) 3
025 Raph (RAPH) RAPH (CD151) 1
026 John Milton Hagen (JMH) JMH (SEMA7A, CD108,
SEMA-L)
6
027 I (I) I (GCNT2, IGnT) 1
028 Globoside (GLOB) GLOB (B3GALNT1) 2
029 Gill (GIL) GIL (AQP3) 1
030 Rh-associated glycoprotein
(RHAG)
RHAG 4
031 FORS (FORS) FORS (GBGT1,
A3GALNT)
1
032 JR (JR) JR (ABCG2) 1
033 Lan (LAN) LAN (ABCB6) 1
034 Vel (VEL) VEL (SMIM1) 1
035 CD59 CD59 1 Source: ISBT website, 2015
![Page 30: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/30.jpg)
28
In blood transfusion practice, ABO and RH are considered the most important blood
group systems. The other blood group systems were thought to be minor/extended
antigen on the red cell surface. However, nowadays the KEL, Kidd and Duffy are also
considered as some of the most important blood group systems. This is because the
blood group antigens from these blood group systems can produce antibodies which
can cause intravascular and extravascular destruction of transfused red cells, induce
haemolytic disease of fetus and newborn (HDFN) and autoimmune haemolytic
anaemia (AIHA).
2.1.1 Rhesus blood group
Rhesus (Rh) blood group is one of the most complicated and the second most
important human blood group systems after ABO (Dean, 2005) with 54 well-known
antigens (Transfusion, 2015) however, only five of these antigens are considered
important. The Rh antigens are encoded by two genes, RHD and RHCE that are
closely linked and are produced by differences in their protein sequences (Flegel,
2007). Although the Rh system is highly polymorphic and immunogenic, the most
significant polymorphism is due to the presence or absence of the Rh D antigen on the
red cells where the terms “Rh positive” and “Rh negative” are referred. Individuals
who do not produce the D antigen will produce anti-D if they encounter the D antigen
on transfused RBCs which can cause a haemolytic transfusion reaction (HTR) or in
pregnant women, can cause HDFN. Incompatibility of the RHCE antigens can also
cause haemolytic reactions. Currently, the Rh status is routinely determined by
serology in blood donors, blood recipients and in pregnant women after ABO (Carritt
et al., 1997; Dean, 2005).
![Page 31: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/31.jpg)
29
2.1.1.1 Antigens and antibodies
Rh antigens can be detected as early as 8 weeks of gestation and is fully expressed at
birth (Gemke et al., 1986). They are only present on red cells and cannot be detected
on platelets, lymphocytes, monocytes, neutrophils or other tissues (Dunstan et al.,
1984; Dunstan, 1986). As mentioned earlier, five antigens that are considered
important include; C, c, D, E and e (Dean, 2005) (Table 2.2). However, routine blood
grouping protocol involves only Rh D antigen testing and the person is reported or
grouped as Rh positive or negative. Almost 99% of Asian population and about 85%
of Caucasians and 92% of Blacks are D positive (Reid & C, 2004).
Table 2.2: Frequency of Rh antigens
Antigen Caucasians Blacks Asians
D 85% 92% 99%
C 68% 27% 93%
E 29% 22% 39%
c 80% 96% 47%
e 98% 98% 96%
Source: Reid & C, 2004
There are four sets of nomenclatures that have been used to describe the antigens,
proteins and genes in the Rh system: two sets are based on the postulated genetic
mechanisms, one set only describes the presence or absence of the antigens and the
fourth is the traditional terminology recommended by the ISBT committee for
terminology of blood group antigens.
In the early 1940s, Fisher and Race postulated that the antigens in the Rh system were
produced by three closely linked sets of alleles (C/c, D/d and E/e) and each gene was
![Page 32: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/32.jpg)
30
responsible for producing the antigens (C, c, D, E, and e) on the surface of RBC
(Race, 1948). To date, no “d” antigen has been found, so it is considered as an
amorphous gene (silent allele) or the absence of D antigen. There are eight possible
haplotype arrangements of Rh genes (Table 2.3).
Table 2.3: Possible haplotype arrangements of Rh genes by Fisher-Race
Terminology
Frequency (%)
Gene Combination White Black Native American Asian
DCe 42 17 44 70
dce 37 26 11 3
DcE 14 11 34 21
Dce 4 44 2 3
dCe 2 2 2 2
dcE 1 0 6 0
DCE 0 0 6 1
dCE* 0 0 0 0
*Frequency less than 1%, but phenotype has been found
Source: Widmann, 1985
In 1943, Wiener introduced terminologies which are more complex. He believed that
the gene responsible for defining Rh actually produced an agglutinogen; a series of
blood factors that were identified by specific antibodies. He proposed the single locus
and eight allele genes theory (Wiener, 1943) (Table 2.4).
![Page 33: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/33.jpg)
31
Table 2.4: Wiener‟s Rh Terminology
Gene Agglutinogen Blood Factors Shorthand
Designation
Fisher-Race
Antigens
Rh0 Rh0 Rh0hr‟hr‟‟ R0 Dce
Rh1 Rh1 Rh0rh‟hr‟‟ R1 DCe
Rh2 Rh2 Rh0hr‟rh‟‟ R2 DcE
Rhz Rhz Rh0rh‟rh‟‟ Rz DCE
rh rh hr‟hr‟‟ r Dce
rh‟ rh‟ rh‟hr‟‟ r‟ dCe
rh‟‟ rh‟‟ hr‟rh‟‟ r‟‟ dcE
rhy rhy rh‟rh‟‟ r
y dCE
Source: Wiener, 1943
Even though this theory was incorrect, the shorthand designation is used by many
blood bankers for the designation of the phenotype.
In 1960s and 1970s, alpha numerical terminology was proposed by Rosenfield and
colleagues (Rosenfield et al., 1962; Rosenfield et al., 1973; Rosenfield et al., 1979)
and this system was only based on the presence or absence of the antigen on the red
cell and has no genetic basis. Each antigen was given a number that assigned it to the
Rh system and a minus sign was given if the antigen is absence (Table 2.5). The five
major antigens that were assigned are D is RH1, C is RH2, E is RH3, c is RH4 and e
is RH5.
![Page 34: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/34.jpg)
32
Table 2.5: Rh types by Three Nomenclatures
Genotype
Fisher-Race Wiener Rosenfield
Common
genotypes
DCe/dce R1r Rh:1,2,-3,4,5
DCe/DCe R1R1 Rh:1,2,-3,-4,5
dce/dce rr Rh:-1,-2,-3,4,5
DCe/DcE R1R2 Rh:1,2,3,4,5
DcE/dce R2r Rh:1,-2,3,4,5
DcE/DcE R2R2 Rh:1,-2,3,4,-5
Rarer genotypes dCe/dce r‟r Rh:-1,2,-3,4,5
dCe/dCe r‟r‟ Rh:-1,2,-3,-4,5
dcE/dce r”r Rh:-1,-2,3,4,5
dcE/dcE r”r” Rh:-1,-2,3,4,-5
Dce/dce R0r Rh:1,-2,-3,4,5
Dce/Dce R0R0 Rh:1,-2,-3,4,5
dCE/dce ryr Rh:-1,2,3,4,5
Source: Wiler, 1999
As the practice of blood transfusion began expanding and researchers shared their data
with others, ISBT was given a mandate to establish a uniform nomenclature that is
easily readable by machine and human and also in keeping with the genetic basis of
blood group. The ISBT adopted six digit numbers for specific antigen; the first three
numbers represent the blood group system while the last three numbers represent the
antigen specificity. For Rh blood group system, 004 were assigned as the first three
numbers and each antigen in the Rh system was given a unique number to complete
the six digit numbers (Table 2.6).
![Page 35: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/35.jpg)
33
Table 2.6: Five major Rh antigens in four nomenclatures
Fisher-Race Wiener Rosenfield ISBT
D Rh0 Rh1 004001
C rh‟ Rh2 004002
E rh” Rh3 004003
c hr‟ Rh4 004005
e hr” Rh5 004006
Source: Wiler, 1999
Rh antibodies are rarely naturally occurring. The Rh antibodies are mostly the product
of sensitization from the previous transfusion or pregnancy and are clinically
significant as they cause transfusion reactions and HDFN. The majority of Rh
antibodies are IgG type and can cross the placenta but rarely activate complement.
Extravascular haemolysis occurs in the spleen as they bind to RBCs via the Fc portion
of the antibody and mark them up for destruction (Dean, 2005).
2.1.1.2 Genetics and biochemistry
The Rh antigens are encoded by two genes; RHD and RHCE (Flegel, 2007), and are
97% identical (Westhoff, 2004). These genes are closely linked on chromosome 1
(1p34.3-p36.13) (Cherif-Zahar et al., 1991) and each contain 10 coding exons but in
tail-to-tail orientation (3‟RHD5‟-5‟RHCE3‟) with an unrelated gene, the SMP1 that
separates them (Wagner & Flegel, 2000) (Figure 2.1). Both genes encode a
transmembrane protein over 400 residues in length that transverses the RBC
membrane 12 times with the internal termini and 6 loops extending outside the
membrane (Figure 2.2). The RhD and RhCE proteins differ by only 32-35 amino acids
(Avent et al., 1992), which is in contrast to most blood group antigens that are
encoded by single genes with alleles that differ by only one or a few amino acids.
![Page 36: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/36.jpg)
34
Figure 2.1: The Rh genes, showing the 10 exons of RHD and RHCE in opposite
orientation on the chromosome, SMP1 in between and Rh boxes
flanking RHD.
Source: Daniels, 2005
The RhD protein encodes over 30 epitopes of the D antigen. The variations of the D
phenotype arises when these epitopes are only weakly expressed (“weak D
phenotype”) or missing (“partial D phenotype”) (Dean, 2005). Meanwhile, the RhCE
protein encodes the C/c antigen on the 2nd
extracellular loop and the E/e antigen on the
4th
extracellular loop, plus many others such as Cw (RH8), C
x (RH9) and VS (RH20).
There are four amino acid substitutions that are usually associated with C/c
polymorphism , at position 16, 60, 68 and 103, but the Ser103Pro substitution in the
second extracellular loop that is definitive for determining C or c activity (arise from
SNP 307T>C). For RH C antigen, proline will be present and for RH c antigen, serine
will be detected. The E/e polymorphism results from a Pro226Ala substitution in the
fourth extracellular loop (arise from SNP 676C>G). For RH E antigen, proline will be
detected and for RH e antigen, alanine will be present (Mouro et al., 1993; Dean,
2005) (Figure 2.2).
![Page 37: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/37.jpg)
35
Figure 2.2: The D and CcEe polypeptides span the membrane 12 times and have
internal N- and C-termini and 6 extracellular loops. The amino acid
substitutions for C/c polymorphism in the second loop and E/e
polymorphism in fourth loop.
Source: Daniels, 2005
2.1.2 KEL blood group
KEL is one of the most complex blood group systems after ABO and Rhesus blood
group. It contains a lot of highly immunogenic antigens and is described as the third
most polymorphic systems. Antibodies which target the KEL antigens could
potentially cause HTR and HDN and this is found to be similar to the Rhesus blood
group systems.
2.1.2.1 Antigens and antibodies
KEL blood group antigens can be found only on red cell in low density and cannot be
detected on monocytes, granulocytes, lymphocytes or platelets using
immunofluorescent flow cytometry. The antigens are well developed at birth and
cannot be destroyed by enzyme treatment of the red cells (Kormoczi et al., 2009).
There are 35 antigens in the KEL blood group systems which include six pairs or
![Page 38: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/38.jpg)
36
triplets of antithetical antigens (Transfusion, 2015). The K antigen is one of the most
clinically significant antigens. K antigen (KEL1) was first described in 1946 by
Coombs and colleagues (1946) because of an antibody that caused HDFN in the serum
of a woman known as Mrs. Kelleher. It can be detected as early as 10 weeks of
gestation and the phenotype frequency is present in 9% of whites and approximately
2% in blacks (Coombs et al., 1946). Three years later, k antigen (KEL2) was
described by Levin and colleagues (1949) as an antithetical antigen to K. It can be
detected at 7 weeks of gestation and is present on red cells of over 99% of all
individuals (Levine et al., 1949).
Other antithetical antigens of the KEL blood group systems are Kpa (KEL3) which has
low frequency, Kpb (KEL4) which has high frequency and Kp
c (KEL21) which
showed low incidence (Allen & Lewis, 1957; Yamaguchi et al., 1979). Other antigens
that showed low incidence were K17 and K24 (Strange et al., 1974; Lee et al., 1997).
The Jsa (KEL6) occurred approximately 20% in black people while Js
b (KEL7)
showed high incidence (Giblett, 1958; Walker et al., 1963). Other studies also showed
that K11 and K14 have high incidence (Guevin et al., 1976; Lee et al., 1997). The
Kellnull or K0 phenotype was described in 1957 where the red cells lack all of the Kell
antigens (Chown et al., 1957) and McLeod phenotype (individual who lack Kx
protein, essential for the expression of Kell system antigens) have been described as a
phenotype with markedly reduced Kell antigen expression (Allen et al., 1961) (Table
2.7, Figure 2.3).
Anti-K is the most common antibody seen in the blood bank. It is an IgG antibody
type which is reactive in the antiglobulin phase. The K antibody has been implicated
![Page 39: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/39.jpg)
37
in causing HTR which can occasionally be severe in nature and also an important
cause of HDFN and neonatal anaemia (Win et al., 2005). It tends to occur not only in
the mothers that has had a history of blood transfusion, but also in the mothers that
have been sensitized to the Kell antigen during previous pregnancies (Dean, 2005). It
is not difficult to find compatible blood for patients with anti-K because over 90% of
donors are K-. Anti-k occurs less frequently but it has similar clinical and serologic
characteristics with anti-K.
Table 2.7: KEL blood group system phenotypes and prevalence
Prevalence (%)
Phenotype White African American
K-k+ 91 98
K+k+ 8.8 2
K+k- 0.2 Rare
Kp(a+b-) Rare 0
Kp(a-b+) 97.7 100
Kp(a+b+) 2.3 Rare
Kp(a-b-c+) 0.32 (Japanese) 0
Js(a+b-) 0 1
Js(a-b+) 100 80
Js(a+b+) Rare 19
Source: Beth H. Shaz, 2009a
![Page 40: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/40.jpg)
38
Figure 2.3: Kell and Kx proteins
Kell is a single-pass protein while Kx span the red blood cell membrane ten times. Kell and Kx are
linked by a disulfide bond, shown as –S–. The amino acids that are responsible for the more common
Kell antigens are shown. The N-glycosylation sites are shown as Y. The hollow Y represents the N-
glycosylation site that is not present on the K (K1) protein.
Source: Beth H. Shaz, 2009a
2.1.2.2 Genetics and biochemistry
KEL gene has been assigned to chromosome 7(q33) and contains 19 exons that span
more than 21 kbp of genomic DNA. The glycoprotein produced by this gene has a
single pass through the red cell membrane (Dean, 2005). The KEL gene is highly
polymorphic and all of these polymorphisms represent SNPs encoding amino acid
substitutions on the Kell glycoprotein.
The k/K polymorphism results from single base mutation, 698C>T SNP in exon 6 of
KEL, encoding a Thr193Met substitution (Lee, 1997; Lee, 1998). When the KEL
gene produces the K antigen, methionine will be present and for the k antigen,
threonine will be detected. The Kpa/Kp
b polymorphism results from an Arg281Trp
![Page 41: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/41.jpg)
39
(arise from SNP 841T>C) and Jsa/Js
b polymorphism results from a Leu597Pro (SNP
1790C>T).
2.1.3 Kidd blood group
Kidd blood group system was discovered by Allen and associates in 1951 with the
identification of an antibody responsible for HDFN (Allen et al., 1951). It is
designated as JK or 009 by ISBT. Kidd blood group system has a special significance
to routine blood banking because of its antibodies which can be difficult to detect and
a common cause of HTR.
The Kidd antigens act as RBC urea transporters and are located in the red cell
membrane. Kidd glycoprotein transports urea in and out of the RBCs rapidly while
maintaining the osmotic stability and the shape of the RBC during the process. Other
than that, it is also expressed on the endothelial cells of vasa recta in the medulla of
human kidney where it enables the kidney to concentrate the urea to produce
concentrated urine. For individuals who do not produce the Kidd glycoprotein, also
known as Jk null individuals, they have a reduced capacity to concentrate their urine
into the maximal concentration and their RBCs are more resistant to lysis by 2 M urea.
However, there is no clinical effect that could lead to other abnormalities, therefore,
they remain healthy and their RBCs would still have a normal shape and lifespan
(Sands et al., 1992; Dean, 2005; Mohandas & Narla, 2005; Beth H. Shaz, 2009a).
![Page 42: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/42.jpg)
40
2.1.3.1 Antigens and antibodies
There are three antigens in the Kidd blood group systems; Jka, Jk
b and Jk
3, but Jk
a and
Jkb are the most common. There are four common phenotypes identified in the Kidd
systems (Table 2.8). The Jk(a-b-) phenotype or null phenotype is also known as Jk3
and is extremely rare, except in some populations of Pacific Island origin, especially
Polynesian and Chinese and as described by Pinkerton and colleagues in 1959
(Pinkerton, 1959).
Table 2.8: Phenotypes and frequencies in the Kidd system
Phenotype Whites (%) Blacks (%) Asians (%)
Jk(a+b-) 26.3 51.1 23.22
Jk(a+b+) 50.3 40.8 49.94
Jk(a-b+) 23.4 8.1 26.84
Jk(a-b-) <0.01 <0.01 0.9 to <0.1 Source: Wilkinson, 2005
Jka antigens can be detected on fetal red cells as early as 11 week of gestation and
even earlier for Jkb antigens at 7 weeks of gestation. Both antigens are well developed
at birth, which contributes to the potential occurrence for HDFN. The antigens cannot
be found on platelets, lymphocytes, monocytes or granulocytes using sensitive
radioimmunoassay or immunofluorescent techniques (Mollison et al., 1997) and also
cannot be destroyed by enzymes, ZZAP, chloroquine diphosphate, AET, DTT or acid
(Calhoun, 1999).
Anti-Jka
is a more common antibody than anti-Jkb. It was found by Allen and
colleagues (1951) in the serum of Mrs. Kidd whose infant had HDFN. Two years
later, anti-Jkb was discovered by Plaut and co-workers (1953) in the serum of a
![Page 43: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/43.jpg)
41
transfusion reaction patient. Both antibodies are IgG type and antiglobulin-reactive
although IgM example has been reported (Mollison et al., 1997).
Anti-Jka and anti-Jk
b antibodies are dangerous antibodies because they can be very
difficult to detect in routine blood cross-matches; they show dosage effect, often weak
and found in combination with other antibodies (Calhoun, 1999; Dean, 2005). They
are a common cause of delayed haemolytic transfusion reaction (DHTR) (Mollison et
al., 1997). Anti-Jk3 (also known as anti-Jk
ab), which is a very rare type of Kidd
antibody produced by Jk(a-b-) individuals, can cause immediate and delayed
haemolytic transfusion reactions. Contrary to its haemolytic reputation in transfusion,
most Kidd antibodies rarely lead to HDFN (Dean, 2005).
2.1.3.2 Genetics and biochemistry
The SLC14A1 gene (Solute carrier family 14, member) or also known as JK gene is a
member of urea-transporter gene family. The gene has been assigned to chromosome
18 (18q11-q12) and organized in 11 exons that is distributed across the 30 kbp of
genomic DNA but only starts at exon 4 until exon 11 where the mature Kidd protein is
encoded; the first three exons and part of forth exons are not translated (Dean, 2005).
The product of the JK gene is a urea transporter molecule that spans the red cell
membrane 10 times with both the N terminus and C terminus being intracellular
(Figure 2.4) (Sands, 2002; Dean, 2005).
![Page 44: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/44.jpg)
42
Figure 2.4: Domain structure of Kidd transporter.
Ten transmembrane domain structure of the Kidd transporter were predicted. The polymorphism
responsible for the Kidd antigens and the site for the N glycan as shown.
Source: Beth H. Shaz, 2009a
The Jka/Jk
b polymorphism arise from SNP 838G>A, resulting in a D280N
substitution. For Jka antigen, aspartic acid will be present and for Jk
b antigen,
asparagine is detected. The molecular basis of Jk3 antigen is unknown (Wilkinson,
2005).
2.1.4 Duffy blood group
Duffy was the first blood group mapped to an autosome (chromosome 1) using
cytogenetic studies. Located at the same chromosome as RH blood group, the
antibodies which targeted the Duffy antigens are usually clinically significant and
have been reported to cause HTR and HDFN.
![Page 45: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/45.jpg)
43
2.1.4.1 Antigens and antibodies
There are five antigens in the Duffy blood group system but only two which are most
important; Fya (FY1) and Fy
b (FY2). Both antigens can be identified on fetal red cells
as early as 6 weeks of gestation and are well developed at birth. These antigens, like
most red cell antigens cannot be found on granulocytes, monocytes, lymphocytes or
platelets but they can be identified in other body tissues including brain, colon,
endothelium, lung, spleen, thyroid, thymus and kidney cells (Reid, 1995). There are
also rare individuals with the Fy(a-b-) phenotype or also known as Fy3
who do not
produce Duffy antigens on their RBCs (Dean, 2005). The Fyx
antigen results from
weak expression of Fyb, and can be found in the white people due to a single mutation
in the FYB gene. The Fy(a-b-) is caused by a mutation in the promoter region of FYB,
which disrupts the binding site for the erythroid transcription factor GATA-1 and
results in the loss of Duffy expression on RBCs, but not its expression on
endothelium. Fy(a-b-) individuals who have no Duffy glycoprotein, form anti-Fy3 and
reacts with all RBCs except Fy(a-b-) RBCs (Beth H. Shaz & John D. Roback, 2009).
In contrast to the Kidd antigens, the Fy antigens (except Fy3 antigen) can be destroyed
by enzymes including ficin, papain, bromelin, chymotrypsin and the IgG cleaving
reagent ZZAP (Calhoun, 1999). Denaturation could also occur by formaldehyde or
heating the red cells at 56oC for 10 minutes (Wilkinson, 2005).
In Duffy blood group system, there are four common phenotypes observed (Table
2.9). The disparity in the distribution of Duffy phenotypes in different races is quite
notable.
![Page 46: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/46.jpg)
44
Table 2.9: Frequencies of Duffy phenotypes
Phenotypes Whites (%) Blacks (%) Chinese (%)
Fy(a+b-) 17 9 90.8
Fy(a+b+) 49 1 8.9
Fy(a-b+) 34 22 0.3
Fy(a-b-) Very rare 68 0
Source: Calhoun, 1999
Antibodies against the Duffy antigens have all been implicated as the cause of HTR
and HDFN. Anti-Fya is 20 times more common than anti-Fy
b (Mollison et al., 1997)
which is commonly found in African patients (especially in the Duffy null phenotype)
that have sickle cell anaemia which require multiple blood transfusion (Dean, 2005). It
was discovered in 1950 in a serum of haemophilia patients who had underwent
multiple blood transfusion (Cutbush et al., 1950). A year later, anti-Fyb was
discovered in the serum of a multiparous female (Ikin et al., 1951). It is rare, weakly
reactive and often occurs in combination with other antibodies (Mollison et al., 1997).
Both antibodies are mainly IgG type and react readily with antiglobulin testing using
the indirect antiglobulin technique.
2.1.4.2 Genetics and biochemistry
The DARC (Duffy antigen receptor for the chemokines) gene or also known as Duffy
(FY) gene is the first human gene to be assigned to an autosome (a non-sex
chromosome). It is located on the long arm of chromosome 1 (q22-q23) (Donahue et
al., 1968) and consists of two exons that span over 1500 bp of genomic DNA (Dean,
2005) which encode a protein of 337 amino acids (Chaudhuri et al., 1995). The
Duffy‟s antigen protein is a multipass transmembrane glycoprotein with a protruding
glycosylated amino terminal region (Figure 2.5). The antigens show a dosage effect,
![Page 47: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/47.jpg)
45
whereby there are twice as many Fya antigens on RBCs from homozygous individual
of the Fya allele than the heterozygous individual (Beth H. Shaz & John D. Roback,
2009). The Duffy glycoprotein is also a membrane protein which serves as a non-
specific receptor for several chemokines and as a receptor for human malarial
parasites Plasmodium vivax and Plasmodium knowlesi in order to invade erythrocytes
(Hadley & Peiper, 1997). However, in individual‟s RBCs that lack the Fya and Fy
b
antigens (individual who have Fy(a-b-)), they are resistant to infection by these
parasitic organisms (Hamblin & Di Rienzo, 2000; Beth H. Shaz & John D. Roback,
2009).
Figure 2.5: Domain structure of Duffy protein.
Seven transmembrane domain structure of the Duffy protein were predicted. The amino acid change
responsible for Fya/Fy
b polymorphism, the mutation responsible for Fy
x glycosylation sites and the
regions where Fy3 and Fy6 map as shown.
Source: Beth H. Shaz & John D. Roback, 2009
![Page 48: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/48.jpg)
46
Fya and Fy
b antigens are encoded by co-dominant allele group, FYA and FYB, which
differ by a SNP 125G>A resulting in a G42D substitution. For Fya antigen, glycine
will be detected and for Fyb antigen, aspartic acid will be present (Hadley & Peiper,
1997). In individuals who have a homozygous nucleotide change in the 5‟
untranslated region, -46T>C, or also called the GATA-1 box mutation, they do not
express Fya or Fy
b antigens on the surface of their RBCs which is serologically
phenotype as Fy(a-b-) (null phenotype). This phenotype is predominant among West
Africans and Afro-Americans populations (Tournamille et al., 1995a).
The presence of antibodies towards these blood group systems are considered as
unexpected alloantibodies and the corresponding antigen must be avoided. There are
isolated reports of prevalence and frequencies of these antibodies in Malaysia,
observed in different clinical settings (Noor Haslina, 2005; Nadarajan et al., 2012;
Yousuf et al., 2013; Osman et al., 2014). However, the most reported cases involved
patients receiving multiple or repeated blood transfusions, especially thalassaemia.
![Page 49: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/49.jpg)
47
Table 2.10: Frequencies of antibodies amongst repeatedly-transfused thalassaemia
patients of Hospital Ampang, Malaysia
Antibody No. of patient
Anti-E 12
Auto IgG 6
Anti-S 5
Anti-Jkb 4
Anti-c 1
Anti-D 1
Anti-e 1
Anti-Jka 1
Anti-Leb 1
Anti-Mia 1
Anti-P1 1
Anti-Fyb 1
Anti-K 1 Source: Osman, et al., 2014
2.2 THALASSAEMIA: DEFINITIONS AND BACKGROUND
Thalassaemia is defined as a heterogeneous group of inherited blood disorder of
haemoglobin synthesis, a result from the reduction or absent production of one or
more α-globin chains which is located on chromosome 16 or β-globin chains of
haemoglobin which is located on chromosome 11 (George, 2013; Kawthalkar, 2013).
It is the commonest single gene disorder in the world and about 3% of the world
population (150 million) carries the β-thalassaemia genes (Saxena & Phadke, 2002)
and up to 5% are affected with α-thalassaemia (Vichinsky, 2010). The word
„thalassaemia‟ comes from the Greek word „thalassa‟ which means „the sea‟ since it
was thought that this disease only occurred among Mediterranean population and
„emia‟ means „related to blood‟. Thomas Cooley, an American paediatrician was the
first person who described Thalassaemia in 1925 (George, 2013).
![Page 50: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/50.jpg)
48
Thalassaemia is a common haemoglobin disorder in Malaysia and is considered as a
major public health problem. Clinically, thalassaemia are classified into three main
clinical phenotypes; trait, intermedia and major. Thalassaemia minor does not cause
any significant problems apart from the individuals acting as a carrier of the disease
and without his/her awareness in the absence of a blood test for screening (George et
al., 2011). In the early 1990s, the thalassaemia carriers were estimated approximately
5% of the population (George, 2001). However, with the current changes in socio-
demographic and rapid population migration and movement, the carrier status may be
underestimated.
Thalassaemia intermedia and thalassaemia major are generally the severe forms of
thalassaemia and are associated with severe symptomatic anaemia which may require
life-long RBC transfusions. β-thalassaemia major results from severe transfusion-
dependent anaemia and α-thalassaemia major or Hb barts hydrops foetalis which is
incompatible with life (Weatherall & Clegg, 2011). Data from Malaysian
Thalassaemia Registry showed that 3,310 out of 4,541 registered patients are
transfusion-dependent β-thalassaemia major and Hb E-β thalassaemia patients
(Malaysia, 2009). Four hundred and fifty-five patients are thalassaemia intermedia
while 410 individuals are affected with Hb H disease and the other subtypes make up
the rest (Malaysia, 2010). Until 2013, the total numbers of thalassaemia cases reported
in Malaysia has reached 6,031 patients and this number will keep increasing year by
year (Malaysia, 2013).
Similar symptoms may be apparent amongst thalassaemia intermedia and
thalassaemia major patients. Pallor is usually the first symptom accompanied by
![Page 51: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/51.jpg)
49
moderate to massive splenomegaly of various severity, irregular fever and failure to
thrive. Symptoms in thalassaemia intermedia usually develop much later in life.
Regular blood transfusions improve anaemia and reduce skeletal deformity associated
with excessive erythropoiesis. Although blood transfusion is a life-saver for
thalassaemia patients, it is associated with many complications such as iron overload,
platelet alloimmunization and anti-red blood cell immunization in the form of
alloantibodies and autoantibodies (George, 2013; Kawthalkar, 2013).
2.3 RBC IMMUNIZATION IN THALASSAEMIA
RBC alloimmunization is one of the complications of blood transfusion. It is defined
by the development of antibodies that occurs as a consequence of the disparity
between donor and recipient‟s RBC antigens. The rates of alloimmunization among
multitransfused individuals are significantly higher compared to the general
population and transfusion-dependent thalassaemia patients have high risk of
complications. Antibody screening for the unexpected red cell antibodies must be
done appropriately using the patient‟s serum prior to each transfusion procedure so
that compatible blood can be provided and the formation of alloantibody can be
avoided.
The development of anti-RBC antibodies (alloantibodies and/or autoantibodies) can
significantly complicate transfusion therapy. Many factors may influence the rate of
alloimmunization such as antigen immunogenicity, duration of transfusion therapy,
genetic factors and environmental factors (Bauer et al., 2007). Brantly and colleagues
(1988) stated that the higher the quantity of blood transfused to the patient, the higher
![Page 52: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/52.jpg)
50
the rate of alloimmunization while other studies found that RBC alloimmunization
will develop at the early onset of transfusion (age<3 years) or before the 15th
transfusion (Blumberg et al., 1984; Michail-Merianou et al., 1987). When antibodies
against the high frequency antigens have been developed, it is usually very difficult to
find the suitable blood for the patients. Most of the blood transfusion services only
provide the red cell units which are matched with ABO and RhD antigens. However,
for patients with haemoglobinopathies who require life-long transfusion, they should
receive blood that is also matched for the extended blood group antigens such as Rh
C, c, E, e and in the KEL, Kidd, and Duffy systems to prevent alloimmunization
(Blumberg et al., 1984).
The prevalence of alloimmunization has been demonstrated in many different
thalassaemia patient groups. An American research group documented that 22% (14
of 64 patients) of severe thalassaemia patients developed alloantibodies. This
consisted of 19 types of alloantibodies of which 14 of them were clinically significant
(Ameen et al., 2003). Another research group who studied a similar patient group in
Iran found that the frequency rate of alloimmunization in thalassaemia patients in
Northeast Iran was 2.87% (Bhatti et al., 2004). Other studies showed that 8.6% (of
162 patients) in Pakistan, 5.6% (of 162 patients) in India, 17.5% (of 143 patients) in
Thailand and 28.4% (of 95 patients) in Egypt develop alloantibobodies (Saied et al.,
2011; Dhawan et al., 2014; Jansuwan et al., 2015; Zaidi et al., 2015).
Autoantibodies are directed against the individual‟s own red cells. It appears less
frequently but may cause significant clinical haemolysis and difficulty in blood cross-
matching. Patients with autoantibody may have a higher transfusion rate and often
![Page 53: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/53.jpg)
51
require immunosuppressive drugs, a splenectomy, or other alternative treatments
(Singer et al., 2000). Study done by Saied and colleagues (2011) found that 1 in 95
regularly transfused beta thalassaemic patients in Egypt will lead to autoantibodies.
This finding is similar with a study done by Noor Haslina and colleagues (2006) on 58
multiply-transfused Malay thalassaemic patients. In a different study, Singer et al.,
(2000) found that 16 of 64 transfusion-dependent thalassaemia patients of
predominantly Asian descent were diagnosed with autoantibodies. Eleven
autoantibodies were reported as IgG while 5 were identified as IgM. In 7 of these 16
patients, autoantibodies were associated with the presence of alloantibodies (Singer et
al., 2000).
2.4 DETERMINATION OF BLOOD GROUP ANTIGENS
2.4.1 The haemagglutination technique
In most hospital blood banks, determination of blood group antigens is performed by
using serological test. Serological test is regarded as the gold standard method for
blood group typing where the specific antisera is used to detect the specific antigens
on the red blood cells surface. This test was used for the first time by Karl Landsteiner
in 1901 when he discovered the major ABO blood antigens, which was then modified
by Coombs, Mourant and Race when they discovered many other minor blood
antigens (Beth H. Shaz, 2009b). The most common serological test used is the tube
method (also known as “wet” method) and the gel method (also known as “column
agglutination”). Both are based on the detection of visible haemagglutination or the
presence of haemolysis (Beth H. Shaz, 2009b; Krista L. Hillyer, 2009).
![Page 54: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/54.jpg)
52
The agglutination occurs when the antigens on RBCs interact with antibodies in the
plasma. There are two major classes of antibodies to RBC antigens which are IgM and
IgG. Typically, IgM antibody results in visible agglutination during the immediate
spin (IS) phase while IgG antibody results in visible agglutination during the anti-
human globulin (AHG) phase.
IS phase:
The IgM antibody binds to corresponding antigens and directly agglutinates the RBCs
after centrifugation, without additional reagents or extended incubation.
AHG phase:
The IgG antibody does not directly result in agglutination, so, AHG techniques must
be used. The AHG phase is based on the principle that AHGs obtained from
immunized non-human species bind to human globulins such as IgG or complement
attached to RBC antigens. The binding of the AHGs to the sensitized RBCs (RBCs
covered with IgG and/or complement) results in visible agglutination following
centrifugation. AHG techniques require additional reagents (potentiators) and
extended incubation for optimal sensitivity.
AHG reagents:
The AHG reagents can be monoclonal, polyclonal or a mixture of both. The
polyspecific AHG contain anti-IgG and anti-C3d and may contain anti-C3b and other
immunoglobulin and complement antibodies. A negative AHG test must be followed
by a control system of IgG sensitized cells (check cells) to confirm that the result is
not a false negative. If the check cells do not agglutinate, test must be repeated.
![Page 55: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/55.jpg)
53
However, the accuracy of the results is highly dependable on the person who reads or
grades the reactions. A good result should be obtained from a well-trained and
qualified person and the reactions should be examined within a short period of time.
In some cases, the detection of the blood group antigen by this method is not reliable.
This may be due to recent exposure to donor red cell, certain drugs or medications or
other diseases that may alter the red cell membrane. A complete clinical and
transfusion history is very important when interpreting the results obtained.
Many studies have reported difficulties in interpreting the patients‟ blood typing when
performing the blood phenotyping from multiply-transfused patients (Reid et al.,
2000; Rožman et al., 2000; Castilho et al., 2002a; Castilho et al., 2002b; Ribeiro et al.,
2009; Guelsin et al., 2010). The mixed-field reactions (where a positive and negative
result in a single reaction tube) that are observed in more than one antigen typing
could also make the determination of the antigen-matched RBCs for the patients
becomes more complicated.
Even though the serological test is simple, inexpensive and when correctly performed
has a specificity and sensitivity appropriate for the clinical care of the majority of
patients, it also has many limitations. This includes unreliable prediction of a foetus at
risk of HDFN, difficulty to correctly type the RBCs from a recently-transfused patient
or those which are coated with IgG. The technique does not precisely indicate RHD
zygosity in D+ people, and requires the availability of specific and reliable antisera
where some may be limited in volume, weakly reactive or not available at all. The
correct blood antigen typing may only be revealed by using molecular methods when
![Page 56: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/56.jpg)
54
the red cells are an unreliable sample source. The understanding of the molecular basis
associated with many blood group antigens and phenotypes enable us to consider the
identification of blood group antigens and antibodies using molecular approaches
(Reid, 2007).
2.4.2 Red blood cell genotyping by molecular analysis
Molecular genetics industry began in the early 1980s since the development of the
polymerase chain reaction (PCR) by Mullis and Faloona (1987) which allows the
amplification of DNA and analysis of genes. The age of genomics has enabled the
application of DNA-based molecular methods to transfusion medicine. Since the first
discovery of ABO blood group antigens by Yamamoto and colleagues (1990), the
molecular basis of almost all blood group antigens has been determined (Daniels,
2005). The majority of genetically defined blood group antigens are the consequence
of a single-nucleotide polymorphism (SNP), so, it is now possible to predict the blood
group antigen profile of an individual by testing their DNA with a high degree of
accuracy (Westhoff, 2006; Moulds, 2010) which may be used to overcome the
limitations of haemagglutination methods.
There are many molecular methods that can be used for red cell genotyping. It can be
divided according to the predicted workload of sampling; low throughput;
conventional PCR by using gel electrophoresis analysis, medium throughput; real
time, Sanger DNA sequencing and pyrosequencing and high throughput; microarray
technology such as Beadchip array, BloodChip and Genome Lab SNP stream, fluidic
microarray systems, TaqMan® OpenArray, MALDI-TOF MS (matrix-assisted laser
desorption/ionization time-of-flight mass spectrometry) and mini-sequencing. The
![Page 57: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/57.jpg)
55
application of the molecular methods in red cell genotyping has been identified to be
advantageous over haemagglutination technique; antigen typing in patients with recent
blood transfusion and in patients with Direct Antiglobulin Test (DAT) positive that
complicates phenotyping or when antiserum especially for rare antigens is not readily
available for antigen typing, resolution of discrepancies in serotyping and assessment
of risk of HDFN using maternal samples (Reid, 2003; Van der Schoot, 2004).
2.4.2.1 Assays based on conventional PCR (low-throughput)
PCR is used to amplify a specific sequence of DNA and the reaction consists of three
steps: 1) denaturation step at 95oC to separate double-stranded DNA, 2) annealing step
typically at 55oC-65
oC for binding of primer to single-stranded DNA and 3) extension
step at 72oC for the creation of a complementary DNA copy. These steps are repeated
25-35 times, which results in exponential increase in the number of copies (PCR
amplicon) (Monteiro et al., 2011). PCR amplification performance and efficiency is
routinely analysed by electrophoresis through an agarose gel with the fragment bands.
The separation of the fragment, based on the size are visualized by ethidium bromide
staining under ultraviolet (UV) light. Various PCR assays commonly used include
allele-specific (AS-PCR), also known as sequence-specific priming (PCR-SSP), PCR-
restriction fragment length polymorphism (RFLP) and multiplex PCR. All of these
types of PCR are also known as gel-based detection.
PCR-RFLP was based on the introduction or loss of restriction sites by SNP of interest
and the alleles are differentiated after PCR by digestion of the product with a
restriction enzyme before the fragment was visualized by electrophoresis. Restriction
![Page 58: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/58.jpg)
56
enzyme will digest the nucleic acids and then recognize the specific sequences of
nucleotides in a DNA strand.
AS-PCR or PCR-SSP requires two reactions to be set up for each DNA sample and
each reaction tube has one primer that is gene-specific (common to both alleles), and
one primer that is specific for one or two possible alleles present. BAGene DNA-SSP
Kits is one of the commercially available kits that can be used for ABO variants,
RHD/RHCE variants and other blood group genes such as K1/K2, FYA/FYB and
JKA/JKB (Prager, 2007; Kyaw, 2012).
Multiplex PCR allows for simultaneous amplification of many target alleles or regions
of DNA in one reaction by using multiple primer pairs. Even though the method
enables a reduction in the number or different assays performed and save times,
multiplexing has limitations in the number of primer pairs that can be combined in one
reaction and the initial optimization of multiplex assays can be technically challenging
and difficult.
Work with these earlier types of molecular diagnostic methods has proved that
molecular testing can be successfully applied to blood group, platelet and human
leukocyte antigen (HLA) typing, and forensic medicine. Basically, these methods are
easy to set up as they do not require expensive instruments and are particularly well
suited for small laboratories with low workload. However, skilled technical staffs
which are costly in training and the long turnaround time due to the large number of
manual steps involved are required to apply it. These methods may also be costly
![Page 59: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/59.jpg)
57
especially in maintaining quality control and it carries a high risk of post-amplicon
contamination (Wu & Csako, 2006).
While widespread use of molecular testing with traditional methods in clinical settings
has been hindered by these limitations, a new era of molecular genotyping with
advance of fast and/or high throughput methods and platforms has allowed molecular
genotyping to enter areas which were mainly serology-based for more than a century.
2.4.2.2 Medium to high-throughput PCR
In order to meet the demand of routine blood group genotyping of donors or patients
per day, the technologies need to be high throughput and, above all, automated,
accurate and cost effective. Cost effectiveness should not be judged on the raw cost
per test alone. The potential benefits of having a comprehensive genotype of a donor
or patient may minimise transfusion complications as alloimmunisation may be
reduced. The full economic cost of providing complex serological investigations for
such individuals should also be considered (Avent, 2009).
2.4.2.2.1 Single Nucleotide Polymorphisms Real-Time Polymerase Chain
Reaction (SNP RT-PCR)
The past decade has seen that the Real Time Polymerase Chain Reaction (RT-PCR) as
a new technique in molecular genetics which allows quantification of polymorphic
DNA region and genotyping of SNPs in one run. A by-product of RT-PCR is the
opportunity to identify new SNPs in the proximity of gene loci of interest. SNPs are
the most common DNA variants in the human genome, with an approximate
![Page 60: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/60.jpg)
58
frequency of one every kilobase. More or less, 65% of the substitutions are transitions,
equally represented by A/G and C/T mutations, whereas 35% are transversions and all
the A/C, A/T, C/G and G/T variants have the same frequency. As SNPs are thought to
have a promising future in a wide range of applications in human genetics, today it is
widely investigated in several fields including pharmacogenomics, the study of
population evolution, analysis of forensic samples and the identification of
susceptibility genes involved in complex disease (Le Hellard et al., 2002; Martino et
al., 2010).
To date, many RT-PCR-based approaches have been used for SNP-typing in large-
scale studies. One of the most commonly applied is the TaqMan® method. Providing
the largest collection of ready-to-use human SNP assays available, the TaqMan®
genotyping assays have the simplest workflow available and are the quickest way to
generate genotyping data. Based on the 5‟nuclease assay for amplifying and detecting
specific SNP alleles in purified genomic DNA samples and takes place in a single
tube/well, it requires a RT-PCR machine, such as Applied Biosystems® 7900HT
Fast/7500 Fast Real-Time PCR Systems by Applied Biosystems® for the detection of
fluorescence. Each TaqMan® genotyping assay contains two primers for amplifying
the sequence of interest and two TaqMan® MGB probes for detecting alleles. The
presence of two probe pairs in each reaction allows genotyping of the two possible
variant alleles at the SNP site in a DNA target sequence. The genotyping assay
determines the presence or absence of a SNP based on the change in the fluorescence
of the dyes associated with the probes (Technologies, 2014).
![Page 61: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/61.jpg)
59
The TaqMan®
MGB probes consist of target-specific oligonucleotides with:
i. A reporter dye at the 5‟ end of each probe which VIC®
dye is linked to the 5‟
of the Allele 1 probe and 6FAM™
dye is linked to the 5‟ of the Allele 2 probe.
ii. A minor groove binder (MGB), which increases the melting temperature (Tm)
without increasing probe length, thereby allowing the design of shorter probes.
Shorter probes result in greater differences in Tm values between matched and
mismatched probes, resulting in accurate allelic discrimination.
iii. A non-fluorescent quencher (NFQ) at the 3‟ end of the probe.
Table 2.11: Correlation between fluorescence signals and sequences
Fluorescence increase Indication
VIC® dye fluorescence only Homozygosity for Allele 1
6FAM™
dye fluorescence only Homozygosity for Allele 2
Fluorescence signals for both dyes Heterozygosity for Allele 1-Allele 2
Source: TaqMan® Genotyping
Master Mix protocol, 2014
During PCR, genomic DNA is introduced into a reaction mixture consisting of
TaqMan®
Genotyping Master Mix, forward and reverse primers and two TaqMan®
MGB probes and each probe anneals specifically to a complementary sequence, if
present, between the forward and reverse primer sites. When the probe is intact, the
proximity of the quencher dye to the reporter dye suppressed the reporter
fluorescence. Then AmpliTaq Gold DNA Polymerase, UP cleaves the only probes that
are hybridized to the target. Cleavage separates the reporter dye from the quencher
dyes, increasing fluorescence by the reporter. The increase in fluorescence occurs only
if the amplified target sequence is complementary to the probe. Thus, the fluorescence
signal generated by PCR amplification indicates which alleles are in the sample
![Page 62: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/62.jpg)
60
(Figure 2.6). The genotypes are determined by plotting the normalized fluorescence
intensities on a scatter plot and using a clustering algorithm in the data analysis
software (Technologies, 2014).
Figure 2.6: The complementary TaqMan® probe fluoresces after anneals to the
template and after cleavage by AmpliTaq Gold DNA Polymerase, Ultra
Pure (UP).
Source: TaqMan
® Genotyping Master Mix Protocol, 2014
The advantage of this method is that only one simple reaction set up is required
without any processing after it and it is suitable for either 96 or 384 sample reactions –
rapid with medium to high-throughput analyses and less post-amplicon contamination.
![Page 63: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/63.jpg)
61
The determination of the molecular basis of blood group antigens has been intensely
studied, with most clinically significant alleles defined. Most blood group variation is
the result of SNPs in their own corresponding genes (Mouro et al., 1993; Lee, 1998;
Wilkinson, 2005). The ability to identify changes up to the single base pair has
enabled the discovery of diversity and polymorphic nature of a certain phenotype. The
polymorphisms may be universal or may be unique to certain ethnicity and
background. However, SNPs are not the sole genetic mechanism for blood group
polymorphism (Avent et al., 2007). For example, in the ABO system, the hybrid
alleles is due to recombination or gene conversion events that lead to unexpected
phenotypes and erroneous genotyping results (Olsson & Chester, 2001). In D
phenotypes, the RHD gene is deleted (Colin et al., 1991) or an RHD pseudogene
(RHDΨ) (Singleton et al., 2000) or hybrid RHD-RHCE genes can be present (Wagner
et al., 2001). In another example, the genetic basis of the Fy(a-b-) phenotype of
African descent for example is unlike any other blood group polymorphisms and is
caused by a promoter region mutation that disrupts a GATA-1 binding site
(Tournamille et al., 1995b). This mutation abolishes the erythroid expression of the Fy
glycoprotein, whereas it is expressed normally in nonerythroid tissues in the same
individual.
2.5 BUCCAL CELLS AS AN ALTERNATIVE SAMPLE SOURCE
FOR GENETIC STUDIES
In recent years, there has been increasing interest in finding alternative sample for
genetic studies and epidemiological investigations. As the genetic code of an
individual is contained in the DNA of all somatic cells, it is possible to perform DNA
![Page 64: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/64.jpg)
62
analysis from any source and one of it that we think is suitable are buccal cells. Buccal
cells can be collected in different protocols and the best two methods most frequently
used are mouthwash rinses (Lum & Le Marchand, 1998; Aidar & Line, 2007;
KÜChler et al., 2012) and cytobrush sampling of the inner cheeks (Saftlas et al., 2004;
Nedel et al., 2009; Poynter et al., 2013). Few studies have tried successfully to collect
the buccal cells from saliva (Quinque et al., 2006; Bahlo et al., 2010; Abraham et al.,
2012) and using cotton buccal swab (McMichael et al., 2009; Cheng et al., 2010;
Kovacevic-Grujicic et al., 2012). But, not all of these methods are practical for
collection from all types of patients. Mouthwashes procedure for example, is not
suitable for the application in younger age groups such as infants or toddlers, and
vulnerable or dependent individuals such as the elderly or unconscious patient.
Sometimes, patients will feel a burning sensation after sampling due to the presence of
alcohol in the mouthwash solution.
When dealing with the DNA that is not from the blood; the optimal DNA source for a
wide variety of genetic analyses, the most important thing that should be taken into
account is the quantity and quality of the DNA. Even the buccal cells can offer a
simple, non-invasive and less-expensive of alternative sampling method, Livy and
colleagues (2011) did not really suggested using the buccal cells as an alternative
sample to blood. The degradation of DNA from buccal cells sample has affected the
total yield and quality of the buccal DNA when compared with the blood DNA in
microarray based genotyping and it is recommended to use blood DNA for expensive
technique like microarrays than the unpredictable buccal DNA (Livy et al., 2011).
Contamination is an issue that will also rise when DNA is obtained from other sources
(Hansen et al., 2007; Herráez & Stoneking, 2008). Although, it is clearly mentioned in
![Page 65: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/65.jpg)
63
the procedures that the subject should rinse their mouth thoroughly before collecting
buccal cells and restrain from eating anything and smoking, some of them do not
exactly follow the procedures leading to contamination of non-human DNA in buccal
samples and other noise artefacts. Quantitative PCR using human primers can solve
this problems (Quinque et al., 2006) but use of such DNA for large scale genotyping
is time consuming and challenging.
Research scientists are eager to use buccal cell DNA due to easier handling
procedures. The sample may be sent via mail and it is not necessary to have special
qualification to perform the sample collection. A pilot study on the Danish nurse
cohort was done to compare the response rate of blood, saliva and buccal cells
samples and only 31% of the requested participants delivered a blood samples,
whereas the other samples showed higher percentage of the response rate compared
with the blood (Hansen et al., 2007). Collection of buccal cell via cytobrush or cotton
swab and buccal cell on FTA card are the most convenience methods compared to
using saliva and mouthwash if the participants of the study are required to send the
samples by mail. The part where the buccal cell should be extracted also plays a very
important role. Inner cheek is always the area of choice in most studies (McMichael et
al., 2009; Kovacevic-Grujicic et al., 2012; Poynter et al., 2013) but the gutter area
could also be another good source to collect the DNA due to the maximized surface
contact between the cytobrush and mucosa (Saftlas et al., 2004; Nedel et al., 2009).
All types of methods have their own advantages and disadvantages. The most suitable
method must be chosen depending on the requirement and needs of the study.
![Page 66: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/66.jpg)
64
For the current project, the buccal swab collection offers an escape from the
confounding factors of previous exposure to donor blood during transfusion. It is
feasible, does not require special equipment, does not involve painful needle pricks
and is generally safe and easy to perform in these patients. The collection of epithelial
cells from other sources such as menstrual blood (Bauer et al., 1999), urine (Rios et
al., 1999) or spit (saliva) (Nunes et al., 2012) have also been demonstrated. These
methods although appears feasible but may be difficult to collect, limited to certain
patient type and age as well as potentially demeaning and restrictive to some patients.
![Page 67: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/67.jpg)
65
CHAPTER III
RESEARCH METHODOLOGY
3.1 STUDY DESIGN
This cross-sectional comparative study was carried out at the Faculty of Medicine and
Health Sciences Universiti Sains Islam Malaysia (USIM), Hospital Ampang and
Universiti Kebangsaan Malaysia Medical Centre (UKMMC) over a two-year period
from September 2013 until August 2015. The paired samples consisting of buccal
swab and peripheral blood samples were withdrawn before the scheduled blood
transfusion and on day 7 after the blood transfusion.
Day 7 was chosen as there would presumably be a mixture (dual population) of the
transfused donor blood with the patient‟s own blood. It is also the most feasible time
for sampling as these patients would have their regular Full Blood Count (FBC) to
check the haemoglobin status after transfusion.
A phenotype of the red cell by serology and genotyping were performed by using
peripheral whole blood samples. The buccal swabs were processed to harvest the
DNA and were subjected to red cell genotyping only.
![Page 68: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/68.jpg)
66
The results of the red cell genotype which was acquired from the peripheral whole
blood and the buccal swabs were compared before and after transfusion. These results
were also correlated with the red cell phenotype obtained through serological
methods.
3.2 POPULATIONS STUDY
3.2.1 Study subjects
The subjects recruited for this study were adult patients above 18 years of age from
the thalassaemia clinic at Hospital Ampang and UKMMC.
3.2.1.1 Subjects selection
The subjects were given an explanation on the project protocols and its purposes prior
to sample collection. The procedures were stated in the Patient Information Sheet
(Appendix C). Upon obtaining the consent from the subjects, the samples were
collected and preceded for further testing. If the subjects withdrew their consent, the
samples were discarded and no other testing will be performed. The data from the
withdrawn subject will also be excluded from the study.
3.2.1.2 Inclusion criteria
1. Multiply-transfused thalassaemia patients where the interval of
transfusion is minimum 2 weeks apart.
2. Age above 18 years old.
![Page 69: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/69.jpg)
67
3.2.1.3 Exclusion criteria
1. Non multiply-transfused thalassaemia patients.
2. Have any oropharyngeal lesions or infection.
3. Age below 18 years old.
3.2.1.4 Sample size calculation
The sample size for the study subjects was calculated based on the methods from
Daniel (1999). The importance of calculating the sample size is to estimate the
population prevalence with good precision (Daniel, 1999).
n = Z2 x P(1-P)
∆2
n = Sample size
Z = Statistic level of confidence
P = Expected prevalence of proportion
∆ = Precision
The level of confidence was set at 95% and therefore the Z value is 1.96. Prevalence
was determined based on studies that showed a prevalence of 4% alloimmunization
after red cell transfusion (Reid & Yazdanbakhsh, 1998). Data from the 2009
Malaysian Thalassaemia Registry showed that of the 4,541 registered patients, 3,310
are transfusion-dependent (Malaysia, 2009). By using a 95% confidence interval and
using a cut-off point for statistical significance of 0.05, the number of samples
required is 60 patients.
![Page 70: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/70.jpg)
68
By taking into account a 10% of dropouts in patients and data, the total samples that
should be collected are 66 patients but only 63 patients were participated.
3.2.2 Control group
The samples were obtained voluntarily from USIM postgraduate students and staffs as
the control (normal healthy) for this study.
3.2.2.1 Control selection
The control group were also given an explanation on the project protocols and its
purpose similar as the subjects group. The control group was chosen for the
optimization of genotyping method for SNP RT-PCR platform by comparing the
results with the established conventional PCR kit from BAGene Health Care for the
determination of Rh types, KEL, Kidd and Duffy.
3.2.2.2 Inclusion criteria
1. Normal healthy individual.
2. Does not have any blood diseases or transfusion-transmitted
diseases.
3. Does not have any blood transfusion within six months.
4. Did not undergo any treatments related to blood diseases.
3.2.2.3 Exclusion criteria
1. Individual that does not meet the inclusion criteria.
![Page 71: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/71.jpg)
69
2. Have any oropharyngeal lesions or infection.
3.2.2.4 Sample size calculation
There was no sample size calculation for the control group as the samples from this
group were obtained for optimization of the method used for red cell genotyping only
by SNP RT-PCR platform and no prevalence data was derived from them.
3.3 ETHICAL CONSIDERATION AND FUNDING
This study was approved by the Medical Research Ethical Committee (MREC)
(NMRR-12-567-12622) (Appendix A) and Universiti Kebangsaan Malaysia Medical
Centre (UKMMC) (FF-419-2012) (Appendix B). This study was funded by the
Ministry of Higher Education (MOHE) Malaysia from the Exploratory Research
Grant Scheme (ERGS) (ERGS/1/2012/SKK06/USIM/03/1). All of the information
obtained especially from the subjects was confidential.
3.4 SAMPLING METHODS
3.4.1 Preparation before sampling
3.4.1.1 Blood sample collection
There is no special preparation needed to collect the blood sample as it is a random
blood type sampling. Peripheral whole blood was collected in K2EDTA preservative
tubes.
![Page 72: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/72.jpg)
70
3.4.1.2 Buccal swab sample collection
To avoid sample contamination and the collection of foreign substances except the
buccal cells only, the subjects were asked to rinse his/her mouth thoroughly with tap
water before the sample was collected and they were also asked to refrain from
smoking and eating for at least 30 minutes prior to the swabbing (Kovacevic-Grujicic
et al., 2012).
3.4.2 Sampling on study subjects
3.4.2.1 Day 0 sampling: before transfusion
A total of 7 ml of peripheral whole blood was collected in two separate 3.5 ml
K2EDTA tubes. One tube was used for the Direct Coombs Test (DCT) and
Serological Red Cell Phenotype and the other tube was used for the DNA extraction
for the SNP RT-PCR. Samples were kept at temperature ranging from 2oC-8
oC for not
more than 1 week after the collection date.
The buccal swab was collected using two sterile cotton swabs from the left and right
inner cheek by scrapping firmly 15 times. The cells were harvested for DNA
extraction for the SNP RT-PCR. Samples were left at room temperature for not more
than 1 week after the collection date.
3.4.2.2 Day 7 sampling: 1 week post-transfusion
For all of the study subjects, the sampling and testing was done similarly as Day 0.
![Page 73: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/73.jpg)
71
Figure 3.1: Workflow of the study subjects
3.4.3 Sampling on control group
A total of 7 ml of peripheral whole blood was collected in two separate 3.5 ml
K2EDTA tubes. One tube was used for Direct Coombs Test (DCT) and Serological
Red Cell Phenotype and the other tube was used for DNA extraction for conventional
PCR and SNP RT-PCR.
Phenotype
by
serology
Day of blood
transfusion
(D0)
Day 7: Post
transfusion
(D7)
Buccal Swab
AND
7 ml Peripheral
whole blood sample
in 2 K2EDTA tubes
Buccal Swab
AND
7 ml Peripheral
whole blood sample
in 2 K2EDTA tubes
Peripheral
whole
blood
Buccal
swab
Buccal
swab
Peripheral
whole
blood
Genotype by
SNP RT-PCR
Phenotype
by
serology
Genotype by
SNP RT-PCR
MULTIPLY-TRANSFUSED THALASSAEMIA PATIENTS;
REQUIRING ≥2-4 WEEKLY BLOOD TRANSFUSIONS (n=63)
![Page 74: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/74.jpg)
72
The buccal swab was collected using two sterile cotton swabs from the left and right
inner check by scrapping firmly 15 times and the cells were harvested for DNA
extraction for the conventional PCR and SNP RT-PCR.
The samples were stored in similar conditions as with the study subjects‟ samples.
Figure 3.2: Workflow of the control group
3.5 LABORATORY METHODS
3.5.1 Serological test using peripheral whole blood
The blood collection tube which contained the sample was centrifuged to separate the
plasma and the packed red cells. The packed red cells were washed with voluminous
normal saline 0.9% (B. Braun, Germany) and 4% red cell suspension was prepared
from the washed packed red cells for blood grouping test (forward) and phenotype
Buccal Swab
Genotype by PCR
7 ml Peripheral whole blood
sample in 2 K2EDTA tubes
Phenotype
by serology
Genotype by
PCR
Conventional
PCR
SNP RT-
PCR
Conventional
PCR
SNP RT-
PCR
CONTROL GROUP (n=17)
![Page 75: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/75.jpg)
73
tests. The plasma was separated into a clean plastic tube for reverse blood grouping
test and antibody testing.
3.5.1.1 Procedure for wash packed red cells
In preparing the wash packed red cells, 0.5 ml of packed red cells was pipetted into a
clean test tube. Voluminous normal saline 0.9% was added into the test tube and the
test tube was spun at 3,000 rpm for one minute. The supernatant was discarded. This
step was repeated 3-4 times. At the last wash, the supernatant must be clear and
completely removed by pipetting them out of the test tube.
3.5.1.2 Procedure for preparation of 4% red cell suspension
In preparing of 1 ml of a 4% red cell suspension, 0.4 ml of the washed packed red
cells was transferred to a tube with 9.6 ml of normal saline 0.9% (Combs et al., 2005).
The tube was covered or caped with the tube stopper and then was gently inverted for
several times.
To compare the colour and density of the suspension by eye, a volume of the prepared
suspension was transferred to a 10 x 75 mm tube. A similar volume of a known 4%
red cell suspension (e.g. commercial reagent red cell suspension) also was transferred
to another 10 x 75 mm tube. The two tubes were held in front of a light source to
compare them.
![Page 76: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/76.jpg)
74
3.5.1.3 Procedure for forward blood group test (tube method)
Four clean glass tubes 10 x 75 mm were prepared and labelled accordingly with
NOVACLONE™
Antisera Anti-A, Anti-B, Anti-AB and Anti-D. One drop of antisera
was added into each of the tube according to the label. Then, one drop of 4% red cell
suspension was added into each tube. The tubes were spun at 3,000 rpm for 15-20
seconds and the results were read macroscopically. The agglutination was observed
and graded as in Section 3.5.1.9.
3.5.1.4 Procedure for reverse blood group test (tube method)
Three clean glass tubes were prepared and labelled accordingly with A cell, B cell and
O cell. One drop of plasma was added into each tube. Then, one drop of A cell, B cell,
O cell was dropped according to the label. The tubes were spun at 3,000 rpm for 15-20
seconds and the agglutination was graded as stated in Section 3.5.1.9.
3.5.1.5 Procedure for antibody screening (tube method)
Three clean glass tubes were prepared and labelled with screening red cells reagent
(PANOSCREEN® Cell I, Cell II and Cell III). One drop of plasma was added into
each tube. Then, one drop of Cell I, Cell II and Cell III was added into the tubes
respectively. The samples were spun at 3,000 rpm for 20 seconds and the results were
recorded at room temperature. After that, one drop of Low Ionic Strength Solution
(LISS) (Diaclon, Switzerland) was added into each tube and all of the tubes were
incubated at 37oC for 15 minutes. After the incubation period, the tubes were spun at
3,000 rpm for 20 seconds and the results were recorded. Then the samples were
washed 3-4 times with normal saline 0.9% followed by the addition of two drops of
![Page 77: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/77.jpg)
75
Anti Human Globulin (AHG) (Diaclon, Switzerland) into each tube after the last wash
was finished. Then, the tubes were spun again at 3,000 rpm for 20 seconds and the
results were recorded. All of the negative results were tested with one drop of Coombs
Control Cell (CCC) for validity.
3.5.1.6 Procedure of red cell phenotype by Direct Antiglobulin Test
method for Rhesus, Kidd and Kell phenotype
Seven clean glass tubes were prepared and labelled properly with commercially
prepared antisera: Anti-E, Anti-e, Anti-C, Anti-c (Rhesus phenotype), Anti-Jka, Anti-
Jkb (Kidd phenotype) and Anti-K (Kell phenotype) (Diaclon, Switzerland). One drop
of antisera was added into each of the tube respectively and followed with one drop of
4% red cell suspension. Then, the mixture was mixed properly before centrifuged at
3,000 rpm for 20 seconds. The results were read macroscopically and were graded as
stated in Section 3.5.1.9.
3.5.1.7 Procedure of red cell phenotype by Indirect Antiglobulin Test
method for Cellano and Duffy phenotype
Three clean glass tubes were prepared and labelled properly with commercially
prepared antisera: Anti-k (Cellano phenotype), Anti-Fya and Anti-Fy
b (Duffy
phenotype) (Diaclon, Switzerland). One drop of antisera was added into each of the
tube respectively and followed by the addition of one drop of 4% red cell suspension.
The mixtures were mixed properly and were incubated at 37oC for 30 minutes. Then,
the samples were washed at least 3-4 times with normal saline 0.9%. After the
samples were washed, two drops of Anti Human Globulin (AHG) were added into
![Page 78: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/78.jpg)
76
each tube. The tubes were spun again at 3,000 rpm for 20 seconds and the results were
recorded as stated in Section 3.5.1.9. All negative results were tested with one drop of
CCC for validity.
3.5.1.8 Procedure for Direct Coombs test
3.5.1.8.1 Polyspecific AHG
Two drops of AHG reagent were mixed with one drop of 4% red cell suspension in a
clean glass tube. Then, the tube was centrifuged at 3,000 rpm for 20 seconds and the
result was read macroscopically and was recorded as stated in Section 3.5.1.9
3.5.1.8.2 Monospecific Anti-IgG
One drop of Anti-IgG reagent (Diaclon, Switzerland) was mixed with one drop of 4%
red cell suspension in a clean glass tube. Then, the tube was centrifuged at 3,000 rpm
for 20 seconds and the result was read macroscopically and was recorded as stated in
Section 3.5.1.9
3.5.1.8.3 Monospecific Anti-C3d
One drop of Anti-C3d reagent (Diaclon, Switzerland) was mixed with one drop of 4%
red cell suspension in a clean glass tube. The tube was incubated at room temperature
for 5 minutes and then centrifuged at 3,000 rpm for 20 seconds. The result was read
macroscopically and was recorded as stated in Section 3.5.1.9.
![Page 79: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/79.jpg)
77
3.5.1.9 Test reaction
A 4+ reaction is represented by one solid aggregate or clump of cells.
A 3+ reaction is represented by several large aggregates or clump of cells.
A 2+ reaction is represented by small to medium sized aggregates with clear
background.
A 1+ reaction is represented by small aggregates with turbid reddish background.
w+ or +/- reaction is represented by barely visible aggregate with turbid background.
A MF reaction is represented by any degree of agglutination in a sea of unagglutinated
cells.
A Negative reaction (0) is interpreted when no agglutination occur with smooth
reddish background.
Haemolysis is interpreted when the plasma is red in colour.
3.5.2 Molecular technique
3.5.2.1 DNA extraction
3.5.2.1.1 Peripheral whole blood sample
The DNA was extracted using a commercial kit (QIAamp DNA Blood Mini Kit,
Qiagen, Germany) to reduce the contamination and to improve the quality of the
extracted DNA. The kit contained the following components:
![Page 80: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/80.jpg)
78
Protease K
Buffer AL
Buffer AW1
Buffer AW2
Buffer AE
The protocols were carried out according to the kit instructions with some
modifications at certain steps and are as follows:
Three hundred microliters of K2EDTA peripheral whole blood was pipetted into a
sterile 1.5 ml micro centrifuge tube. The tube was centrifuged at 3,000 rpm for 5
minutes. The supernatant was removed and discarded as much as possible to achieve a
total volume of 200 µl without disturbing the buffy coat layer on the top of the red
packed cells. If the sample volume was less than 200 µl, appropriate volume of PBS
pH 7.2 was added.
Twenty microliters of QIAGEN Protease was pipetted into the bottom of the tube. The
tube was mixed thoroughly by vortexing vigorously. Then, 200 µl of Buffer AL was
added into the sample and were mixed thoroughly by vortexing vigorously to obtain a
homogenous solution. After that, the tube was incubated at 56oC for 10 minutes. Two
hundred microliters of absolute ethanol was added into the tube after incubation and
was mixed thoroughly by vortexing vigorously before centrifuged at 6,500 xg for 1
minute.
The mixture was then carefully transferred into the QIAamp Spin-Column in a 2 ml
collection tube without wetting the rim, the cap was closed and was centrifuged at
6,500 xg for 1 minute. The QIAamp Spin-Column was placed in a clean 2 ml
![Page 81: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/81.jpg)
79
collection tube and the tube containing the filtrate was discarded. Then, 500 µl of
Buffer AW1 was added without wetting the rim and the tube was centrifuged at 6,500
xg for 1 minute. The spin column was transferred into the new collection tube and the
tube that containing the filtrate was discarded.
Five hundred microliters of Buffer AW2 was added into the tube without wetting the
rim and the tube was centrifuged at 13,300 xg for 10 minutes. Then, the spin column
was transferred to a new 1.5 ml micro centrifuge tube and the tube containing the
filtrate was discarded. Thirty microliters of Buffer AE was added into the spin column
during the elution step and the spin column was incubated at room temperature (15-
25oC) for 5 minutes. After that, the spin column was centrifuged at 6,500 xg for 1
minute. The elution step was repeated once again and the procedure was carried out as
previously described. Lastly, the genomic DNA was quantified and stored at -20oC
until required. The quantification method was carried out as discussed in Section
3.5.2.2
3.5.2.1.2 Buccal swab sample
3.5.2.1.2.1 Preparation of Phosphate Buffered Saline (PBS) 10X
Two grams of Potassium Chloride (KCl) together with 80 g of Natrium Chloride
(NaCl), 2 g of Monopotassium Phosphate (KH2PO4) and 11.5 g Sodium
Monohydrogen Phosphate Heptahydrate (Na2HPO4.7H2O) were diluted with 1 L of
distilled water. The pH of the solution was measured until it reached pH 7.2. Then, the
solution was filtered using filter paper.
![Page 82: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/82.jpg)
80
3.5.2.1.2.2 Preparation of Phosphate Buffered Saline (PBS) 1X
Hundred millilitres of 10X PBS which was prepared earlier, was diluted in 900 ml
distilled water to make up a 1 L of 1X PBS. The pH was measured until it reached pH
7.2. Then, the solution was sterilized using an autoclave.
3.5.2.1.2.3 Procedure of DNA extraction from buccal swab samples
The same extraction kit with the blood samples were used for the DNA extraction of
the buccal swab samples. The protocols were carried out according to the kit
instructions with some modifications at certain steps and are as follows:
After scrapping the buccal cells from the left and right inner cheek of the subjects with
two different swabs for each side, the swabs were air-dried for about 30 minutes. In
the meantime, a new 1.5 ml micro centrifuge tube was filled with 400 µl of Phosphate
Buffered Solution (PBS) 1X pH 7.2. Then, one swab was placed in the micro
centrifuge tube and the swab was mixed properly with the PBS. Then, the swab was
separated from the stick using a pair of scissors. The tube was capped and vortexed
vigorously (while vortexing, the swab still remains in the tube). The swab was then
removed by pressing it against the wall of the tube. Then, the second swab was placed
in the same micro centrifuge tube and the same steps were repeated similar as the first
swab. Then, the tube was centrifuged at 6,500 xg for 1 minute. The supernatant was
removed while the sediment (pellet) was left intact in the tube.
Twenty microliters of QIAGEN Protease and 400 µl of Buffer AL were pipetted into
the bottom of the tube. The tube was mixed thoroughly by vortexing vigorously. After
![Page 83: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/83.jpg)
81
that, the tube was incubated at 56oC for 20 minutes. Four hundred microliters of
absolute ethanol was added into the tube after incubation and was mixed thoroughly
by vortexing vigorously before being centrifuged at 6,500 xg for 1 minute.
Then, 700 µl of the mixture was carefully transferred into the QIAamp Spin-Column
in a 2 ml collection tube without wetting the rim. The cap was closed and was
centrifuged at 6,500 xg for 1 minute. Then the spin column was transferred into the
new collection tube. The remaining mixture was added into the spin column and was
centrifuged at 6,500 xg for 1 minute.
After that, the QIAamp Spin-Column was placed in a clean 2 ml collection tube while
the tube containing the filtrate was discarded. Five hundred microliters of Buffer AW1
was added without wetting the rim and the tube was centrifuged at 6,500 xg for 1
minute. The spin column was then transferred into the new collection tube and the
tube containing the filtrate was discarded.
Five hundred microliters of Buffer AW2 was added into the tube without wetting the
rim and the tube was centrifuged at 13,300 xg for 10 minutes. Then, the spin column
was transferred to a new 1.5 ml micro centrifuge tube while the tube containing the
filtrate was discarded. Thirty microliters of Buffer AE was added into the spin column
during the elution step and the spin column was incubated at room temperature (15-
25oC) for 5 minutes. After that, the spin column was centrifuged at 6,500 xg for 1
minute. This elution step was repeated once again and the procedure was carried out
as described previously. Lastly, the genomic DNA was quantified as described in
Section 3.5.2.2 and stored at -20oC until required.
![Page 84: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/84.jpg)
82
3.5.2.2 DNA quantification
The quantity and quality of the extracted DNA was determined by the
NanoPhotometer®
P-Class analysis using ultraviolet (UV) light. The DNA yields were
determined from the concentration of DNA in the eluate, measured by the absorbance
at 260 nm (A260) and the reading should be within 0.1 – 1.0. The purity was
determined by calculating the ratio of absorbance at 260 nm (A260) to absorbance at
280 nm (A280). Pure DNA has an A260/A280 ratio of 1.7 – 1.9. The A260/A230 ratio
is used as a secondary measure of nucleic purity. The values of the pure samples were
often higher than the respective A260/A280 ratio values. The A260/A230 ratio should
be greater than 1.5, ideally close to 1.8. Otherwise, it may indicate the presence of
contaminants with the absorbance at 230 nm (A230) (Qiagen, 2013).
3.5.2.3 Conventional Polymerase Chain Reaction (PCR) methodology
3.5.2.3.1 Buffers and solutions
3.5.2.3.1.1 Tank buffer and gel buffer
Fifty millilitres of 20X LB Conductive Medium (Faster Better Media, USA) buffer
was diluted in 950 ml distilled water to make up a 1 L of 1X LB Conductive Medium
buffer (working solution) for the tank buffer and gel buffer.
3.5.2.3.2 2% Agarose gel preparation
Two grams of agarose powder (Agarose Biotechnology Grade, Norgen Biotek,
Canada) was weighed and added to a clean Schott Bottle to which a 100 ml of 1X LB
![Page 85: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/85.jpg)
83
Conductive Medium buffer (working solution) was added. The bottle was placed in
the microwave and the solution was heated until all of the agarose powder was
completely dissolved. The bottle was removed from the microwave and 4 µl of
GoodView Nucleic Acid Stain (SBS Genetech, China) was added to the agarose gel
and mixed well. This solution was then poured into the casting tray and was allowed
to polymerize at least 30 minutes prior to sample loading.
3.5.2.3.3 BAGene DNA-SSP Kits – Conventional PCR
A commercially available kit for conventional PCR method for the determination of
Rh types, KEL, Kidd and Duffy systems on a molecular genetic basis from the BAG
Health Care GmbH, Germany was used. This method was only performed on control
samples and then the results from this method were compared with the result from
SNP RT-PCR method. The control samples that used in both method (conventional
PCR and SNP RT-PCR) then were used as a negative and positive control for each
gene detected when SNP RT-PCR method was performed on the study subjects
samples.
The test procedure for conventional PCR was done by using the Sequence Specific
Primers (SSP)-PCR. 10/20 BAGene plates/strips which were sufficient for 10/20
typings. The strips contained the pre-aliquoted and dried reaction mixtures consisting
of allele specific primers, internal control primers (specific for the HGH gene (human
growth hormone) and chromosome I genomic sequence, 90.000 bp 5‟ of Rhesus Box
respectively) and nucleotides. 10X PCR buffer was also provided together with the
kit. Amplification parameters were optimized to a final volume of 10 µl.
![Page 86: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/86.jpg)
84
The calculation of the master mix consisting of 10X PCR buffer, DNA solution, Taq
Polymerase and Aqua dest was done prior to the test. The composition of the master
mix depends on the number of reaction mixes as shown in Table 3.1.
Table 3.1: Composition of the master mix depending on the number of reaction
mixes
No.
of
mixes
Aqua
dest
(µl)
10X PCR
buffer
(µl)
DNA
solution.
(50-100
ng/µl)
(µl)
Taq
Polymerase
(5 U/µl)
(µl)
Total Volume,
approximately
(µl)
1 8 1 1 0.08 10
2 16 2 2 0.2 20
6 50 7 7 0.5 65
7 70 9 9 0.7 90
8 80 10 10 0.8 100
9 88 11 11 0.9 110
10 96 12 12 1.0 120
11 104 13 13 1.0 130
12 112 14 14 1.1 140
13 128 16 16 1.3 160
14 136 17 17 1.4 170
15 144 18 18 1.4 180
16 152 19 19 1.5 190 Source: BAGene DNA-SSP Kits, 2010
For the determination of Rh types, BAGene RH-TYPE (ref number: 6645) kit was
used and for the determination of KEL, Kidd and Duffy systems, BAGene KKD-
TYPE (ref number: 6650) kit was used. Both of these kits have different number of
mixes and the preparations of the master mix were followed based on Table 3.1.
3.5.2.3.4 PCR cycling program
The DNA template was amplified in a Mastercycler® epGradient S (Eppendorf,
Germany) and the program set up was shown in Table 3.2.
![Page 87: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/87.jpg)
85
Table 3.2: PCR Cycling Program using BAGene DNA-SSP Kits
Program-Step Time Temperature No. of Cycles
First Denaturation 5 min 96oC 1 Cycle
Denaturation 10 sec 96oC 5 Cycles
Annealing+Extension 60 sec 70oC
Denaturation 10 sec 96oC 10 Cycles
Annealing 50 sec 65oC
Extension 45 sec 72oC
Denaturation 10 sec 96oC 15 Cycles
Annealing 50 sec 61oC
Extension 45 sec 72oC
Final Extension 5 min 72oC 1 Cycle Source: BAGene DNA-SSP Kits, 2010
3.5.2.3.5 Gel electrophoresis
The separation of the amplification products was performed by electrophoresis via a
(horizontal) agarose gel. Six microliters of the completed reaction mixture was mixed
with 1 µl of 6X Bromophenol Blue DNA Loading Dye (Norgen Biotek, Canada) and
then loaded in each slot of the gel. At the end of the gel slot, 6 µl of LowRanger
100bp DNA Ladder (100bp-2000bp) (Norgen Biotek, Canada) was loaded.
Electrophoretic separation was done at 10-12 V/cm (with 20 cm distance between the
electrodes approximately 200-240 V) for 40 minutes.
3.5.2.3.6 Documentation and interpretation of result
For documentation, the gel was viewed under gel documentation system (Alpha
Innotech). The exposure time and the aperture were adjusted until the bands were
drawn sharp and stand out against the dark background.
To interpret the results, the evaluation diagram which was provided together with the
BAGene DNA-SSP Kits, Bag Health Care was used. Only bands that have the correct
![Page 88: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/88.jpg)
86
size in correlation to the DNA length standard was considered positive. The correct
sizes can be found in the worksheet and evaluation diagram (Appendix D). In all lanes
without the allele-specific amplification, the internal control has to be 434 bp in all
cases but at lane 2 for PCR reaction of RH-TYPE, the fragment length of the internal
control is 659 bp.
3.5.2.4 Single Nucleotide Polymorphisms Real Time – Polymerase Chain
Reaction (SNP RT-PCR) methodology
3.5.2.4.1 Selection of suitable assay for SNP RT-PCR methodology
The information of the genes of interest were searched through the gene database from
the National Center for Biotechnology Information (NCBI)
(http://www.ncbi.nlm.nih.gov/) before the suitable assay was selected (as shown in
Figure 3.3). The example shown was for KEL system.
![Page 89: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/89.jpg)
87
Figure 3.3: Information searching from the NCBI website for selection of the
suitable assay
1) Front page of NCBI website
2) All of the information about the KEL system
1
2
![Page 90: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/90.jpg)
88
3) Details about the gene of interest
4) Details about the SNP of the KEL system
3.5.2.4.2 TaqMan® SNP genotyping assay
The TaqMan® SNP genotyping assay was designed and optimized to work with
TaqMan®
Universal PCR Mastermix using the same thermal cycling conditions for
genotyping SNPs. The product used the 5‟ nuclease assay for amplifying and
detecting specific SNP alleles in purified genomic DNA samples. This assay contains
3
4
![Page 91: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/91.jpg)
89
two components; sequence-specific forward and reverse primers to amplify the
polymorphic sequence of interest and two TaqMan® MGB probes, where one probe
was labelled with VIC® dye to detect the designated Allele 1 sequence, whilst another
probe was labelled with FAM™
dye to detect the designated Allele 2 sequence. All
assay primers/probes sets selected to detect the SNPs responsible for variant antigen
expression in this study were purchased either as predesigned or custom-designed
based on locus files submitted to Applied Biosystems® (Table 3.3). For the purpose of
this study, 4 Custom-Designed TaqMan®
SNP genotyping assays and 2 Pre-Designed
TaqMan®
SNP genotyping assays were used. The steps identifying which assay was
custom-designed or pre-designed types were shown in Figure 3.4.
Table 3.3: Specifics of selected genotyping assays
System
Name
Gene Antigen SNP rs# Base
Change
AA change
Rh RHCE
E/e 609320 676G>C P226A
C/c 45493401 307T>C S103P
676785 307T>C S103P
Kell KEL K/k 8176058 698C>T T193M
Kidd JK Jka/Jk
b 1058396 838G>A D280N
Duffy FY Fya/Fy
b 12075 125G>A G42D
![Page 92: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/92.jpg)
90
Figure 3.4: Workflow of searching the assay type
1) Applied Biosytems website was opened and directly went to SNP Genotyping Analysis
TaqMan®
Assays page.
2) The page was scrolled down and the unique rs number was typed in the “Enter target
information box”.
1
2
![Page 93: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/93.jpg)
91
3 (a): The rs number was not in the system; custom-designed assay.
3 (b): The rs number was in the system; pre-designed assay.
3.5.2.4.2.1 Custom TaqMan® SNP genotyping assay – RHCE and KEL blood
group antigens
The custom TaqMan® SNP genotyping assays is a part of the custom TaqMan
®
genomic assays service which is available when a product for a SNP of interest is not
found on the Applied Biosystems®
website. This assay development service that
3 (a)
3 (b)
![Page 94: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/94.jpg)
92
designed, synthesized, formulated and delivered analytically quality-controlled primer
and probe sets for genotyping assays based on the sequence information that was
submitted to the Applied Biosystems® representative. Assays to SNPs, as well as to
detect insertions/deletions (in/dels) and multinucleotide polymorphisms (MNPs) up to
6 bases in length, for both human and nonhuman targets, can be designed. In this
study, 4 assays for the genotyping studies were designed:
Table 3.4: Assay for RHCc blood group antigens (1)
Assay Name rs45493401
Assay ID AHGJ8DN
Reporter 1 Dye VIC
Reporter 1 Quencher NFQ
Reporter 2 Dye FAM
Reporter 2 Quencher NFQ
Forward Primer Sequence CTGCTGGACGGCTTCCT
Reverse Primer Sequence CCCAATACCTGAACAGTGTGATGAC
Reporter 1 Sequence CCCAGGAGGGAACT
Reporter 2 Sequence TCCCAGAAGGGAACT
Table 3.5: Assay for RHCc blood group antigens (2)
Assay Name rs676785
Assay ID AHFA97F
Reporter 1 Dye VIC
Reporter 1 Quencher NFQ
Reporter 2 Dye FAM
Reporter 2 Quencher NFQ
Forward Primer Sequence CCCAATACCTGAACAGTGTGATGAC
Reverse Primer Sequence CTGCTGGACGGCTTCCT
Reporter 1 Sequence CTTCCCAGAAGGGAACT
Reporter 2 Sequence CCCAGGAGGGAACT
![Page 95: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/95.jpg)
93
Table 3.6: Assay for RHEe blood group antigens
Assay Name RHCE676G_C
Assay ID AHBKEE7
SNP ID rs609320
Reporter 1 Dye VIC
Reporter 1 Quencher NFQ
Reporter 2 Dye FAM
Reporter 2 Quencher NFQ
Forward Primer Sequence GCATTCTTCCTTTGGATTGGACTTC
Reverse Primer Sequence GCCCTCTTCTTGTGGATGTTCTG
Reporter 1 Sequence TGTCAACTCTGCTCTGCT
Reporter 2 Sequence TGTCAACTCTCCTCTGCT
Table 3.7: Assay for KEL blood group antigens
Assay Name KEL698C_T
Assay ID AHCTCLF
SNP ID rs8176058
Reporter 1 Dye VIC
Reporter 1 Quencher NFQ
Reporter 2 Dye FAM
Reporter 2 Quencher NFQ
Forward Primer Sequence GCATCTCTGGTAAATGGACTTCCTT
Reverse Primer Sequence GGAAATGGCCATACTGACTCATCA
Reporter 1 Sequence AAGTCTCAGCGTTCGGT
Reporter 2 Sequence AGTCTCAGCATTCGGT
3.5.2.4.2.2 Pre-Designed TaqMan® SNP genotyping assay – Kidd and Duffy
blood group antigens
TaqMan®
Pre-Designed SNP genotyping assay has more than 3 million genome-wide
assays including assays to more than 2.5 million HapMan SNP, as well as ~ 30,000
high value nonsynonymous cSNPs (including known disease mutations and SNPs in
protein domains associated with drug binding regions). These made to order assays,
available in multiple scales, are manufactured and functionally tested upon ordering.
For this study, 2 Pre-Designed TaqMan® SNP genotyping assays were used.
![Page 96: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/96.jpg)
94
Table 3.8: Assay for Kidd blood group antigens
Assay ID C___1727582_10
Gene Symbol SLC14A1
SNP ID rs1058396
Reporter 1 Dye VIC
Reporter 1
Quencher
NFQ
Reporter 2 Dye FAM
Reporter 2
Quencher
NFQ
Context Sequence ACTCAGTCTTTCAGCCCCATTTGAG[A/G]ACATCTACTT
TGGACTCTGGGGTTT
Gene of interest Kidd
Table 3.9: Assay for Duffy blood group antigens
Assay ID C___2493442_10
Gene Symbol DARC;LOC100131825;CADM3
SNP ID rs12075
Reporter 1 Dye VIC
Reporter 1
Quencher
NFQ
Reporter 2 Dye FAM
Reporter 2
Quencher
NFQ
Context Sequence GATTCCTTCCCAGATGGAGACTATG[A/G]TGCCAACCTG
GAAGCAGCTGCCCCC
Gene of interest Duffy
3.5.2.4.3 TaqMan® GTXpress
™ master mix
TaqMan®
GTXpress™
master mix is a ready to use master mix for the PCR using the
Applied Biosystems®
7500 Fast Real Time PCR Systems (Applied Biosystems®,
USA).
![Page 97: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/97.jpg)
95
3.5.2.4.4 PCR reaction mix components
The PCR reaction consisted of; TaqMan® GTXpress
™ Master Mix (2X), TaqMan
®
Genotyping Assay Mix (20X), DNase-free water and sample. The calculation was
done prior to the test. The composition of the master mix depends on the number of
reaction mixes as shown in Table 3.10.
Table 3.10: PCR reaction mix components
PCR reaction mix components
Component Volume for 5-µL
PCR reaction
(µL/well)
Volume for 10-µL
PCR reaction
(µL/well)
Volume for 25-µL
PCR reaction
(µL/well)
TaqMan®
GTXpress™
Master
Mix (2X)
2.50 5.0 12.50
TaqMan®
genotyping assay
mix (20X)
0.25 0.5 1.25
DNase-free water 1.25 2.5 6.25
Sample 1.0 2.0 5.0
Total 5.0 10.0 25.0 Source: TaqMan
® Genotyping
Master Mix protocol, 2014
In SNP RT-PCR, it only requires 1 to 10 ng of purified gDNA sample per well.
Therefore, a standardized purified gDNA was calculated before preparing the PCR
reaction mix.
3.5.2.4.5 PCR cycling program
The DNA template was amplified in the Applied Biosystems® 7500 Fast Real Time
PCR Systems and the program was set up as shown in Table 3.11.
![Page 98: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/98.jpg)
96
Table 3.11: PCR Cycling Program for Applied Biosystems®
7500 Fast Real Time
PCR Systems
Stage Step Temp Time
Holding DNA Polymerase Activation 95oC 20 sec
Cycling
(40 cycles)
Denature 95oC 3 sec
Anneal/Extend 60oC 30 sec
Source: TaqMan® Genotyping
Master Mix protocol, 2014
3.5.2.4.6 Interpretation of results
After PCR amplification, an endpoint plate-read was performed using an Applied
Biosystems® Real-Time PCR System software v2.0.6. The Sequence Detection
System (SDS) Software uses the fluorescence measurements made during the plate
read to plot fluorescence (Rn) values based on the signals from each well. The plotted
fluorescence signals indicate which alleles were detected in each sample. The SDS
software recorded the results of the allelic discrimination run on a scatter plot of
Allele 1 versus Allele 2 (Figure 3.5).
![Page 99: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/99.jpg)
97
Figure 3.5: Interpretation of the SNP result
The clusters in the allelic discrimination plot show the three genotypes of one SNP
Source: TaqMan® Genotyping
Master Mix protocol, 2014
3.5.2.4.7 Sequencing
The sequencing was done by outsourcing it to a selected company (1st BASE
Laboratories Sdn Bhd). Only selected samples were chosen for the sequencing service
which consists of:
i. Few samples from each assays (from the control group and study subjects) to
ensure the sequence of the assays is correct.
ii. Samples that have discrepancies results between blood and buccal swab
sample (if any).
Homozygous Allele 2
Heterozygous Allele 1/ Allele 2
Homozygous Allele 1
![Page 100: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/100.jpg)
98
Due to the short base pair (bp) for each assay tested, cloning must be done before the
sequencing method and the reference clones were constructed by subcloning of the
RHCE, KEL, SLC14A1 and DARC fragments into pJET1.2/vector. Five positive
colonies were randomly picked for sequencing.
3.6 DATA COLLECTION
The data domains and related specific data that were collected in this study were
tabulated as shown in Table 3.12.
Table 3.12: Data domains that were collected in this study
A Demographic Gender, age, ethnic
B Type of thalassaemia and
its clinical severity
Thalassaemia major, Thalassaemia intermedia: E-
beta thalassaemia, HbH disease
C Transfusion history Frequency of transfusion, type of red cell product
transfused
D Serological investigations Red cell phenotype from pre-transfusion and post-
transfusion samples, Direct Coombs Test (DCT)
result and antibody screening result.
E Red cell profile ABO group, RH status, KEL group, Kidd group,
Duffy group
F Red cell genotype Pre-transfusion and post-transfusion samples from
peripheral blood and buccal swab
3.7 DATA ANALYSIS
Analyses of the data from the study subjects‟ samples were performed. TaqMan®
Genotyper Software v1.0.1 was used to analyse the raw data from the genotyping
experiments which were created using the Applied Biosystems® Real-Time PCR
system. This software gives more accurate, efficient and comprehensive
![Page 101: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/101.jpg)
99
understanding of the results. The results were viewed as individual data points for
each reaction on the Cartesian plot representing the signal intensity of the fluorescent
VIC® reporter (Allele 1) versus signal intensity of the fluorescent FAM
™ reporter
(Allele 2). Genotype calls were determined by interpretation of the ratio of VIC®
signal to FAM™
signal for each system. Reaction clusters obtained at the x/y axis that
do not contain the template of DNA were used as negative controls for the experiment
The statistical analysis was performed using the IBM Statistical Package for the Social
Science (SPSS) software version 20.0. Demographic data was summarized and
tabulated. The continuous variables were summarized by descriptive statistics, which
included the sample size and mean. Discrete variables were summarized by
frequencies and percentages illustrated in contingency tables.
Cross tabulation tables were employed to compare the result of red cell phenotype by
serological methods with PCR genotype on peripheral blood samples and also to
compare the result of red cell genotype by PCR on peripheral whole blood with buccal
swabs.
![Page 102: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/102.jpg)
100
CHAPTER IV
FINDINGS
4.1 RESULTS FOR STUDY SUBJECTS
4.1.1 Demographic data
A cross-sectional comparative study was conducted at Faculty of Medicine and Health
Sciences Universiti Sains Islam Malaysia (USIM), Hospital Ampang and Universiti
Kebangsaan Malaysia Medical Centre (UKMMC) over a two-year period from
September 2013 until August 2015. Complete data was available in 33 multiply-
transfused thalassaemia patients. The study population consisted of 12 males (36.4%)
and 21 females (63.6%). Twenty-three patients (69.7%) were Malays and 10 (30.3%)
were Chinese. There were no patients from other ethnic groups (Figure 4.1). In this
study, 15 (45.5%) were thalassaemia β-intermedia patients. Fourteen (42.4%) had
thalassemia β-major and four (12.1%) had Hb H disease (Table 4.1).
![Page 103: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/103.jpg)
101
Figure 4.1: Distribution of the study subjects according to gender and race
Table 4.1: Types of thalassaemia according to race
Malay Chinese Total
Thalassaemia β-
Major
8
8
14
Thalassaemia β-
Intermedia
14 1 15
Hb H Disease 3 1 4
Total 23 10 33
4.1.2 Frequency of ABO, RHD blood group, antibody screening and
Direct Coombs Test.
Blood grouping was performed by antigen antibody agglutination test using
commercial monoclonal antisera. The distribution of ABO phenotypes in the total
samples were 8 (24.2%), 8 (24.2%), 2 (6.1%), 15 (45.5%) for groups A, B, AB and O,
0
5
10
15
20
25
Male Female
7
16 5
5
Chinese
Malay
![Page 104: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/104.jpg)
102
respectively (Figure 4.2). All patients were Rhesus positive. The phenotypic
frequencies of blood group in ABO and Rhesus system according to gender is shown
in Table 4.2. Antibody screening for unexpected antibodies showed 24.2% positive.
The DCT results are as shown in Table 4.3.
Figure 4.2: Phenotypic frequencies of blood group in ABO and Rhesus system
Table 4.2: Phenotypic frequencies of blood group in ABO and Rhesus system
according to gender
Gender
Phenotype
Total A Rh D
Positive
B Rh D
Positive
AB Rh D
Positive
O Rh D
Positive
Male
2
4
0
6
12
Female 6 4 2 9 21
Total
8
8
2
15
33
8
8
2
15 A Rh D Positive
B Rh D Positive
AB Rh D Positive
O Rh D Positive
![Page 105: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/105.jpg)
103
Table 4.3: Antibody screening and DCT results
Result Antibody
screening
DCT (pre-transfusion,
D0)
DCT (post-transfusion,
D7)
AHG IgG C3d AHG IgG C3d
Positive
(%)
8
(24.2)
10
(30.3)
6
(18.2)
3
(9.1)
10
(30.3)
4
(12.1)
2
(6.1)
Negative
(%)
25
(75.8)
23
(69.7)
27
(81.8)
30
(90.9)
23
(69.7)
29
(87.9)
31
(93.9)
4.1.3 Frequency of transfusion and types of red blood cell product
transfused
Eleven patients received a blood transfusion as frequent as every 4 weekly intervals,
shown in Table 4.4. Thirteen of thalassaemia β-major patients received 2 to 4 weekly
blood transfusions and only one patient required 6 to 8 weekly blood transfusions.
Eight of thalassaemia β-intermedia patients required 2 to 4 weekly blood transfusions,
five received 6 to 8 weekly blood transfusion and two required 12 weekly blood
transfusions. Only three of the Hb H disease patients received 6 to 8 weekly blood
transfusions and one patient required 12 weekly blood transfusions (Figure 4.3).
There are three types of red blood cell products that patients received during
transfusion; Filtered Red Blood Cells (FRBC), Packed Red Blood Cells (PC) and
Buffy-coat Poor Packed Cells (BCPPC) as shown in Figure 4.4. Twenty-eight patients
received FRBC products.
![Page 106: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/106.jpg)
104
Table 4.4: Frequency of transfusion
Frequency of transfusion Number of patients
2 weekly 4
4 weekly 17
6 weekly 3
8 weekly 6
12 weekly 3
Figure 4.3: Frequency of transfusion based on types of thalassaemia
13
8
1
5
3
2
1
0
2
4
6
8
10
12
14
Thal β- Major Thal β- Intermedia Hb H disease
2-4 weekly
6-8 weekly
12 weekly
![Page 107: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/107.jpg)
105
Figure 4.4: Types of red blood cell product received during transfusion
Data shown were obtained during this study period only. The types of red cell product received by
patients may be different from the previous transfusion.
4.1.4 Red cell phenotype using peripheral blood: pre- and post-
transfusion samples
The phenotype frequencies determined serologically for RH, KEL, Kidd and Duffy
are shown in Table 4.5. The most frequent phenotype of the RH system determined on
pre-transfusion blood samples were Rh C+c- (45.5%) and Rh E-e+ (57.6%). For Kidd
system, the most frequent phenotype was Jk(a+b+) (27.3%) and for Duffy system was
Fy(a+b+) (39.4%). There were 9, 8, 18 and 16 samples that could not be interpreted
due to mixed field reactions in the Rh C/c, Rh E/e, Kidd and Duffy system,
respectively.
On day 7 post-transfusion peripheral blood samples, Rh C+c- (45.5%) and Rh E-e+
(57.6%) were detected as the most frequent phenotype in the RH system. Jk(a+b+)
(36.4%) and Fy(a+b+) (21.2%) were also the most frequent phenotype in the Kidd and
28
1 4
FRBC
PC
BCPPC
![Page 108: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/108.jpg)
106
Duffy system, respectively. There were 9, 9, 17 and 23 samples that could not be
interpreted in the Rh C/c, Rh E/e, Kidd and Duffy system, respectively.
For KEL system, in pre- and post-transfusion samples, it shows 100% of the
phenotype is K-k+ and no undetermined samples were detected.
![Page 109: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/109.jpg)
107
Table 4.5: Blood group phenotype frequencies on pre- and post-transfusion using
peripheral blood samples
Pre-
transfusion
Patients (N = 33) Post-
transfusion
Patients (N = 33)
Frequency n Frequency n
Rh system
Rh C+c- 45.5 15 Rh C+c- 45.5 15
Rh C+c+ 27.3 9 Rh C+c+ 27.3 9
Rh C-c+ 0 0 Rh C-c+ 0 0
Undetermined 27.3 9 Undetermined 27.3 9
Rh E+e- 0 0 Rh E+e- 0 0
Rh E+e+ 18.2 6 Rh E+e+ 15.2 5
Rh E-e+ 57.6 19 Rh E-e+ 57.6 19
Undetermined 24.2 8 Undetermined 27.3 9
Kidd system
Jk(a+b-) 12.1 4 Jk(a+b-) 6.1 2
Jk(a+b+) 27.3 9 Jk(a+b+) 36.4 12
Jk(a-b+) 6.1 2 Jk(a-b+) 6.1 2
Undetermined 54.5 18 Undetermined 51.5 17
Duffy system
Fy(a+b-) 12.1 4 Fy(a+b-) 9.1 3
Fy(a+b+) 39.4 13 Fy(a+b+) 21.2 7
Fy(a-b+) 0 0 Fy(a-b+) 0 0
Undetermined 48.5 16 Undetermined 69.7 23
KEL system
K+k- 0 0 K+k- 0 0
K+k+ 0 0 K+k+ 0 0
K-k+ 100 33 K-k+ 100 33
Undetermined 0 0 Undetermined 0 0 N, number of individuals; n, number of alleles
4.1.5 Blood group genotype by SNP RT-PCR using peripheral blood:
pre- and post-transfusion samples
Genotypic frequencies results for pre- and post-transfusion using peripheral blood
samples are shown in Table 4.6. The most frequent genotype of the RH system were
RHCE*CC (66.7%) and RHCE*ee (81.8%), the Kidd system was JK*A/JK*B
![Page 110: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/110.jpg)
108
(45.5%) and the Duffy system was FY*A/FY*A (75.8%). The genotype of the KEL
system was KEL*2/KEL*2 (100%). All of the patients‟ samples of red blood cell
blood group genotype both on the pre- or post- transfusion samples were able to be
determined. The results are concordant between the two samplings.
Table 4.6: Blood group genotype frequencies on pre- and post-transfusion of
peripheral blood samples by using SNP RT-PCR method
Pre-
transfusion
Patients (N = 33) Post-
transfusion
Patients (N = 33)
Frequency n Frequency n
Rh system
RHCE*CC 66.7 22 RHCE*CC 66.7 22
RHCE*Cc 33.3 11 RHCE*Cc 33.3 11
RHCE*cc 0 0 RHCE*cc 0 0
Undetermined 0 0 Undetermined 0 0
RHCE*EE 0 0 RHCE*EE 0 0
RHCE*Ee 18.2 6 RHCE*Ee 18.2 6
RHCE*ee 81.8 27 RHCE*ee 81.8 27
Undetermined 0 0 Undetermined 0 0
Kidd system
JK*A/JK*A 30.3 10 JK*A/JK*A 30.3 10
JK*A/JK*B 45.5 15 JK*A/JK*B 45.5 15
JK*B/JK*B 24.2 8 JK*B/JK*B 24.2 8
Undetermined 0 0 Undetermined 0 0
Duffy system
FY*A/FY*A 75.8 25 FY*A/FY*A 75.8 25
FY*A/FY*B 21.2 7 FY*A/FY*B 21.2 7
FY*B/FY*B 3.0 1 FY*B/FY*B 3.0 1
Undetermined 0 0 Undetermined 0 0
KEL system
KEL*1/KEL*1 0 0 KEL*1/KEL*1 0 0
KEL*1/KEL*2 0 0 KEL*1/KEL*2 0 0
KEL*2/KEL*2 100 33 KEL*2/KEL*2 100 33
Undetermined 0 0 Undetermined 0 0 N, number of individuals; n, number of alleles
![Page 111: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/111.jpg)
109
4.1.6 Blood group genotype by SNP RT-PCR using peripheral blood and
buccal swab: pre-transfusion sampling
We collected samples from peripheral blood and buccal swabs at D0 or pre-
transfusion. DNA was extracted and the blood group genotype was determined using
SNP RT-PCR. Genotypic frequencies for pre-transfusion using peripheral blood and
buccal swab samples are as shown in Table 4.7. The most frequent genotype of the
RH system were RHCE*CC (66.7%) and RHCE*ee (81.8%), the Kidd system was
JK*A/JK*B (45.5%), the Duffy system was FY*A/FY*A (75.8%) and the KEL
system was KEL*2/KEL*2 (100%) for both types of samples. The results for both
sampling methods are concordant.
![Page 112: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/112.jpg)
110
Table 4.7: Blood group genotype frequencies which were determined on
peripheral blood and buccal swab pre-transfusion samples (D0) by
using SNP RT-PCR
Blood samples Patients (N = 33) Buccal swab
samples
Patients (N = 33)
Frequency n Frequency n
Rh system
RHCE*CC 66.7 22 RHCE*CC 66.7 22
RHCE*Cc 33.3 11 RHCE*Cc 33.3 11
RHCE*cc 0 0 RHCE*cc 0 0
Undetermined 0 0 Undetermined 0 0
RHCE*EE 0 0 RHCE*EE 0 0
RHCE*Ee 18.2 6 RHCE*Ee 18.2 6
RHCE*ee 81.8 27 RHCE*ee 81.8 27
Undetermined 0 0 Undetermined 0 0
Kidd system
JK*A/JK*A 30.3 10 JK*A/JK*A 30.3 10
JK*A/JK*B 45.5 15 JK*A/JK*B 45.5 15
JK*B/JK*B 24.2 8 JK*B/JK*B 24.2 8
Undetermined 0 0 Undetermined 0 0
Duffy system
FY*A/FY*A 75.8 25 FY*A/FY*A 75.8 25
FY*A/FY*B 21.2 7 FY*A/FY*B 21.2 7
FY*B/FY*B 3.0 1 FY*B/FY*B 3.0 1
Undetermined 0 0 Undetermined 0 0
KEL system
KEL*1/KEL*1 0 0 KEL*1/KEL*1 0 0
KEL*1/KEL*2 0 0 KEL*1/KEL*2 0 0
KEL*2/KEL*2 100 33 KEL*2/KEL*2 100 33
Undetermined 0 0 Undetermined 0 0 N, number of individuals; n, number of alleles
![Page 113: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/113.jpg)
111
4.1.7 Phenotype-genotype frequencies detected on pre-transfusion
peripheral blood samples
The blood group phenotype frequencies determined serologically on pre-transfusion
peripheral blood samples are shown in Table 4.5. There were a few samples that could
not be interpreted in each blood group system serologically.
DNA patients were tested using SNP RT-PCR. All of the patients‟ samples blood
group genotypes were able to be determined (Table 4.8). RHCE*CC (66.7%) and
RHCE*ee (81.8%) were the most frequent genotype in the RH system. JK*A/JK*B
(45.5%) and FY*A/FY*A (75.8%) were the most frequent genotype in their own
system, respectively. The frequencies were discordant in most but all undetermined
phenotypes by serology were resolved.
For KEL blood group system, the phenotype and genotype frequency was concordant;
KEL*2/KEL*2 (100%).
![Page 114: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/114.jpg)
112
Table 4.8: Phenotype-genotype frequencies for pre-transfusion peripheral blood
samples
Phenotype Patients (N = 33)
Genotype Patients (N = 33)
Frequency n Frequency n
Rh system
Rh C+c- 45.5 15 RHCE*CC 66.7 22
Rh C+c+ 27.3 9 RHCE*Cc 33.3 11
Rh C-c+ 0 0 RHCE*cc 0 0
Undetermined 27.3 9 Undetermined 0 0
Rh E+e- 0 0 RHCE*EE 0 0
Rh E+e+ 18.2 6 RHCE*Ee 18.2 6
Rh E-e+ 57.6 19 RHCE*ee 81.8 27
Undetermined 24.2 8 Undetermined 0 0
Kidd system
Jk(a+b-) 12.1 4 JK*A/JK*A 30.3 10
Jk(a+b+) 27.3 9 JK*A/JK*B 45.5 15
Jk(a-b+) 6.1 2 JK*B/JK*B 24.2 8
Undetermined 54.5 18 Undetermined 0 0
Duffy system
Fy(a+b-) 12.1 4 FY*A/FY*A 75.8 25
Fy(a+b+) 39.4 13 FY*A/FY*B 21.2 7
Fy(a-b+) 0 0 FY*B/FY*B 3.0 1
Undetermined 48.5 16 Undetermined 0 0
KEL system
K+k- 0 0 KEL*1/KEL*1 0 0
K+k+ 0 0 KEL*1/KEL*2 0 0
K-k+ 100 33 KEL*2/KEL*2 100 33
Undetermined 0 0 Undetermined 0 0 N, number of individuals; n, number of alleles
4.1.8 Phenotype-genotype frequencies detected on post-transfusion
peripheral blood samples
The blood group phenotype frequencies determined serologically on post-transfusion
peripheral blood samples are shown in Table 4.5. The phenotype-genotype
frequencies for post-transfusion peripheral blood are shown in Table 4.9. The
![Page 115: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/115.jpg)
113
frequency of undetermined serological phenotype was much higher on post-
transfusion.
All of the samples‟ genotypes were able to be determined by using SNP RT-PCR.
RHCE*CC (66.7%) and RHCE*ee (81.8%) was the highest frequent genotype in RH
system. JK*A/JK*B (45.5%) and FY*A/FY*A (75.8%) was the highest frequent
genotype in Kidd and Duffy system, respectively. All undetermined serological
phenotypes were resolved.
Similar to the pre-transfusion samples, the phenotype-genotype frequency for KEL
system also showed concordant results; KEL*2/KEL*2 (100%).
![Page 116: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/116.jpg)
114
Table 4.9: Phenotype-genotype frequencies for post-transfusion peripheral blood
samples
Phenotype Patients (N = 33)
Genotype Patients (N = 33)
Frequency n Frequency n
Rh system
Rh C+c- 45.5 15 RHCE*CC 66.7 22
Rh C+c+ 27.3 9 RHCE*Cc 33.3 11
Rh C-c+ 0 0 RHCE*cc 0 0
Undetermined 27.3 9 Undetermined 0 0
Rh E+e- 0 0 RHCE*EE 0 0
Rh E+e+ 15.2 5 RHCE*Ee 18.2 6
Rh E-e+ 57.6 19 RHCE*ee 81.8 27
Undetermined 27.3 9 Undetermined 0 0
Kidd system
Jk(a+b-) 6.1 2 JK*A/JK*A 30.3 10
Jk(a+b+) 36.4 12 JK*A/JK*B 45.5 15
Jk(a-b+) 6.1 2 JK*B/JK*B 24.2 8
Undetermined 51.5 17 Undetermined 0 0
Duffy system
Fy(a+b-) 9.1 3 FY*A/FY*A 75.8 25
Fy(a+b+) 21.2 7 FY*A/FY*B 21.2 7
Fy(a-b+) 0 0 FY*B/FY*B 3.0 1
Undetermined 69.7 23 Undetermined 0 0
KEL system
K+k- 0 0 KEL*1/KEL*1 0 0
K+k+ 0 0 KEL*1/KEL*2 0 0
K-k+ 100 33 KEL*2/KEL*2 100 33
Undetermined 0 0 Undetermined 0 0 N, number of individuals; n, number of alleles
4.1.9 Correlation of blood group genotype results between peripheral
blood and buccal swab samples: pre-transfusion sampling
There were full agreement of the genotype results between peripheral blood and
buccal swab samples in all the selected blood group systems tested (Table 4.10).
![Page 117: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/117.jpg)
115
Table 4.10: Genotype result between pre-transfusion peripheral blood and buccal
swab samples
Blood Samples Buccal Swab Samples
Rh System
CCee
CcEe
Ccee
CCee 22
CcEe 6
Ccee 5
CcEE
Kidd System JK*A/JK*B JK*A/JK*A JK*B/JK*B
JK*A/JK*B 15
JK*A/JK*A 10
JK*B/JK*B 8
Duffy System FY*A/FY*B FY*A/FY*A FY*B/FY*B
FY*A/FY*B 7
FY*A/FY*A 25
FY*B/FY*B 1
KEL System KEL*1/KEL*1 KEL*1/KEL*2 KEL*2/KEL*2
KEL*2/KEL*2 33
4.1.10 Correlation between phenotype and genotype results
Correlation between phenotype and genotype was done in only peripheral blood
samples as the genotypic result for buccal swab samples are concordant with the
genotypic result from peripheral blood samples (as shown in Table 4.10).
4.1.10.1 Phenotype-genotype discrepancies of pre-transfusion sampling
Duffy blood group system showed the highest number of discrepancies between the
red cell phenotype determined serologically with the genotype determined by
molecular technique (SNP RT-PCR). Twenty-five cases were discordant (Table 4.11).
![Page 118: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/118.jpg)
116
The main discrepancy was found in FY*A/FY*A when serologically showed
Fy(a+b+) and undetermined result (mixed field).
Twenty-two patients were found to have discrepancies between the serological
phenotype and genotype in the RH blood group system. Agreement between
phenotype and genotype was observed for RH blood group system in 18 patients.
Thirteen patients are CCee, 3 patients are CcEe and 2 patients are Ccee.
The Kidd blood group system showed 23 discrepancies between the two methods
used.
There were no discrepancy results in KEL blood group system.
![Page 119: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/119.jpg)
117
Table 4.11: Discrepancies of red cell blood group detected between serology and
SNP RT-PCR method for pre-transfusion peripheral blood samples
Serological
Phenotype
Genotype by SNP RT-PCR
Rh System
CCee
CcEe
Ccee
CCee 13 1
CcEe 2 3 1
Ccee 2
Undetermined 7 6 5
Kidd System JK*A/JK*B JK*A/JK*A JK*B/JK*B
Jk (a+b+) 6 1 2
Jk (a+b-) 1 3
Jk(a-b+) 1 1
Undetermined 7 6 5
Duffy System FY*A/FY*B FY*A/FY*A FY*B/FY*B
Fy(a+b+) 4 8 1
Fy(a+b-) 4
Undetermined 3 13
KEL System KEL*1/KEL*1 KEL*1/KEL*2 KEL*2/KEL*2
K-k+ 33 The shaded cells indicate the discrepant cases between phenotype by serology and genotype by SNP
RT-PCR. All results outside of the shaded cells represent concordances.
4.1.10.2 Phenotype-genotype discrepancies of post-transfusion sampling
Duffy blood group system also showed the highest number of discrepancies result
between the phenotype and genotype in post-transfusion peripheral blood samples.
Twenty-eight cases were discordant (Table 4.12). The main discrepancy was found in
FY*A/FY*A when four cases showed Fy(a+b+) and 18 cases could not be determined
by haemagglutination technique. Agreement between phenotype and genotype was
observed in 5 cases only; 2 were FY*A/FY*B and 3 were FY*A/FY*A.
![Page 120: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/120.jpg)
118
Fourteen patients were found to have discrepancies between the phenotype and
genotype result in RH blood group system. Nineteen cases have concordant results; 14
are CCee, 3 are CcEe and 2 are Ccee.
There were 24 discrepancies cases in Kidd system. The main discrepancy was found
in JK*A/JK*B when serologically showed Jk(a-b+) (1 case) and undetermined (8
cases). Agreement between phenotype and genotype was observed in 9 patients only.
Six patients were JK*A/JK*B, 2 patients were JK*A/JK*A and 1 patient was
JK*B/JK*B.
There were no discrepant cases in the KEL system.
![Page 121: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/121.jpg)
119
Table 4.12: Discrepancies of red cell blood group detected between serology and
SNP RT-PCR method for post-transfusion peripheral blood samples
Serological
Phenotype
Genotype by SNP RT-PCR
Rh System
CCee
CcEe
Ccee
CCee 14 1
CcEe 1 3 1
Ccee 1 2
Undetermined 6 2 2
Kidd System JK*A/JK*B JK*A/JK*A JK*B/JK*B
Jk (a+b+) 6 2 4
Jk (a+b-) 2
Jk(a-b+) 1 1
Undetermined 8 6 3
Duffy System FY*A/FY*B FY*A/FY*A FY*B/FY*B
Fy(a+b+) 2 4 1
Fy(a+b-) 3
Undetermined 5 18
KEL System KEL*1/KEL*1 KEL*1/KEL*2 KEL*2/KEL*2
K-k+ 33 The shaded cells indicate the discrepant cases between phenotype by serology and genotype by SNP
RT-PCR. All results outside of the shaded cells represent concordances.
4.1.11 Prevalence of donor leukocyte contamination in post-transfusion
peripheral blood samples
No discrepancy was recorded in blood genotype of pre- and post-transfusion
peripheral blood samples‟ results (as shown in Table 4.13). The frequency of each
antigen between pre- and post-transfusion results also showed full concordance (as
shown in Table 4.6).
![Page 122: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/122.jpg)
120
Table 4.13: Blood genotype result of pre- and post-transfusion peripheral blood
samples
Genotype of pre-
transfusion samples
Genotype of post-transfusion samples
Rh System
CCee
CcEe
Ccee
CCee 22
CcEe 6
Ccee 5
Kidd System JK*A/JK*B JK*A/JK*A JK*B/JK*B
JK*A/JK*B 15
JK*A/JK*A 10
JK*B/JK*B 8
Duffy System FY*A/FY*B FY*A/FY*A FY*B/FY*B
FY*A/FY*B 7
FY*A/FY*A 25
FY*B/FY*B 1
KEL System KEL*1/KEL*1 KEL*1/KEL*2 KEL*2/KEL*2
KEL*2/KEL*2 33
4.1.12 Comparison of DNA yields and purity between buccal swab and
peripheral blood samples
DNA yields and purity from buccal swab and peripheral blood samples are shown in
Table 4.14. Mean DNA concentration from buccal swab samples were lower than
peripheral blood samples (in both pre- and post-transfusion peripheral blood samples).
Mean DNA concentration from buccal swab samples were 14.14 ng/µl while mean
DNA concentration from pre- and post-transfusion blood samples were 338.08 ng/µl
and 275.11 ng/µl, respectively.
![Page 123: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/123.jpg)
121
For measurement of DNA purity, the mean A260/A280 ratio between all of the three
types of samples were almost similar; 1.81 for buccal swab and 1.79 for pre- and post-
transfusion peripheral blood samples.
Table 4.14: Comparison of DNA yields and purity according to different types of
samples
Types of samples Buccal swab
Peripheral Blood
Pre-transfusion
samples
Post-transfusion
samples
Number of
samples
33 33 33
Amount of sample
used
2 swabs 200 µl 200 µl
Mean DNA
concentration
(ng/µl; range)
14.14 (4.5 – 46.5) 338.08 (23 – 1015) 275.11 (62.5 – 721)
Mean A260/A280
ratio (range)
1.81 (1.70 – 2.25) 1.79 (1.70 – 1.85) 1.79 (1.71 – 1.84)
4.2 RESULTS FOR CONTROL GROUP
4.2.1 Demographic data
Seventeen samples were obtained voluntarily from USIM postgraduate students and
staffs as normal healthy controls for the study. The control group was chosen for the
optimization of the SNP RT-PCR platform. The control group consisted of 4 males
![Page 124: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/124.jpg)
122
(23.5%) and 13 females (76.5%). Sixteen (94.1%) were Malays and only 1 (5.9%) was
Indian (Figure 4.5).
Figure 4.5: Distribution of the control groups according to gender and race
4.2.2 PCR results
Results from conventional PCR using BAGene DNA SSP-Kits were compared with
the results from SNP RT-PCR.
4.2.2.1 Conventional results
The conventional PCR results are shown in Figure 4.6. We identified the patterns of
the genotypes and the figures shown below are the examples (according to the kit
package insert, APPENDIX D).
0
2
4
6
8
10
12
14
Male Female
4
12
1
Indian
Malay
![Page 125: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/125.jpg)
123
Figure 4.6: Conventional result by BAGene DNA SSP-Kits
Genotype: KEL*2/KEL*2; JK*A/JK*B; FY*A/FY*B
Genotype: KEL*2/KEL*2; JK*A/JK*A; FY*B/FY*B
![Page 126: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/126.jpg)
124
Genotype: KEL*2/KEL*2; JK*B/JK*B; FY*A/FY*A
Genotype: KEL*2/KEL*2; JK*A/JK*B; FY*B/FY*B
![Page 127: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/127.jpg)
125
Genotype: KEL*2/KEL*2; JK*A/JK*A; FY*A/FY*B
Genotype: Rh D Positive; CCee
![Page 128: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/128.jpg)
126
Genotype: Rh D Positive; CcEe
Genotype: Rh D Positive; ccEe
![Page 129: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/129.jpg)
127
Genotype: Rh D Positive; Ccee
4.2.2.2 SNP RT-PCR results
The samples were tested with the SNP RT-PCR platform after the conventional PCR
was performed and the blood group genotypes were determined. The results that are
shown in the SNP RT-PCR are in an allelic discrimination plot. The red colour plot
represents the homogenous (homozygous) for Allele 1, the blue colour plot represents
the homogenous (homozygous) for Allele 2 and the green colour plot represents the
heterogeneous (heterozygous) of Allele 1 and Allele 2 (Figure 4.7). List of the Allele
1 and Allele 2 for RH E/e, Kidd and Duffy system are stated in Table 4.15.
![Page 130: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/130.jpg)
128
Figure 4.7: SNP RT-PCR allelic plot results
Table 4.15: List of Allele 1 and Allele 2 for RH E/e, Kidd, Duffy and KEL blood
group system
Blood system SNP rs# Allele 1 Allele 2
RH E/e 609320 RH e RH E
Kidd 1058396 Jk b Jk a
Duffy 12075 Fy b Fy a
KEL 8176058 Cellano (k) Kell (K)
4.2.2.2.1 Results for RH C/c blood group system by using different assay
names and IDs
For RH C/c blood group systems, two primers with different assay names and assay
IDs were used. The results for both assays were found to be concordant (Figure 4.8 &
Figure 4.9). List of the Allele 1 and Allele 2 for RH C/c system is stated in Table 4.16.
![Page 131: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/131.jpg)
129
Figure 4.8: SNP RT-PCR allelic plot results for RH C/c (rs45493401)
14 samples were homozygous Allele 2, 9 samples were heterozygous Allele 1/ Allele 2 and 1 sample
was homozygous Allele 1
Figure 4.9: SNP RT-PCR allelic plot results for RH C/c (rs676785)
1 sample was homozygous Allele 2, 9 samples were heterozygous Allele 1/ Allele 2 and 14 samples
were Allele 1
Homozygous Allele 2
Heterozygous Allele 1/ Allele 2
Homozygous Allele 1
Homozygous Allele 2
Heterozygous Allele 1/ Allele 2
Homozygous Allele 1
![Page 132: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/132.jpg)
130
Table 4.16: List of Allele 1 and Allele 2 for RH C/c blood group system
Blood system SNP rs# Allele 1 Allele 2
RH C/c 45493401 RH c RH C
676785 RH C RH c
4.2.2.2.2 Sequencing results
Due to the short base pair (bp) for each assay tested, cloning have been done before
the sequencing method and the reference clones were constructed by subcloning of the
RHCE, KEL, SLC14A1 and DARC fragments into pJET1.2/vector. Five positive
colonies were randomly picked for sequencing. Figure 4.10 show the construct map
for the cloning process and Figure 4.11 are the detailed sequence of the whole
construct. List of the blood group results based on the SNP sequences are stated in
Table 4.17.
Figure 4.10: Construct map for the cloning process
![Page 133: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/133.jpg)
131
Figure 4.11: Detailed sequence of the whole construct
Primers sequences are highlighted in yellow and green colour indicate the positive colonies where they
were inserted.
![Page 134: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/134.jpg)
132
Table 4.17: List of the blood group results based on the SNP sequences
Gene SNP rs# SNP sequences
RH E/e 609320 CTTTGGATTGGACTTCTCAGCAGAG[C/G]AGAGTTGA
CACTTGGCCAGAACATC
C = RH E (Allele 2)
G = RH e (Allele 1)
RH C/c 45493401 GGACGGCTTCCTGAGCCAGTTCCCT[C/T]CTGGGAAG
GTGGTCATCACACTGTT
C = RH C (Allele 2)
T = RH c (Allele 1)
676785 AACAGTGTGATGACCACCTTCCCAG[A/G]AGGGAACT
GGCTCAGGAAGCCGTCC
A = RH c (Allele 2)
G = RH C (Allele 1)
KEL 8176058 TGGACTTCCTTAAACTTTAACCGAA[A/C/G/T]GCTGAG
ACTTCTGATGAGTCAGTAT
A/T = K (Kell) (Allele 2)
C/G = k (cellano) (Allele 1)
Kidd 1058396 ACTCAGTCTTTCAGCCCCATTTGAG[A/G]ACATCTACT
TTGGACTCTGGGGTTT
A = Jk b (Allele 1)
G = Jk a (Allele 2)
Duffy 12075 GATTCCTTCCCAGATGGAGACTATG[A/G]TGCCAACCT
GGAAGCAGCTGCCCCC
A = Fy b (Allele 1)
G = Fy a (Allele 2)
![Page 135: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/135.jpg)
133
4.2.3 Phenotype-genotype frequencies using peripheral blood samples
There was full agreement between phenotype determined serologically and genotype
by both conventional PCR and SNP RT-PCR method using peripheral blood samples
in the control group (Table 4.18).
Table 4.18: Phenotype-genotype frequencies using peripheral blood samples
Phenotype Control (N = 17)
Genotype Control (N = 17)
Frequency n Frequency N
Rh system
Rh C+c- 47.1 8 RHCE*CC 47.1 8
Rh C+c+ 47.1 8 RHCE*Cc 47.1 8
Rh C-c+ 5.9 1 RHCE*cc 5.9 1
Rh E+e- 0 0 RHCE*EE 0 0
Rh E+e+ 23.5 4 RHCE*Ee 23.5 4
Rh E-e+ 76.5 13 RHCE*ee 76.5 13
Kidd system
Jk(a+b-) 35.3 6 JK*A/JK*A 35.3 6
Jk(a+b+) 41.2 7 JK*A/JK*B 41.2 7
Jk(a-b+) 23.5 4 JK*B/JK*B 23.5 4
Duffy system
Fy(a+b-) 64.7 11 FY*A/FY*A 64.7 11
Fy(a+b+) 23.5 4 FY*A/FY*B 23.5 4
Fy(a-b+) 11.8 2 FY*B/FY*B 11.8 2
KEL system
K+k- 0 0 KEL*1/KEL*1 0 0
K+k+ 0 0 KEL*1/KEL*2 0 0
K-k+ 100 17 KEL*2/KEL*2 100 17 Genotype results shown here represented for both types of PCR method (conventional PCR and SNP
RT-PCR)
![Page 136: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/136.jpg)
134
4.2.4 Blood group genotype frequencies between peripheral blood and
buccal swab samples by conventional PCR and SNP RT-PCR
There is also full agreement of genotype results between peripheral blood and buccal
swab samples using both types of PCR method (conventional PCR and SNP RT-PCR)
(Table 4.19). The most frequent genotype in RH system were RHCE*CC (47.1%) and
RHCE*Cc (47.1%) and RHCE*ee (76.5%). JK*A/JK*B (41.2%), FY*A/FY*A
(64.7%) and KEL*2/KEL*2 (100%) were the most frequent genotype in Kidd, Duffy
and KEL system, respectively.
![Page 137: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/137.jpg)
135
Table 4.19: Genotype frequencies between peripheral blood and buccal swab
samples
Peripheral
Blood
samples
Control (N = 17) Buccal swab
samples
Control (N = 17)
Frequency n Frequency n
Rh system
RHCE*CC 47.1 8 RHCE*CC 47.1 8
RHCE*Cc 47.1 8 RHCE*Cc 47.1 8
RHCE*cc 5.9 1 RHCE*cc 5.9 1
RHCE*EE 0 0 RHCE*EE 0 0
RHCE*Ee 23.5 4 RHCE*Ee 23.5 4
RHCE*ee 76.5 13 RHCE*ee 76.5 13
Kidd system
JK*A/JK*A 35.3 6 JK*A/JK*A 35.3 6
JK*A/JK*B 41.2 7 JK*A/JK*B 41.2 7
JK*B/JK*B 23.5 4 JK*B/JK*B 23.5 4
Duffy system
FY*A/FY*A 64.7 11 FY*A/FY*A 64.7 11
FY*A/FY*B 23.5 4 FY*A/FY*B 23.5 4
FY*B/FY*B 11.8 2 FY*B/FY*B 11.8 2
KEL system
KEL*1/KEL*1 0 0 KEL*1/KEL*1 0 0
KEL*1/KEL*2 0 0 KEL*1/KEL*2 0 0
KEL*2/KEL*2 100 17 KEL*2/KEL*2 100 17 Genotype results shown here represented for both types of PCR method (conventional PCR and SNP
RT-PCR)
4.2.5 Comparison of DNA yields and quality between buccal swab and
peripheral blood samples
DNA yields and purity from buccal swab and peripheral blood samples are shown in
Table 4.20. Mean DNA concentration from buccal swab samples were lower than
mean DNA concentration from blood samples. Mean DNA concentration from buccal
swab samples were 24.26 ng/µl while for peripheral blood samples were 109.41 ng/µl.
![Page 138: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/138.jpg)
136
For measurement of DNA purity, the mean A260/A280 ratio in both types of samples
were almost similar; 1.84 for buccal swab and 1.81 for peripheral blood samples.
Table 4.20: Comparison of DNA yields and quality between buccal swab and
peripheral blood samples
Types of samples Buccal swab Peripheral Blood
Number of samples
17
17
Amount of sample used 2 swabs 200 µl
Mean DNA
concentration (ng/µl;
range)
24.26 (5.0 – 73) 109.41 (26.5 – 241)
Mean A260/A280 ratio
(range)
1.84 (1.70 – 2.13) 1.81 (1.73 – 1.91)
![Page 139: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/139.jpg)
137
CHAPTER V
ANALYSIS AND DISCUSSIONS
5.1 INTRODUCTION
Serological tests are widely utilized in many blood banks and transfusion laboratories
to evaluate the presence of the major blood antigens, which are the A, B, AB, O and
the RhD antigens. These tests are routinely performed to avoid any unwanted side
effects, notably haemolytic transfusion reactions that may occur during or even after
the commencement of a blood transfusion. Nowadays, there are 35 known minor
blood groups with more than 300 different blood antigens identified (Transfusion,
2015). For a patient who receives only one or two transfusions during their lifetime,
mismatches for the minor blood antigens do not pose a problem. However, patients
that require regular or frequent blood transfusions especially those with red cell
disorders such as patients with red cell membrane disorders; such as hereditary
spherocytosis, southeast asian ovalostomatocytosis, globin chain disorders; such as
thalassaemia, sickle cell disease and other haemoglobinopathies, and patients with
enzymopathies; such as Glucose-6-Phosphate Dehydrogenase (G6PD) Deficiency,
their body can develop strong and sometimes even fatal immune responses. In some
cases, acute or delayed haemolytic reaction may occur. The Public Health Agency of
Canada has estimated that as many as 1 in 12,000 transfusions end in an acute
reaction, with as many as 1 in 600, 000 ending in death. Delayed reactions occur in as
![Page 140: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/140.jpg)
138
many as 1 in 5000 transfusion, even though less often fatal, it causes considerable
morbidity. Nevertheless, for many different reasons, including the
continual increase in reagent costs, unreliable serological results and lack of tests for
some antigens, the detection of minor blood antigens is not routinely performed either
on blood donors (Quill, 2008; Mograin, 2009) or on patients too. This problem is also
a major concern in most blood banks and transfusion laboratories in Malaysia due to
inability to provide the extended red cell blood group antigen phenotype to the
patients especially for those that require multiple transfusions. Accurate blood
phenotype assessment is also very difficult to implement for this group of patients due
to the presence of donor‟s blood cells in their blood circulation from previous
transfusions unless the red cell phenotyping is performed at diagnosis or prior to the
first transfusion. Unfortunately most of the hospital‟s blood banks in Malaysia are
unable to provide extended blood phenotype profile especially for the clinically
significant blood group antigens; RhCcEe, KEL, Kidd and Duffy.
After the discovery of the molecular basis of the ABO blood group by Yamamoto et
al., (1990), many researchers have shown their interest in identifying the other minor
blood groups by using molecular analysis (Cherif-Zahar et al., 1991; Hadley & Peiper,
1997; Lee, 1997; Dean, 2005). Currently, almost all of human blood groups genes
have now been cloned and the molecular basis for all of the clinically important blood
group polymorphisms have been determined by the rapidly growing variety of
technologies, from the low throughput to the high throughput platforms (Monteiro et
al., 2011). Difficulties in identifying the blood phenotype by serological test for
multiply-transfused patients are expected to be resolved by performing the molecular
technique.
![Page 141: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/141.jpg)
139
In order to prove the importance of molecular blood genotyping in multiply-transfused
patients, we compared their blood phenotype result by haemagglutination method with
the genotyping result by TaqMan®
SNP RT-PCR method. We also attempted to use an
alternative sampling technique other than peripheral blood as a source of DNA for
blood group genotyping. In light of the debate about donor‟s blood being present in
patients‟ circulation if genotyping was done from the recently transfused samples, we
adopted a D0 (pre-transfusion sample) and D7 (post-transfusion sample) for
comparison. Therefore, we have also compared the genotyping results from the blood
samples with samples obtained from buccal cell scrapping.
5.2 DEMOGRAPHIC DATA
The sample groups include thalassaemia β-intermedia patients (45.5%), thalassaemia
β-major patients (42.4%) and Hb H disease patients (12.1%). Thirteen of our
thalassemia β-major patients received 2 to 4 weekly blood transfusions and only one
patient required 6 to 8 weekly blood transfusions. From our β-intermedia patients,
eight of them required 2 to 4 weekly blood transfusions, five received 6 to 8 weekly
blood transfusions and two required 12 weekly blood transfusions. Only three of the
Hb H disease patients received 6 to 8 weekly blood transfusions and one patient
required 12 weekly blood transfusions. Majority of the patients received blood
transfusions as frequent as 4 weekly (51.5%). The main aim of the red cell transfusion
in these patients is to keep the mean haemoglobin level >9 g/dL as this condition is
vital to suppress ineffective erythropoiesis which is the basis for the clinical features
for this disease while minimising the complications and maintaining tissue
![Page 142: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/142.jpg)
140
oxygenation. The decision to start blood transfusion will require proper clinical
assessment of each individual thalassaemia patient. The blood transfusion should be
started promptly when there is clinical evidence of severe anaemia with signs or
symptoms of cardiac failure, failure to thrive and/or thalassaemia bone deformity
(Malaysia, 2009). Transfusion interval depends on the pre- and post-transfusion Hb
level in any types of thalassaemia and can be as frequent as 2 to 4 weeks apart
(Malaysia, 2008). Pre-transfusion Hb level should be kept at 9 to 10 g/dL and the
optimal post-transfusion Hb level should be targeted between 13.5 to 15.5 g/dL. It is
recommended that the Hb level should be monitored at least one hour after completion
of the transfusion (Malaysia, 2009).
A high alloimmunization rate of around 20% was observed among Asian
Thalassaemia patients (Singer et al., 2000). Other than antigenic discrepancies, the
immune system in particular, is undoubtedly involved with the heightened
development of harmful alloantibodies and/or autoantibodies in these patients.
Immunomodulatory effects of transfused blood, especially suppression of recipient
white cells, is a well-recognized area (Blajchman, 1998). However, absolute
lymphocytosis especially in splenectomized thalassaemia individuals, is accompanied
by an increase in serum immunoglobulins, presence of circulating immune complexes
and cells coated with surface immunoglobulins, which are the result of the
immunomodulatory effects of blood elements, absence of spleen and recipient
immune status (Blajchman, 1998; Ghio et al., 1999; Sibinga, 1999). This activated
immune system increases the propensity of thalassaemia patients, who are considered
high-risk individuals to develop alloantibodies and autoantibodies.
![Page 143: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/143.jpg)
141
In this current study, 24.2% of the patients were detected positive for either
alloantibodies or autoantibodies or both. DCT was variably positive both in pre-
transfusion and post-transfusion samplings. Most of the patients were referred cases
from other hospitals and hence were subjected to different transfusion policies and
practises of each hospital. Furthermore, once current or previous record of
alloimmunization has been documented, the availability of RBC units for transfusion
may be severely restricted by compatibility issues and the time taken to identify the
compatible units may be prolonged. Current practices in Malaysia only test for the
presence of ABO and RhD antigen by traditional agglutination method. When specific
antigen-negative bloods are needed, they must test the donor‟s blood for the presence
of the relevant antigens that must be avoided. The patients also must have their
extended red blood cell antigen profiled. However, for these regularly-transfused
patients, this test becomes more complicated because the results from the
agglutination method may not be reliable due to the coated antibodies on the surface
of the patients‟ own RBC that typically reacts with all cell tested or mixture with
previous transfused blood.
The „pre-transfusion blood sampling or D0‟ and „post-transfusion blood sampling or
D7‟ approach were employed in the present work to eliminate result‟s bias, validate
patient sampling while at the same time confirming the DNA results and evaluate the
presence of potential donor leukocyte.
![Page 144: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/144.jpg)
142
5.3 THE IMPORTANCE OF DOING PATIENTS’ EXTENDED RED
CELL BLOOD GROUP GENOTYPE
The relevance of performing extended blood group genotyping in multiply-transfused
patients has been demonstrated to be useful. It will allow the clinicians to determine
the actual extended blood group and assisting in the selection of antigen-negative
RBCs for transfusion (Guelsin et al., 2010). By receiving antigen-matched RBCs
based on genotype, patients have shown better in vivo RBC survival, increased
haemoglobin levels and diminished frequency of transfusion (Castilho et al., 2002a;
Ribeiro et al., 2009).
However, limited study has been performed on the prevalence of the extended blood
groups which are clinically significant amongst the Malaysian population. Improper
data recording and management of data especially regarding the extended blood group
antigens amongst the multiply-transfused patients further complicate the problem
especially when phenotypic-matched blood is required for supply. This has happened
because most of the patients will refer their cases from one hospital to other
specialized hospital depending on their health, degree of complications and socio-
economic status. In this present works, the extended blood groups were tested by
haemagglutination method and molecular method. However, the results from
haemagglutination method are unreliable and have many undetermined results. The
phenotype frequencies of pre- and post-transfusion samples are not in line between the
two samplings as shown in Table 4.5. When the molecular method was applied to
determine the extended blood groups, the results from the molecular method are the
most reliable. The genotype frequencies of pre- and post-transfusion are concordant as
![Page 145: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/145.jpg)
143
shown in Table 4.6 and the undetermined blood phenotype results were resolved.
However, the molecular method is not simple to perform as haemagglutination
method. The selection of suitable primer must be done properly and correctly as some
of the blood antigens tested are polymorphic and lacking of local data towards the
blood antigens making the process quite difficult. In the beginning of this study, we
plan to compare the genotyping results with two different molecular methods;
conventional PCR using BAGene DNA-SSP Kits and SNP RT-PCR. However, due to
budget constraint, we have decided to perform the optimization and comparison of the
commercial kit and the SNP RT-PCR platform for healthy controls only. After a
concordant result was obtained, the patient samples were genotyped with the SNP RT-
PCR method only.
5.3.1 Primer designation for determination of RHCcEe and KEL blood
group antigens
The primers detecting the RHCcEe and KEL antigens are custom made. It is only
available when a product for a SNP of interest is not found on the Applied
Biosystems® website and the primers will be designed upon customer‟s request.
During the primer designation process, the important factors that need to be
considered are, i) which antigens is most prevalent amongst Malaysian population and
ii) which amino acid substitutions are associated with the blood group antigens
because both blood groups are polymorphic and SNPs analysis are going to be applied
in this study.
Rhesus blood group is one of the most complicated blood group systems (Dean, 2005)
and it has 54 well-known antigens (Transfusion, 2015) which is encoded by two
![Page 146: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/146.jpg)
144
genes; RHD and RHCE (Flegel, 2007). In this study, we only focus on RhCE. The
RhCE protein encodes the C/c antigen and E/e antigen with many other antigens. For
C/c polymorphism, there are four amino acid substitutions that show association but
only Ser103Pro encoded by exon 2 is definitive for determining C or c activity. The
E/e polymorphism only come from a Pro226Ala substitution (Mouro et al., 1993;
Dean, 2005). Difficulties were encountered when choosing suitable primer for RhCc.
Two different assay names with different assay IDs (rs45493401, AHGJ8DN and
rs676785, AHFA979F, respectively) have been found during the primer designation
process. Both assays showed that they will detect the same antigen at the same amino
acid substitution. Thus we decided to try both assays and compare the results which
both assays were found to be concordant. As mentioned earlier, even with different
assay names or IDs for one blood group antigen, the results should be reliable if the
primer is correct as proven by sequencing analysis.
Primer designation for KEL blood group antigen was not as complicated as RhCc
because the k/K polymorphism results from single base mutation only, 698C>T SNP
in exon 6, encoding a Thr193Met substitution. This is the only amino acid substitution
that represents k/K polymorphism.
5.3.2 Primer designation for determination of Kidd and Duffy blood
group antigens
In contrast with the primer designation for RhCcEe and KEL blood group antigens,
the primer used for these two types of blood antigens are pre-designed; it is available
in multiple scales, manufactured and functionally tested upon ordering - quite stable
and trusted. The blood group antigens tested were not polymorphic. In Kidd blood
![Page 147: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/147.jpg)
145
group systems, there are only three antigens detected; Jka, Jk
b and Jk
3 however only
Jka and Jk
b are the most common. The Jk
a/Jk
b polymorphism arise from SNP
838G>A, resulting in a D280N substitution. For Duffy blood group systems, there are
five antigens but only two are the most important; Fya and Fy
b which differ by a SNP
125G>A resulting in a G42D substitution. From the blood genotypic results, we did
not find any rare blood group (eg: Fy(a-b-) or Jk(a-b-)) as all of our study subjects are
Malaysians and these types of blood group antigen are rare amongst the Asian
population.
5.4 CORRELATION BETWEEN PHENOTYPE AND GENOTYPE
RESULTS IN PRE- AND POST-TRANSFUSION SAMPLES
The haemagglutination method, though regarded as the gold standard in blood group
identification, the results may be unreliable in certain situations. Many factors need to
be considered before analysing the results and assigning the blood groups. These
include patient‟s history of previous exposure to donor blood transfusions, the
duration, pregnancy status in females and transplantation should be taken into account
especially for vulnerable groups such as infants, the elderly and immunocompromised
patients.
After receiving multiple transfusions, the patients‟ serologic typing of blood group
phenotype may be very problematic to determine due to mixed RBC population in
their blood circulation. Based on the phenotype-genotype results from this current
study from two samplings (D0 and D7), it is shown that there is a very high likelihood
of mistyping when haemagglutination is performed (Table 4.8 and Table 4.9). This
![Page 148: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/148.jpg)
146
would potentially lead to false assignment of the relevant blood group systems. When
doing a correlation between phenotype and genotype results, 25 cases in Duffy
system, 23 cases in Kidd system and 22 cases in the RH blood group system were
found to have discrepancies in pre-transfusion or D0 samples (Table 4.11). This shows
that the extended blood group phenotype was unreliable even before transfusion was
commenced. Post-transfusion samples or D7 was even worse whereby, 28 cases in
Duffy system, 24 cases in Kidd system and 14 in the RH blood group system cases
were found to have discrepancies (Table 4.12). Blood group phenotypes were also
undetermined when mixed-field reactions were recorded.
A number of studies and observations have reported that the high failure rate of
serological antigen typing in multiply-transfused patients makes the serological results
unreliable (Reid et al., 2000; Rožman et al., 2000; Castilho et al., 2002a; Castilho et
al., 2002b; Ribeiro et al., 2009; Guelsin et al., 2010). The phenotyping results in all of
these studies have shown discordance with the genotyping results. In these studies,
different types of molecular methods were employed amongst the multiply-transfused
patients with various haematological diseases and one study in patients with renal
failure. Mixed-field agglutination was also observed in more than one antigen typing
which makes it difficult to interpret the patients‟ blood phenotype and determination
of the antigen-matched red cell that are suitable for the patients. As accurately stated
in AABB Technical Manual (Martha Rae Combs et al., 2005), the results of serologic
test can only be accessed with combination of the patient‟s history and clinical data
and the interpretation of the results must be done by a well-trained personnel.
![Page 149: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/149.jpg)
147
In this present work, even though there are many discrepancies results between pre-
(D0) and post-transfusion samples (D7) in each blood group tested, the blood group
phenotypes which were managed to find are amongst the common genotypes and most
likely within the range of the Malaysian population. In the Rh system, there are 3 Rh
phenotypes/genotypes that can be seen from the results; CCee, CcEe and Ccee. Due to
the fact that all the patients were Rh D positive, there are many possibilities of Weiner
assignments that can arise from the results. The possible Weiner assignments for
RHDCCee are R1R1 and R1r‟, for RHDCcEe are R1R2, R0RZ, R0Ry, R1r‟‟, R2r‟ and RZr
and for RHDCcee are R1r, R0r‟, and R1R0. One study was conducted amongst 594
Malaysian donors and the results showed that that the five most common phenotype
for Rhesus blood group system in the Malaysian population were RHDCCee/R1R1,
RHDCcEe/R1R2, RHDCcee/R1r, RHDccEE/R2R2 and RHDccEe/R2r (Musa et al.,
2012). In other study involving 1014 Malaysian donors, ccee/rr was reported to be
amongst the common phenotype for Rhesus blood group system in the Malaysian
population which was relatively high in Indian donors (Musa et al., 2015). Based on
these databases, our patients‟ blood group phenotype can still be classified as common
genotypes.
For Kidd and Duffy blood group system, we did not find any rare genotypes such as
Jk(a-b-) and Fy(a-b-). Jk(a+b+) is always the first common genotype among Asians
followed by Jk(a+b-) and Jk(a-b+). This finding is in line with our finding and also
supported with the study by Musa et al., (2012) involving 594 Malaysian donors.
However, the Jk(a-b-) or commonly known as antigen Jk3, though cannot be found in
this present work, it can still be found amongst the Malaysian population and it is the
rarer genotype (Musa et al., 2012). As with the Duffy system, it has been previously
![Page 150: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/150.jpg)
148
reported that the Fya is very common amongst Asian populations with the occurrence
of about 90.8%, 81.5% and 69% in Chinese, Japanese and Thai subjects, respectively
(Reid & C, 2004). Similar findings have been obtained in this study, where the
Fy(a+b-) is the commonest phenotypes followed by Fy(a+b+) and Fy(a-b+). No Fy(a-
b-) was found in this study which is considered as rare phenotype even though it can
still be found amongst Malaysian population (Musa et al., 2012). Fy(a-b-) has been
reported with higher frequencies in countries with high incidence of Plasmodium
vivax and Plasmodium knowlesi (Hamblin & Di Rienzo, 2000; Beth H. Shaz & John
D. Roback, 2009). Plasmodium vivax is currently the most dominant malaria species
in Malaysia (Seng, 2006).
In the KEL system, the k antigen has high frequency in all populations while K
antigen has frequency of about 9% amongst Caucasians and may be as high as 25%
amongst Arabs (Reid & C, 2004). The findings in this study are not in conflict with all
the previous reports since the majority of the patients were kk positive.
The DNA that used for detecting the blood genotyping in this current study was
collected from the buffy-coat layer comprising of leukocytes. In patients who are
multiply-transfused, the presence of any residual donor leukocytes may interfere with
molecular blood group genotyping. However, based on the genotyping results using
pre-transfusion (D0) and post-transfusion samples (D7) (Table 4.6 and Table 4.13),
the results were fully concordant and showed that potential donor leukocytes admixed
with patient‟s leukocytes from the post-transfusion samples did not interfere with the
results. Therefore peripheral blood samples collected 7 days post-transfusion may still
be used in blood genotyping. Nevertheless, the presence or clearance of donor
![Page 151: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/151.jpg)
149
leukocyte contamination cannot be discussed in detail in this report as a chimerism
analysis was not performed. While Lee and colleagues (1995) stated that the
concentration of donor leukocytes in recipient blood increases transiently in their post-
transfusion orthopaedic surgery patients, a number of studies showed that DNA from
the post transfusion samples would not affect the blood group genotyping results
without the risk of detecting microchimerism (Reid et al., 2000; Rožman et al., 2000;
Castilho et al., 2002a). This would most likely be due to the overwhelming excess of
patients‟ own DNA. These findings are parallel with our finding. On the other hand,
the finding by Reid and associates (2000) was also in agreement with Wenk and
Chiafari (1997) who showed that, in 12 massively transfused adult patients, Southern
blot analysis of variable number of tandem repeat polymorphism sequences detected
patient DNA but not donor DNA. There were also many arguments amongst the
researchers regarding their finding about microchimerism after transfusion of
leukodepleted blood to patients (Lee et al., 2005; Utter et al., 2006; Lapierre et al.,
2007). Based on the types of blood product transfused (Figure 4.4), not all patients
received leukoreduced red cells and hence would be difficult to analyse. To support
our findings, when compared with the genotype results obtained from buccal swab,
the results also showed full concordance (Table 4.10).
For many years, it has been observed that RBC components from allogeneic donors
contain 106 to 10
8 leukocytes which are capable of survival and expansion (Schechter
et al., 1972; Schechter et al., 1977; Lee et al., 1995). Although these leukocytes do not
serve any therapeutic role, prolonged exposure to donor cells can cause transfusion-
related complications, such as chill-fever reactions known as febrile non-haemolytic
transfusion reactions, to HLA alloimmunization, graft-versus-host disease (GVHD)
![Page 152: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/152.jpg)
150
and transfusion transmitted diseases (Lee et al., 1995; Gupta et al., 2011; Alves et al.,
2012). For management of blood transfusion amongst thalassaemia patients in
Malaysia, whenever possible fresh blood of less than 14 days and leukoreduced
products should be given to the patients (Centre, 2007; Malaysia, 2009) in order to
reduce the risk of transfusion complications that will make the patients‟ blood
transfusion management become more complicated. Universal leukodepletion is also a
strategy that could be adopted to minimise the risk of donor leukocyte contamination.
5.5 THE USEFULNESS OF SNP MOLECULAR GENOTYPING IN
RESOLUTION OF PHENOTYPE DISCREPANCIES ISSUES
Haemagglutination method is demonstrated to be simple but challenging to interpret
in the present work. There are many phenotype discrepancies reported. Molecular
analysis in determining the blood group overcomes the limitation of
haemagglutination method. This is because it is not influenced by immunoglobulin
coating of the red blood cells, the presence of the recently-transfused red blood cells
or any form of polyagglutination or by the limitations commonly found with the
antisera. No mixed-field reaction will occur which lead to the undetermined result.
Undetermined phenotypes detected using the haemagglutination technique in D0 and
D7 samples were resolved when the patient‟s DNA was subjected to red cell blood
group system genotyping using the SNP RT-PCR. Mixed-field reaction denotes a
mixture of more than one population of red cells and therefore a positive and negative
reaction are both seen in the reaction tube. However, for KEL system, there was full
concordance between the phenotype and genotype results in pre- and post-transfusion
samples. When comparing the genotyping results between different types of samples,
![Page 153: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/153.jpg)
151
peripheral blood and buccal swab, the results were found to be concordant (Table 4.7
& Table 4.10). Even though there are many types of PCR method that can be used for
blood genotyping like PCR-RFLP, PCR-SSP, multiplex-PCR which was gel-based
detection, the SNP RT-PCR was considered most suitable to be applied as it offers
medium to high throughput platform, the number of SNPs that can be run per samples
was not too low or too high and the turnaround time was quite fast compared with the
gel-based detection.
Most of blood group antigens are bi-allelic and generally result from SNPs. As the
technology for molecular method grows rapidly and the molecular bases of almost all
the major blood group antigens have been determined over the past 20 years, many
research has enabled the development of various DNA-based methods for determining
the blood group genotype (Yamamoto et al., 1990; Cherif-Zahar et al., 1991; Hadley
& Peiper, 1997; Lee, 1997). Although the conventional PCR still remains a well-
established and first of choice method for genotyping, with the fast development of
molecular technologies and increasing demands, it is no longer suitable to be used in a
busy transfusion laboratory or donor collection setting. As conventional PCR offers
limited number of SNPs analysed per run, relatively high cost and provide low
throughput service, real-time PCR can be considered as the second option for
genotyping analysis.
Comparison was done between the conventional PCR and SNP RT-PCR that were
used for molecular analysis in this study. In term of cost, after including the
consumables‟ price and the reagents (cost of DNA extraction was excluded), the cost
for SNP RT-PCR was much cheaper than the conventional PCR; RM 4 for two blood
![Page 154: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/154.jpg)
152
group antigens compared with the conventional PCR that cost almost RM 12 for gel
preparation only. Besides that, the total turnaround time (time taken from preparing
samples until results analysis) between SNP RT-PCR and conventional PCR showed
significant difference; approximately 1 hour 45 minutes for SNP RT-PCR and almost
5 hours for conventional PCR. Furthermore, there is no longer a need to use
mutagenic substances such as ethidium bromide as some of the procedure in
conventional PCR need to use this substance. Less usage of DNA template volume
also should be considered because the samples used in this study have less of DNA
concentration; in conventional PCR, the minimum concentration of template should
be 50 ng/µl. If the concentration of DNA template is too low, more volume is needed
when preparing the mastermix. In contrast with SNP RT-PCR, the minimum
concentration of DNA template was very little, which is only 1 ng/µl. However, even
after the concentration of sample was standardized to 10 ng/µl per reaction, the DNA
template volume was still in balance.
Comparison between haemagglutination test and SNP RT-PCR was also demonstrated
in this study. Even though the method is straightforward and can be performed in a
short period of time, the cost to perform haemagglutination test was quite high
compared with the cost for SNP RT-PCR. Results from the haemagglutination test
were deemed not totally reliable as samples were taken from the recently-transfused
patients. The results also show discordance between the pre- and post-transfusion
samples. From the results of this investigation, it shows that SNP analysis by PCR is a
useful tool for red cell genotyping.
![Page 155: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/155.jpg)
153
However, when performing the SNP RT-PCR, there are many areas that need to be
considered in order to reduce the contamination and false positive results. Storage of
the reagents is one of the most important things that need to be taken into account.
TaqMan® Genotyping Master Mix must be stored at 2
oC – 8
oC while the TaqMan
®
SNP Genotyping Assay must be stored at -20oC, in the dark condition as it is light
sensitive. Excessive exposure to light may affect the fluorescent probes. Other than
that, the freeze-thaw cycles should be minimized. The best solution is to separate the
assays into a few sterile tubes (act as stock) and only retrieve the stock when it is
needed. Lastly, wearing appropriate PPE and following the laboratory rules and
regulations are also important to avoid contamination of samples and tests.
5.6 BUCCAL SWAB AS AN ALTERNATIVE SOURCE IN BLOOD
GENOTYPING
Blood has always been the first choice of sampling in determining the blood group
types. However, blood sampling is invasive, time consuming and expensive. To get
the blood, it must be conducted by a skilled individual (optimally a certified
phlebotomist). The phlebotomy procedure may become painful and not suitable for
certain types of patients such as infants and elderly patients. The accurate phenotyping
of RBC from recently transfused patients also become problematic due to the presence
of donors RBC in patients‟ blood. Although blood typing can be resolved by
molecular method using the DNA from the blood, if the DNA is prepared from a
transfused patient‟s blood sample, donor leukocytes, at least will interfere the
genotyping results (Adams et al., 1992; Lee et al., 1995). To overcome these
problems, another source of DNA should be used in the determination of blood
![Page 156: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/156.jpg)
154
genotyping. As the genetic code is contained within all somatic cells, buccal cell
collection, on the other hands, are considered as a convenient, inexpensive and non-
invasive for collecting the genetic material hence doing the blood genotyping (Rios et
al., 1999; Mulot et al., 2005; McMichael et al., 2009).
Buccal cell collection can be performed either by buccal swab or mouthwash
procedure. A few studies compared these methods in terms of DNA yield and found
that mouthwash procedure provides more yield and higher quality DNA than buccal
swab methods (García-Closas et al., 2001; Cozier et al., 2004; Mulot et al., 2005).
Nevertheless, mouthwash procedure was not suitable for the application of infants or
toddlers, elderly or unconscious patients. Therefore for these subjects, buccal swab
was the best choice of method to collect the DNA. Our finding revealed that we still
can extract the DNA from buccal swab and do the blood genotyping even though the
mean DNA concentration from buccal swab is lower than the blood samples (Table
4.14). The buccal cells provided usable amounts of DNA from two swabs although the
amount of extracted DNA gave interindividual variation. Mulot and co-workers
(2005) claimed that the two consecutive brushes that they applied by using cytobrush
to collect the buccal cells did not affect the DNA yield but it is contradicted with our
finding where we found that after using two swabs, we got better DNA yield and the
amount of the samples were enough for us to run the genotyping test. In terms of
DNA purity, when the mean UV A260/A280 ratio between buccal swab and
peripheral blood samples is compared, the value obtained did not show any significant
differences; which means that the quality between both types of samples were almost
similar and our samples were maybe not contaminated with the protein. Comparison
of genotype results between peripheral blood and buccal swab were shown to be fully
![Page 157: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/157.jpg)
155
concordant (Table 4.7 and Table 4.10). Thus, this study has shown that DNA from
buccal swab can be used in blood genotyping as supported by Rios and associates
(1999) although few researchers do not suggest the use of the buccal cell DNA as an
alternative to blood due to high potential of getting bacterial contamination during the
process of obtaining the buccal cell (Livy et al., 2011). However, this is more cost
effective to the genotyping experiments if buccal swab is used as the sample.
![Page 158: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/158.jpg)
156
CHAPTER VI
CONCLUSIONS AND RECOMMENDATIONS
In conclusion, red blood cell molecular-based genotyping can be extremely helpful in
determining the actual extended blood group systems in multiply-transfused patient
populations and assisting in the identification of suspected antibodies and the selection
of antigen-negative RBCs for transfusion. DNA from buccal swab can be the
alternative source for blood genotyping. The development of medium to high-
throughput genotyping platforms that utilize microarray and chip technologies offers
the opportunity to perform large-scale testing on numerous antigens simultaneously,
allowing an accurate selection of donor units to facilitate matching of donor RBCs to
the recipient‟s blood type. Commercial kits available are not only expensive in cost
but are developed based on the prevalence of Western population. What is important
is the inclusion of alleles that are relevant and prevalent to the Malaysian population.
The development of a Malaysian-based genotype assay using molecular techniques
suited for small to moderate scale for patients and larger scale for prospective blood
donors will be the focus for future research and investigation.
![Page 159: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/159.jpg)
157
6.1 LIMITATIONS
6.1.1 Samplings
Total number of samples was less than the target due to the subjects‟ refusal to
perform post-transfusion sampling at D7. After complete data cleaning was done, only
33 samples were included in the final analysis.
6.1.2 Methodology
Difficulties were encountered during buccal swab collection. Patient‟s mouth was
found to be quite dry and the usage of cotton swab was not practicable as the cotton
from the swab will stick at the patient‟s inner cheek and make the process of
harvesting the buccal cell quite difficult. Cytobrush perhaps could be used in the
future to resolve this issue. Good quality DNA from the buccal swab was quite
challenging to achieve at the beginning of the study. Optimization of this step was
lengthy but crucial to obtain higher DNA yields and purity before the actual molecular
work was performed on patient‟s sample.
WBC count in donor blood bag and the chimerism analysis were not performed in this
study. Therefore, the donor leukocyte contamination in patient‟s post transfusion
blood sampling could not be included in the present study.
Blood genotyping for Rh D gene was omitted in this study as 99% of the population
was phenotyped as RhD positive by serology; less than 1% are Rh D negative. The
![Page 160: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/160.jpg)
158
serology result was also very clear for Rh D because all the patients were Rh D
positive. The objective of the study was to explore the extended Rh alleles as matched
blood for transfusion in most hospitals stop short at D positive typing only. If RhD
gene was also included in future research, the researcher would have to take into
account the polymorphic nature of the gene and take into account the prevalent alleles
in our population to be included on the genotyping panel. Furthermore, alloanti-D is
very rarely detected. The antigen profile used in this study was limited to only Rh (C,
c, E, e), KEL, Kidd and Duffy as it is based on the highest frequency of antibody
developed in thalassaemia patients.
![Page 161: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/161.jpg)
159
BIBLIOGRAPHY
Abraham, J.E., M.J. Maranian, I. Spiteri, R. Russell, S. Ingle, C. Luccarini, H.M. Earl,
P.P. Pharoah, A.M. Dunning & C. Caldas. 2012. "Saliva samples are a viable
alternative to blood samples as a source of DNA for high throughput
genotyping". BMC Med Genomics. Vol. 5: pp. 19.
Adams, P.T., R.D. Davenport, D.A. Reardon & M.S. Roth. 1992. "Detection of
circulating donor white blood cells in patients receiving multiple transfusions".
Blood. Vol. 80(2): pp. 551-555.
Aidar, M. & S.R.P. Line. 2007. "A simple and cost-effective protocol for DNA
isolation from buccal epithelial cells". Brazilian dental journal. Vol. 18(2): pp.
148-152.
Allen, F., L. Diamond & B. Niedziela. 1951. "A new blood group antigen". Nature.
Vol. 167: pp. 482.
Allen, F.H., Jr., S.M. Krabbe & P.A. Corcoran. 1961. "A new phenotype (McLeod) in
the Kell blood-group system". Vox Sang. Vol. 6: pp. 555-560.
Allen, F.H., Jr. & S.J. Lewis. 1957. "Kpa, (Penney), a new antigen in the Kell blood
group system". Vox Sang. Vol. 2(2): pp. 81-87.
Alves, V.M., P.R.J. Martins, S. Soares, G. Araújo, L.C. Schmidt, S.S.d.M. Costa,
D.M. Langhi & H. Moraes-Souza. 2012. "Alloimmunization screening after
transfusion of red blood cells in a prospective study". Revista Brasileira de
Hematologia e Hemoterapia. Vol. 34(3): pp. 206-211.
Ameen, R., S. Al-Shemmari, S. Al-Humood, R.I. Chowdhury, O. Al-Eyaadi & A. Al-
Bashir. 2003. "RBC alloimmunization and autoimmunization among
transfusion-dependent Arab thalassemia patients". Transfusion. Vol. 43(11):
pp. 1604-1610.
Anstee, D.J. 2009. "Red cell genotyping and the future of pretransfusion testing".
Blood. Vol. 114(2): pp. 248-256.
Avent, N.D. 2009. "Large-scale blood group genotyping – clinical implications".
British Journal of Haematology. Vol. 144(1): pp. 3-13.
Avent, N.D., S.K. Butcher, W. Liu, W.J. Mawby, G. Mallinson, S.F. Parsons, D.J.
Anstee & M.J. Tanner. 1992. "Localization of the C termini of the Rh (rhesus)
polypeptides to the cytoplasmic face of the human erythrocyte membrane".
Journal of Biological Chemistry. Vol. 267(21): pp. 15134-15139.
Avent, N.D., A. Martinez, W.A. Flegel, M.L. Olsson, M.L. Scott, N. Nogués, M.
Písǎcka, G. Daniels, E. Van Der Schoot & E. Muñiz‐Diaz. 2007. "The
BloodGen project: toward mass‐scale comprehensive genotyping of blood
donors in the European Union and beyond". Transfusion. Vol. 47(s1): pp. 40S-
46S.
Bahlo, M., J. Stankovich, P. Danoy, P.F. Hickey, B.V. Taylor, S.R. Browning, M.A.
Brown & J.P. Rubio. 2010. "Saliva-derived DNA performs well in large-scale,
high-density single-nucleotide polymorphism microarray studies". Cancer
Epidemiology Biomarkers & Prevention. Vol. 19(3): pp. 794-798.
![Page 162: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/162.jpg)
160
Bauer, M., A. Kraus & D. Patzelt. 1999. "Detection of epithelial cells in dried blood
stains by reverse transcriptase-polymerase chain reaction". J Forensic Sci. Vol.
44(6): pp. 1232-1236.
Bauer, Martijn P., J. Wiersum-Osselton, M. Schipperus, Jan P. Vandenbroucke & E.
Briët. 2007. "Clinical predictors of alloimmunization after red blood cell
transfusion". Transfusion. Vol. 47(11): pp. 2066-2071.
Beth H. Shaz. 2009a. Kell and kidd blood group systems. Transfusion Medicine and
Hemostasis - Clinical and Laboratory Aspects. Christopher D. Hillyer, Beth H.
Shaz, James C. Zimring & T.C. Abshire. New York, USA, Elsevier.
Beth H. Shaz. 2009b. Pretransfusion Testing. Transfusion Medicine and Hemostasis -
Clinical and Laboratory Aspects. Christopher D. Hillyer, Beth H. Shaz, James
C. Zimring & T.C. Abshire. New York, USA, Elsevier.
Beth H. Shaz & John D. Roback. 2009. MNS and Duffy Blood Group Systems.
Transfusion Medicine and Hemostasis - Clinical and Laboratory Aspects.
Christopher D. Hillyer, Beth H. Shaz, James C. Zimring & T.C. Abshire. New
York, USA, Elsevier.
Bhatti, F.A., N. Salamat, A. Nadeem & N. Shabbir. 2004. "Red cell immunization in
beta thalassaemia major". J Coll Physicians Surg Pak. Vol. 14(11): pp. 657-
660.
Blajchman, M. 1998. "Immunomodulatory effects of allogeneic blood transfusions:
clinical manifestations and mechanisms". Vox Sanguinis. Vol. 74(S2): pp. 315-
319.
Blumberg, N., K. Ross, E. Avila & K. Peck. 1984. "Should chronic transfusions be
matched for antigens other than ABO and Rho(D)?". Vox Sang. Vol. 47(3): pp.
205-208.
Brantly SG & R. G. 1988. "Red cell alloimmunisation in multitransfused HLA-typed
patients". Transfusion. Vol. 24: pp. 463-466.
Calhoun, L. 1999. Other major blood group systems. Modern blood banking and
transfusion practices. D.M. Harmening. 4th ed. Book Promotion & Service
Co,., Ltd.
Carritt, B., T.J. Kemp & M. Poulter. 1997. "Evolution of the Human RH (Rhesus)
Blood Group Genes: A 50 Year Old Prediction (Partially) Fulfilled". Human
Molecular Genetics. Vol. 6(6): pp. 843-850.
Castilho, L., M. Rios, C. Bianco, J. Pellegrino, Fernando L. Alberto, Sara T.O. Saad &
Fernando F. Costa. 2002a. "DNA-based typing of blood groups for the
management of multiply-transfused sickle cell disease patients". Transfusion.
Vol. 42(2): pp. 232-238.
Castilho, L., M. Rios, J. Pellegrino, Jr., T.O.S. S & F.C. F. 2002b. "Blood group
genotyping facilitates transfusion of beta-thalassemia patients". J Clin Lab
Anal. Vol. 16(5): pp. 216-220.
National Blood Centre. 2007. "Guidelines for the Rational Use of Blood and Blood
Products".
Chaudhuri, A., J. Polyakova, V. Zbrzezna & A. Pogo. 1995. "The coding sequence of
Duffy blood group gene in humans and simians: restriction fragment length
polymorphism, antibody and malarial parasite specificities, and expression in
nonerythroid tissues in Duffy- negative individuals". Blood. Vol. 85(3): pp.
615-621.
![Page 163: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/163.jpg)
161
Cheng, T.-H., S.-P. Chen, T.-C. Lu, W.-C. Chen, J.-S. Sher & Y.-S. Shieh. 2010.
"Optimal DNA extraction from buccal swab samples". Journal of Medical
Sciences. Vol. 30(4): pp. 149-154.
Cherif-Zahar, B., M.G. Mattei, C. Le Van Kim, P. Bailly, J.P. Cartron & Y. Colin.
1991. "Localization of the human Rh blood group gene structure to
chromosome region 1p34.3-1p36.1 by in situ hybridization". Hum Genet. Vol.
86(4): pp. 398-400.
Chown, B., M. Lewis & K. Kaita. 1957. "A new Kell blood-group phenotype".
Nature. Vol. 180(4588): pp. 711.
Colin, Y., B. Cherif-Zahar, C. Le Van Kim, V. Raynal, V. Van Huffel & J.P. Cartron.
1991. "Genetic basis of the RhD-positive and RhD-negative blood group
polymorphism as determined by Southern analysis". Blood. Vol. 78(10): pp.
2747-2752.
Combs, M.R., G. Denomme, B.J. Grossman, N.R. Haley, T. Harris, B.W. Jett, R.M.
Leger, J.V. Linden, J.G. McFarland, J.T. Perkins, S.D. Roseff, J. Sweeney &
D.J. Triulzi. 2005. AABB Technical Manual. M.E. Brecher. 15th ed. AABB.
Coombs, R.R., A.E. Mourant & R.R. Race. 1946. "In-vivo isosensitisation of red cells
in babies with haemolytic disease". Lancet. Vol. 1(6391): pp. 264-266.
Cozier, Y.C., J.R. Palmer & L. Rosenberg. 2004. "Comparison of methods for
collection of DNA samples by mail in the black women's health study". Annals
of Epidemiology. Vol. 14(2): pp. 117-122.
Cutbush, M., P.L. Mollison & D.M. Parkin. 1950. "A New Human Blood Group".
Nature. Vol. 165(4188): pp. 188-189.
Daniel, W.W. 1999. Biostatistics: A Foundation for Analysis in the Health Sciences.
7th ed. Vol. New York: John Wiley & Sons.
Daniels, G. 2005. "The molecular genetics of blood group polymorphism". Transplant
Immunology. Vol. 14(3–4): pp. 143-153.
Dean, L. 2005. Blood Groups and Red Cell Antigens. US. Bethesda (MD): National
Center for Biotechnology Information
Dhawan, H.K., V. Kumawat, N. Marwaha, R.R. Sharma, S. Sachdev, D. Bansal, R.K.
Marwaha & S. Arora. 2014. "Alloimmunization and autoimmunization in
transfusion dependent thalassemia major patients: Study on 319 patients".
Asian Journal of Transfusion Science. Vol. 8(2): pp. 84-88.
Donahue, R.P., W.B. Bias, J.H. Renwick & V.A. McKusick. 1968. "Probable
assignment of the Duffy blood group locus to chromosome 1 in man".
Proceedings of the National Academy of Sciences of the United States of
America. Vol. 61(3): pp. 949-955.
Dunstan, R.A. 1986. "Status of major red cell blood group antigens on neutrophils,
lymphocytes and monocytes". Br J Haematol. Vol. 62(2): pp. 301-309.
Dunstan, R.A., M.B. Simpson & W.F. Rosse. 1984. "Erythrocyte antigens on human
platelets. Absence of Rh, Duffy, Kell, Kidd, and Lutheran antigens".
Transfusion. Vol. 24(3): pp. 243-246.
Flegel, W.A. 2007. "The genetics of the Rhesus blood group system". Blood Transfus.
Vol. 5(2): pp. 50-57.
García-Closas, M., K.M. Egan, J. Abruzzo, P.A. Newcomb, L. Titus-Ernstoff, T.
Franklin, P.K. Bender, J.C. Beck, L. Le Marchand, A. Lum, M. Alavanja, R.B.
Hayes, J. Rutter, K. Buetow, L.A. Brinton & N. Rothman. 2001. "Collection of
![Page 164: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/164.jpg)
162
Genomic DNA from Adults in Epidemiological Studies by Buccal Cytobrush
and Mouthwash". Cancer Epidemiology Biomarkers & Prevention. Vol. 10(6):
pp. 687-696.
Gemke, R.J., H.H. Kanhai, M.A. Overbeeke, C.J. Maas, J. Bennebroek Gravenhorst,
L.F. Bernini, C.P. Engelfriet & M.B. van't Veer. 1986. "ABO and Rhesus
phenotyping of fetal erythrocytes in the first trimester of pregnancy". Br J
Haematol. Vol. 64(4): pp. 689-697.
George, E. 2001. "Beta-thalassemia major in Malaysia, an ongoing public health
problem". Med J Malaysia. Vol. 56(4): pp. 397-400.
George, E. 2013. "HbE B-Thalassaemia in Malaysia: Revisited". J Hematol Thromb
Dis. Vol. 1: pp. 101.
George, E., M.I. Lai, L.K. Teh, R. Ramasamy, E.H. Goh, K. Asokan, J.A. Tan, M.
Vasudevan & S. Low. 2011. "Screening for intermediate and severe forms of
thalassaemia in discarded red blood cells: optimization and feasibility". Med J
Malaysia. Vol. 66(5): pp. 429-434.
Ghio, M., P. Contini, C. Mazzei, S. Brenci, G. Barberis, G. Filaci, F. Indiveri & F.
Puppo. 1999. "Soluble HLA class I, HLA class II, and Fas ligand in blood
components: a possible key to explain the immunomodulatory effects of
allogeneic blood transfusions". Blood. Vol. 93(5): pp. 1770-1777.
Giblett, E. 1958. "Js, a "new" blood group antigen found in Negroes". Nature. Vol.
180: pp. 711.
Guelsin, G.A., A.M. Sell, L. Castilho, V.L. Masaki, F.C. Melo, M.N. Hashimoto, T.T.
Higa, L.S. Hirle & J.E. Visentainer. 2010. "Benefits of blood group
genotyping in multi-transfused patients from the south of Brazil". J Clin Lab
Anal. Vol. 24(5): pp. 311-316.
Guevin, R.M., V. Taliano & O. Waldmann. 1976. "The Cote serum (anti-K11), an
antibody defining a new variant in the Kell system". Vox Sang. Vol. 31(1
SUPPL): pp. 96-100.
Gupta, R., D.K. Singh, B. Singh & U. Rusia. 2011. "Alloimmunization to red cells in
thalassemics: Emerging problem and future strategies". Transfusion and
Apheresis Science. Vol. 45(2): pp. 167-170.
Hadley, T.J. & S.C. Peiper. 1997. "From Malaria to Chemokine Receptor: The
Emerging Physiologic Role of the Duffy Blood Group Antigen". Blood. Vol.
89(9): pp. 3077-3091.
Hamblin, M.T. & A. Di Rienzo. 2000. "Detection of the signature of natural selection
in humans: evidence from the Duffy blood group locus". American Journal of
Human Genetics. Vol. 66(5): pp. 1669-1679.
Hansen, T.v.O., M.K. Simonsen, F.C. Nielsen & Y.A. Hundrup. 2007. "Collection of
Blood, Saliva, and Buccal Cell Samples in a Pilot Study on the Danish Nurse
Cohort: Comparison of the Response Rate and Quality of Genomic DNA".
Cancer Epidemiology Biomarkers & Prevention. Vol. 16(10): pp. 2072-2076.
Herráez, D.L. & M. Stoneking. 2008. "High fractions of exogenous DNA in human
buccal samples reduce the quality of large-scale genotyping". Analytical
Biochemistry. Vol. 383(2): pp. 329-331.
Higgins, J.M. & S.R. Sloan. 2008. "Stochastic modeling of human RBC
alloimmunization: evidence for a distinct population of immunologic
responders". Blood. Vol. 112(6): pp. 2546-2553.
![Page 165: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/165.jpg)
163
Hosono, S., A.F. Faruqi, F.B. Dean, Y. Du, Z. Sun, X. Wu, J. Du, S.F. Kingsmore, M.
Egholm & R.S. Lasken. 2003. "Unbiased whole-genome amplification directly
from clinical samples". Genome Res. Vol. 13(5): pp. 954-964.
Ikin, E.W., A.E. Mourant, H.J. Pettenkofer & G. Blumenthal. 1951. "Discovery of the
expected haemagglutinin, anti-Fyb". Nature. Vol. 168(4288): pp. 1077-1078.
Jansuwan, S., O. Tangvarasittichai & S. Tangvarasittichai. 2015. "Alloimmunization
to Red Cells and the Association of Alloantibodies Formation with
Splenectomy Among Transfusion-Dependent beta-Thalassemia Major/HbE
Patients". Indian J Clin Biochem. Vol. 30(2): pp. 198-203.
Kawthalkar, S.M. 2013. Essentials of Haematology. India: Jaypee Brothers Medical
Publishers (P) LTD.
Klein, H.G. & D.J. Anstee. 2006. Mollison's blood transfusion in clinical medicine.
11th ed. Wiley-Blackwell
Kormoczi, G.F., E.A. Scharberg & C. Gassner. 2009. "A novel KEL*1,3 allele with
weak Kell antigen expression confirming the cis-modifier effect of KEL3".
Transfusion. Vol. 49(4): pp. 733-739.
Kovacevic-Grujicic, N., S. Davidovic, D. Takic, M. Mojsin & M. Stevanovic. 2012.
"Direct PCR amplification of the HVSI region in mitochondrial DNA from
buccal cell swabs". Archives of Biological Sciences. Vol. 64(3): pp. 851-858.
Krista L. Hillyer. 2009. Serologic Testing of Donor Products. Transfusion Medicine
and Hemostasis - Clinical and Laboratory Aspects. Christopher D. Hillyer,
Beth H. Shaz, James C. Zimring & T.C. Abshire. New York, USA, Elsevier.
KÜChler, E.C., P.N. Tannure, P. Falagan-Lotsch, T.S. Lopes, J.M. Granjeiro &
L.M.F. Amorim. 2012. "Buccal cells DNA extraction to obtain high quality
human genomic DNA suitable for polymorphism genotyping by PCR-RFLP
and Real-Time PCR". Journal of Applied Oral Science. Vol. 20(4): pp. 467-
471.
Kyaw, T.Z. 2012. "Molecular analysis of Malaysian Chinese D-donors: a single centre
experience". Asian Biomed. Vol. 6(1): pp. 27-33.
Landsteiner, K. 1900. "Zur Kenntnis der antifermentativen, lytischen und
agglutinierenden Wirkungen des Blutserums und der Lymphe". Zbl Bakt. Vol.
27: pp. 357-362.
Lapierre, V., A. Aupérin, E. Robinet, C. Ferrand, N. Oubouzar, D. Tramalloni, P.
Saas, B. Debaene, P. Lasser & P. Tiberghien. 2007. "Immune modulation and
microchimerism after unmodified versus leukoreduced allogeneic red blood
cell transfusion in cancer patients: results of a randomized study". Transfusion.
Vol. 47(9): pp. 1691-1699.
Le Hellard, S., S.J. Ballereau, P.M. Visscher, H.S. Torrance, J. Pinson, S.W. Morris,
M.L. Thomson, C.A. Semple, W.J. Muir & D.H. Blackwood. 2002. "SNP
genotyping on pooled DNAs: comparison of genotyping technologies and a
semi automated method for data storage and analysis". Nucleic acids research.
Vol. 30(15): pp. e74-e74.
Lee, S. 1997. "Molecular Basis of Kell Blood Group Phenotypes". Vox Sanguinis.
Vol. 73(1): pp. 1-11.
Lee, S. 1998. "Molecular basis of Kell blood group phenotypes". Vox Sang. Vol. 74:
pp. 58.
![Page 166: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/166.jpg)
164
Lee, S., D. Naime, M. Reid & C. Redman. 1997. "The KEL24 and KEL14 alleles of
the Kell blood group system". Transfusion. Vol. 37(10): pp. 1035-1038.
Lee, T.H., E. Donegan, S. Slichter & M.P. Busch. 1995. "Transient increase in
circulating donor leukocytes after allogeneic transfusions in immunocompetent
recipients compatible with donor cell proliferation". Blood. Vol. 85(5): pp.
1207-1214.
Lee, T.H., T. Paglieroni, G.H. Utter, D. Chafets, R.C. Gosselin, W. Reed, J.T.
Owings, P.V. Holland & M.P. Busch. 2005. "High-level long-term white blood
cell microchimerism after transfusion of leukoreduced blood components to
patients resuscitated after severe traumatic injury". Transfusion. Vol. 45(8):
pp. 1280-1290.
Levine, P., M. Backer, M. Wigod & R. Ponder. 1949. "A New Human Hereditary
Blood Property (Cellano) Present in 99.8% of all Bloods". Science. Vol.
109(2836): pp. 464-466.
Livy, A., S. Lye, C.K. Jagdish, N. Hanis, V. Sharmila, L.W. Ler & B. Pramod. 2011.
"Evaluation of Quality of DNA Extracted from Buccal Swabs for Microarray
Based Genotyping". Indian Journal of Clinical Biochemistry. Vol. 27(1): pp.
28-33.
Lum, A. & L. Le Marchand. 1998. "A simple mouthwash method for obtaining
genomic DNA in molecular epidemiological studies". Cancer Epidemiology
Biomarkers & Prevention. Vol. 7(8): pp. 719-724.
Ministry of Health Malaysia. 2008. "Transfusion Practice Guidelines for Clinical and
Laboratory Personnel".
Ministry of Health Malaysia. 2009. "Clinical practice guidelines: Management of
transfusion dependent thalassaemia".
Malaysia, M.o.H. 2010. MyTalasemia Malaysia Thalasemia Vortal - prime source of
information on Thalassaemia. <http://www.mytalasemia.net.my/>. accessed:
18 February 2014
Malaysia, M.o.H. 2013. "Thalassaemia Registry".
Martha Rae Combs, Gregory Denomme, Brenda J. Grossman, N. Rebecca Haley,
Teresa Harris, Betsy W. Jett, Regina M. Leger, Jeanne V. Linden, Janice G.
McFarland, James T. Perkins, Susan D. Roseff, Joseph Sweeney & D.J.
Triulzi. 2005. The Positive Direct Antiglobulin Test and Immune-Mediated
Red Cell Destruction. American Association of Blood Bank Technical
Manual. M.E. Brecher. 15th ed. United States: AABB.
Martino, A., T. Mancuso & A.M. Rossi. 2010. "Application of high-resolution melting
to large-scale, high-throughput SNP genotyping a comparison with the
TaqMan® method". Journal of biomolecular screening. Vol. 15(6): pp. 623-
629.
McMichael, G.L., C.S. Gibson, M.E. O‟Callaghan, P.N. Goldwater, G.A. Dekker,
E.A. Haan, A.H. MacLennan & G. for the South Australian Cerebral Palsy
Research. 2009. "DNA from Buccal Swabs Suitable for High-Throughput SNP
Multiplex Analysis". Journal of Biomolecular Techniques : JBT. Vol. 20(5):
pp. 232-235.
Mercier, B., C. Gaucher, O. Feugeas & C. Mazurier. 1990. "Direct PCR from whole
blood, without DNA extraction". Nucleic acids research. Vol. 18(19): pp.
5908.
![Page 167: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/167.jpg)
165
Michail-Merianou, V., L. Pamphili-Panousopoulou, L. Piperi-Lowes, E. Pelegrinis &
A. Karaklis. 1987. "Alloimmunization to red cell antigens in thalassemia:
comparative study of usual versus better-match transfusion programmes". Vox
Sang. Vol. 52(1-2): pp. 95-98.
Mograin, I. 2009. Development of a Blood Antigen Molecular Profiling Panel using
Genotyping Technologies for Patients Requiring Frequent Transfusions.
(Master Thesis). Université De Montréal
Mohandas, N. & A. Narla. 2005. "Blood group antigens in health and disease". Curr
Opin Hematol. Vol. 12(2): pp. 135-140.
Mollison, P., C. Engelfriet & M. Contreras. 1997. Blood Transfusion in Clinical
Medicine. London: Blackwell Scientific.
Monteiro, F., G. Tavares, M. Ferreira, A. Amorim, P. Bastos, C. Rocha, F. Araújo &
L.M. Cunha-Ribeiro. 2011. "Technologies involved in molecular blood group
genotyping". ISBT Science Series. Vol. 6(1): pp. 1-6.
Moulds, J.M. 2010. "Future of molecular testing for red blood cell antigens". Clin Lab
Med. Vol. 30(2): pp. 419-429.
Mouro, I., Y. Colin, B. Cherif-Zahar, J.-P. Cartron & C.L. Van Kim. 1993.
"Molecular genetic basis of the human Rhesus blood group system". Nat
Genet. Vol. 5(1): pp. 62-65.
Mullis, K.B. & F.A. Faloona. 1987. "Specific synthesis of DNA in vitro via a
polymerase-catalyzed chain reaction". Methods Enzymol. Vol. 155: pp. 335-
350.
Mulot, C., I. Stücker, J. Clavel, P. Beaune & M.-A. Loriot. 2005. "Collection of
Human Genomic DNA From Buccal Cells for Genetics Studies: Comparison
Between Cytobrush, Mouthwash, and Treated Card". Journal of Biomedicine
and Biotechnology. Vol. 2005(3): pp. 291-296.
Musa, R.H., S.A. Ahmed, H. Hashim, Y. Ayob, N.H. Asidin, P.Y. Choo & F.S. Al-
Joudi. 2012. "Red cell phenotyping of blood from donors at the National blood
center of Malaysia". Asian Journal of Transfusion Science. Vol. 6(1): pp. 3-9.
Musa, R.H., N.A. Muhamad, A. Hassan, Y. Ayob & N.M. Yusoff. 2015. "Molecular
basis of Rh blood group system in the Malaysian population". Asian J Transfus
Sci. Vol. 9(1): pp. 48-54.
Nadarajan, V.S., A.A. Laing, S.M. Saad & M. Usin. 2012. "Prevalence and specificity
of red-blood-cell antibodies in a multiethnic South and East Asian patient
population and influence of using novel MUT+Mur+ kodecytes on its
detection". Vox Sang. Vol. 102(1): pp. 65-71.
Nedel, F., M.C.M. Conde, I.O.d. Oliveira, S.B.C. Tarquinio & F.F. Demarco. 2009.
"Comparison between DNA obtained from buccal cells of the upper and lower
gutter area". Brazilian dental journal. Vol. 20(4): pp. 275-278.
Noor Haslina, M.N. 2005. A Pilot Study On Red Cell Immunization In Multiply
Transfused Thalassaemic Patients. (Master Thesis). Universiti Sains Malaysia
Noor Haslina, M.N., N. Ariffin, I. Illuni Hayati & H. Rosline. 2006. "Red cell
immunization in multiply transfused Malay thalassemic patients". Southeast
Asian J Trop Med Public Health. Vol. 37(5): pp. 1015-1020.
Nunes, A.P., I.O. Oliveira, B.R. Santos, C. Millech, L.P. Silva, D.A. González, P.C.
Hallal, A.M.B. Menezes, C.L. Araújo & F.C. Barros. 2012. "Quality of DNA
![Page 168: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/168.jpg)
166
extracted from saliva samples collected with the Oragene™ DNA self-
collection kit". BMC Medical Research Methodology. Vol. 12: pp. 65-65.
Olsson, M.L. & M. Chester. 2001. "Polymorphism and recombination events at the
ABO locus: a major challenge for genomic ABO blood grouping strategies".
Transfusion Medicine. Vol. 11(4): pp. 295-313.
Osman, N.H., A.W. Ahmad Asnawi, M.D. Mohd Rani & J. Sathar. 2014.
"Alloantibody and autoantibody immunization in repeatedly transfused
thalassaemia patients: Hospital Ampang experience". Malaysian J Pathol. Vol.
36(Supplement A): pp. 102-103.
Pinkerton, F.e.a. 1959. "The phenotype Jk(a-b-) in the Kidd blood group system". Vox
Sang. Vol. 4: pp. 155.
Plaut, G., E. Ikin & A.e.a. Mourant. 1953. "A new blood group antibody, anti-Jkb".
Nature. Vol. 171: pp. 431.
Poynter, J.N., J.A. Ross, A.J. Hooten, E. Langer, C. Blommer & L.G. Spector. 2013.
"Predictors of mother and child DNA yields in buccal cell samples collected in
pediatric cancer epidemiologic studies: a report from the Children‟s Oncology
group". BMC Genetics. Vol. 14: pp. 69-69.
Prager, M. 2007. "Molecular genetic blood group typing by the use of PCR‐SSP
technique". Transfusion. Vol. 47(s1): pp. 54S-59S.
Qiagen. 2013. Quantification of DNA.
<https://www.qiagen.com/my/resources/molecular-biology-
methods/dna/#Quantification%20of%20DNA>. accessed: 17 May 2013.
Quill, E. 2008. "Medicine. Blood-matching goes genetic". Science. Vol. 319(5869):
pp. 1478-1479.
Quinque, D., R. Kittler, M. Kayser, M. Stoneking & I. Nasidze. 2006. "Evaluation of
saliva as a source of human DNA for population and association studies".
Analytical Biochemistry. Vol. 353(2): pp. 272-277.
Race, R. 1948. "The Rh genotypes and Fisher's theory". Blood. Vol. (Special issue 2):
pp. 27-42.
Reid, M. 2003. "Applications of DNA‐based assays in blood group antigen and
antibody identification". Transfusion. Vol. 43(12): pp. 1748-1757.
Reid, M. & L.-F. C. 2004. The Blood Group Antigen Facts Book. 2nd edition. New
York: Elsevier Academic Press.
Reid, M.E. 1995. "Molecular Basis of Human Blood Group Antigens. Jean-Pierre
Cartron and Philippe Rouger, eds". Transfusion. Vol. 35(9): pp. 793-793.
Reid, M.E. 2007. "Overview of molecular methods in immunohematology".
Transfusion. Vol. 47(s1): pp. 10S-16S.
Reid, M.E., M. Rios, V.I. Powell, D. Charles-Pierre & V. Malavade. 2000. "DNA
from blood samples can be used to genotype patients who have recently
received a transfusion". Transfusion. Vol. 40(1): pp. 48-53.
Reid, M.E. & K. Yazdanbakhsh. 1998. "Molecular insights into blood groups and
implications for blood transfusion". Curr Opin Hematol. Vol. 5(2): pp. 93-102.
Ribeiro, K.R., M.H. Guarnieri, D.C. Da Costa, F.F. Costa, J. Pellegrino Jr & L.
Castilho. 2009. "DNA array analysis for red blood cell antigens facilitates the
transfusion support with antigen-matched blood in patients with sickle cell
disease". Vox Sanguinis. Vol. 97(2): pp. 147-152.
![Page 169: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/169.jpg)
167
Rios, M., K. Cash, A. Strupp, J. Uehlinger & M. Reid. 1999. "DNA from urine
sediment or buccal cells can be used for blood group molecular genotyping".
Immunohematology. Vol. 15(2): pp. 61-65.
Rosenfield, R., F.J. Allen & P. Rubinstein. 1973. "Genetic model for the Rh blood-
group system". Proc Natl Acad U S A. Vol. 70: pp. 1303-1307.
Rosenfield, R., F.J. Allen, S. Swisher & S. Kochwa. 1962. "A review of Rh Serology
and presentation of a new terminology ". Transfusion. Vol. 2: pp. 287-312.
Rosenfield, R., F.J. Allen, S. Swisher & S. Kochwa. 1979. "Rh nomenclature".
Transfusion. Vol. 19: pp. 487.
Rožman, P., T. Dovč & C. Gassner. 2000. "Differentiation of autologous ABO, RHD,
RHCE, KEL, JK, and FY blood group genotypes by analysis of peripheral
blood samples of patients who have recently received multiple transfusions".
Transfusion. Vol. 40(8): pp. 936-942.
Sadeghian, M.H., M.R. Keramati, Z. Badiei, M. Ravarian, H. Ayatollahi, H.
Rafatpanah & M.K. Daluei. 2009. "Alloimmunization among transfusion-
dependent thalassemia patients". Asian Journal of Transfusion Science. Vol.
3(2): pp. 95-98.
Saftlas, A.F., M. Waldschmidt, N. Logsden-Sackett, E. Triche & E. Field. 2004.
"Optimizing buccal cell DNA yields in mothers and infants for human
leukocyte antigen genotyping". American journal of epidemiology. Vol.
160(1): pp. 77-84.
Saied, D.A., A.M. Kaddah, R.M. Badr Eldin & S.S. Mohaseb. 2011.
"Alloimmunization and erythrocyte autoimmunization in transfusion-
dependent Egyptian thalassemic patients". J Pediatr Hematol Oncol. Vol.
33(6): pp. 409-414.
Sands, J. 2002. "Molecular approaches to urea transporters". J Am Soc Nephrol. Vol.
13: pp. 2795-2806.
Sands, J.M., J.J. Gargus, O. Frohlich, R.B. Gunn & J.P. Kokko. 1992. "Urinary
concentrating ability in patients with Jk(a-b-) blood type who lack carrier-
mediated urea transport". J Am Soc Nephrol. Vol. 2(12): pp. 1689-1696.
Saxena, A. & S.R. Phadke. 2002. "Feasibility of thalassaemia control by extended
family screening in Indian context". J Health Popul Nutr. Vol. 20(1): pp. 31-
35.
Schechter, G.P., F. Soehnlen & W. McFarland. 1972. "Lymphocyte response to blood
transfusion in man". N Engl J Med. Vol. 287(23): pp. 1169-1173.
Schechter, G.P., J. Whang-Peng & W. McFarland. 1977. "Circulation of donor
lymphocytes after blood transfusion in man". Blood. Vol. 49(4): pp. 651-656.
Seng, T.A. 2006. "Malaria and other vector-borne diseases control in Malaysia:
historical development and chronological events.". Vector Journal. Vol. 9(1):
pp. 36-38.
Sibinga, C.T.S. 1999. "Immune effects of blood transfusion". Current opinion in
hematology. Vol. 6(6): pp. 442.
Singer, S.T., V. Wu, R. Mignacca, F.A. Kuypers, P. Morel & E.P. Vichinsky. 2000.
"Alloimmunization and erythrocyte autoimmunization in transfusion-
dependent thalassemia patients of predominantly Asian descent". Blood. Vol.
96(10): pp. 3369-3373.
![Page 170: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/170.jpg)
168
Singleton, B.K., C.A. Green, N.D. Avent, P.G. Martin, E. Smart, A. Daka, E.G.
Narter-Olaga, L.M. Hawthorne & G. Daniels. 2000. "The presence of an RHD
pseudogene containing a 37 base pair duplication and a nonsense mutation in
Africans with the Rh D-negative blood group phenotype". Blood. Vol. 95(1):
pp. 12-18.
Strange, J.J., R.J. Kenworthy, A.J. Webb & C.M. Giles. 1974. "Wka (Weeks), a new
antigen in the Kell blood group system". Vox Sang. Vol. 27(1): pp. 81-86.
Technologies, L. 2014. TaqMan Genotyping Master Mix Protocol.
<https://www.appliedbiosystems.com/>. accessed: 18th February 2014.
Tournamille, C., Y. Colin, J.P. Cartron & C. Le Van Kim. 1995a. "Disruption of a
GATA motif in the Duffy gene promoter abolishes erythroid gene expression
in Duffy-negative individuals". Nat Genet. Vol. 10(2): pp. 224-228.
Tournamille, C., Y. Colin, J.P. Cartron & C. Le Van Kim. 1995b. "Disruption of a
GATA motif in the Duffy gene promoter abolishes erythroid gene expression
in Duffy–negative individuals". Nature genetics. Vol. 10(2): pp. 224-228.
Transfusion, I.S.O.B. 2015. <http://www.isbtweb.org/>. accessed: 30 September
2015.
Utter, G.H., A.B. Nathens, T.-H. Lee, W.F. Reed, J.T. Owings, T.A. Nester & M.P.
Busch. 2006. "Leukoreduction of blood transfusions does not diminish
transfusion-associated microchimerism in trauma patients". Transfusion. Vol.
46(11): pp. 1863-1869.
Vamvakas, E.C. & M.A. Blajchman. 2009. "Transfusion-related mortality: the
ongoing risks of allogeneic blood transfusion and the available strategies for
their prevention". Blood. Vol. 113(15): pp. 3406-3417.
Van der Schoot, C. 2004. "Molecular diagnostics in immunohaematology". Vox
Sanguinis. Vol. 87(s2): pp. 189-192.
Vichinsky, E. 2010. "Complexity of alpha thalassemia: growing health problem with
new approaches to screening, diagnosis, and therapy". Ann N Y Acad Sci. Vol.
1202: pp. 180-187.
Wagner, F.F. & W.A. Flegel. 2000. "RHD gene deletion occurred in the Rhesus box".
Blood. Vol. 95(12): pp. 3662-3668.
Wagner, F.F., A. Frohmajer & W.A. Flegel. 2001. "RHD positive haplotypes in D
negative Europeans". BMC Genetics. Vol. 2(1): pp. 10.
Walker, R.H., C.I. Argall, E.A. Steane, T.T. Sasaki & T.J. Greenwalt. 1963. "Anti-Js-
b, the expected antithetical antibody of the Suttee blood group system".
Nature. Vol. 197: pp. 295-296.
Weatherall, D.J. & J.B. Clegg. 2011. The Thalassaemia Syndromes. 4th. edition.
Blackwell Science, London.
Westhoff, C.M. 2004. "The Rh blood group system in review: A new face for the next
decade". Transfusion Vol. 44: pp. 1663-1673.
Westhoff, C.M. 2006. "Molecular testing for transfusion medicine". Current opinion
in hematology. Vol. 13(6): pp. 471-475.
Wiener, A. 1943. "Genetic theory of the Rh blood types". Proc Soc Exp Biol (NY).
Vol. 54: pp. 316.
Wilkinson, S.L. 2005. Other Blood Groups. Textbook of blood banking and
transfusion medicine. S.V. Rudman. 2nd edition. Elsevier.
![Page 171: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/171.jpg)
169
Win, N., P. Amess, M. Needs & P.E. Hewitt. 2005. "Use of red cells preserved in
extended storage media for exchange transfusion in anti-k haemolytic disease
of the newborn". Transfus Med. Vol. 15(2): pp. 157-160.
Wu, Y.Y. & G. Csako. 2006. "Rapid and/or high-throughput genotyping for human
red blood cell, platelet and leukocyte antigens, and forensic applications".
Clinica Chimica Acta. Vol. 363(1): pp. 165-176.
Yamaguchi, H., Y. Okubo, T. Seno, K. Matsushita & G.L. Daniels. 1979. "A 'new'
allele, Kpc, at the Kell complex locus". Vox Sang. Vol. 36(1): pp. 29-30.
Yamamoto, F.-i., H. Clausen, T. White, J. Marken & S.-i. Hakomori. 1990.
"Molecular genetic basis of the histo-blood group ABO system". Nature. Vol.
345(6272): pp. 229-233.
Yousuf, R., S. Abdul Aziz, N. Yusof & C.F. Leong. 2013. "Incidence of Red Cell
Alloantibody among the Transfusion Recipients of Universiti Kebangsaan
Malaysia Medical Centre". Indian Journal of Hematology & Blood
Transfusion. Vol. 29(2): pp. 65-70.
Zaidi, U., M. Borhany, S. Ansari, S. Parveen, S. Boota, I. Shamim, D. Zahid & T.
Shamsi. 2015. "Red cell alloimmunisation in regularly transfused beta
thalassemia patients in Pakistan". Transfusion Medicine. Vol. 25(2): pp. 106-
110.
![Page 172: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/172.jpg)
170
APPENDIX A
ETHICAL APPROVAL LETTER FROM MEDICAL RESEARCH ETHICAL
COMMITTEE (MREC)
![Page 173: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/173.jpg)
171
APPENDIX B
ETHICAL APPROVAL LETTER FROM UNIVERSITI KEBANGSAAN
MALAYSIA MEDICAL CENTRE (UKMMC)
![Page 174: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/174.jpg)
172
APPENDIX C
PATIENT INFORMATION SHEET AND CONSENT FORM
![Page 175: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/175.jpg)
173
![Page 176: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/176.jpg)
174
![Page 177: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/177.jpg)
175
APPENDIX D
BAGene DNA-SSP KITS WORKSHEET AND EVALUATION DIAGRAM
![Page 178: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/178.jpg)
176
![Page 179: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/179.jpg)
177
APPENDIX E
LIST OF PRESENTATIONS
NAME OF CONFERENCE TITLE
Conference of Pathology (CPATH),
Kuala Lumpur.
[13th
– 14th
June 2105]
A Comparison between Two Sampling
Methods for Extended Red Cell
Genotyping Using TaqMan Single
Nucleotide Polymorphisms
[Poster presentation]
Malaysian J Pathol 2015; 37(2) : pp.
198
Postgraduate Colloquium on Medical
Sciences 2015, Selangor.
[25th
– 26th
May 2015]
Can Buccal Swab Be Used In
Determination of Red Blood Cell
Profiling?
[Oral Presentation – Nomination for
Young Scientist Award]
National Research Seminar 2015, Perak.
[9th
May 2015]
Importance of Extended Blood Group
Genotyping in Multiply Transfused
Patients.
[Oral Presentation – Winner for Best
Paper Award]
Will be published in Journal of
Contemporary Issues and Thought,
Vol 6, 2016
3rd
National Conference on Medical
Laboratory Sciences, Kelantan.
[28th
– 30th
April 2015]
Red Blood Cell Profiling: A Comparison
between Serology and SNP RT-PCR in
Multiply Transfused Patients
[Oral Presentation]
![Page 180: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/180.jpg)
178
International Congress of Pathology &
Laboratory Medicine (ICPaLM), Kuala
Lumpur.
[26th
– 28th
August 2014]
Low DNA Concentration From Buccal
Swab Can Be Used For Blood Group
Molecular Genotyping.
[Oral Presentation – Nomination for
Young Investigator‟s Award]
Malaysian J Pathol 2014; 36:
Supplement A: pp. 63. ISSN 0126-8635
International Congress of Pathology &
Laboratory Medicine (ICPaLM), Kuala
Lumpur.
[26th
– 28th
August 2014]
Alloantibody and Autoantibody
Immunization in Repeatedly Transfused
Thalassaemia Patients: Hospital Ampang
Experience.
[Poster Presentation]
Malaysian J Pathol 2014; 36:
Supplement A: pp. 102-103. ISSN
0126-8635
XIth Malaysian National Haematology
Scientific Meeting, Kuala Lumpur,
[4th
– 6th
April 2014]
A Living Infant With Homozygous
South-East Asian Hereditary
Ovalostomatocytosis.
[Poster Presentation]
![Page 181: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/181.jpg)
179
APPENDIX F
AWARDS & ACHIEVEMENTS
Best Paper Award
Full paper will be published in Journal of Contemporary Issues and Thought, Vol 6,
2016.
![Page 182: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/182.jpg)
180
Young Scientist Award Competition
![Page 183: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/183.jpg)
181
Young Investigator’s Award
![Page 184: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/184.jpg)
182
APPENDIX G
PROCEEDINGS / PUBLICATIONS
Malaysian J Pathol 2015; 37(2): pp. 198
![Page 185: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/185.jpg)
183
Malaysian J Pathol 2014; 36: Supplement A: pp. 63. ISSN 0126-8635
![Page 186: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/186.jpg)
184
Malaysian J Pathol 2014; 36: Supplement A: pp. 102-103. ISSN 0126-8635
![Page 187: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/187.jpg)
185
![Page 188: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/188.jpg)
186
Journal of Contemporary Issues and Thought, Vol 6, 2016.
![Page 189: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/189.jpg)
187
![Page 190: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/190.jpg)
188
![Page 191: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/191.jpg)
189
![Page 192: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/192.jpg)
190
![Page 193: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/193.jpg)
191
![Page 194: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/194.jpg)
192
![Page 195: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/195.jpg)
193
![Page 196: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/196.jpg)
194
![Page 197: Nadila Haryani Bt Osman_3130198_A Comparison Between Using](https://reader034.vdocuments.net/reader034/viewer/2022051200/587c82651a28ab71378b4c8f/html5/thumbnails/197.jpg)
195