nasipp mediates self-incompatibility in nicotiana · 95 several species avoid self-fertilization...
TRANSCRIPT
1
NaSIPP mediates self-incompatibility in Nicotiana 1
2
3
4
5
Felipe Cruz-García 6
Departamento de Bioquímica, Facultad de Química, Universidad Nacional Autónoma de 7
México. Ciudad de México. 04510, México. 8
01(55)56225279 9
11
12
13
14
15
16
17
18
19
20
21
22
23
24
Plant Physiology Preview. Published on September 5, 2017, as DOI:10.1104/pp.16.01884
Copyright 2017 by the American Society of Plant Biologists
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
2
SIPP, a novel mitochondrial phosphate carrier mediates in self-incompatibility 25
Liliana E. García-Valencia1, Carlos E. Bravo-Alberto1, Hen-Ming Wu2, Rogelio Rodríguez-26
Sotres1, Alice Y. Cheung2 and Felipe Cruz-García1 27
28
1Departamento de Bioquímica, Facultad de Química, Universidad Nacional Autónoma de 29
México. 04510. Ciudad de México. 30
2Department of Biochemistry and Molecular Biology, University of Massachusetts, 31
Amherst MA 01003. 32
33
34
35
36
Summary: SIPP mediates self-incompatibility in Nicotiana and it interacts with StEP 37 in mitochondria of pollen tubes 38 39 40
41
42
43
F.C-G and LE.G-V conceived the project and the original research plan; F.C-G, LE.G-V 44
and A.Y.C designed the experiments; LE.G-V and CE.B-A performed most of the 45
experiments; H-M.W provided technical advice and discussion on experimental design to 46
LE.G-V; R.R-S calculated the NaSIPP three-dimensional model; LE.G-V, F.C-G. and 47
A.Y.C analyzed data; F.C-G. and LE.G-V wrote the article with contributions from all the 48
authors 49
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
3
50
51
52
53
54
This work was supported by Grants: IN217816 and RN217816 (PAPIIT-UNAM); 55
329718/234690 (to LE.G-V) and 236602 from Consejo Nacional de Ciencia y Tecnología 56
and Grant Number 0955910 (RCN on Integrative Pollen Biology) and 1147165 from NSF 57
(to A.Y.C). Computing resources were provided by the LANCAD-UNAM-DGTIC-215 58
supercomputing project. 59
60
Felipe Cruz-García 61
63
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
4
ABSTRACT 64
In Solanaceae, the S-specific interaction between the pistil S-RNase and the pollen S-Locus 65
F-box (SLF) protein control self-incompatibility (SI). Although this interaction defines the 66
specificity of the pollen rejection response, the identification of three pistil essential 67
modifier genes unlinked to the S-locus (HT-B, 120K and NaStEP), unveils a higher degree 68
of complexity in the pollen rejection pathway. We showed previously that NaStEP, a 69
stigma protein with homology with Kunitz-type protease inhibitors, is essential to SI in 70
Nicotiana. During pollination NaStEP is taken up by pollen tubes where potential 71
interactions with pollen tube proteins might underlie its function. Here, we identified 72
NaSIPP, a mitochondrial protein with phosphate transporter activity, as a novel NaStEP-73
interacting protein. Coexpression of NaStEP and NaSIPP in pollen tubes showed 74
interaction in the mitochondria, although when expressed alone NaStEP remains mostly 75
cytosolic, implicating NaSIPP-mediated translocation of NaStEP into the organelle. The 76
NaSIPP transcript is detected specifically in mature pollen of Nicotiana spp; however, in 77
self-compatible plants this gene has accumulated mutations, so its coding region is unlikely 78
to produce a functional protein. RNAi suppression of NaSIPP in Nicotiana pollen grains 79
disrupts the SI by preventing pollen tube inhibition. Taken together, our results are 80
consistent with a model whereby the NaStEP and NaSIPP interaction, in incompatible 81
pollen tubes, might destabilize the mitochondria, and contribute to arrest pollen tube 82
growth. 83
84
85
86
87
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
5
INTRODUCTION 88
Cross-pollination has decisively contributed to the widespread distribution of angiosperms, 89
and in many species the pistil has played an active role in the reject of self-pollen and the 90
acceptance of pollen coming from genetically unrelated plants. Thus, the pistil has evolved 91
to some extent to safeguard the species identity as well as to produce a vigorous progeny 92
with new allelic combinations. 93
94
Several species avoid self-fertilization through self-incompatibility (SI), a genetically 95
controlled system by the polymorphic S-locus (de Nettancourt, 2001). In Solanaceae, 96
Plantaginaceae and Rosaceae, the S-locus includes two tightly linked genes: the male and 97
female determinants. The product of the female determinant is a pistil extracellular 98
glycoprotein known as S-RNase (Anderson et al., 1986; McClure et al., 1989). S-99
RNases are secreted to the stylar extracellular matrix (ECM) and incorporated into both 100
compatible and incompatible pollen tubes (Luu et al., 2000; Goldraij et al., 2006), 101
apparently using an MdABCF transporter localized at the pollen tube membrane as 102
described in apple (Meng et al., 2014). 103
104
Once the S-RNases are inside the pollen tubes, large amounts of these enzyme 105
molecules are compartmentalized inside the vacuoles. If the cross is incompatible 106
vacuoles break down releasing S-RNases into the cytoplasm, RNA is hydrolyzed and the 107
pollen tube stops growing. In contrast, if a compatible cross takes place, the S-RNases 108
remain confined into intact vacuoles, and the pollen tubes can growth towards the ovary 109
(Goldraij et al., 2006). 110
111
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
6
The male S-determinant encodes the cytosolic protein called S-locus F-box protein (Lai et 112
al., 2002; Entani et al., 2003; Ushijima et al., 2003; Wang et al., 2004; Sijacic et al., 2004). 113
An important characteristic of SLF is a F-box domain at the N-terminus. F-box proteins are 114
a component of the SCF (Skp1, Cullin-1, F-box protein) E3 ligase complex, which is 115
involved in ubiquitin-mediated protein degradation by the 26S proteasome (Qiao et al., 116
2004; Hua and Kao, 2008; Williams et al., 2015). Within the SCF complex, Cullin-1 is a 117
scaffold and Skp1 connects the scaffold to a F-box protein, which in turn recruits the target 118
protein (Vierstra, 2003; Xu et al., 2009). 119
120
Several SLF genes have been identified at the S-locus in Solanaceae and Rosaceae, 121
subfamily Maloidea (Wang et al., 2004; Wheeler and Newbigin, 2007; Ashkani and Rees, 122
2016). In particular, in S2- and S3-haplotypes of Petunia inflata 17 SLF genes have been 123
found to aid recognition of several S-RNases variants (Sijacic et al., 2004; Kubo et al., 124
2010; Williams et al., 2015). Based on the specificity of these interaction, multiple SLF 125
proteins expressed in a specific pollen S-haplotype have been proposed to collaboratively 126
recognize and detoxify non-self S-RNases, allowing only self-S-RNases to exert their 127
cytotoxic effect on self-pollen (Kubo et al., 2010; Williams et al., 2015). 128
129
Although the interaction between SLF and S-RNase defines the S-specific pollen rejection, 130
there are modifier genes unlinked to the S-locus that are also essential to the SI response (de 131
Nettancourt, 2001; Zhang and Xue, 2008; McClure et al., 2011). To date, three pistil 132
modifier genes have been identified: 120K (Hancock et al., 2005), HT-B (McClure et al., 133
1999) and NaStEP (Jiménez-Durán et al., 2013). 134
135
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
7
The HT-B protein presents a C- terminal domain rich in asparagine and aspartic acid 136
(McClure et al., 1999; Kondo and McClure, 2008). HT-B is only expressed in mature 137
pistils and has been described in Solanum, Nicotiana and Petunia (McClure et al., 1999; 138
Kondo et al., 2002; O’Brien et al., 2002; Sassa and Hirano, 2006; Puerta et al., 2009). In 139
the particular case of S. habrochaites there is no HT-B gene, but there is a related HT-A 140
gene, which may act as a substitute for the HT-B function in this species (Covey et al., 141
2010). Immunolocalization assays show that HT-B, like S-RNases, is taken up by 142
compatible and incompatible pollen tubes during pollination (Goldraij et al., 2006). In 143
incompatible crosses HT-B levels decrease slightly in pollen tubes; however, in compatible 144
crosses, HT-B levels inside pollen tubes decrease by 75-97% (Goldraij et al., 2006; 145
Jiménez Durán et al., 2013). Apparently HT-B is needed to halt pollen tube growth, and in 146
agreement, down-regulation of HT genes results in breakdown of SI Nicotiana (McClure et 147
al., 1999), Petunia (Puerta et al., 2009) and Solanum (Kondo et al., 2002; O’Brien et al., 148
2002). 149
150
The arabinogalactan glycosylated protein 120K, accumulates abundantly in the ECM in 151
mature styles of N. alata (Schultz et al., 1997), like S-RNases, 120K is taken up by pollen 152
tubes and targeted to vacuoles (Lind et al., 1996; Goldraij et al., 2006). Loss of function 153
assays show that 120K is essential to SI, because its suppression by RNAi disrupts self-154
pollen rejection (Hancock et al., 2005). Protein-protein interaction experiments gave 155
evidence of 120K complexes with style proteins, including S-RNases, NaPELP III, Nap11 156
(Cruz-García et al., 2005) and pollen C2 domain-containing protein (NaPCCP). This last 157
protein also associates with the endomembrane system via phosphatidylinositol 3-158
phosphate (Lee et al., 2008; 2009). 159
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
8
160
NaStEP (N. alata Stigma Expressed Protein) is an abundant stigma-specific protein of SI 161
Nicotiana spp (Busot et al., 2008). In mature papillary stigmatic cells NaStEP remains 162
stored in the vacuoles, but upon pollination, the cell wall of these papillary cells becomes 163
punctured and NaStEP relocalizes to the stigmatic exudate (Busot et al., 2008), and from 164
there it can be taken up by compatible and incompatible pollen tubes (Jiménez-Durán et al., 165
2013). NaStEP is homologous to Kunitz-type protease inhibitors (Busot et al., 2008) and 166
inhibits subtilisin in vitro, in a specific manner (Jiménez-Durán et al., 2013). RNAi-167
mediated suppression of Nicotiana NaStEP prevents S-specific pollen rejection (Jiménez-168
Durán et al., 2013). Likewise, NaStEP protects HT-B stability in pollen tubes by a yet 169
unidentified mechanism, because when NaStEP is absent, HT-B is degraded inside pollen 170
tubes in both compatible and incompatible crosses (Jiménez-Durán et al., 2013). This last 171
evidence, suggests an interaction of these two modifier genes at some point of the pollen 172
rejection pathway in Nicotiana, which currently is vaguely known. Consequently, it 173
becomes important to find if additional pollen proteins are required by NaStEP to exert its 174
function in pollen rejection. 175
176
Here, a mitochondrial NaStEP interacting protein was identified and designated as NaSIPP 177
(N. alata Self-Incompatibility Pollen Protein); and convincing evidence of the ability of 178
NaSIPP to recruit NaStEP to the mitochondria in pollen tubes is provided. In addition, 179
NaSIPP transcript was detected specifically in mature pollen of SI and SC (self- 180
compatible) Nicotiana spp. Notably, the NaSIPP orthologs in SC species have accumulated 181
extensive mutations on the coding region, so that the encoded product is unlikely to 182
produce a functional protein. According to these data and further evidence given below, 183
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
9
NaSIPP represents a novel mitochondrial protein with phosphate carrier activity that is 184
essential to SI. 185
186
RESULTS 187
Identifying NaStEP pollen protein partners 188
To identify pollen and pollen tube proteins possibly interacting with NaStEP, we performed 189
a Yeast Two-Hybrid assay using NaStEP as bait to screen a N. rastroensis pollen/pollen 190
tube cDNA library fused to a transcription factor activation domain (AD), according to 191
Fields and Song (1989). Positive clones were selected under stringent conditions for further 192
analysis. 193
194
From the above experiment, we recovered a cDNA encoding the C-terminal of a MPC 195
(Mitochondrial Phosphate Carrier)-like protein. To confirm the interaction was mediated by 196
the bait (NaStEP) and prey (MPC sequence) pair, we cotransformed yeast with an empty 197
vector (Binding domain or BD) or the bait (BD-NaStEP) and the candidate prey protein and 198
selected positive transformants under stringent medium. From this assay we only recovered 199
clones coexpressing the BD-NaStEP fusion and the AD-C-terminal of MPC-like cDNA 200
(Fig. 1A). In addition, in a similar assay NaStEP was not found to interact with Mir1, a 201
MPC from Saccharomyces cerevisiae. 202
203
The cDNA coding the C-terminal of MPC-like was 431 bp long. Northern blot analysis 204
using this cDNA as probe, showed the accumulation of this MPC-like transcript specifically 205
in mature N. rastroensis pollen (Supplementary Fig. 1). We therefore cloned its full-length 206
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
10
cDNA by rapid amplification of cDNA ends (RACE 5’) from N. rastroensis and N. alata. 207
The resulting sequence was named NaSIPP. 208
209
When tested by Yeast Two-Hybrid assay, the full-length NaSIPP cDNA remained positive 210
for interaction with NaStEP. Therefore the NaSIPP C-terminus has enough exposure in the 211
complete protein to account for its interaction with NaStEP. 212
213
NaSIPP belongs to the phosphate carrier family 214
According to a multiple sequence alignment of NaSIPP, and other MPC sequences from 215
both, functionally characterized and putative MPC (Supplementary Fig. 2A), NaSIPP 216
belongs to the MPC subfamily within the mitochondrial carrier family, which includes a 217
number of membrane proteins, known to transport solutes across the mitochondrial 218
membranes (Palmieri et al., 2011). Three tandem repeats of a domain, known as 219
mitochondrial carrier domain (PROSITE PS50920, PFAM PF00153 and IPR00193) 220
(Palmieri, 2004) are conserved in the primary sequences of all mitochondrial carrier family 221
members. Each domains are about 100 amino acids long and contains two hydrophobic 222
transmembrane segments connected through a hydrophilic loop and is characterized by a 223
sequence motif PX[D/E]XX[K/R]X[K/R] (20-30 residues) [D/E]GXXXX[W/Y/F][K/R]G 224
(Palmieri, 1994; 2004). This signature has been used to identify mitochondrial carriers in 225
eukaryotic sequenced genomes (Palmieri, 1994; 2004). 226
227
A phylogenetic analysis of 21 MPC sequences from yeast, plants and animals based on 228
amino acid sequences (Supplementary Fig. 2B), clearly defined a plant and animal clade. 229
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
11
Notably, this sequence comparison shows S. cerevisiae Pic2 as a closer relative to the 230
animals and plants MPC than to Mir1, a second homolog encoded in S. cerevisiae genome. 231
232
The MPC plant sequences could be further separated into three subgroups: 1) Legumes 233
MPC (Glycine max and Medicago truncatula) sharing 95.3% sequence identity, 2) 234
Solanaceae MPC (five sequences sharing 84.8% sequence identity) and 3) a diverse set of 235
plant sequences from different plant families, which were clustered together, although they 236
do not conform a well-defined group. The Solanaceae subgroup is represented by five MPC 237
and the higher identity is between the two carriers from Solanum with 99.2% of identity; 238
follow by the Nicotiana carriers, which share 98.8% of identity. NaSIPP formed part of this 239
subgroup and presents a high identity with a N. tomentosiformis MPC, followed by the 240
Solanum carriers (95.3%) and the Ipomoea MPC (88.3%). 241
242
Expression of NaSIPP rescues the mitochondrial defect of the yeast mutant Δmir1 243
Because the NaSIPP sequence has MPC protein family features, we evaluated its ability to 244
complement the Δmir1 mutant of S. cerevisiae. The amino acids known to be required for 245
phosphate transport in Mir1 are His32, Lys42, Thr43, Thr79, Lys90, Glu126, Arg140, 246
Arg142, Lys179, Lys187, Asp236, and Arg276. When these residues are mutated the 247
ability to transport phosphate is suppressed (Briggs et al., 1999; Phelps et al., 2001; 248
Wohlrab et al., 2002). Sequence alignment of NaSIPP with multiple functional and putative 249
MPCs showed high conservation in these twelve residues for NaSIPP (Supplementary Fig. 250
2A), in agreement with its possible phosphate transport function. 251
252
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
12
In S. cerevisiae, there are two functionally redundant MPC, Mir1 and Pic2. Mir1 is more 253
abundant than Pic2 under normal conditions (Murakami et al., 1990), whereas expression 254
of Pic2 is induced by high temperature (Hamel et al., 2004). NaSIPP shares 50% identity 255
with Pic2 and 40.3% with Mir1, which offered an opportunity to evaluate whether NaSIPP 256
rescue the Δmir1 mutant. To test this, we transformed the Δmir1 S. cerevisiae strain with 257
NaSIPP using the yeast expression vector pYES-DEST52. As shown in Figure 2, NaSIPP 258
partially rescued the Δmir1 mutant, although transformants grew slower in glycerol (a non-259
fermentable substrate) compared to those transformed by Mir1. According to this result, 260
NaSIPP can provide phosphate transport to the yeast mutant, but with reduced efficiency. 261
Differences between NaSIPP and Mir1 in kinetic or regulatory properties, or the absence of 262
some unidentified factor may limit NaSIPP function in yeast, but that issue was out of the 263
scope of the present paper. 264
265
NaSIPP three-dimensional model 266
Mitochondrial carrier members have divergent sequences (15-20% of identity), but share 267
predicted membrane topologies with six transmembrane helices, as do NaSIPP and 268
ATP/ADP translocators (ANT). The yeast mitochondrial ANT was used as template to 269
model NaSIPP, and extensive Molecular Dynamics simulations in an explicit mixed-lipid 270
membrane, with explicit water and ions were used to improve the model (see Materials and 271
Methods). The final model had a Rd.HMM score considered as highly reliable (Martínez-272
Castilla and Rodríguez-Sotres, 2010), similar to those found for NMR experimental 273
solutions of protein three-dimensional structures and the scoring method has a very low 274
false positive rate. The predicted structure of NaSIPP had an all-α structure, forming a core 275
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
13
of 6 transmembrane regions (Fig. 3A). The upper soluble domain had a discoidal shape 276
(Fig. 3A, red dotted line), while the bottom domain was quasi-globular (Fig. 3A, yellow 277
dotted line). Both N- and C-termini were on the bottom domain. 278
279
The three dimensional model of this protein has a central channel dominated by positive (at 280
neutral pH) and neutral polar side chains (Fig. 3B), but the entrance at the top had several 281
negatively charged chains (Fig. 3C). In this model, Asp298 forms a salt-bridge with 282
Arg316, which obstructs the pore, but a pH change could allow protonation of the acidic 283
side chains to open the gate and allow phosphate transport. Thus, the model's structural 284
features are consistent with the partial complementation found of Δmir1 mutant by NaSIPP. 285
286
Subcellular localization of NaSIPP 287
Several members of the mitochondrial carrier family localize to mitochondria, although 288
some have been localized in the plasma membrane, specifically in caveolae microdomain 289
(Lisanti et al., 1994; Bàthori et al., 1999), or in small vesicles (Wandrey et al., 2004), 290
peroxisomes, glyoxisomes or plastids (Fukao et al., 2001; Palmieri et al., 2001; Bedhomme 291
et al., 2005; Leroch et al., 2005). Thus, to determine the precise subcellular localization of 292
NaSIPP, we expressed NaSIPP fused with the tomato fluorescent protein and under the 293
control of the pollen-specific promoter Lat52 (Lat52::NaSIPP-Tomato) in transiently 294
transformed tobacco pollen tubes. Furthermore, NaSIPP-Tomato signal was analyzed in 295
these pollen tubes in the presence of the mitochondrial marker Mit-GFP (Mitochondria 296
targeting sequence fused to GFP; Logan and Leaver, 2000). Results indicated that the 297
NaSIPP-Tomato fluorescence signal was associated with motile organelles throughout the 298
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
14
pollen tube cytoplasm, which displayed a movement similar to a reverse-fountain pattern 299
(Fig. 4A and Supplementary Movie 1), characteristic of elongating pollen tubes (Cheung 300
and Wu, 2008). Cotransformation of the mitochondrial marker Mit-GFP (Fig. 4B) showed 301
clear overlap of NaSIPP-Tomato and Mit-GFP on the same motile organelles previously 302
observed (Fig. 4C, yellow signal and Supplementary Movie 2), providing evidence of 303
NaSIPP mitochondrial localization in tobacco pollen tubes. 304
305
To obtain further support for the mitochondrial localization of NaSIPP, we transiently 306
expressed the construct NaSIPP-GFP in A. thaliana seedlings via A. tumefaciens, along 307
with staining with the mitochondrial marker MitoTracker Red FM. We found NaSIPP-GFP 308
fluorescence signal colocalizing with MitoTracker Red FM (Fig. 4D-G), indicating that the 309
necessary information to target NaSIPP to the plant mitochondria is contained within its 310
amino acid sequence. 311
312
Interaction between NaStEP- NaSIPP in plant cells 313
To establish the interaction between NaStEP and NaSIPP in plant cells, we performed a 314
Bimolecular Fluorescence Complementation (BiFC) assay. We used vectors containing the 315
Ubiquitin-10 promoter that drives a moderate expression in plant cells and mitigates 316
potential problems, such as false positive (Grefen et al., 2010). 317
318
We fused each gene to the N- and C- terminal halves of YFP and used them to transform A. 319
tumefaciens. Transient coexpression of NaStEP and NaSIPP constructs in roots and 320
hypocotyl epidermis of A. thaliana seedlings led to the restoration of YFP fluorescence, 321
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
15
prominently in the meristematic and elongation zone of the roots (Fig. 5A-C) and lower 322
hypocotyl (Fig. 5D-F). Fluorescence was not observed in seedlings cotransformed with 323
either halves of the split YFP vector in combination with an empty vector (Supplementary 324
Fig. 3A-H). 325
326
Additionally, we performed a BiFC assay in N. tabacum pollen tubes. We fused each gene 327
to the N- and C- terminal halves of the Venus protein and under the control of the pollen-328
specific promoter Lat52. Even though the frequencies of transient expression were low, 329
ranging from 0.001-0.002%; the transient coexpression of NaStEP and NaSIPP constructs 330
in transformed tobacco pollen tubes led to the restoration of Venus fluorescence, mainly in 331
small sausage-shaped organelles resembling mitochondria, distributed throughout the 332
pollen tube (Fig. 5G-I). Fluorescence was not observed in pollen tubes cotransformed with 333
either halves of the split Venus vector in combination with an empty vector (Supplementary 334
Fig. 3I-L). These data demonstrate the NaStEP-NaSIPP interaction in vivo, both in pollen 335
tubes, and in other heterologous plant tissues. 336
337
Interaction of NaSIPP- NaStEP is associated with mitochondria 338
To examine if NaSIPP-NaStEP complex associates with the mitochondria, we performed a 339
BiFC assay in A. thaliana seedlings, which were also treated with MitoTracker Red FM, in 340
order to determine whether the reconstituted YFP signal could be detected in mitochondria. 341
Figure 6A shows NaStEP-nYFP and NaSIPP-cYFP constructs coexpressed in A. thaliana 342
seedlings, where the YFP fluorescence was reestablished; as shown before, and how the 343
NaStEP and NaSIPP (Fig. 6A, green signal) colocalizes with the MitoTracker Red signal 344
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
16
coming from mitochondria (Fig. 6B-D). Altogether, these data give evidence of an in vivo 345
complex between NaStEP and NaSIPP located in mitochondria. The time-resolution of the 346
events is not enough to indicate whether the complex forms in the mitochondria, or a 347
preformed complex is targeted to this organelle, and this could be one of the questions to 348
answer in the future. 349
350
BiFC complementation provides evidence of the interaction between two proteins in vivo, 351
but since it involves a covalent bond, the complex has an extended long life. To provide 352
further evidence of the interaction between NaStEP and NaSIPP using a more dynamical 353
probe, tobacco pollen grains were transformed by microprojectile bombardment using both 354
constructs: Lat52::NaStEP-GFP and Lat52::NaSIPP-Tomato and the GFP and/or Tomato 355
fluorescence was monitored by confocal microscopy. When NaSIPP was expressed alone, 356
the red tomato fluorescence was distributed to discrete structures in pollen tubes (Fig. 7A). 357
By contrast, NaStEP-GFP signal was randomly distributed in the pollen tube cytoplasm 358
(Fig. 7B). When both proteins were coexpressed, the localization pattern of NaStEP 359
changed from a cytoplasm distribution to a punctate pattern (Fig. 7C-E), suggesting again a 360
physical interaction between NaStEP and NaSIPP, which apparently mediates the 361
translocation of the cytoplasmic NaStEP to the mitochondria. 362
363
The NaSIPP transcript accumulates highly in mature pollen of Nicotiana species 364
A BLAST analysis on the National Center for Biotechnology Information site 365
(http://www.ncbi.nlm.nih.gov) with NaSIPP cDNA as probe found three MPC-like cDNA 366
of N. tabacum sharing high identity to NaSIPP CDS: XM_016632920.1 (20.1), 367
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
17
XM_016617131.1 (31.1) and XM_016600064.1 (64.1). The expression patterns of these 368
MPC-like mRNA were compared to those of NaSIPP transcript by reverse transcription-369
PCR analysis, using specific primers for each MPC-like transcripts, and in several N. alata 370
organs (Fig. 8A), developing anthers at various stages (Fig. 8B) and mature pollen from 371
Nicotiana species (Fig. 8C). Results show the MPC-like 20.1 and 64.1 transcripts 372
expressed on reproductive and no reproductive tested organs and MPC-like 31.1 mRNA 373
was detected on all, with exception of pollen grains. Besides, the 20.1 and 64.1 transcripts 374
were amplified in all the anther development stages evaluated, whereas NaSIPP mRNA 375
was only detected in mature pollen (Fig. 8A and 8B). In addition, when we tested the 376
presence of MPC-like transcripts in mature pollen of different Nicotiana species (Fig. 8C), 377
the 20.1 and 64.1 mRNA were present in most of the Nicotiana species. In the case of 378
SIPP, a cDNA was amplified with high similarity to the NaSIPP cDNA in all the Nicotiana 379
species, with the only exception of N. glauca. Nevertheless, when all of these cDNAs were 380
sequenced, we found indels in the sequences from SC Nicotiana spp (N. plumblaginifolia, 381
N. tabacum and N. benthamiana) and the nucleotide sequences are predicted to encode for 382
proteins with significant differences to NaSIPP, including frame-shift mutations and/or 383
premature stop codons. If expressed, the putative corresponding protein products are 384
unlikely to be functional (Supplementary Fig. 4A and 4B). By contrast, all the SIPP cDNAs 385
from SI Nicotiana spp (N. alata, N. rastroensis and N. forgetiana) show better conservation 386
in their amino acid sequences (Supplementary Fig. 3A and 3B) and appear to encode 387
proteins sharing all the features associated to their predicted function, in agreement with 388
their possible participation in the SI response. 389
390
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
18
NaSIPP suppression in pollen tubes 391
To test if NaSIPP plays a role in SI, we transformed N. alata SA2-pollen by microprojectile 392
bombardment with the construct RNAi-NaSIPP under the control of NTP303 promoter 393
(NTP303p). The transformed pollen grains were used to pollinate SI N. alata SA2SA2 pistils 394
(incompatible cross) and we evaluated the effect on pollination, observing the pollen tube 395
growth through the style after 72 h pollination (Fig. 9A). If NaSIPP is playing a role in 396
pollen rejection, its suppression, would allow to pollen tubes to reach the base of the style 397
in an incompatible cross (when the S-allele in pollen matches with one of the pistil S-398
alleles); otherwise the pollen tube growth should be inhibited in the upper one-third of the 399
style as happens in the SI N. alata. 400
401
When SI N. alata SA2SA2 pistils were pollinated with untransformed SA2-pollen 402
(incompatible cross), the pollen tubes did not reach the base of the style (Fig. 9B), as 403
expected, because the pollen tube growth was inhibited in the upper segment of style. Here, 404
the average length of pollen tube was equivalent to 28% of the style length (SEM= 3.9; n= 405
28 pistils analyzed; Fig. 9F, Supplementary Table 1). 406
407
Pollen transformed with the empty vector, displayed a similar behavior to the WT pollen 408
and the average pollen tube growth was equivalent to 26% of the style (SEM= 2.9; n= 67 409
pistils analyzed; Fig. 9C and 9F; and Supplementary Tables 1 and 2). 410
411
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
19
Transformation of pollen grains with RNAi-NaSIPP, resulted in a notable increase in the 412
number of pollen tubes reaching the base of the style than with those pollen tubes coming 413
from untransformed pollen or pollen transformed with the empty vector (Fig. 9D and 9F) 414
and the average length of pollen tube was equivalent to 64.9% of the style (SEM= 2.3; n= 415
89 pistils analyzed). Moreover, the difference was statistically highly significant (P< 416
0.0001; Supplementary Tables 1 and 2) between the pollen transformed with RNAi-NaSIPP 417
and the pollen transformed with the empty vector. As predicted, RNAi made normally 418
incompatible pollen tubes to grow significantly longer and many did reach the base of the 419
style, suggesting that the RNAi-mediated suppression of NaSIPP expression impairs SI and 420
giving further support to the proposed role of NaSIPP as a novel pollen modifier gene, 421
essential to the SI response in Nicotiana. 422
423
On the other hand, when we pollinated SI N. alata SC10SC10 pistils with SA2-pollen 424
bombarded with the construction RNAi-NaSIPP, most of the pollen tubes reached the base 425
of the style (Fig. 9E), as expected for a compatible cross. 426
427
428
DISCUSSION 429
In this study, we identified a novel pollen mitochondrial phosphate carrier, NaSIPP; which 430
interacts with NaStEP and the resulting complex was found associated to the mitochondria. 431
Likewise, evidence is provided of NaSIPP being an essential gene to the pollen rejection 432
response in Nicotiana. 433
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
20
434
The interaction of NaStEP with a mitochondrial protein as NaSIPP was initially 435
unexpected, because we previously demonstrated the role of the stigma-located NaStEP 436
protein as proteinase inhibitor and its ability to enhance HT-B stability inside the vacuoles 437
of pollen tubes (Jiménez-Durán et al., 2013). However, interaction of NaStEP with the 438
mitochondrial membrane protein NaSIPP, agrees with some reports describing Kunitz-type 439
inhibitors interact with membrane ion channels, that are able to induce membrane 440
permeability changes (Lancelin et al., 1994; Harvey, 2001; Peigneur et al., 2011; García-441
Fernández et al., 2016). 442
443
The specific expression of NaSIPP in mature pollen and its capability to complement 444
phosphate-transport deficient mutant, could relate this protein to energy requirements 445
during pollen tube growth. The NaSIPP transcript was found expressed in mature pollen of 446
both SI and SC Nicotiana spp; however, their orthologues in SC Nicotiana spp. have 447
accumulate frame-shifting mutations that generate premature stop codons, and even if those 448
proteins are translated, they are unlikely to be functional (Supplementary Fig. 4B). 449
Therefore, the expression pattern of the functional NaSIPP in SI Nicotiana backgrounds 450
and the SI disruption when NaSIPP was suppressed, are strongly consistent with a key role 451
for this protein in the SI response in Nicotiana, probably after its interaction with NaStEP. 452
453
Recent evidence points to some MPC as structural component of the permeability transition 454
pore (PTP) (Leung et al., 2008; Gutiérrez-Aguilar et al., 2010; Varanyuwatana and 455
Halestrap, 2012). The PTP is a non-specific channel in the mitochondrial membrane 456
(Haworth and Hunter, 1979; Crompton et al., 1987) and it is usually closed. The opening of 457
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
21
PTP may result from a number of stimuli, including a calcium overload of the 458
mitochondrial matrix (Hunter and Haworth, 1979; Al-Nasser and Crompton, 1986), which 459
triggers an increase in the mitochondrial inorganic phosphate pools (Crompton and Costi, 460
1988; Kushnareva et al., 1999; Arpagaus et al., 2002). 461
462
An open PTP allows an unrestricted movement of solutes, increasing the mitochondrial 463
permeability and producing the collapse of mitochondrial membrane potential (Bhosale et 464
al., 2015). As a result, the ATP synthesis stops and a cellular energy crisis take place 465
(Halestrap et al., 1998; 2004). If NaSIPP is a component of PTP-like, its interaction with 466
NaStEP might be part of the mechanism of PTP opening and cause the pollen tube to stop 467
growing, as part of the S-specific pollen rejection response. Many aspects of this proposal 468
are still hypothetical, and should be challenged by further studies, some of which are in 469
progress in our group. 470
471
The opened PTP has been shown to mediate the cytochrome c release, along with others 472
cell death factors (Petronilli et al., 1994; Doran and Halestrap 2000); which are early 473
crucial events in both animals and plants intrinsic pathway of PCD activation (Beers, 1997; 474
Balk et al., 1999; Stein and Hansen, 1999; Sun et al., 1999; Lam and del Pozo, 2000). 475
However, we do not know if this happens in SI in Nicotiana, and it would be interesting to 476
explore in the future, since PCD has been implicated in the gametophytic pollen rejection 477
response (Thomas and Franklin-Tong, 2004) and different hallmarks of PCD have also 478
been reported in other species such as Pyrus pyrifolia (Wang et al., 2009; Wang and Zhang, 479
2011), Olea europaea (Serrano et al., 2010) and N. alata (Roldán et al., 2012). 480
481
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
22
Although whether the SI response in Nicotiana involves a PCD program is yet to be tested, 482
the features of NaSIPP and the possibility that PCD might be part of the pollen rejection 483
response in Nicotiana, make NaSIPP a good candidate for an active role if such SI-specific 484
cascade takes place in these species. 485
486
It is well know that interaction between S-RNase and SLF determines either the 487
compatibility or incompatibility phenotype. But further evidence indicated the participation 488
of HT-B, NaStEP and NaSIPP somewhere downstream this interaction. NaStEP enters both 489
compatible and incompatible pollen tubes early in pollination (Jiménez-Durán et al., 2013), 490
and considering its properties, NaStEP might be playing roles at the cytoplasm and at the 491
mitochondria in the pollen rejection response. Thus, in an incompatible cross NaStEP 492
might function as proteinase inhibitor protecting HT-B from degradation. On the other 493
hand, NaStEP in the pollen tube evidence that interact with NaSIPP in the mitochondria, 494
with this interaction could create an energy crisis and contribute to pollen tube growth 495
inhibition. Somehow in a compatible cross, the interaction between NaSIPP and NaStEP 496
might be impaired or altered, through an unknown mechanism, related to the unspecific S-497
allele interaction between SLF and S-RNase. Under this last condition, we postulate that 498
the S-RNases remain confined to intact vacuoles, HT-B would be degraded, and the 499
mitochondria would stay healthy to provide ATP and support the growth of the pollen tubes 500
towards the ovary. 501
502
Our future goal is to propose a comprehensive model of the SI mechanism by identifying 503
all the factors required in the S-RNase-dependent pollen rejection pathway and their 504
participation in the SI-response related mechanism. Here, we give evidence that NaSIPP is 505
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
23
an essential gene for SI and our findings suggest a possible pivotal participation of 506
mitochondria in the SI Nicotiana response. 507
508
Supplemental Data 509
Supplementary Figure 1. The NaSIPP transcript is specifically detected in mature pollen 510 in N. rastroensis. 511
Supplementary Figure 2. Sequence alignment of NaSIPP, functional and putative 512 Mitochondrial Phosphate Carrier. 513
Supplementary Figure 3. BiFC assay controls. 514
Supplementary Figure 4. Sequence alignment of different Nicotiana SIPP sequences. 515
Supplementary Table 1. Evaluation of pollen tube length after RNAi-NaSIPP pollen 516 transformation. 517
Supplementary Table 2. NaSIPP suppression disrupts S-specific pollen rejection. 518
Supplementary Movie 1. Lat52::NaSIPP-Tomato localization 519
Supplementary Movie 2. Coexpression of Lat52::NaSIPP-Tomato and Lat52::Mit-Green 520
521
ACKNOWLEDGMENTS 522
We are grateful to Yanjiao Zou for her assistance in microprojectile bombardment, to Jorge 523
Herrera Díaz for his assistance in yeast complementation assays, to Javier Andres Juárez-524
Díaz for his assistance in BiFC assays, to Karina Jiménez-Durán for confocal microscopy 525
support, to Yuridia Cruz-González Zamora for her technical assistance, to María Teresa 526
Olivera-Flores for greenhouse support and to Janai M. García-Valencia for assistance with 527
imaging. We thank the anonymous reviewers for the thoughtful comments scientifically 528
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
24
and for improving the presentation of our data. We also thank the RCN on Integrative 529
Pollen Biology for facilitating collaboration. We thank UNAM-DGTIC staff for the help in 530
compilation and maintenance of the required software. 531
532
MATERIALS AND METHODS 533
Plant materials 534
SI Nicotiana alata (SA2SA2, SC10SC10 genotype), SC N. glauca, and SC N. tabacum 535
‘Praecox’ have been described previously (Murfett et al., 1994, 1996; Beecher and 536
McClure, 2001). SC N. plumbaginifolia (inventory No. TW107) and SI N. forgetiana 537
(inventory No. TW50) were a gift from Bruce McClure lab. SI N. rastroensis (Rastroensis) 538
and N. bethamiana have been described previously (Jiménez-Durán et al., 2013). Tobacco 539
(N. tabacum var Petit Havana SR1) was used for pollen transformation. All the plants were 540
grown in soil under greenhouse conditions. 541
542
Yeast Two-Hybrid assay, Clone Identification and Sequencing 543
NaStEP bait 544
The cDNA of NaStEP (accession number EU253563) was amplified using the primers: 545
forward, 5’-CCGGAATTCTCATCTTTCACTTCCACCAATCCCATTGTC -3’; reverse, 546
5’-GCGCTGCAGTTATGCATCAGTCTTCTGGAATTTCTCGAAGAC-3’. The PCR 547
product was cloned into a pGBKT7 vector (Clontech). Transformation of NaStEP 548
construction was performed in Saccharomyces cerevisiae Y2HGold cells, according to the 549
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
25
manufacturer’s instructions (YeastmakerTM Yeast Transformation System 2, Clontech). 550
551
Pollen- Pollen tube cDNA Library 552
Messenger RNA was purified from total RNA from N. rastroensis pollen and pollen tubes 553
(germinated during 16 h, 30ºC) using the PolyATtract® mRNA Isolation System 554
(Promega). Total RNA was isolated with TRIzolTM (Invitrogen). To cDNA library 555
construction a 1:1 mix of mRNA from pollen and pollen tubes was used for cDNA 556
synthesis using the CDS III and CDS III/6 primers, according to the manufacturer’s 557
instructions (Make Your Own ‘Mate & PlateTM, Library System, Clontech). The S. 558
cerevisiae strain employed was Y187. 559
560
The cDNA library was screened using BD-NaStEP as bait. The screening was performed 561
using a yeast-mating. Transformed cells were plated on QDO/ X-α-gal medium (SD/-Trp-562
Leu-His-Ade) supplemented with 40 μg/ml X-α-gal (5-bromo-4-chloro-3-indolyl- α-D-563
galactopyranoside), according with the manufacturer’s instructions (Matchmaker® Gold 564
Yeast Two-Hybrid System, Clontech). 565
566
Positive interactions were confirmed by yeast mating between the BD-NaStEP and AC-567
prey proteins and then were growing on DDO and QDO/ X-α-gal/ Aureobasidin A media, 568
the plates contained 125 ng/ml Aureobasidin A, according with the manufacturer’s 569
instructions (Matchmaker® Gold Yeast Two-Hybrid System, Clontech). 570
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
26
571
Full NaSIPP cDNA cloning 572
RNA was isolated from N. alata and N. rastroensis mature pollen with TRIzolTM 573
(Invitrogen) and cDNA was prepared using SMARTerTM RACE cDNA Amplification kit 574
(Clontech). A full-length clone was recovered, cloned into pGEM-T-Easy® and sequenced. 575
576
Confirmation of NaStEP- full length NaSIPP interaction by Yeast-Two Hybrid 577
The cDNA of NaStEP and NaSIPP were amplified using the primers: forward, 5’-578
CACCATGTCATCTTTCACTTCCA-3’; reverse, 5’- 579
TGCATCAGTCTTCTGGAATTTCTC-3’ and the primers forward, 5’- 580
CACCATGGCCTACACACACAACT-3’; reverse, 5’-CTTGGCAGGGGCAGGTG -3’ 581
respectively. As a negative control was used Mir1; the cDNA of Mir1 was amplified using 582
the primers forward, 5’- CACCATGTCTGTGTCTGCT-3’; reverse, 5’-583
ATGACCACCACCACCAATTTC-3’. PCR products were cloned into pENTRTM-D-584
TOPO® vector (Invitrogen), according to the manufacturer’s instructions. A subsequent LR 585
reaction was performed in pDEST32 and pDEST22 (Invitrogen) for NaSIPP, NaStEP and 586
Mir1. Yeast transformation of those constructions was performed in Y2HGold and Y187 587
cells, according to the manufacturer’s instructions (YeastmakerTM Yeast Transformation 588
System 2, Clontech). 589
590
Positive interactions were confirmed by yeast mating and then were growing on DDO and 591
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
27
QDO/ X-α-gal/ Aureobasidin A media, the plates contained 125 ng/ml Aureobasidin A, 592
according with the manufacturer’s instructions (Matchmaker® Gold Yeast Two-Hybrid 593
System, Clontech). 594
595
Transformation of Arabidopsis thaliana seedlings 596
Agrobacterium tumefaciens strain GV3101 cells carrying the clones of interest were grown 597
during a first cycle (20 h, 200 rpm, 28ºC) in 5 ml LB medium with 50 μg ml-1 rifampicin 598
and 100 μg ml-1 spectinomycin. A second cycle of growth was started by inoculation of an 599
aliquot from the first culture at a 1:1000 dilution in fresh medium, and then cultured until 600
late exponential growth phase (OD600 of 1.5-2.0). The bacteria were harvested and 601
resuspended in 10 mM MgCl2 with 100 μM acetosyringone (Sigma-Aldrich) and incubated 602
for 1 h. For cocultivation with A. thaliana, the bacteria were resuspended in 0.5X MS basal 603
salt medium (Sigma-Aldrich) pH 7.2 with 0.003% Sylwett-77, to a final OD600 0.5 604
(Campanoni et al., 2007). 605
606
Transformation pollen grains 607
Pollen tubes 608
Five milligrams of mature pollen grains of N. tabacum (8 x 105 cells; as counted with 609
TC20TM, Bio-Rad) were used in each bombardment trial and suspended in 500 μl of 610
pollen germination medium (Cheung et al., 2002). Pollen suspension was dispersed on 35 611
mm Petri dishes with germination medium and solidified with 0.7% agarose. The slides 612
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
28
were maintained in dark in a humid chamber at 26- 28ºC. After 8- 12 h, the pollen tubes 613
were observed. 614
615
Transient transformation of pollen grains was accomplished with a microprojectile 616
bombardment equipment Bio-Rad Biolistic® PDS-1000/He, according to Chen et al. 617
(2002) and with the manufacturer’s recommended protocol. The pollen grains samples were 618
bombarded twice to increase the yield of transformed pollen tubes. The pollen tubes were 619
observed directly on glass slides. On average, 25 pollen tubes were counted for each 620
sample, unless otherwise indicated. The average transformation efficiency was roughly 621
0.003%. 622
623
Subcellular localization 624
For subcellular localization in pollen tubes, the constructions were under the control of the 625
pollen-specific promoter Lat52 (Twell et al., 1989), five micrograms of Lat52::NaSIPP-626
Tomato and three micrograms of Lat52::Mit-GFP (Logan and Leaver, 2000) were mixed 627
with 10 μl spermidine (0.1 M), 25 μl CaCl2 (2.5 M) and 25 μl of tungsten particles (60 628
mg/ml). The pollen grains were transformed and germinated as described above. A Nikon 629
E800 confocal microscope was used to observe the fluorescence. 630
631
The construction 35S::NaSIPP-GFP was used to transformed A. tumefaciens strain 632
GV3101 cells which were used for A. thaliana seedlings transformation (described above). 633
A solution of 20 nM MitoTracker Red FM (Invitrogen) was used as mitochondrial marker. 634
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
29
635
Complementation of Δmir1 yeast mutant 636
Strains, media, plasmids 637
The yeast strains BY4741 MATα; his3 Δ1; leu2 Δ0; met15 Δ0; ura3 Δ (WT) and BY4741 638
MATα; his3 Δ1; leu2 Δ0; met15 Δ0; ura3 Δ0; YJR077c: kanMX4 (Δmir1) were used for the 639
complementation test. The yeast strains were a gift from Salvador Uribe-Carvajal lab. 640
641
The cDNA of Pic2 was amplified using the primers: forward, 5’- 642
CACCATGGAGTCCAATAAACAACC-3’; reverse, 5’-643
ATAAGAATGCGGCCGCCTAACCGGTGGTTGGTAA-3’. The PCR product were 644
cloned into pENTRTM-D-TOPO® vector (Invitrogen). The constructions of Pic2:pENTR 645
NaSIPP:pENTR and Mir1:pENTR (described above) was used for a LR recombination in 646
pYES-DEST52® vector (Invitrogen). 647
648
Yeast transformation with the NaSIPP, Pic2, Mir1 and empty vector (pYES-DEST52®) 649
constructions were performed in Δmir1 BY4741 cells, according to the manufacturer’s 650
instructions (YeastmakerTM Yeast Transformation System 2, Clontech). The transformed 651
yeasts were grown on selective medium (-Ura, Clontech). 652
653
Growth Conditions 654
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
30
The strains WT and Δmir BY4741 were incubated in YPD preculture medium for 24 h at 30 655
ºC, under agitation at 200 rpm. Subsequently cultured in YPGal (carbon source: Galactose) 656
medium for 24 h at 30 ºC, under agitation at 200 rpm. Finally, cultured in YPGly (carbon 657
source: Glycerol) medium for five days at 30 ºC, under agitation at 200 rpm. 658
659
Transformed yeasts were incubated in SD-Ura (carbon source: Glucose) preculture medium 660
for 24 h at 30 ºC. Subsequently cultured in SGal-Ura (carbon source: Galactose) medium 661
for 24 h at 30 ºC, under agitation at 200 rpm. Then, cultured in SGly-Ura (carbon source: 662
Glycerol) medium for five days at 30 ºC, under agitation at 200 rpm. The evaluation of 663
growth was realized everyday according with the DO600. 664
665
For the evaluation of growth in solid media, and aliquot 100 μl of the YPGal and SGal-Ura 666
culture was taken and spotted on the plates contained glycerol medium (YPGly, SGly-Ura) 667
and 2% of agar. 668
669
RNA Transcript Analysis 670
RNA was isolated with TRIzolTM (Invitrogen) from N. alata pistil, pollen, sepal, leaf, root 671
and petal materials as well as from anthers at different developmental stages (A1: 0.5-1.0 672
cm, A2: 1.1-2.0 cm, A3: 2.1-3.5 cm, A4: 3.5- 6.0 and A5: 6.0 cm- mature flower). Mature 673
pollen RNA (stage A5) was isolated from the following species: N. alata, N. forgetiana, N. 674
rastroensis, N. glauca, N. plumbaginifolia, N. tabacum and N. benthamiana. cDNA was 675
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
31
made from all RNA samples using M-MLV Reverse Transcriptase (Sigma-Aldrich), 676
according with the manufacturer’s instructions. 677
678
The cDNA of NaSIPP was amplified using the specific primers: forward, 5’- 679
GACACGGCTTCTTCTTCACCATTCTC-3’; reverse, 5’- TCTTCACTTGGCAGGGGCA 680
-3’. 681
682
The cDNA of MPC-like from N. tabacum XM_016632920.1 (LOC107808402) was 683
amplified using the specific primers: forward, 5’- 684
ATGGAGTATATTGATCCTGCAAAGTACA-3’; reverse, 5’- 685
TCGTGTATGGTATCTGTCGTCC-3’. 686
687
The cDNA of MPC-like from N. tabacum XM_016617131.1 (LOC107823043) was 688
amplified using the specific primers: forward, 5’-ATGGCGTTTCCAGATAGCTCGACT-689
3’; reverse, 5’-GGTGTCGGAATGACATGTTTATAGAGTTG -3’. 690
691
The cDNA of MPC-like from N. tabacum XM_016600064.1 (LOC107779610) was 692
amplified using the specific primers: forward, 5’- ATGGAGAACTCACGCCGTCA-3’; 693
reverse, 5’-TTGGTAATCCATCTGACAATCCCCT-3’. 694
695
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
32
RNAi construct, NaSIPP suppression and Pollination Phenotype 696
The NTP303 promoter was amplified using the primers: forward, 5’- 697
CCGGAGGTCCTGATACACTCGCAAC-3’; and reverse, 5’- 698
CCGCTCGAGCATGACGTTGTTTTT -3’. The PCR product contains the XhoI and 699
PpuMI restriction sites and was inserted at the RNAi vector pBADC. 700
701
The construction of NaSIPP:pENTR (described above) was used for a LR recombination 702
into the RNAi vector, to generated a sense and antisense NaSIPP (RNAi-NaSIPP). 703
704
Freshly collected SA2-pollen grains of SI N. alata, were transient transformed with five 705
micrograms of RNAi-NaSIPP construction by microprojectile bombardment, as describe 706
above. The pollen grains were used to pollinate SA2SA2 pistils (incompatible cross) and 707
SC10SC10 pistils (compatible cross). Effects on pollination behavior were evaluated by 708
staining style squashes with decolorized aniline blue (Kho and Baer, 1968). The pollen 709
tubes were counted and their growth along of the style evaluated at 72 h after pollination, 710
using an AmScope FM320T microscope. 711
712
Development of a reliable model for the three dimensional structure of NaSIPP 713
Taking advantage of the distant relationship to ATP/ADP translocators (ANT) of NaSIPP 714
models were obtained form SAMT-T08 (Karplus, 2009), I-TASSER (Zhang, 2008), and 715
HHpred (Karplus et al., 1998)/modeller (Eswar et al., 2007), and scored for biological 716
appropriateness using Rd.HMM (Martínez-Castilla and Rodriguez-Sotres, 2010). The most 717
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
33
appropriate prediction (Rd.HMM) was placed in a mixed-lipid membrane (Martínez et al., 718
2009), and subjected to Molecular Dynamics (MD) simulations (NPT cubic box, TIP3P 719
water, 0.15 M NaCl PME electrostatics, SHAKE for C-H bonds, ∆t 2 fs, AMBER 99SB-720
ildn force-field, 9), with the following temperature and time scheme (T,t ): (i) 313K, 100 721
ns; 328K, 100 ns; (ii) five rounds of 298 to 413K,3 heating; 413K, 3ns; 413 to 320K 722
cooling, 10 ns; 320 to 298K cooling, 6 ns; (iii) five rounds of 298 to 413K heating, 3 ns; 723
398K, 10 ns; 398 to 320K cooling, 6 ns; 320 to 298K cooling, 6ns. Conformers were 724
recovered by clustering the 320-298K trajectory sections, and their energy was minimized. 725
The conformer with the highest Rd.HMM had departed significantly form the starting 726
template, but was comparable in quality to NMR structural solutions (Score of ~0.4 times 727
the length of the NaSIPP amino acid sequence; Martínez-Castilla and Rodriguez-Sotres, 728
2010). 729
730
Bimolecular fluorescence complementation (BiFC) assay 731
A. thaliana seedlings 732
The NaSIPP:pENTR and NaStEP:pENTR (described above) constructions was used for a 733
LR recombination in pUBC-nYFP and pUBC-cYFP vectors (Grefen et al., 2010); to yield 734
the NaStEP-nYFP and NaSIPP-cYFP fusion proteins. The BiFC analyses were performed 735
by transient transformation of A. thaliana seedlings (described above). A solution of 20 nM 736
MitoTracker Red FM (Invitrogen) was used as mitochondrial marker. 737
738
Tobacco pollen tubes 739
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
34
Seven micrograms of Lat52::NaSIPP-CVenus and Lat52::NaStEP-NVenus constructions 740
were mixed with 10 μl spermidine (0.1 M), 25 μl CaCl2 (2.5 M) and 25 μl of tungsten 741
particles (60 mg/ml). The pollen grains were transformed and germinated as described 742
above. A fluorescence microscope was used to observe the reestablishment of Venus 743
fluorescence. 744
745
In addition, the pollen grains were cobombarded with NaStEP-NV and empty vector (CV), 746
or with the NaSIPP-CV and empty vector (NV), as described above. A rapid screening was 747
performed looking for fluorescence in all the glass slides where the pollen grains were 748
deposited. Then, a screening was carried out with selected preparations, performing 749
detailed observations of the pollen tubes. An average of 200 pollen tubes were analyzed. 750
751
For the coexpression assays of NaStEP-GFP and NaSIPP-Tomato in pollen tubes, were 752
used five micrograms of Lat52::NaSIPP-Tomato construct and seven micrograms of the 753
Lat52::NaStEP-GFP construct. The transient transformation of pollen grains was done as 754
described above. 755
756
Microscopic Observations 757
Confocal images were obtained on Olympus FV1000 and Nikon E800 microscope. GFP 758
fluorescence was excited with the 458- or 488-nm Argon laser lines; YFP and Venus 759
fluorescence was excited with the 514-nm laser line; aniline blue fluorescence was excited 760
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
35
with the 390-nm laser line; MitoTracker Red FM (Invitrogen) and Tomato fluorescence 761
were excited with the 581 nm laser line. Emitted light was collected through a NFT515 762
dichroic and 505- to 530-nm (GFP), 535- to 590-nm (YFP), 380- to 390-nm (aniline blue) 763
and 600- to 650-nm (MitoTracker Red FM, Invitrogen) band-pass filters. 764
765
Accession Number 766
Sequence data from this article can be found in the GenBank accession number for 767
nucleotide sequence: BankIt1982585 Seq KY471417. 768
769
Figure legends 770
Figure 1. NaStEP interacts with the pollen protein NaSIPP. Interaction between NaStEP 771
and NaSIPP was detected by a Yeast Two Hybrid assay. (A) Cotransformed S. cerevisiae 772
growing on the QDO medium (SD/Trp-Leu-Ade-His). (B) Yeast growth on QDO medium 773
supplemented with X-α-Gal and Aureobasidin; positive interactions support growth and 774
turn blue. (C) Yeast growth on DDO medium (SD/Trp-Leu). BD= Binding Domain. AD= 775
Activation Domain. Full NaSIPP; the whole NaSIPP protein. Mir1; Mitochondrial 776
phosphate carrier of S. cerevisiae. BD and AD empty vectors were used as negative 777
controls. 778
779
Figure 2. NaSIPP is a phosphate transporter and partially complements the absence of Mir1 780
in S. cerevisiae. (A) Growth curve of the yeast mutant Δmir1, the wild-type (WT) strain and 781
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
36
the Δmir1 yeast transformed with the plasmid pYES-DEST52 (empty vector), with construct 782
Pic2::pYES-DEST52, with NaSIPP::pYES-DEST52 and Mir1::pYES-DEST52. Yeast were 783
grown on liquid glycerol medium at 30 ºC. (B) Yeast were grown on solid glycerol medium 784
at 30 ºC for ten days and (C) Replica-plated on solid glucose medium was incubated for 785
three days at 30 ºC. 786
Figure 3. Schematic representation of the predicted three-dimensional structure of NaSIPP. 787
(A) The model is shown as cartoons from the membrane side. A translucent cartoon 788
representation is shown from the top (B) showing the region indicated by the red dotted line 789
in (A), or from the bottom (C) showing the region indicated by the yellow dotted line in 790
(A). In (B) and (C) the amino acids atoms are represented as Van der Walls spheres and 791
colored by amino acid type: red, acidic; blue, basic; green, polar neutral; light gray, 792
hydrophobic. Prepared using Visual Molecular Dynamics (Humphrey et al., 1996). 793
Figure 4. Subcelullar localization of NaSIPP. Coexpression of NaSIPP-Tomato with the 794
mitochondrial marker Mit-GFP. Labeled compartments in N. tabacum pollen tubes 795
expressing: (A) NaSIPP-Tomato (red), (B) Mit-GFP (green) and (C) merge (yellow) are 796
shown. The white arrow shows the colocalization of NaSIPP-Tomato and Mit-GFP. The 797
pollen grains were transformed by microprojectile bombardment. Scale bar: 5μm. 798
Transiently transformed A. thaliana seedlings expressing (D) the 35S:NaSIPP:GFP 799
construct (green) in hypocotyl cells. (E) MitoTracker Red FM signal is observed in red (F, 800
G) merge (yellow). Scale bar: 40μm. 801
Figure 5. NaStEP interacts with NaSIPP in plant cells. Interaction between NaStEP and 802
NaSIPP was detected by Bimolecular Fluorescence Complementation (BiFC) assays. (A) 803
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
37
Coexpression of NaStEP-nYFP and NaSIPP-cYFP constructs in roots transiently 804
transformed in A. thaliana seedlings. (B) Merge of A and C. (C) Bright-field. (D) 805
Coexpression of NaStEP-nYFP and NaSIPP-cYFP constructs in hypocotyls transiently 806
transformed in A. thaliana seedlings. (E) Merge of D and F. (F) Bright-field. The YFP 807
fluorescence is shown in yellow. Scale bar: 50 μm. (G) Coexpression of NaStEP-NVen and 808
NaSIPP-CVen constructs of tobacco pollen tubes transformed by microprojectile 809
bombardment. (H) Merge of G and I. (I) Bright-field. The Venus fluorescence is shown in 810
yellow. Scale bar: 40 μm. 811
Figure 6. Physical interaction between NaStEP and NaSIPP occurs in mitochondria. 812
Colocalization of the BiFC signal with the mitochondrial marker MitoTracker Red in A. 813
thaliana seedlings. (A) Localization of the interaction between NaStEP-nYFP with 814
NaSIPP-cYFP (green) expressed in hypocotyl cells. (B) MitoTracker Red signal is 815
observed in red. C and D are merged signal (yellow). A. thaliana seedlings were transiently 816
transformed. Scale bar: 50 μm. 817
Figure 7. Interaction between NaStEP and NaSIPP occurs in the mitochondria of pollen 818
tube. (A) Localization pattern of NaSIPP-Tomato (red), (B) NaStEP-GFP (green) and (C) 819
The coexpression of NaSIPP-Tomato with NaStEP-GFP on red channel, (D) On green 820
channel and (E) Merge (yellow). The pollen tubes were transformed by microprojectile 821
bombardment. Scale bar: 10 μm. 822
823
Figure 8. The NaSIPP transcript is specifically accumulated in mature pollen of Nicotiana 824
species. mRNA levels of different MPC in (A) Different organs of N. alata. (B) 825
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
38
Developmental anthers stages, A1: 0.5-1.0 cm; A2: 1.1-2.0 cm; A3: 2.1-3.5 cm; A4: 3.5-6.0 826
cm; A5: 6.0 cm- mature flower. (C) Detection of transcripts in different genetic Nicotiana 827
backgrounds. Primers used were specific for the gene shown at the right: NaSIPP, 828
XM_0166322920.1 (20.1); XM_016649631.1 (31.1); XM_016600064.1 (64.1) and 829
Ubiquitin (UBQ) was used as a load control. SI: Self-incompatible and SC: Self-830
compatible. 831
Figure 9. Suppression of NaSIPP in pollen tubes disrupts SI in N. alata. Pistils from SI N. 832
alata were pollinated with SA2-pollen and prepared for imaging after 72 h of pollination. 833
(A) As shown in the diagram, the field of view is at or very near the base of the style. (B) 834
SI N. alata SA2SA2 pistils pollinated with untransformed SA2 –pollen. Epidermal tissue (ep) 835
is also visible. The untransformed control pollen shows normal S-allele specific pollen 836
rejection because no SA2-pollen tubes are evident. (C) SI N. alata SA2SA2 pistils pollinated 837
with SA2 -pollen bombarded with the empty vector. (D) Pollen tubes reaching the base of a 838
style of: SI N. alata SA2SA2, pollinated with SA2-pollen bombarded with the construct RNAi-839
NaSIPP. Pollen tubes (pt) appear as fiber with brightly stained callose plugs (arrows). (E) 840
SI N. alata SC10SC10 pistils pollinated with SA2-pollen bombarded with the construction 841
RNAi-NaSIPP. Scale bar: 50 μm. (F) Histogram of pollen tube lengths after of SI N. alata 842
SA2SA2 pistils were pollinated with untransformed SA2-pollen, with pollen grains bombarded 843
with empty vector and with the construct RNAi-NaSIPP. Results are the average and 844
standard error of 28 pollinations with untransformed pollen grains, 67 pollinations with 845
pollen grains transformed with the empty vector and 89 pollinations with pollen grains 846
transformed with the RNAi-NaSIPP construct. The error bars represent the SEM; asterisk 847
represents statistical significance (P < 0.05, One-way ANOVA with Dunett’s post test). 848
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
39
849
Supplementary Figure 1. The NaSIPP transcript is specifically detected in mature pollen in 850
N. rastroensis. Total RNA (5 μg) was loaded in each lane, blotted and probed with 32P-851
labelled C-terminal NaSIPP. To ascertain equal RNA loading, blots were stained with 852
methylene blue (lower section). 853
854
Supplementary Figure 2. (A) Sequence alignment of NaSIPP, functional and putative 855
Mitochondrial Phosphate Carrier (MPC). Functional MPC from: Saccharomyces cerevisiae 856
Mir1 (NP_012611) and Pic2 (NP_010973.3), Ipomoea tricolor (BAF64711), Lotus 857
japonicus (BAB83689), Glycine max (NP_001237304), Mus musculus (NP_598429), 858
Rattus novergicus (NP_620800), Homo sapiens isoform B (NP_002626), Arabidopsis 859
thaliana 3 (NP_190454), A. thaliana 5 (NP_196908). Putative MPC from: Solanum 860
tuberosum (XP_006347354), S. lycopersicum (XP_004242142), Ricinus communis 861
(XP_002512859.1), Populus trichocarpa (XP_002300143), Medicago truncatula 862
(XP_003624478), Danio rerio (AAH67565), Cricetulus griseus (ERE87819), Nicotiana 863
tomentosiformis (XP_009618018), Malus domestica (XP_008341244), A. thaliana 2 864
(NP_179319), N. alata (NaSIPP). These sequences were aligned using PSI/TM-Coffee 865
(http://tcoffee.crg.cat/apps/tcoffee/do:tmcoffee). Residues highlighted in pink correspond to 866
the predicted transmembrane region, in yellow the residues found in the inner part of the 867
membrane and purple the residues found in the external part of the membrane. The residues 868
indicated by downward asterisk are the amino acids, which were found critical or important 869
for the phosphate transport activity of Mir1 on the basis of mutagenesis studies (Briggs et 870
al., 1999; Phelps et al., 2001; Wohlrab et al., 2002). Position 1 corresponds to the first 871
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
40
amino acid of Mir1. (B) Phylogenetic tree of NaSIPP, functional and putative MPC. The 872
phylogenic analysis was originated from an alignment, which was performed by MUSCLE 873
(http://www.ebi.ac.uk/Tools/msa/muscle/). Alignment was delimited and curated by 874
Gblocks (http://molevol.cmima.csic.es/castresana/Gblocks_server.html). ProtTest 2.4 875
server determined the best model for amino acids substitution. The maximum likelihood 876
tree was estimated by PHYML (http://www.atgc-montpellier.fr/phyml/). 877
Supplementary Figure 3. BiFC assays controls. Fluorescence images of seedlings and 878
pollen tubes expressing (fluorescence, left; bright-field, right): (A-D) NaStEP-nYFP 879
coexpressed with empty vector (c-YFP) in root and hypocotyl of A. thaliana seedlings. (E-880
H) NaSIPP-cYFP coexpressed with empty vector (n-YFP) in root and hypocotyl of A. 881
thaliana seedlings. Scale bar: 50 μm. (I-J) NaStEP-NVen coexpressed with empty vector 882
(CVen) in tobacco pollen tubes. (K-L) NaSIPP-CVen coexpressed with empty vector 883
(NVen) in tobacco pollen tubes. Scale bar: 40 μm. 884
885
Supplementary Figure 4. Sequence alignment of different Nicotiana SIPP sequences. (A) 886
cDNA sequence of SI Nicotiana spp (N. alata, N. rast roensis and N. forgetiana ) and SC 887
Nicotiana spp (N. plumbaginifolia, N. tabacum and N. benthamiana ). The red boxes 888
indicate the first stop codon of each sequence. (B) Predicted protein sequences obtained 889
from cDNA of SI and SC Nicotiana spp. The alignment was performed by MUSCLE 890
(http://www.ebi.ac.uk/Tools/msa/muscle/). 891
892
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
41
Supplementary Table 1. Evaluation of pollen tube length after RNAi-NaSIPP pollen 893
transformation. Pistils SI N. alata SA2SA2 were pollinated with: Untransformed SA2-pollen, 894
SA2-pollen transformed with empty vector and SA2-pollen transformed with RNAi-NaSIPP 895
construction by microprojectile bombardment. After 72 h of pollination, styles were 896
prepared for imaging and the pollen tube length was evaluated in each case. The mean and 897
standard error (SEM) was calculated. 898
899
Supplementary Table 2. NaSIPP suppression disrupts S-specific pollen rejection. SI N. 900
alata SA2SA2 pistils were pollinated with: Untransformed SA2-pollen, SA2-pollen transformed 901
with empty vector and SA2-pollen transformed with an RNAi-NaSIPP construction by 902
microprojectile bombardment. Analysis was performed after 72 h of pollination. Styles 903
were prepared for imaging and the pollen tube length was evaluated in each case. To test if 904
exist a statistical difference between treatments One-way ANOVA with Dunnett's post test 905
was performed using GraphPad Prism version 5.0b for Mac OS X, GraphPad Software, San 906
Diego California USA, www.graphpad.com. 907
908
LITERATURE CITED 909
Al-Nasser I, Crompton M (1986) The entrapment of the Ca2+ indicator arsenazo III in the 910
matrix space of rat liver mitochondria by permeabilization and resealing. Na+-911
dependent and -independent effluxes of Ca2+ in arsenazo III-loaded mitochondria. 912
Biochem J 239(1): 31-40 913
Anderson MA, Cornish EC, Mav SL, Williams EG, Hoggart R, Atkinson A, Boning I, 914
Greg B, Simpson RJ, Roche PJ, Haley JD, Penschow JD, Niall HD, Tregear GW, 915
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
42
Cohhlan JP, Crawford RJ, Clarke AE (1986) Cloning of cDNA for a stylar 916
glycoprotein associated with expression of self-incompatibility in Nicotiana alata. 917
Nature 321(6065): 38-44 918
Arpagaus S, Rawyler A, Braendle R (2002) Occurrence and characteristics of the 919
mitochondrial permeability transition in plants. J Bio Chem 277(3): 1780-1787 920
Ashkani J, Rees DJ (2016) A Comprehensive Study of Molecular Evolution at the Self-921
Incompatibility Locus of Rosaceae. J Mol Evol 82(2-3): 128-145 922
Balk J, Leaver CJ, McCabe PF (1999) Translocation of cytochrome c from the 923
mitochondria to the cytosol occurs during heat-induced programmed cell death in 924
cucumber plants. FEBS Lett 463(1-2): 151-154 925
Bàthori G, Parolini I, Tombola F, Szabò I, Messina A, Oliva M, De Pinto V, Lisanti 926
M, Sargiacomo M, Zoratti M (1999) Porin is present in the plasma membrane where 927
it is concentrated in caveolae and caveolae-related domains. J Biol Chem 274(42): 928
29607-29612 929
Bedhomme M, Hoffmann M, McCarthy EA, Gambonnet B, Moran RG, Rébeillé F, 930
Ravanel S (2005) Folate metabolism in plants: an Arabidopsis homolog of the 931
mammalian mitochondrial folate transporter mediates folate import into chloroplasts. J 932
Biol Chem 280(41): 34823-34831 933
Beecher B, McClure BA (2001) Expressing self-incompatibility RNases (S-RNases) in 934
transgenic plants. Methods Mol Biol 160: 65-85 935
Beers EP (1997) Programmed cell death during plant growth and development. Cell Death 936
Differ 4(8): 649-661 937
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
43
Bhosale G, Sharpe JA, Sundier SY, Duchen MR (2015) Calcium signaling as a mediator 938
of cell energy demand and a trigger to cell death. Ann N Y Acad Sci 1350: 107-116 939
Briggs C, Mincone L, Wohlrab H (1999) Replacements of basic and hydroxyl amino 940
acids identify structurally and functionally sensitive regions of the mitochondrial 941
phosphate transport protein. Biochemistry 38(16): 5096-5102 942
Busot GY, McClure B, Ibarra-Sánchez CP, Jiménez-Durán K, Vázquez-Santana S, 943
Cruz-García F (2008) Pollination in Nicotiana alata stimulates synthesis and transfer 944
to the stigmatic surface of NaStEP, a vacuolar Kunitz proteinase inhibitor homologue. 945
J Exp Bot 59(11): 3187-3201 946
Campanoni P, Sutter JU, Davis CS, Littlejohn GR, Blatt MR (2007) A generalized 947
method for transfecting root epidermis uncovers endosomal dynamics in Arabidopsis 948
root hair. Plant J 51: 322-330 949
Chen CY, Wong EI, Vidali L, Estavillo A, Hepler PK, Wu HM, Cheung AY (2002) 950
The regulation of actin organization by actin-depolimerizing factor in elongating 951
pollen tubes. Plant Cell 14(9): 2175-2190 952
Cheung AY, Wu HM (2008) Structural and signaling networks for the polar cell growth 953
machinery in pollen tubes. Annu. Rev. Plant Biol. 59: 547–72 954
Cheung AY, Chen CY, Glaven RH, de Graaf BH, Vidali L, Hepler PK, Wu HM 955
(2002) Rab2 GTPase regulates vesicle trafficking between the endoplasmic reticulum 956
and the Golgi bodies and is important to pollen tube growth. Plant Cell 14(4): 945-962 957
Covey PA, Kondo K, Welch L, Frank E, Sianta S, Kumar A, Nuñez R, Lopez-Casado 958
G, van der Knaap E, Rose JK, McClure BA, Bedinger PA (2010) Multiple features 959
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
44
that distinguish unilateral incongruity and self-incompatibility in the tomato clade. 960
Plant J 64(3): 367-378 961
Crompton M, Costi A (1988) Kinetic evidence for a heart mitochondrial pore activated by 962
Ca+2, inorganic phosphate and oxidative stress. A potential mechanism for 963
mitochondrial dysfunction during cellular Ca+2 overload. Eur J Biochem 178(2): 489-964
501 965
Crompton M, Costi A, Hayat L (1987) Evidence for the presence of a reversible Ca+2- 966
dependent pore activated by oxidative stress in heart mitochondria. Biochem J 245(3): 967
915-918 968
Cruz-García F, Hancock CN, Kim D, McClure B (2005) Stylar glycoproteins bind to S-969
RNase in vitro. Plant J 42(3): 295-304 970
de Nettancourt D (2001) Incompatibility and Incongruity in Wild and Cultivated Plants. 971
Springer-Verlag, New York 972
Doran E, Halestrap AP (2000) Cytochrome c release from isolated rat liver mitochondria 973
can occur independently of outer-membrane rupture: possible role of contact sites. 974
Biochem J 348:343–350 975
Entani T, Iwano M, Shiba H, Che FS, Isogai A, Takayama S (2003) Comparative 976
analysis of the self-incompatibility S-locus region of Prunus mume: identification of a 977
pollen-expressed F-box gene with allelic diversity. Genes Cells 8(3): 203-213 978
Eswar N, Webb B, Marti-Renom MA, Madhusudhan MS, Eramian D, Shen M, Pieper 979
U, Sali A (2007) Comparative protein structure modeling using MODELLER. Curr 980
Protoc Protein Sci Chapter 2:Unit 2.9 981
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
45
Fields S, Song O (1989) A novel genetic system to detect protein-protein interactions. 982
Nature 340(6230): 245-246 983
Fukao Y, Hayashi Y, Mano S, Hayashi M, Nishimura M (2001) Developmental analysis 984
of a putative ATP/ADP carrier protein localized on glyoxysomal membranes during 985
the peroxisome transition in pumpkin cotyledons. Plant Cell Physiol 42(8): 835-841 986
García-Fernández R, Peigneur S, Pons T, Alvarez C, González L, Chávez MA, Tytgat 987
J (2016) The Kunitz-Type Protein ShPI-1 Inhibits Serine Proteases and Voltage-Gated 988
Potassium Channels. Toxins (Basel) 8(4): 110 989
Goldraij A, Kondo K, Lee CB, Hancock CN, Sivaguru M, Vazquez-Santana S, Kim S, 990
Phillips TE, Cruz-García F, McClure BA (2006) Compartmentalization of S-RNase 991
and HT-B degradation in self-incompatible Nicotiana. Nature 439 (7078): 805-810 992
Grefen C, Donald N, Schumacher K, Blatt MR (2010) A Ubiquitin-10 promoter-based 993
vector set for fluorescent protein tagging facilitates temporal stability and native 994
protein distribution in transient and stable expression studies. Plant J 64(2): 355-365 995
Gutiérrez-Aguilar M1, Pérez-Martínez X, Chávez E, Uribe-Carvajal S (2010) In 996
Saccharomyces cerevisiae, the phosphate carrier is a component of the mitochondrial 997
unselective channel. Arch Biochem Biophys 494(2): 184-191 998
Halestrap AP, Clarke SJ, Javadov SA (2004) Mitochondrial permeability transition pore 999
opening during myocardial reperfusion-a target for cardioprotection. Cardiovasc Res 1000
61(3): 372-385 1001
Halestrap AP, Kerr PM, Javadov S, Woodfield KY (1998) Elucidating the molecular 1002
mechanism of the permeability transition pore and its role in reperfusion injury of the 1003
heart. Biochim Biophys Acta 1366(1-2): 79-94 1004
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
46
Hamel P, Saint-Georges Y, de Pinto B, Lachacinski N, Altamura N, Dujardin G 1005
(2004) Redundancy in the function of mitochondrial phosphate transport in 1006
Saccharomyces cerevisiae and Arabidopsis thaliana. Mol Microbiol 51:307-317 1007
Hancock CN, Kent L, McClure BA (2005) The stylar 120 kDa glycoprotein is required 1008
for S-specific pollen rejection in Nicotiana. Plant J 43(5): 716-723 1009
Harvey AL (2001) Twenty years of dendrotoxins. Toxicon 39(1): 15-26 1010
Haworth RA, Hunter DR (1979) The Ca+2-induced membrane transition in mitochondria: 1011
II. Nature of the Ca+2 trigger site. Arch Biochem and Biophys 195(2): 460-467 1012
Hua Z, Kao TH (2008) Identification of major lysine residues of S(3)-RNase of Petunia 1013
inflata involved in ubiquitin-26S proteasome-mediated degradation in vitro. Plant J 1014
54(6): 1094-1104 1015
Hunter DR, Haworth RA (1979) The Ca2+-induced membrane transition in mitochondria. 1016
I. The protective mechanism. Arch Biochem Biophys 195(2): 453-459 1017
Jiménez-Durán K, McClure B, García-Campusano F, Rodríguez-Sotres R, Cisneros J, 1018
Busot G, Cruz-García F (2013) NaStEP: a proteinase inhibitor essential to self-1019
incompatibility and positive regulator of the HT-B stability in Nicotiana alata pollen 1020
tubes. Plant Physiol 161(1): 97-107 1021
Karplus K, Barrett C, Hughey R (1998) Hidden Markov models for detecting remote
protein homologies. Bioinformatics 14(10): 846-856
Karplus K (2009) SAM-T08, HMM-based protein structure prediction. Nucleic Acids Res
37(Web Server issue): W492-7
Kho YO, Baer J (1968) Observing pollen tubes by means of fluorescence. Euphytica 17: 1022
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
47
298–302 1023
Kondo K, McClure B (2008) New microsome-associated HT-B family proteins from 1024
Nicotiana respond to pollination and define an HT/NOD-24 protein family. Mol Plant 1025
1(4): 634-644 1026
Kondo K, Yamamoto M, Matton DP, Sato T, Hirai M, Norioka S, Hattori T, 1027
Kowyama Y (2002) Cultivated tomato has defects in both S-RNase and HT genes 1028
required for stylar function of self-incompatibility. Plant J 29(5): 627-636 1029
Kubo K, Entani T, Takara A, Wang N, Field AM, Hua Z, Toyoda M, Kawashima S, 1030
Ando T, Isogai A, Kao TH, Takayama S (2010) Collaborative non-self recognition 1031
system in S-RNase–based self-incompatibility. Science 330(6005): 796-799 1032
Kushnareva YE, Haley LM, Sokolove PM (1999) The role of low (< or = 1mM) 1033
phosphate concentrations in regulation of mitochondrial permeability: modulation of 1034
matrix free Ca+2 concentration. Arch Biochem Biophys 363(1): 155-162 1035
Lai Z, Ma W, Han B, Liang L, Zhang Y, Hong G, Xue Y (2002) An F-box gene linked 1036
to the self-incompatibility (S) locus of Antirrhinum is expressed specifically in pollen 1037
and tapetum. Plant Mol Biol 50(1); 29-42 1038
Lam E, del Pozo O (2000) Caspase-like protease involvement in the control of plant cell 1039
death. Plant Mol Biol 44(3): 417-428 1040
Lancelin JM, Foray MF, Poncin M, Hollecker M, Marion D (1994) Proteinase inhibitor 1041
homologues as potassium channel blockers. Nat Struct Biol 1(4): 246-250 1042
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
48
Lee CB, Kim S, McClure B (2009) A pollen protein, NaPCCP, that binds pistil 1043
arabinogalactan proteins also binds phosphatidylinositol 3-phosphate and associates 1044
with the pollen tube endomembrane systems. Plant Physiol 149(2): 791-802 1045
Lee CB, Swatek KN, McClure B (2008) Pollen proteins bind to the C-terminal domain of 1046
Nicotiana alata pistil arabinogalactan proteins. J Biol Chem 283(40): 26965-26973 1047
Leroch M, Kirchberger S, Haferkamp I, Wahl M, Neuhaus HE, Tjaden J (2005) 1048
Identification and characterization of a novel plastidic adenine nucleotide uniporter 1049
from Solanum tuberosum. J Biol Chem 280(18): 17992-8000 1050
Leung AW, Varanyuwatana P, Halestrap AP (2008) The mitochondrial phosphate 1051
carrier interacts with cyclophilin D and may play a key role in the permeability 1052
transition. J Biol Chem 283(39): 26312-26323 1053
Lind JL, Bönig I, Clarke AE, Anderson MA (1996) A style-specific 120 kDa 1054
glycoprotein enters pollen tubes of Nicotiana alata in vivo. Sex Plant Reprod 9: 75-86 1055
Lisanti MP, Scherer PE, Tang Z, Sargiacomo M (1994) Caveolae, caveolin and 1056
caveolin-rich membrane domains: a signaling hypothesis. Trends Cell Biol 4(7): 231-1057
235 1058
Logan DC, Leaver CJ (2000) Mitochondria-target GFP highlights the heterogeneity of
mitochondrial shape, size and movement within living plant cells. J Exp Bot 51(346):
865-871
Luu DT, Qin X, Morse D, Cappadocia M (2000) S-RNase uptake by compatible pollen 1059
tubes in gametophytic self-incompatibility. Nature 407(6804): 649-651 1060
Martínez L, Andrade R, Birgin EG, Martínez JM (2009) PACKMOL: a package for
building initial configurations for molecular dynamics simulations. J Comput Chem
30(13): 2157-64
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
49
Martínez-Castilla LP, Rodríguez-Sotres R (2010) A score of the ability of a three-
dimensional protein model to retrieve its own sequence as a quantitative measure of its
quality and appropriateness. PLoS One 5(9): e12483
McClure BA, Cruz-García F, Romero C (2011) Compatibility and incompatibility in S-
RNase-based systems. Ann Bot 108(4): 647-658
McClure BA, Haring V, Ebert PR, Anderson MA, Simpson RJ, Sakiyama F, Clarke A 1061
(1989) Style self-incompatibility gene products of Nicotiana alata are ribonucleases. 1062
Nature 342(6252): 955-957 1063
McClure BA, Mou B, Canevascini S, Bernatzky (1999) A small asparagine-rich protein 1064
required for S-allele-specific pollen rejection in Nicotiana. Proc Natl Acad Sci USA. 1065
96(23): 13548-13553 1066
Meng D, Gu Z, Li W, Wang A, Yuan H, Yang Q, Li T (2014) Apple MdABCF assists in 1067
the transportation of S-RNase into pollen tubes. Plant J 78(6): 990-1002 1068
Murakami H, Blobel G, Pain D (1990) Isolation and characterization of the gene for a 1069
yeast mitochondrial import receptor. Nature 347(6292): 488-491 1070
Murffet J, Atherto TL, Mou B, Gasser CS, McClure BA (1994) S-RNase expressed in 1071
transgenic Nicotiana causes S-allele specific pollen rejection. Nature 367(6463): 563-1072
566 1073
Murffet J, Strabala TJ, Zurek DM, Mou B, Beecher B, McClure BA (1996) S-RNase 1074
and interspecific pollen rejection in the genus Nicotiana: Multiple pollen-rejection 1075
pathways contribute to unilateral incompatibility between self-incompatible and self-1076
compatible species. Plant Cell 8(6): 943-958 1077
O’Brien M, Kapfer C, Major G, Laurin M, Bertrand C, Kondo K, Kowyama Y, 1078
Matton DP (2002) Molecular analysis of the stylar-expressed Solanum chacoense 1079
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
50
small asparagine-rich protein family related to the HT modifier of gametophytic self-1080
incompatibility in Nicotiana. Plant J 32 (6): 985-996 1081
Palmieri F (1994) Mitochondrial carrier proteins. FEBS Lett 346(1): 48-54 1082
Palmieri F (2004) The mitochondrial transport family (SCL25): physiological and 1083
pathological implications. Pflugers Arch 447(5): 689-709 1084
Palmieri F, Pierri CL, De Grassi A, Nunes-Nesi A, Fernie AR (2011) Evolution, 1085
structure and function of mitochondrial carriers: a review with insights. Plant J 66(1): 1086
161-181 1087
Palmieri L, Rottensteiner H, Girzalsky W, Scarcia P, Palmieri F, Erdmann R (2001) 1088
Identification and functional reconstitution of the yeast peroxisomal adenine nucleotide 1089
transporter. EMBO J 20(18): 5049-5059 1090
Peigneur S, Billen B, Derua R, Waelkens E, Debaveye S, Béress L, Tytgat J (2011) A 1091
bifunctional sea anemone peptide with Kunitz type protease and potassium channel 1092
inhibiting properties. Biochem Pharmacol 82(1): 81-90 1093
Petronilli V, Nicolli A, Costantini P, Colonna R, Bernardi P (1994) Regulation of the 1094
permeability transition pore, a voltage-dependent mitochondrial channel inhibited by 1095
cyclosporin A. Biochim Biophys Acta 1187: 255-259 1096
Phelps A, Briggs C, Haefele A, Mincone L, Ligeti E, Wohlrab H (2001) Mitochondrial 1097
phosphate transport protein. Reversions of inhibitory conservative mutations identify 1098
four helices and a nonhelix protein segment with transmembrane interactions and 1099
Asp39, Glu137, and Ser158 as nonessential for transport. Biochemistry 40(7): 2080-1100
2086 1101
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
51
Puerta AR, Ushijima K, Koba T, Sassa H (2009) Identification and functional analysis of 1102
pistil self-incompatibility factor HT-B of Petunia. J Exp Bot 60(4): 1309–1318 1103
Qiao H, Wang H, Zhao J, Huang J, Zhang Y, Xue Y (2004) The F-box protein AhSLF-1104
S2 physically interacts with S-RNases that may be inhibited by the ubiquitin/26S 1105
proteasome pathway of protein degradation during compatible pollination in 1106
Antirrhinum. Plant Cell 16(3): 582-595 1107
Roldán J, Rojas HJ, Goldriaj A (2012) Disorganization of F-actin cytoskeleton precedes 1108
vacuolar disruption in pollen tubes during the in vivo self-incompatibility response in 1109
Nicotiana alata. Ann Bot 110(4): 787-795 1110
Sassa H, Hirano H (2006) Identification of a new class of pistil-specific proteins of 1111
Petunia inflata that is structurally similar to, but functionally distinct from the self-1112
incompatibility factor HT. Mol Genet and Genomics 275 (1): 97-104 1113
Schultz CJ, Hauser K, Lind JL, Atkinson AH, Pu Z, Anderson MA, Clarke AE (1997) 1114
Molecular characterization of a cDNA sequence encoding the backbone of a style 1115
specific 120kDa glycoprotein which has features of both extensions and 1116
arabinogalactan-proteins. Plant Mol Biol 35: 833-845 1117
Serrano I, Pelliccione S, Olmedilla A (2010) Programmed-cell-death hallmarks in 1118
incompatible pollen and papillar stigma cells of Olea europaea L. under free 1119
pollination. Plant Cell Rep 29(6): 561-572 1120
Sijacic P, Wang X, Skirpan AL, Wang Y, Dowd PE, McCubbin AG, Huang S, Kao 1121
TH (2004) Identification of the pollen determinant of S-RNase-mediated self-1122
incompatibility. Nature 429(6989): 302-305 1123
Stein JC, Hansen G (1999) Mannose induces an endonuclease responsible for DNA 1124
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
52
laddering in plant cells. Plant Physiol 121(1): 71-80 1125
Sun YL, Zhao Y, Hong X, Zhai ZH (1999) Cytochrome c release and caspase activation 1126
during menadione-induced apoptosis in plants. FEBS Lett 462(3): 317-321 1127
Thomas SG, Franklin-Tong VE (2004) Self-incompatibility triggers programmed cell 1128
death in Papaver pollen. Nature 429(6989): 305-309 1129
Twell D, Wing R, Yamaguchi J, McCormick S (1989) Isolation and expression of an 1130
anther-specific gene from tomato. Mol Gen Genet 217(2-3): 240-245 1131
Ushijima K, Sassa H, Dandekar AM, Gradziel TM, Tao R, Hirano H (2003) Structural 1132
and transcriptional analysis of the self-incompatibility locus of almond: identification 1133
of a pollen-expressed F-box gene with haplotype-specific polymorphism 15(3): 771-1134
781 1135
Varanyuwatana P, Halestrap AP (2012) The roles of phosphate and the phosphate carrier 1136
in the mitochondrial permeability transition pore. Mitochondrion 12(1): 120-125 1137
Vierstra RD (2003) The ubiquitin/26S proteasome pathway, the complex last chapter in 1138
the life of many plant proteins. Trends Plant Sci 8(3): 135-142 1139
Wandrey M, Trevaskis B, Brewin N, Udvardi MK (2004) Molecular and cell biology of 1140
a family of voltage-dependent anion channel porins in Lotus japonicus. Plant Physiol 1141
134(1): 182-193 1142
Wang Y, Tsukamoto T, Yi KW, Wang X, Huang S, McCubbin AG, Kao TH (2004) 1143
Chromosome walking in the Petunia inflata self-incompatibility (S-) locus and gene 1144
identification in an 881-kb contig containing S2-RNase. Plant Mol Biol 54(5): 727–74 1145
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
53
Wang CL, Xu GC, Jiang XT, Chen G, Wu J, Wu HQ, Zhang SL (2009) S-RNase 1146
triggers mitochondrial alteration and DNA degradation in the incompatible pollen tube 1147
of Pyrus pyrifolia. Plant J 57(2): 220-9 1148
Wang CL, Zhang SL (2011) A cascade signal pathway occurs in self-incompatibility of 1149
Pyrus pyrifolia. Plant Signal Behav 6(3): 420-1 1150
Wheeler D, Newbigin E (2007) Expression of 10 S-class SLF-like genes in Nicotiana alata 1151
pollen and its implications for understanding the pollen factor of the S locus. Genetics 1152
177(4): 2171-2180 1153
Williams JS, Wu L, Lis S, Sun P, Kao TH (2015) Insight into S-RNase-based self-1154
incompatibility in Petunia: recent findings and future directions. Front Plant Sci 6:41 1155
Wohlrab H, Annese V, Haefele A (2002) Single replacement constructs of all hydroxyl, 1156
basic, and acidic amino acids identify new function and structure-sensitive regions of 1157
the mitochondrial phosphate transport protein. Biochemistry 41(9): 3254-3261 1158
Xu G, Ma H, Nei M, Kong H (2009) Evolution of F-box genes in plants: different modes 1159
of sequence divergence and their relationships with functional diversification. Proc 1160
Natl Acad Sci USA 106(3): 835-840 1161
Zhang Y (2008) I-TASSER server for protein 3D structure prediction. BMC 1162
Bioinformatics 9:40 1163
Zhang Y, Xue Y (2008) Molecular Biology of S-RNase-Based Self-Incompatibility. Self-1164
Incompatibility in Flowering Plants: Evolution, Diversity, and Mechanisms. Springer-1165
Verlag Berlin Heidelberg 1166
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
Parsed CitationsAl-Nasser I, Crompton M (1986) The entrapment of the Ca2+ indicator arsenazo III in the matrix space of rat liver mitochondria bypermeabilization and resealing. Na+-dependent and -independent effluxes of Ca2+ in arsenazo III-loaded mitochondria. Biochem J239(1): 31-40
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Anderson MA, Cornish EC, Mav SL, Williams EG, Hoggart R, Atkinson A, Boning I, Greg B, Simpson RJ, Roche PJ, Haley JD, PenschowJD, Niall HD, Tregear GW, Cohhlan JP, Crawford RJ, Clarke AE (1986) Cloning of cDNA for a stylar glycoprotein associated withexpression of self-incompatibility in Nicotiana alata. Nature 321(6065): 38-44
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Arpagaus S, Rawyler A, Braendle R (2002) Occurrence and characteristics of the mitochondrial permeability transition in plants. J BioChem 277(3): 1780-1787
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ashkani J, Rees DJ (2016) A Comprehensive Study of Molecular Evolution at the Self-Incompatibility Locus of Rosaceae. J Mol Evol82(2-3): 128-145
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Balk J, Leaver CJ, McCabe PF (1999) Translocation of cytochrome c from the mitochondria to the cytosol occurs during heat-inducedprogrammed cell death in cucumber plants. FEBS Lett 463(1-2): 151-154
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bàthori G, Parolini I, Tombola F, Szabò I, Messina A, Oliva M, De Pinto V, Lisanti M, Sargiacomo M, Zoratti M (1999) Porin is present inthe plasma membrane where it is concentrated in caveolae and caveolae-related domains. J Biol Chem 274(42): 29607-29612
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bedhomme M, Hoffmann M, McCarthy EA, Gambonnet B, Moran RG, Rébeillé F, Ravanel S (2005) Folate metabolism in plants: anArabidopsis homolog of the mammalian mitochondrial folate transporter mediates folate import into chloroplasts. J Biol Chem 280(41):34823-34831
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Beecher B, McClure BA (2001) Expressing self-incompatibility RNases (S-RNases) in transgenic plants. Methods Mol Biol 160: 65-85Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Beers EP (1997) Programmed cell death during plant growth and development. Cell Death Differ 4(8): 649-661Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Bhosale G, Sharpe JA, Sundier SY, Duchen MR (2015) Calcium signaling as a mediator of cell energy demand and a trigger to celldeath. Ann N Y Acad Sci 1350: 107-116
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Briggs C, Mincone L, Wohlrab H (1999) Replacements of basic and hydroxyl amino acids identify structurally and functionally sensitiveregions of the mitochondrial phosphate transport protein. Biochemistry 38(16): 5096-5102
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Busot GY, McClure B, Ibarra-Sánchez CP, Jiménez-Durán K, Vázquez-Santana S, Cruz-García F (2008) Pollination in Nicotiana alatastimulates synthesis and transfer to the stigmatic surface of NaStEP, a vacuolar Kunitz proteinase inhibitor homologue. J Exp Bot59(11): 3187-3201
Pubmed: Author and TitleCrossRef: Author and Title www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from
Copyright © 2017 American Society of Plant Biologists. All rights reserved.
Google Scholar: Author Only Title Only Author and Title
Campanoni P, Sutter JU, Davis CS, Littlejohn GR, Blatt MR (2007) A generalized method for transfecting root epidermis uncoversendosomal dynamics in Arabidopsis root hair. Plant J 51: 322-330
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Chen CY, Wong EI, Vidali L, Estavillo A, Hepler PK, Wu HM, Cheung AY (2002) The regulation of actin organization by actin-depolimerizing factor in elongating pollen tubes. Plant Cell 14(9): 2175-2190
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Cheung AY, Wu HM (2008) Structural and signaling networks for the polar cell growth machinery in pollen tubes. Annu. Rev. Plant Biol.59: 547-72
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Cheung AY, Chen CY, Glaven RH, de Graaf BH, Vidali L, Hepler PK, Wu HM (2002) Rab2 GTPase regulates vesicle trafficking betweenthe endoplasmic reticulum and the Golgi bodies and is important to pollen tube growth. Plant Cell 14(4): 945-962
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Covey PA, Kondo K, Welch L, Frank E, Sianta S, Kumar A, Nuñez R, Lopez-Casado G, van der Knaap E, Rose JK, McClure BA,Bedinger PA (2010) Multiple features that distinguish unilateral incongruity and self-incompatibility in the tomato clade. Plant J 64(3):367-378
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Crompton M, Costi A (1988) Kinetic evidence for a heart mitochondrial pore activated by Ca+2, inorganic phosphate and oxidativestress. A potential mechanism for mitochondrial dysfunction during cellular Ca+2 overload. Eur J Biochem 178(2): 489-501
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Crompton M, Costi A, Hayat L (1987) Evidence for the presence of a reversible Ca+2- dependent pore activated by oxidative stress inheart mitochondria. Biochem J 245(3): 915-918
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Cruz-García F, Hancock CN, Kim D, McClure B (2005) Stylar glycoproteins bind to S-RNase in vitro. Plant J 42(3): 295-304Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
de Nettancourt D (2001) Incompatibility and Incongruity in Wild and Cultivated Plants. Springer-Verlag, New YorkPubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Doran E, Halestrap AP (2000) Cytochrome c release from isolated rat liver mitochondria can occur independently of outer-membranerupture: possible role of contact sites. Biochem J 348:343-350?
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Entani T, Iwano M, Shiba H, Che FS, Isogai A, Takayama S (2003) Comparative analysis of the self-incompatibility S-locus region ofPrunus mume: identification of a pollen-expressed F-box gene with allelic diversity. Genes Cells 8(3): 203-213
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Eswar N, Webb B, Marti-Renom MA, Madhusudhan MS, Eramian D, Shen M, Pieper U, Sali A (2007) Comparative protein structuremodeling using MODELLER. Curr Protoc Protein Sci Chapter 2:Unit 2.9
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Fields S, Song O (1989) A novel genetic system to detect protein-protein interactions. Nature 340(6230): 245-246Pubmed: Author and TitleCrossRef: Author and Title www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from
Copyright © 2017 American Society of Plant Biologists. All rights reserved.
Google Scholar: Author Only Title Only Author and Title
Fukao Y, Hayashi Y, Mano S, Hayashi M, Nishimura M (2001) Developmental analysis of a putative ATP/ADP carrier protein localized onglyoxysomal membranes during the peroxisome transition in pumpkin cotyledons. Plant Cell Physiol 42(8): 835-841
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
García-Fernández R, Peigneur S, Pons T, Alvarez C, González L, Chávez MA, Tytgat J (2016) The Kunitz-Type Protein ShPI-1 InhibitsSerine Proteases and Voltage-Gated Potassium Channels. Toxins (Basel) 8(4): 110
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Goldraij A, Kondo K, Lee CB, Hancock CN, Sivaguru M, Vazquez-Santana S, Kim S, Phillips TE, Cruz-García F, McClure BA (2006)Compartmentalization of S-RNase and HT-B ?degradation in self-incompatible Nicotiana. Nature 439 (7078): 805-810
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Grefen C, Donald N, Schumacher K, Blatt MR (2010) A Ubiquitin-10 promoter-based vector set for fluorescent protein taggingfacilitates temporal stability and native protein distribution in transient and stable expression studies. Plant J 64(2): 355-365
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gutiérrez-Aguilar M1, Pérez-Martínez X, Chávez E, Uribe-Carvajal S (2010) In Saccharomyces cerevisiae, the phosphate carrier is acomponent of the mitochondrial unselective channel. Arch Biochem Biophys 494(2): 184-191
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Halestrap AP, Clarke SJ, Javadov SA (2004) Mitochondrial permeability transition pore opening during myocardial reperfusion-a targetfor cardioprotection. Cardiovasc Res 61(3): 372-385
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Halestrap AP, Kerr PM, Javadov S, Woodfield KY (1998) Elucidating the molecular mechanism of the permeability transition pore andits role in reperfusion injury of the heart. Biochim Biophys Acta 1366(1-2): 79-94
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hamel P, Saint-Georges Y, de Pinto B, Lachacinski N, Altamura N, Dujardin G (2004) Redundancy in the function of mitochondrialphosphate transport in Saccharomyces cerevisiae and Arabidopsis thaliana. Mol Microbiol 51:307-317
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hancock CN, Kent L, McClure BA (2005) The stylar 120 kDa glycoprotein is required for S-specific pollen rejection in Nicotiana. Plant J43(5): 716-723
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Harvey AL (2001) Twenty years of dendrotoxins. Toxicon 39(1): 15-26Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Haworth RA, Hunter DR (1979) The Ca+2-induced membrane transition in mitochondria: II. Nature of the Ca+2 trigger site. ArchBiochem and Biophys 195(2): 460-467
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hua Z, Kao TH (2008) Identification of major lysine residues of S(3)-RNase of Petunia inflata involved in ubiquitin-26S proteasome-mediated degradation in vitro. Plant J 54(6): 1094-1104
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hunter DR, Haworth RA (1979) The Ca2+-induced membrane transition in mitochondria. I. The protective mechanism. Arch BiochemBiophys 195(2): 453-459
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Jiménez-Durán K, McClure B, García-Campusano F, Rodríguez-Sotres R, Cisneros J, Busot G, Cruz-García F (2013) NaStEP: aproteinase inhibitor essential to self-incompatibility and positive regulator of the HT-B stability in Nicotiana alata pollen tubes. PlantPhysiol 161(1): 97-107
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Karplus K, Barrett C, Hughey R (1998) Hidden Markov models for detecting remote protein homologies. Bioinformatics 14(10): 846-856Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Karplus K (2009) SAM-T08, HMM-based protein structure prediction. Nucleic Acids Res 37(Web Server issue): W492-7Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kho YO, Baer J (1968) Observing pollen tubes by means of fluorescence. Euphytica 17: 298-302Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kondo K, McClure B (2008) New microsome-associated HT-B family proteins from Nicotiana respond to pollination and define anHT/NOD-24 protein family. Mol Plant 1(4): 634-644
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kondo K, Yamamoto M, Matton DP, Sato T, Hirai M, Norioka S, Hattori T, Kowyama Y (2002) Cultivated tomato has defects in both S-RNase and HT genes required for stylar function of self-incompatibility. Plant J 29(5): 627-636
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kubo K, Entani T, Takara A, Wang N, Field AM, Hua Z, Toyoda M, Kawashima S, Ando T, Isogai A, Kao TH, Takayama S (2010)Collaborative non-self recognition system in S-RNase-based self-incompatibility. Science 330(6005): 796-799
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kushnareva YE, Haley LM, Sokolove PM (1999) The role of low (< or = 1mM) phosphate concentrations in regulation of mitochondrialpermeability: modulation of matrix free Ca+2 concentration. Arch Biochem Biophys 363(1): 155-162
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lai Z, Ma W, Han B, Liang L, Zhang Y, Hong G, Xue Y (2002) An F-box gene linked to the self-incompatibility (S) locus of Antirrhinum isexpressed specifically in pollen and tapetum. Plant Mol Biol 50(1); 29-42
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lam E, del Pozo O (2000) Caspase-like protease involvement in the control of plant cell death. Plant Mol Biol 44(3): 417-428Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lancelin JM, Foray MF, Poncin M, Hollecker M, Marion D (1994) Proteinase inhibitor homologues as potassium channel blockers. NatStruct Biol 1(4): 246-250
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lee CB, Kim S, McClure B (2009) A pollen protein, NaPCCP, that binds pistil arabinogalactan proteins also binds phosphatidylinositol3-phosphate and associates with the pollen tube endomembrane systems. Plant Physiol 149(2): 791-802
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lee CB, Swatek KN, McClure B (2008) Pollen proteins bind to the C-terminal domain of Nicotiana alata pistil arabinogalactan proteins.J Biol Chem 283(40): 26965-26973
Pubmed: Author and Title www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Leroch M, Kirchberger S, Haferkamp I, Wahl M, Neuhaus HE, Tjaden J (2005) Identification and characterization of a novel plastidicadenine nucleotide uniporter from Solanum tuberosum. J Biol Chem 280(18): 17992-8000
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Leung AW, Varanyuwatana P, Halestrap AP (2008) The mitochondrial phosphate carrier interacts with cyclophilin D and may play a keyrole in the permeability transition. J Biol Chem 283(39): 26312-26323
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lind JL, Bönig I, Clarke AE, Anderson MA (1996) A style-specific 120 kDa glycoprotein enters pollen tubes of Nicotiana alata in vivo.Sex Plant Reprod 9: 75-86
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lisanti MP, Scherer PE, Tang Z, Sargiacomo M (1994) Caveolae, caveolin and caveolin-rich membrane domains: a signaling hypothesis.Trends Cell Biol 4(7): 231-235
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Logan DC, Leaver CJ (2000) Mitochondria-target GFP highlights the heterogeneity of mitochondrial shape, size and movement withinliving plant cells. J Exp Bot 51(346): 865-871
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Luu DT, Qin X, Morse D, Cappadocia M (2000) S-RNase uptake by compatible pollen tubes in gametophytic self-incompatibility. Nature407(6804): 649-651
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Martínez L, Andrade R, Birgin EG, Martínez JM (2009) PACKMOL: a package for building initial configurations for molecular dynamicssimulations. J Comput Chem 30(13): 2157-64
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Martínez-Castilla LP, Rodríguez-Sotres R (2010) A score of the ability of a three-dimensional protein model to retrieve its ownsequence as a quantitative measure of its quality and appropriateness. PLoS One 5(9): e12483
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
McClure BA, Cruz-García F, Romero C (2011) Compatibility and incompatibility in S-RNase-based systems. Ann Bot 108(4): 647-658Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
McClure BA, Haring V, Ebert PR, Anderson MA, Simpson RJ, Sakiyama F, Clarke A (1989) Style self-incompatibility gene products ofNicotiana alata are ribonucleases. Nature 342(6252): 955-957
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
McClure BA, Mou B, Canevascini S, Bernatzky (1999) A small asparagine-rich protein required for S-allele-specific pollen rejection inNicotiana. Proc Natl Acad Sci USA. 96(23): 13548-13553
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Meng D, Gu Z, Li W, Wang A, Yuan H, Yang Q, Li T (2014) Apple MdABCF assists in the transportation of S-RNase into pollen tubes.Plant J 78(6): 990-1002
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Murakami H, Blobel G, Pain D (1990) Isolation and characterization of the gene for a yeast mitochondrial import receptor. Nature347(6292): 488-491 www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from
Copyright © 2017 American Society of Plant Biologists. All rights reserved.
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Murffet J, Atherto TL, Mou B, Gasser CS, McClure BA (1994) S-RNase expressed in transgenic Nicotiana causes S-allele specificpollen rejection. Nature 367(6463): 563-566
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Murffet J, Strabala TJ, Zurek DM, Mou B, Beecher B, McClure BA (1996) S-RNase and interspecific pollen rejection in the genusNicotiana: Multiple pollen-rejection pathways contribute to unilateral incompatibility between self-incompatible and self-compatiblespecies. Plant Cell 8(6): 943-958
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
O'Brien M, Kapfer C, Major G, Laurin M, Bertrand C, Kondo K, Kowyama Y, Matton DP (2002) Molecular analysis of the stylar-expressed Solanum chacoense small asparagine-rich protein family related to the HT modifier of gametophytic self-incompatibility inNicotiana. Plant J 32 (6): 985-996
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Palmieri F (1994) Mitochondrial carrier proteins. FEBS Lett 346(1): 48-54Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Palmieri F (2004) The mitochondrial transport family (SCL25): physiological and pathological implications. Pflugers Arch 447(5): 689-709Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Palmieri F, Pierri CL, De Grassi A, Nunes-Nesi A, Fernie AR (2011) Evolution, structure and function of mitochondrial carriers: a reviewwith insights. Plant J 66(1): 161-181
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Palmieri L, Rottensteiner H, Girzalsky W, Scarcia P, Palmieri F, Erdmann R (2001) Identification and functional reconstitution of theyeast peroxisomal adenine nucleotide transporter. EMBO J 20(18): 5049-5059
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Peigneur S, Billen B, Derua R, Waelkens E, Debaveye S, Béress L, Tytgat J (2011) A bifunctional sea anemone peptide with Kunitz typeprotease and potassium channel inhibiting properties. Biochem Pharmacol 82(1): 81-90
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Petronilli V, Nicolli A, Costantini P, Colonna R, Bernardi P (1994) Regulation of the permeability transition pore, a voltage-dependentmitochondrial channel inhibited by cyclosporin A. Biochim Biophys Acta 1187: 255-259?
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Phelps A, Briggs C, Haefele A, Mincone L, Ligeti E, Wohlrab H (2001) Mitochondrial phosphate transport protein. Reversions ofinhibitory conservative mutations identify four helices and a nonhelix protein segment with transmembrane interactions and Asp39,Glu137, and Ser158 as nonessential for transport. Biochemistry 40(7): 2080-2086
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Puerta AR, Ushijima K, Koba T, Sassa H (2009) Identification and functional analysis of pistil self-incompatibility factor HT-B of Petunia.J Exp Bot 60(4): 1309-1318
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Qiao H, Wang H, Zhao J, Huang J, Zhang Y, Xue Y (2004) The F-box protein AhSLF-S2 physically interacts with S-RNases that may beinhibited by the ubiquitin/26S proteasome pathway of protein degradation during compatible pollination in Antirrhinum. Plant Cell 16(3):582-595
Pubmed: Author and Title www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.
CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Roldán J, Rojas HJ, Goldriaj A (2012) Disorganization of F-actin cytoskeleton precedes vacuolar disruption in pollen tubes during thein vivo self-incompatibility response in Nicotiana alata. Ann Bot 110(4): 787-795
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sassa H, Hirano H (2006) Identification of a new class of pistil-specific proteins of Petunia inflata that is structurally similar to, butfunctionally distinct from the self-incompatibility factor HT. Mol Genet and Genomics 275 (1): 97-104
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Schultz CJ, Hauser K, Lind JL, Atkinson AH, Pu Z, Anderson MA, Clarke AE (1997) Molecular characterization of a cDNA sequenceencoding the backbone of a style specific 120kDa glycoprotein which has features of both extensions and arabinogalactan-proteins.Plant Mol Biol 35: 833-845
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Serrano I, Pelliccione S, Olmedilla A (2010) Programmed-cell-death hallmarks in incompatible pollen and papillar stigma cells of Oleaeuropaea L. under free pollination. Plant Cell Rep 29(6): 561-572
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sijacic P, Wang X, Skirpan AL, Wang Y, Dowd PE, McCubbin AG, Huang S, Kao TH (2004) Identification of the pollen determinant of S-RNase-mediated self-incompatibility. Nature 429(6989): 302-305
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Stein JC, Hansen G (1999) Mannose induces an endonuclease responsible for DNA laddering in plant cells. Plant Physiol 121(1): 71-80Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sun YL, Zhao Y, Hong X, Zhai ZH (1999) Cytochrome c release and caspase activation during menadione-induced apoptosis in plants.FEBS Lett 462(3): 317-321
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Thomas SG, Franklin-Tong VE (2004) Self-incompatibility triggers programmed cell death in Papaver pollen. Nature 429(6989): 305-309Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Twell D, Wing R, Yamaguchi J, McCormick S (1989) Isolation and expression of an anther-specific gene from tomato. Mol Gen Genet217(2-3): 240-245
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ushijima K, Sassa H, Dandekar AM, Gradziel TM, Tao R, Hirano H (2003) Structural and transcriptional analysis of the self-incompatibility locus of almond: identification of a pollen-expressed F-box gene with haplotype-specific polymorphism 15(3): 771-781
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Varanyuwatana P, Halestrap AP (2012) The roles of phosphate and the phosphate carrier in the mitochondrial permeability transitionpore. Mitochondrion 12(1): 120-125
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Vierstra RD (2003) The ubiquitin/26S proteasome pathway, the complex last chapter in the life of many plant proteins. Trends Plant Sci8(3): 135-142
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wandrey M, Trevaskis B, Brewin N, Udvardi MK (2004) Molecular and cell biology of a family of voltage-dependent anion channelporins in Lotus japonicus. Plant Physiol 134(1): 182-193 www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from
Copyright © 2017 American Society of Plant Biologists. All rights reserved.
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wang Y, Tsukamoto T, Yi KW, Wang X, Huang S, McCubbin AG, Kao TH (2004) Chromosome walking in the Petunia inflata self-incompatibility (S-) locus and gene identification in an 881-kb contig containing S2-RNase. Plant Mol Biol 54(5): 727-74
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wang CL, Xu GC, Jiang XT, Chen G, Wu J, Wu HQ, Zhang SL (2009) S-RNase triggers mitochondrial alteration and DNA degradation inthe incompatible pollen tube of Pyrus pyrifolia. Plant J 57(2): 220-9
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wang CL, Zhang SL (2011) A cascade signal pathway occurs in self-incompatibility of Pyrus pyrifolia. Plant Signal Behav 6(3): 420-1Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wheeler D, Newbigin E (2007) Expression of 10 S-class SLF-like genes in Nicotiana alata pollen and its implications for understandingthe pollen factor of the S locus. Genetics 177(4): 2171-2180
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Williams JS, Wu L, Lis S, Sun P, Kao TH (2015) Insight into S-RNase-based self-incompatibility in Petunia: recent findings and futuredirections. Front Plant Sci 6:41
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wohlrab H, Annese V, Haefele A (2002) Single replacement constructs of all hydroxyl, basic, and acidic amino acids identify newfunction and structure-sensitive regions of the mitochondrial phosphate transport protein. Biochemistry 41(9): 3254-3261
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Xu G, Ma H, Nei M, Kong H (2009) Evolution of F-box genes in plants: different modes of sequence divergence and their relationshipswith functional diversification. Proc Natl Acad Sci USA 106(3): 835-840
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhang Y (2008) I-TASSER server for protein 3D structure prediction. BMC Bioinformatics 9:40Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhang Y, Xue Y (2008) Molecular Biology of S-RNase-Based Self-Incompatibility. Self-Incompatibility in Flowering Plants: Evolution,Diversity, and Mechanisms. Springer-Verlag Berlin Heidelberg
Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.