nasipp mediates self-incompatibility in nicotiana · 95 several species avoid self-fertilization...

1

NaSIPP mediates self-incompatibility in Nicotiana 1

2

3

4

5

Felipe Cruz-García 6

Departamento de Bioquímica, Facultad de Química, Universidad Nacional Autónoma de 7

México. Ciudad de México. 04510, México. 8

01(55)56225279 9

[email protected] 10

11

12

13

14

15

16

17

18

19

20

21

22

23

24

Plant Physiology Preview. Published on September 5, 2017, as DOI:10.1104/pp.16.01884

Copyright 2017 by the American Society of Plant Biologists

www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

2

SIPP, a novel mitochondrial phosphate carrier mediates in self-incompatibility 25

Liliana E. García-Valencia1, Carlos E. Bravo-Alberto1, Hen-Ming Wu2, Rogelio Rodríguez-26

Sotres1, Alice Y. Cheung2 and Felipe Cruz-García1 27

28

1Departamento de Bioquímica, Facultad de Química, Universidad Nacional Autónoma de 29

México. 04510. Ciudad de México. 30

2Department of Biochemistry and Molecular Biology, University of Massachusetts, 31

Amherst MA 01003. 32

33

34

35

36

Summary: SIPP mediates self-incompatibility in Nicotiana and it interacts with StEP 37 in mitochondria of pollen tubes 38 39 40

41

42

43

F.C-G and LE.G-V conceived the project and the original research plan; F.C-G, LE.G-V 44

and A.Y.C designed the experiments; LE.G-V and CE.B-A performed most of the 45

experiments; H-M.W provided technical advice and discussion on experimental design to 46

LE.G-V; R.R-S calculated the NaSIPP three-dimensional model; LE.G-V, F.C-G. and 47

A.Y.C analyzed data; F.C-G. and LE.G-V wrote the article with contributions from all the 48

authors 49



3

50

51

52

53

54

This work was supported by Grants: IN217816 and RN217816 (PAPIIT-UNAM); 55

329718/234690 (to LE.G-V) and 236602 from Consejo Nacional de Ciencia y Tecnología 56

and Grant Number 0955910 (RCN on Integrative Pollen Biology) and 1147165 from NSF 57

(to A.Y.C). Computing resources were provided by the LANCAD-UNAM-DGTIC-215 58

supercomputing project. 59

60

Felipe Cruz-García 61

[email protected] 62

63



4

ABSTRACT 64

In Solanaceae, the S-specific interaction between the pistil S-RNase and the pollen S-Locus 65

F-box (SLF) protein control self-incompatibility (SI). Although this interaction defines the 66

specificity of the pollen rejection response, the identification of three pistil essential 67

modifier genes unlinked to the S-locus (HT-B, 120K and NaStEP), unveils a higher degree 68

of complexity in the pollen rejection pathway. We showed previously that NaStEP, a 69

stigma protein with homology with Kunitz-type protease inhibitors, is essential to SI in 70

Nicotiana. During pollination NaStEP is taken up by pollen tubes where potential 71

interactions with pollen tube proteins might underlie its function. Here, we identified 72

NaSIPP, a mitochondrial protein with phosphate transporter activity, as a novel NaStEP-73

interacting protein. Coexpression of NaStEP and NaSIPP in pollen tubes showed 74

interaction in the mitochondria, although when expressed alone NaStEP remains mostly 75

cytosolic, implicating NaSIPP-mediated translocation of NaStEP into the organelle. The 76

NaSIPP transcript is detected specifically in mature pollen of Nicotiana spp; however, in 77

self-compatible plants this gene has accumulated mutations, so its coding region is unlikely 78

to produce a functional protein. RNAi suppression of NaSIPP in Nicotiana pollen grains 79

disrupts the SI by preventing pollen tube inhibition. Taken together, our results are 80

consistent with a model whereby the NaStEP and NaSIPP interaction, in incompatible 81

pollen tubes, might destabilize the mitochondria, and contribute to arrest pollen tube 82

growth. 83

84

85

86

87



5

INTRODUCTION 88

Cross-pollination has decisively contributed to the widespread distribution of angiosperms, 89

and in many species the pistil has played an active role in the reject of self-pollen and the 90

acceptance of pollen coming from genetically unrelated plants. Thus, the pistil has evolved 91

to some extent to safeguard the species identity as well as to produce a vigorous progeny 92

with new allelic combinations. 93

94

Several species avoid self-fertilization through self-incompatibility (SI), a genetically 95

controlled system by the polymorphic S-locus (de Nettancourt, 2001). In Solanaceae, 96

Plantaginaceae and Rosaceae, the S-locus includes two tightly linked genes: the male and 97

female determinants. The product of the female determinant is a pistil extracellular 98

glycoprotein known as S-RNase (Anderson et al., 1986; McClure et al., 1989). S-99

RNases are secreted to the stylar extracellular matrix (ECM) and incorporated into both 100

compatible and incompatible pollen tubes (Luu et al., 2000; Goldraij et al., 2006), 101

apparently using an MdABCF transporter localized at the pollen tube membrane as 102

described in apple (Meng et al., 2014). 103

104

Once the S-RNases are inside the pollen tubes, large amounts of these enzyme 105

molecules are compartmentalized inside the vacuoles. If the cross is incompatible 106

vacuoles break down releasing S-RNases into the cytoplasm, RNA is hydrolyzed and the 107

pollen tube stops growing. In contrast, if a compatible cross takes place, the S-RNases 108

remain confined into intact vacuoles, and the pollen tubes can growth towards the ovary 109

(Goldraij et al., 2006). 110

111



6

The male S-determinant encodes the cytosolic protein called S-locus F-box protein (Lai et 112

al., 2002; Entani et al., 2003; Ushijima et al., 2003; Wang et al., 2004; Sijacic et al., 2004). 113

An important characteristic of SLF is a F-box domain at the N-terminus. F-box proteins are 114

a component of the SCF (Skp1, Cullin-1, F-box protein) E3 ligase complex, which is 115

involved in ubiquitin-mediated protein degradation by the 26S proteasome (Qiao et al., 116

2004; Hua and Kao, 2008; Williams et al., 2015). Within the SCF complex, Cullin-1 is a 117

scaffold and Skp1 connects the scaffold to a F-box protein, which in turn recruits the target 118

protein (Vierstra, 2003; Xu et al., 2009). 119

120

Several SLF genes have been identified at the S-locus in Solanaceae and Rosaceae, 121

subfamily Maloidea (Wang et al., 2004; Wheeler and Newbigin, 2007; Ashkani and Rees, 122

2016). In particular, in S2- and S3-haplotypes of Petunia inflata 17 SLF genes have been 123

found to aid recognition of several S-RNases variants (Sijacic et al., 2004; Kubo et al., 124

2010; Williams et al., 2015). Based on the specificity of these interaction, multiple SLF 125

proteins expressed in a specific pollen S-haplotype have been proposed to collaboratively 126

recognize and detoxify non-self S-RNases, allowing only self-S-RNases to exert their 127

cytotoxic effect on self-pollen (Kubo et al., 2010; Williams et al., 2015). 128

129

Although the interaction between SLF and S-RNase defines the S-specific pollen rejection, 130

there are modifier genes unlinked to the S-locus that are also essential to the SI response (de 131

Nettancourt, 2001; Zhang and Xue, 2008; McClure et al., 2011). To date, three pistil 132

modifier genes have been identified: 120K (Hancock et al., 2005), HT-B (McClure et al., 133

1999) and NaStEP (Jiménez-Durán et al., 2013). 134

135



7

The HT-B protein presents a C- terminal domain rich in asparagine and aspartic acid 136

(McClure et al., 1999; Kondo and McClure, 2008). HT-B is only expressed in mature 137

pistils and has been described in Solanum, Nicotiana and Petunia (McClure et al., 1999; 138

Kondo et al., 2002; O’Brien et al., 2002; Sassa and Hirano, 2006; Puerta et al., 2009). In 139

the particular case of S. habrochaites there is no HT-B gene, but there is a related HT-A 140

gene, which may act as a substitute for the HT-B function in this species (Covey et al., 141

2010). Immunolocalization assays show that HT-B, like S-RNases, is taken up by 142

compatible and incompatible pollen tubes during pollination (Goldraij et al., 2006). In 143

incompatible crosses HT-B levels decrease slightly in pollen tubes; however, in compatible 144

crosses, HT-B levels inside pollen tubes decrease by 75-97% (Goldraij et al., 2006; 145

Jiménez Durán et al., 2013). Apparently HT-B is needed to halt pollen tube growth, and in 146

agreement, down-regulation of HT genes results in breakdown of SI Nicotiana (McClure et 147

al., 1999), Petunia (Puerta et al., 2009) and Solanum (Kondo et al., 2002; O’Brien et al., 148

2002). 149

150

The arabinogalactan glycosylated protein 120K, accumulates abundantly in the ECM in 151

mature styles of N. alata (Schultz et al., 1997), like S-RNases, 120K is taken up by pollen 152

tubes and targeted to vacuoles (Lind et al., 1996; Goldraij et al., 2006). Loss of function 153

assays show that 120K is essential to SI, because its suppression by RNAi disrupts self-154

pollen rejection (Hancock et al., 2005). Protein-protein interaction experiments gave 155

evidence of 120K complexes with style proteins, including S-RNases, NaPELP III, Nap11 156

(Cruz-García et al., 2005) and pollen C2 domain-containing protein (NaPCCP). This last 157

protein also associates with the endomembrane system via phosphatidylinositol 3-158

phosphate (Lee et al., 2008; 2009). 159



8

160

NaStEP (N. alata Stigma Expressed Protein) is an abundant stigma-specific protein of SI 161

Nicotiana spp (Busot et al., 2008). In mature papillary stigmatic cells NaStEP remains 162

stored in the vacuoles, but upon pollination, the cell wall of these papillary cells becomes 163

punctured and NaStEP relocalizes to the stigmatic exudate (Busot et al., 2008), and from 164

there it can be taken up by compatible and incompatible pollen tubes (Jiménez-Durán et al., 165

2013). NaStEP is homologous to Kunitz-type protease inhibitors (Busot et al., 2008) and 166

inhibits subtilisin in vitro, in a specific manner (Jiménez-Durán et al., 2013). RNAi-167

mediated suppression of Nicotiana NaStEP prevents S-specific pollen rejection (Jiménez-168

Durán et al., 2013). Likewise, NaStEP protects HT-B stability in pollen tubes by a yet 169

unidentified mechanism, because when NaStEP is absent, HT-B is degraded inside pollen 170

tubes in both compatible and incompatible crosses (Jiménez-Durán et al., 2013). This last 171

evidence, suggests an interaction of these two modifier genes at some point of the pollen 172

rejection pathway in Nicotiana, which currently is vaguely known. Consequently, it 173

becomes important to find if additional pollen proteins are required by NaStEP to exert its 174

function in pollen rejection. 175

176

Here, a mitochondrial NaStEP interacting protein was identified and designated as NaSIPP 177

(N. alata Self-Incompatibility Pollen Protein); and convincing evidence of the ability of 178

NaSIPP to recruit NaStEP to the mitochondria in pollen tubes is provided. In addition, 179

NaSIPP transcript was detected specifically in mature pollen of SI and SC (self- 180

compatible) Nicotiana spp. Notably, the NaSIPP orthologs in SC species have accumulated 181

extensive mutations on the coding region, so that the encoded product is unlikely to 182

produce a functional protein. According to these data and further evidence given below, 183



9

NaSIPP represents a novel mitochondrial protein with phosphate carrier activity that is 184

essential to SI. 185

186

RESULTS 187

Identifying NaStEP pollen protein partners 188

To identify pollen and pollen tube proteins possibly interacting with NaStEP, we performed 189

a Yeast Two-Hybrid assay using NaStEP as bait to screen a N. rastroensis pollen/pollen 190

tube cDNA library fused to a transcription factor activation domain (AD), according to 191

Fields and Song (1989). Positive clones were selected under stringent conditions for further 192

analysis. 193

194

From the above experiment, we recovered a cDNA encoding the C-terminal of a MPC 195

(Mitochondrial Phosphate Carrier)-like protein. To confirm the interaction was mediated by 196

the bait (NaStEP) and prey (MPC sequence) pair, we cotransformed yeast with an empty 197

vector (Binding domain or BD) or the bait (BD-NaStEP) and the candidate prey protein and 198

selected positive transformants under stringent medium. From this assay we only recovered 199

clones coexpressing the BD-NaStEP fusion and the AD-C-terminal of MPC-like cDNA 200

(Fig. 1A). In addition, in a similar assay NaStEP was not found to interact with Mir1, a 201

MPC from Saccharomyces cerevisiae. 202

203

The cDNA coding the C-terminal of MPC-like was 431 bp long. Northern blot analysis 204

using this cDNA as probe, showed the accumulation of this MPC-like transcript specifically 205

in mature N. rastroensis pollen (Supplementary Fig. 1). We therefore cloned its full-length 206



10

cDNA by rapid amplification of cDNA ends (RACE 5’) from N. rastroensis and N. alata. 207

The resulting sequence was named NaSIPP. 208

209

When tested by Yeast Two-Hybrid assay, the full-length NaSIPP cDNA remained positive 210

for interaction with NaStEP. Therefore the NaSIPP C-terminus has enough exposure in the 211

complete protein to account for its interaction with NaStEP. 212

213

NaSIPP belongs to the phosphate carrier family 214

According to a multiple sequence alignment of NaSIPP, and other MPC sequences from 215

both, functionally characterized and putative MPC (Supplementary Fig. 2A), NaSIPP 216

belongs to the MPC subfamily within the mitochondrial carrier family, which includes a 217

number of membrane proteins, known to transport solutes across the mitochondrial 218

membranes (Palmieri et al., 2011). Three tandem repeats of a domain, known as 219

mitochondrial carrier domain (PROSITE PS50920, PFAM PF00153 and IPR00193) 220

(Palmieri, 2004) are conserved in the primary sequences of all mitochondrial carrier family 221

members. Each domains are about 100 amino acids long and contains two hydrophobic 222

transmembrane segments connected through a hydrophilic loop and is characterized by a 223

sequence motif PX[D/E]XX[K/R]X[K/R] (20-30 residues) [D/E]GXXXX[W/Y/F][K/R]G 224

(Palmieri, 1994; 2004). This signature has been used to identify mitochondrial carriers in 225

eukaryotic sequenced genomes (Palmieri, 1994; 2004). 226

227

A phylogenetic analysis of 21 MPC sequences from yeast, plants and animals based on 228

amino acid sequences (Supplementary Fig. 2B), clearly defined a plant and animal clade. 229



11

Notably, this sequence comparison shows S. cerevisiae Pic2 as a closer relative to the 230

animals and plants MPC than to Mir1, a second homolog encoded in S. cerevisiae genome. 231

232

The MPC plant sequences could be further separated into three subgroups: 1) Legumes 233

MPC (Glycine max and Medicago truncatula) sharing 95.3% sequence identity, 2) 234

Solanaceae MPC (five sequences sharing 84.8% sequence identity) and 3) a diverse set of 235

plant sequences from different plant families, which were clustered together, although they 236

do not conform a well-defined group. The Solanaceae subgroup is represented by five MPC 237

and the higher identity is between the two carriers from Solanum with 99.2% of identity; 238

follow by the Nicotiana carriers, which share 98.8% of identity. NaSIPP formed part of this 239

subgroup and presents a high identity with a N. tomentosiformis MPC, followed by the 240

Solanum carriers (95.3%) and the Ipomoea MPC (88.3%). 241

242

Expression of NaSIPP rescues the mitochondrial defect of the yeast mutant Δmir1 243

Because the NaSIPP sequence has MPC protein family features, we evaluated its ability to 244

complement the Δmir1 mutant of S. cerevisiae. The amino acids known to be required for 245

phosphate transport in Mir1 are His32, Lys42, Thr43, Thr79, Lys90, Glu126, Arg140, 246

Arg142, Lys179, Lys187, Asp236, and Arg276. When these residues are mutated the 247

ability to transport phosphate is suppressed (Briggs et al., 1999; Phelps et al., 2001; 248

Wohlrab et al., 2002). Sequence alignment of NaSIPP with multiple functional and putative 249

MPCs showed high conservation in these twelve residues for NaSIPP (Supplementary Fig. 250

2A), in agreement with its possible phosphate transport function. 251

252



12

In S. cerevisiae, there are two functionally redundant MPC, Mir1 and Pic2. Mir1 is more 253

abundant than Pic2 under normal conditions (Murakami et al., 1990), whereas expression 254

of Pic2 is induced by high temperature (Hamel et al., 2004). NaSIPP shares 50% identity 255

with Pic2 and 40.3% with Mir1, which offered an opportunity to evaluate whether NaSIPP 256

rescue the Δmir1 mutant. To test this, we transformed the Δmir1 S. cerevisiae strain with 257

NaSIPP using the yeast expression vector pYES-DEST52. As shown in Figure 2, NaSIPP 258

partially rescued the Δmir1 mutant, although transformants grew slower in glycerol (a non-259

fermentable substrate) compared to those transformed by Mir1. According to this result, 260

NaSIPP can provide phosphate transport to the yeast mutant, but with reduced efficiency. 261

Differences between NaSIPP and Mir1 in kinetic or regulatory properties, or the absence of 262

some unidentified factor may limit NaSIPP function in yeast, but that issue was out of the 263

scope of the present paper. 264

265

NaSIPP three-dimensional model 266

Mitochondrial carrier members have divergent sequences (15-20% of identity), but share 267

predicted membrane topologies with six transmembrane helices, as do NaSIPP and 268

ATP/ADP translocators (ANT). The yeast mitochondrial ANT was used as template to 269

model NaSIPP, and extensive Molecular Dynamics simulations in an explicit mixed-lipid 270

membrane, with explicit water and ions were used to improve the model (see Materials and 271

Methods). The final model had a Rd.HMM score considered as highly reliable (Martínez-272

Castilla and Rodríguez-Sotres, 2010), similar to those found for NMR experimental 273

solutions of protein three-dimensional structures and the scoring method has a very low 274

false positive rate. The predicted structure of NaSIPP had an all-α structure, forming a core 275



13

of 6 transmembrane regions (Fig. 3A). The upper soluble domain had a discoidal shape 276

(Fig. 3A, red dotted line), while the bottom domain was quasi-globular (Fig. 3A, yellow 277

dotted line). Both N- and C-termini were on the bottom domain. 278

279

The three dimensional model of this protein has a central channel dominated by positive (at 280

neutral pH) and neutral polar side chains (Fig. 3B), but the entrance at the top had several 281

negatively charged chains (Fig. 3C). In this model, Asp298 forms a salt-bridge with 282

Arg316, which obstructs the pore, but a pH change could allow protonation of the acidic 283

side chains to open the gate and allow phosphate transport. Thus, the model's structural 284

features are consistent with the partial complementation found of Δmir1 mutant by NaSIPP. 285

286

Subcellular localization of NaSIPP 287

Several members of the mitochondrial carrier family localize to mitochondria, although 288

some have been localized in the plasma membrane, specifically in caveolae microdomain 289

(Lisanti et al., 1994; Bàthori et al., 1999), or in small vesicles (Wandrey et al., 2004), 290

peroxisomes, glyoxisomes or plastids (Fukao et al., 2001; Palmieri et al., 2001; Bedhomme 291

et al., 2005; Leroch et al., 2005). Thus, to determine the precise subcellular localization of 292

NaSIPP, we expressed NaSIPP fused with the tomato fluorescent protein and under the 293

control of the pollen-specific promoter Lat52 (Lat52::NaSIPP-Tomato) in transiently 294

transformed tobacco pollen tubes. Furthermore, NaSIPP-Tomato signal was analyzed in 295

these pollen tubes in the presence of the mitochondrial marker Mit-GFP (Mitochondria 296

targeting sequence fused to GFP; Logan and Leaver, 2000). Results indicated that the 297

NaSIPP-Tomato fluorescence signal was associated with motile organelles throughout the 298



14

pollen tube cytoplasm, which displayed a movement similar to a reverse-fountain pattern 299

(Fig. 4A and Supplementary Movie 1), characteristic of elongating pollen tubes (Cheung 300

and Wu, 2008). Cotransformation of the mitochondrial marker Mit-GFP (Fig. 4B) showed 301

clear overlap of NaSIPP-Tomato and Mit-GFP on the same motile organelles previously 302

observed (Fig. 4C, yellow signal and Supplementary Movie 2), providing evidence of 303

NaSIPP mitochondrial localization in tobacco pollen tubes. 304

305

To obtain further support for the mitochondrial localization of NaSIPP, we transiently 306

expressed the construct NaSIPP-GFP in A. thaliana seedlings via A. tumefaciens, along 307

with staining with the mitochondrial marker MitoTracker Red FM. We found NaSIPP-GFP 308

fluorescence signal colocalizing with MitoTracker Red FM (Fig. 4D-G), indicating that the 309

necessary information to target NaSIPP to the plant mitochondria is contained within its 310

amino acid sequence. 311

312

Interaction between NaStEP- NaSIPP in plant cells 313

To establish the interaction between NaStEP and NaSIPP in plant cells, we performed a 314

Bimolecular Fluorescence Complementation (BiFC) assay. We used vectors containing the 315

Ubiquitin-10 promoter that drives a moderate expression in plant cells and mitigates 316

potential problems, such as false positive (Grefen et al., 2010). 317

318

We fused each gene to the N- and C- terminal halves of YFP and used them to transform A. 319

tumefaciens. Transient coexpression of NaStEP and NaSIPP constructs in roots and 320

hypocotyl epidermis of A. thaliana seedlings led to the restoration of YFP fluorescence, 321



15

prominently in the meristematic and elongation zone of the roots (Fig. 5A-C) and lower 322

hypocotyl (Fig. 5D-F). Fluorescence was not observed in seedlings cotransformed with 323

either halves of the split YFP vector in combination with an empty vector (Supplementary 324

Fig. 3A-H). 325

326

Additionally, we performed a BiFC assay in N. tabacum pollen tubes. We fused each gene 327

to the N- and C- terminal halves of the Venus protein and under the control of the pollen-328

specific promoter Lat52. Even though the frequencies of transient expression were low, 329

ranging from 0.001-0.002%; the transient coexpression of NaStEP and NaSIPP constructs 330

in transformed tobacco pollen tubes led to the restoration of Venus fluorescence, mainly in 331

small sausage-shaped organelles resembling mitochondria, distributed throughout the 332

pollen tube (Fig. 5G-I). Fluorescence was not observed in pollen tubes cotransformed with 333

either halves of the split Venus vector in combination with an empty vector (Supplementary 334

Fig. 3I-L). These data demonstrate the NaStEP-NaSIPP interaction in vivo, both in pollen 335

tubes, and in other heterologous plant tissues. 336

337

Interaction of NaSIPP- NaStEP is associated with mitochondria 338

To examine if NaSIPP-NaStEP complex associates with the mitochondria, we performed a 339

BiFC assay in A. thaliana seedlings, which were also treated with MitoTracker Red FM, in 340

order to determine whether the reconstituted YFP signal could be detected in mitochondria. 341

Figure 6A shows NaStEP-nYFP and NaSIPP-cYFP constructs coexpressed in A. thaliana 342

seedlings, where the YFP fluorescence was reestablished; as shown before, and how the 343

NaStEP and NaSIPP (Fig. 6A, green signal) colocalizes with the MitoTracker Red signal 344



16

coming from mitochondria (Fig. 6B-D). Altogether, these data give evidence of an in vivo 345

complex between NaStEP and NaSIPP located in mitochondria. The time-resolution of the 346

events is not enough to indicate whether the complex forms in the mitochondria, or a 347

preformed complex is targeted to this organelle, and this could be one of the questions to 348

answer in the future. 349

350

BiFC complementation provides evidence of the interaction between two proteins in vivo, 351

but since it involves a covalent bond, the complex has an extended long life. To provide 352

further evidence of the interaction between NaStEP and NaSIPP using a more dynamical 353

probe, tobacco pollen grains were transformed by microprojectile bombardment using both 354

constructs: Lat52::NaStEP-GFP and Lat52::NaSIPP-Tomato and the GFP and/or Tomato 355

fluorescence was monitored by confocal microscopy. When NaSIPP was expressed alone, 356

the red tomato fluorescence was distributed to discrete structures in pollen tubes (Fig. 7A). 357

By contrast, NaStEP-GFP signal was randomly distributed in the pollen tube cytoplasm 358

(Fig. 7B). When both proteins were coexpressed, the localization pattern of NaStEP 359

changed from a cytoplasm distribution to a punctate pattern (Fig. 7C-E), suggesting again a 360

physical interaction between NaStEP and NaSIPP, which apparently mediates the 361

translocation of the cytoplasmic NaStEP to the mitochondria. 362

363

The NaSIPP transcript accumulates highly in mature pollen of Nicotiana species 364

A BLAST analysis on the National Center for Biotechnology Information site 365

(http://www.ncbi.nlm.nih.gov) with NaSIPP cDNA as probe found three MPC-like cDNA 366

of N. tabacum sharing high identity to NaSIPP CDS: XM_016632920.1 (20.1), 367


http://www.ncbi.nlm.nih.gov/


17

XM_016617131.1 (31.1) and XM_016600064.1 (64.1). The expression patterns of these 368

MPC-like mRNA were compared to those of NaSIPP transcript by reverse transcription-369

PCR analysis, using specific primers for each MPC-like transcripts, and in several N. alata 370

organs (Fig. 8A), developing anthers at various stages (Fig. 8B) and mature pollen from 371

Nicotiana species (Fig. 8C). Results show the MPC-like 20.1 and 64.1 transcripts 372

expressed on reproductive and no reproductive tested organs and MPC-like 31.1 mRNA 373

was detected on all, with exception of pollen grains. Besides, the 20.1 and 64.1 transcripts 374

were amplified in all the anther development stages evaluated, whereas NaSIPP mRNA 375

was only detected in mature pollen (Fig. 8A and 8B). In addition, when we tested the 376

presence of MPC-like transcripts in mature pollen of different Nicotiana species (Fig. 8C), 377

the 20.1 and 64.1 mRNA were present in most of the Nicotiana species. In the case of 378

SIPP, a cDNA was amplified with high similarity to the NaSIPP cDNA in all the Nicotiana 379

species, with the only exception of N. glauca. Nevertheless, when all of these cDNAs were 380

sequenced, we found indels in the sequences from SC Nicotiana spp (N. plumblaginifolia, 381

N. tabacum and N. benthamiana) and the nucleotide sequences are predicted to encode for 382

proteins with significant differences to NaSIPP, including frame-shift mutations and/or 383

premature stop codons. If expressed, the putative corresponding protein products are 384

unlikely to be functional (Supplementary Fig. 4A and 4B). By contrast, all the SIPP cDNAs 385

from SI Nicotiana spp (N. alata, N. rastroensis and N. forgetiana) show better conservation 386

in their amino acid sequences (Supplementary Fig. 3A and 3B) and appear to encode 387

proteins sharing all the features associated to their predicted function, in agreement with 388

their possible participation in the SI response. 389

390



18

NaSIPP suppression in pollen tubes 391

To test if NaSIPP plays a role in SI, we transformed N. alata SA2-pollen by microprojectile 392

bombardment with the construct RNAi-NaSIPP under the control of NTP303 promoter 393

(NTP303p). The transformed pollen grains were used to pollinate SI N. alata SA2SA2 pistils 394

(incompatible cross) and we evaluated the effect on pollination, observing the pollen tube 395

growth through the style after 72 h pollination (Fig. 9A). If NaSIPP is playing a role in 396

pollen rejection, its suppression, would allow to pollen tubes to reach the base of the style 397

in an incompatible cross (when the S-allele in pollen matches with one of the pistil S-398

alleles); otherwise the pollen tube growth should be inhibited in the upper one-third of the 399

style as happens in the SI N. alata. 400

401

When SI N. alata SA2SA2 pistils were pollinated with untransformed SA2-pollen 402

(incompatible cross), the pollen tubes did not reach the base of the style (Fig. 9B), as 403

expected, because the pollen tube growth was inhibited in the upper segment of style. Here, 404

the average length of pollen tube was equivalent to 28% of the style length (SEM= 3.9; n= 405

28 pistils analyzed; Fig. 9F, Supplementary Table 1). 406

407

Pollen transformed with the empty vector, displayed a similar behavior to the WT pollen 408

and the average pollen tube growth was equivalent to 26% of the style (SEM= 2.9; n= 67 409

pistils analyzed; Fig. 9C and 9F; and Supplementary Tables 1 and 2). 410

411



19

Transformation of pollen grains with RNAi-NaSIPP, resulted in a notable increase in the 412

number of pollen tubes reaching the base of the style than with those pollen tubes coming 413

from untransformed pollen or pollen transformed with the empty vector (Fig. 9D and 9F) 414

and the average length of pollen tube was equivalent to 64.9% of the style (SEM= 2.3; n= 415

89 pistils analyzed). Moreover, the difference was statistically highly significant (P< 416

0.0001; Supplementary Tables 1 and 2) between the pollen transformed with RNAi-NaSIPP 417

and the pollen transformed with the empty vector. As predicted, RNAi made normally 418

incompatible pollen tubes to grow significantly longer and many did reach the base of the 419

style, suggesting that the RNAi-mediated suppression of NaSIPP expression impairs SI and 420

giving further support to the proposed role of NaSIPP as a novel pollen modifier gene, 421

essential to the SI response in Nicotiana. 422

423

On the other hand, when we pollinated SI N. alata SC10SC10 pistils with SA2-pollen 424

bombarded with the construction RNAi-NaSIPP, most of the pollen tubes reached the base 425

of the style (Fig. 9E), as expected for a compatible cross. 426

427

428

DISCUSSION 429

In this study, we identified a novel pollen mitochondrial phosphate carrier, NaSIPP; which 430

interacts with NaStEP and the resulting complex was found associated to the mitochondria. 431

Likewise, evidence is provided of NaSIPP being an essential gene to the pollen rejection 432

response in Nicotiana. 433



20

434

The interaction of NaStEP with a mitochondrial protein as NaSIPP was initially 435

unexpected, because we previously demonstrated the role of the stigma-located NaStEP 436

protein as proteinase inhibitor and its ability to enhance HT-B stability inside the vacuoles 437

of pollen tubes (Jiménez-Durán et al., 2013). However, interaction of NaStEP with the 438

mitochondrial membrane protein NaSIPP, agrees with some reports describing Kunitz-type 439

inhibitors interact with membrane ion channels, that are able to induce membrane 440

permeability changes (Lancelin et al., 1994; Harvey, 2001; Peigneur et al., 2011; García-441

Fernández et al., 2016). 442

443

The specific expression of NaSIPP in mature pollen and its capability to complement 444

phosphate-transport deficient mutant, could relate this protein to energy requirements 445

during pollen tube growth. The NaSIPP transcript was found expressed in mature pollen of 446

both SI and SC Nicotiana spp; however, their orthologues in SC Nicotiana spp. have 447

accumulate frame-shifting mutations that generate premature stop codons, and even if those 448

proteins are translated, they are unlikely to be functional (Supplementary Fig. 4B). 449

Therefore, the expression pattern of the functional NaSIPP in SI Nicotiana backgrounds 450

and the SI disruption when NaSIPP was suppressed, are strongly consistent with a key role 451

for this protein in the SI response in Nicotiana, probably after its interaction with NaStEP. 452

453

Recent evidence points to some MPC as structural component of the permeability transition 454

pore (PTP) (Leung et al., 2008; Gutiérrez-Aguilar et al., 2010; Varanyuwatana and 455

Halestrap, 2012). The PTP is a non-specific channel in the mitochondrial membrane 456

(Haworth and Hunter, 1979; Crompton et al., 1987) and it is usually closed. The opening of 457



21

PTP may result from a number of stimuli, including a calcium overload of the 458

mitochondrial matrix (Hunter and Haworth, 1979; Al-Nasser and Crompton, 1986), which 459

triggers an increase in the mitochondrial inorganic phosphate pools (Crompton and Costi, 460

1988; Kushnareva et al., 1999; Arpagaus et al., 2002). 461

462

An open PTP allows an unrestricted movement of solutes, increasing the mitochondrial 463

permeability and producing the collapse of mitochondrial membrane potential (Bhosale et 464

al., 2015). As a result, the ATP synthesis stops and a cellular energy crisis take place 465

(Halestrap et al., 1998; 2004). If NaSIPP is a component of PTP-like, its interaction with 466

NaStEP might be part of the mechanism of PTP opening and cause the pollen tube to stop 467

growing, as part of the S-specific pollen rejection response. Many aspects of this proposal 468

are still hypothetical, and should be challenged by further studies, some of which are in 469

progress in our group. 470

471

The opened PTP has been shown to mediate the cytochrome c release, along with others 472

cell death factors (Petronilli et al., 1994; Doran and Halestrap 2000); which are early 473

crucial events in both animals and plants intrinsic pathway of PCD activation (Beers, 1997; 474

Balk et al., 1999; Stein and Hansen, 1999; Sun et al., 1999; Lam and del Pozo, 2000). 475

However, we do not know if this happens in SI in Nicotiana, and it would be interesting to 476

explore in the future, since PCD has been implicated in the gametophytic pollen rejection 477

response (Thomas and Franklin-Tong, 2004) and different hallmarks of PCD have also 478

been reported in other species such as Pyrus pyrifolia (Wang et al., 2009; Wang and Zhang, 479

2011), Olea europaea (Serrano et al., 2010) and N. alata (Roldán et al., 2012). 480

481



22

Although whether the SI response in Nicotiana involves a PCD program is yet to be tested, 482

the features of NaSIPP and the possibility that PCD might be part of the pollen rejection 483

response in Nicotiana, make NaSIPP a good candidate for an active role if such SI-specific 484

cascade takes place in these species. 485

486

It is well know that interaction between S-RNase and SLF determines either the 487

compatibility or incompatibility phenotype. But further evidence indicated the participation 488

of HT-B, NaStEP and NaSIPP somewhere downstream this interaction. NaStEP enters both 489

compatible and incompatible pollen tubes early in pollination (Jiménez-Durán et al., 2013), 490

and considering its properties, NaStEP might be playing roles at the cytoplasm and at the 491

mitochondria in the pollen rejection response. Thus, in an incompatible cross NaStEP 492

might function as proteinase inhibitor protecting HT-B from degradation. On the other 493

hand, NaStEP in the pollen tube evidence that interact with NaSIPP in the mitochondria, 494

with this interaction could create an energy crisis and contribute to pollen tube growth 495

inhibition. Somehow in a compatible cross, the interaction between NaSIPP and NaStEP 496

might be impaired or altered, through an unknown mechanism, related to the unspecific S-497

allele interaction between SLF and S-RNase. Under this last condition, we postulate that 498

the S-RNases remain confined to intact vacuoles, HT-B would be degraded, and the 499

mitochondria would stay healthy to provide ATP and support the growth of the pollen tubes 500

towards the ovary. 501

502

Our future goal is to propose a comprehensive model of the SI mechanism by identifying 503

all the factors required in the S-RNase-dependent pollen rejection pathway and their 504

participation in the SI-response related mechanism. Here, we give evidence that NaSIPP is 505



23

an essential gene for SI and our findings suggest a possible pivotal participation of 506

mitochondria in the SI Nicotiana response. 507

508

Supplemental Data 509

Supplementary Figure 1. The NaSIPP transcript is specifically detected in mature pollen 510 in N. rastroensis. 511

Supplementary Figure 2. Sequence alignment of NaSIPP, functional and putative 512 Mitochondrial Phosphate Carrier. 513

Supplementary Figure 3. BiFC assay controls. 514

Supplementary Figure 4. Sequence alignment of different Nicotiana SIPP sequences. 515

Supplementary Table 1. Evaluation of pollen tube length after RNAi-NaSIPP pollen 516 transformation. 517

Supplementary Table 2. NaSIPP suppression disrupts S-specific pollen rejection. 518

Supplementary Movie 1. Lat52::NaSIPP-Tomato localization 519

Supplementary Movie 2. Coexpression of Lat52::NaSIPP-Tomato and Lat52::Mit-Green 520

521

ACKNOWLEDGMENTS 522

We are grateful to Yanjiao Zou for her assistance in microprojectile bombardment, to Jorge 523

Herrera Díaz for his assistance in yeast complementation assays, to Javier Andres Juárez-524

Díaz for his assistance in BiFC assays, to Karina Jiménez-Durán for confocal microscopy 525

support, to Yuridia Cruz-González Zamora for her technical assistance, to María Teresa 526

Olivera-Flores for greenhouse support and to Janai M. García-Valencia for assistance with 527

imaging. We thank the anonymous reviewers for the thoughtful comments scientifically 528



24

and for improving the presentation of our data. We also thank the RCN on Integrative 529

Pollen Biology for facilitating collaboration. We thank UNAM-DGTIC staff for the help in 530

compilation and maintenance of the required software. 531

532

MATERIALS AND METHODS 533

Plant materials 534

SI Nicotiana alata (SA2SA2, SC10SC10 genotype), SC N. glauca, and SC N. tabacum 535

‘Praecox’ have been described previously (Murfett et al., 1994, 1996; Beecher and 536

McClure, 2001). SC N. plumbaginifolia (inventory No. TW107) and SI N. forgetiana 537

(inventory No. TW50) were a gift from Bruce McClure lab. SI N. rastroensis (Rastroensis) 538

and N. bethamiana have been described previously (Jiménez-Durán et al., 2013). Tobacco 539

(N. tabacum var Petit Havana SR1) was used for pollen transformation. All the plants were 540

grown in soil under greenhouse conditions. 541

542

Yeast Two-Hybrid assay, Clone Identification and Sequencing 543

NaStEP bait 544

The cDNA of NaStEP (accession number EU253563) was amplified using the primers: 545

forward, 5’-CCGGAATTCTCATCTTTCACTTCCACCAATCCCATTGTC -3’; reverse, 546

5’-GCGCTGCAGTTATGCATCAGTCTTCTGGAATTTCTCGAAGAC-3’. The PCR 547

product was cloned into a pGBKT7 vector (Clontech). Transformation of NaStEP 548

construction was performed in Saccharomyces cerevisiae Y2HGold cells, according to the 549



25

manufacturer’s instructions (YeastmakerTM Yeast Transformation System 2, Clontech). 550

551

Pollen- Pollen tube cDNA Library 552

Messenger RNA was purified from total RNA from N. rastroensis pollen and pollen tubes 553

(germinated during 16 h, 30ºC) using the PolyATtract® mRNA Isolation System 554

(Promega). Total RNA was isolated with TRIzolTM (Invitrogen). To cDNA library 555

construction a 1:1 mix of mRNA from pollen and pollen tubes was used for cDNA 556

synthesis using the CDS III and CDS III/6 primers, according to the manufacturer’s 557

instructions (Make Your Own ‘Mate & PlateTM, Library System, Clontech). The S. 558

cerevisiae strain employed was Y187. 559

560

The cDNA library was screened using BD-NaStEP as bait. The screening was performed 561

using a yeast-mating. Transformed cells were plated on QDO/ X-α-gal medium (SD/-Trp-562

Leu-His-Ade) supplemented with 40 μg/ml X-α-gal (5-bromo-4-chloro-3-indolyl- α-D-563

galactopyranoside), according with the manufacturer’s instructions (Matchmaker® Gold 564

Yeast Two-Hybrid System, Clontech). 565

566

Positive interactions were confirmed by yeast mating between the BD-NaStEP and AC-567

prey proteins and then were growing on DDO and QDO/ X-α-gal/ Aureobasidin A media, 568

the plates contained 125 ng/ml Aureobasidin A, according with the manufacturer’s 569

instructions (Matchmaker® Gold Yeast Two-Hybrid System, Clontech). 570



26

571

Full NaSIPP cDNA cloning 572

RNA was isolated from N. alata and N. rastroensis mature pollen with TRIzolTM 573

(Invitrogen) and cDNA was prepared using SMARTerTM RACE cDNA Amplification kit 574

(Clontech). A full-length clone was recovered, cloned into pGEM-T-Easy® and sequenced. 575

576

Confirmation of NaStEP- full length NaSIPP interaction by Yeast-Two Hybrid 577

The cDNA of NaStEP and NaSIPP were amplified using the primers: forward, 5’-578

CACCATGTCATCTTTCACTTCCA-3’; reverse, 5’- 579

TGCATCAGTCTTCTGGAATTTCTC-3’ and the primers forward, 5’- 580

CACCATGGCCTACACACACAACT-3’; reverse, 5’-CTTGGCAGGGGCAGGTG -3’ 581

respectively. As a negative control was used Mir1; the cDNA of Mir1 was amplified using 582

the primers forward, 5’- CACCATGTCTGTGTCTGCT-3’; reverse, 5’-583

ATGACCACCACCACCAATTTC-3’. PCR products were cloned into pENTRTM-D-584

TOPO® vector (Invitrogen), according to the manufacturer’s instructions. A subsequent LR 585

reaction was performed in pDEST32 and pDEST22 (Invitrogen) for NaSIPP, NaStEP and 586

Mir1. Yeast transformation of those constructions was performed in Y2HGold and Y187 587

cells, according to the manufacturer’s instructions (YeastmakerTM Yeast Transformation 588

System 2, Clontech). 589

590

Positive interactions were confirmed by yeast mating and then were growing on DDO and 591



27

QDO/ X-α-gal/ Aureobasidin A media, the plates contained 125 ng/ml Aureobasidin A, 592

according with the manufacturer’s instructions (Matchmaker® Gold Yeast Two-Hybrid 593

System, Clontech). 594

595

Transformation of Arabidopsis thaliana seedlings 596

Agrobacterium tumefaciens strain GV3101 cells carrying the clones of interest were grown 597

during a first cycle (20 h, 200 rpm, 28ºC) in 5 ml LB medium with 50 μg ml-1 rifampicin 598

and 100 μg ml-1 spectinomycin. A second cycle of growth was started by inoculation of an 599

aliquot from the first culture at a 1:1000 dilution in fresh medium, and then cultured until 600

late exponential growth phase (OD600 of 1.5-2.0). The bacteria were harvested and 601

resuspended in 10 mM MgCl2 with 100 μM acetosyringone (Sigma-Aldrich) and incubated 602

for 1 h. For cocultivation with A. thaliana, the bacteria were resuspended in 0.5X MS basal 603

salt medium (Sigma-Aldrich) pH 7.2 with 0.003% Sylwett-77, to a final OD600 0.5 604

(Campanoni et al., 2007). 605

606

Transformation pollen grains 607

Pollen tubes 608

Five milligrams of mature pollen grains of N. tabacum (8 x 105 cells; as counted with 609

TC20TM, Bio-Rad) were used in each bombardment trial and suspended in 500 μl of 610

pollen germination medium (Cheung et al., 2002). Pollen suspension was dispersed on 35 611

mm Petri dishes with germination medium and solidified with 0.7% agarose. The slides 612



28

were maintained in dark in a humid chamber at 26- 28ºC. After 8- 12 h, the pollen tubes 613

were observed. 614

615

Transient transformation of pollen grains was accomplished with a microprojectile 616

bombardment equipment Bio-Rad Biolistic® PDS-1000/He, according to Chen et al. 617

(2002) and with the manufacturer’s recommended protocol. The pollen grains samples were 618

bombarded twice to increase the yield of transformed pollen tubes. The pollen tubes were 619

observed directly on glass slides. On average, 25 pollen tubes were counted for each 620

sample, unless otherwise indicated. The average transformation efficiency was roughly 621

0.003%. 622

623

Subcellular localization 624

For subcellular localization in pollen tubes, the constructions were under the control of the 625

pollen-specific promoter Lat52 (Twell et al., 1989), five micrograms of Lat52::NaSIPP-626

Tomato and three micrograms of Lat52::Mit-GFP (Logan and Leaver, 2000) were mixed 627

with 10 μl spermidine (0.1 M), 25 μl CaCl2 (2.5 M) and 25 μl of tungsten particles (60 628

mg/ml). The pollen grains were transformed and germinated as described above. A Nikon 629

E800 confocal microscope was used to observe the fluorescence. 630

631

The construction 35S::NaSIPP-GFP was used to transformed A. tumefaciens strain 632

GV3101 cells which were used for A. thaliana seedlings transformation (described above). 633

A solution of 20 nM MitoTracker Red FM (Invitrogen) was used as mitochondrial marker. 634



29

635

Complementation of Δmir1 yeast mutant 636

Strains, media, plasmids 637

The yeast strains BY4741 MATα; his3 Δ1; leu2 Δ0; met15 Δ0; ura3 Δ (WT) and BY4741 638

MATα; his3 Δ1; leu2 Δ0; met15 Δ0; ura3 Δ0; YJR077c: kanMX4 (Δmir1) were used for the 639

complementation test. The yeast strains were a gift from Salvador Uribe-Carvajal lab. 640

641

The cDNA of Pic2 was amplified using the primers: forward, 5’- 642

CACCATGGAGTCCAATAAACAACC-3’; reverse, 5’-643

ATAAGAATGCGGCCGCCTAACCGGTGGTTGGTAA-3’. The PCR product were 644

cloned into pENTRTM-D-TOPO® vector (Invitrogen). The constructions of Pic2:pENTR 645

NaSIPP:pENTR and Mir1:pENTR (described above) was used for a LR recombination in 646

pYES-DEST52® vector (Invitrogen). 647

648

Yeast transformation with the NaSIPP, Pic2, Mir1 and empty vector (pYES-DEST52®) 649

constructions were performed in Δmir1 BY4741 cells, according to the manufacturer’s 650

instructions (YeastmakerTM Yeast Transformation System 2, Clontech). The transformed 651

yeasts were grown on selective medium (-Ura, Clontech). 652

653

Growth Conditions 654



30

The strains WT and Δmir BY4741 were incubated in YPD preculture medium for 24 h at 30 655

ºC, under agitation at 200 rpm. Subsequently cultured in YPGal (carbon source: Galactose) 656

medium for 24 h at 30 ºC, under agitation at 200 rpm. Finally, cultured in YPGly (carbon 657

source: Glycerol) medium for five days at 30 ºC, under agitation at 200 rpm. 658

659

Transformed yeasts were incubated in SD-Ura (carbon source: Glucose) preculture medium 660

for 24 h at 30 ºC. Subsequently cultured in SGal-Ura (carbon source: Galactose) medium 661

for 24 h at 30 ºC, under agitation at 200 rpm. Then, cultured in SGly-Ura (carbon source: 662

Glycerol) medium for five days at 30 ºC, under agitation at 200 rpm. The evaluation of 663

growth was realized everyday according with the DO600. 664

665

For the evaluation of growth in solid media, and aliquot 100 μl of the YPGal and SGal-Ura 666

culture was taken and spotted on the plates contained glycerol medium (YPGly, SGly-Ura) 667

and 2% of agar. 668

669

RNA Transcript Analysis 670

RNA was isolated with TRIzolTM (Invitrogen) from N. alata pistil, pollen, sepal, leaf, root 671

and petal materials as well as from anthers at different developmental stages (A1: 0.5-1.0 672

cm, A2: 1.1-2.0 cm, A3: 2.1-3.5 cm, A4: 3.5- 6.0 and A5: 6.0 cm- mature flower). Mature 673

pollen RNA (stage A5) was isolated from the following species: N. alata, N. forgetiana, N. 674

rastroensis, N. glauca, N. plumbaginifolia, N. tabacum and N. benthamiana. cDNA was 675



31

made from all RNA samples using M-MLV Reverse Transcriptase (Sigma-Aldrich), 676

according with the manufacturer’s instructions. 677

678

The cDNA of NaSIPP was amplified using the specific primers: forward, 5’- 679

GACACGGCTTCTTCTTCACCATTCTC-3’; reverse, 5’- TCTTCACTTGGCAGGGGCA 680

-3’. 681

682

The cDNA of MPC-like from N. tabacum XM_016632920.1 (LOC107808402) was 683

amplified using the specific primers: forward, 5’- 684

ATGGAGTATATTGATCCTGCAAAGTACA-3’; reverse, 5’- 685

TCGTGTATGGTATCTGTCGTCC-3’. 686

687


amplified using the specific primers: forward, 5’-ATGGCGTTTCCAGATAGCTCGACT-689

3’; reverse, 5’-GGTGTCGGAATGACATGTTTATAGAGTTG -3’. 690

691


amplified using the specific primers: forward, 5’- ATGGAGAACTCACGCCGTCA-3’; 693

reverse, 5’-TTGGTAATCCATCTGACAATCCCCT-3’. 694

695



32

RNAi construct, NaSIPP suppression and Pollination Phenotype 696

The NTP303 promoter was amplified using the primers: forward, 5’- 697

CCGGAGGTCCTGATACACTCGCAAC-3’; and reverse, 5’- 698

CCGCTCGAGCATGACGTTGTTTTT -3’. The PCR product contains the XhoI and 699

PpuMI restriction sites and was inserted at the RNAi vector pBADC. 700

701

The construction of NaSIPP:pENTR (described above) was used for a LR recombination 702

into the RNAi vector, to generated a sense and antisense NaSIPP (RNAi-NaSIPP). 703

704

Freshly collected SA2-pollen grains of SI N. alata, were transient transformed with five 705

micrograms of RNAi-NaSIPP construction by microprojectile bombardment, as describe 706

above. The pollen grains were used to pollinate SA2SA2 pistils (incompatible cross) and 707

SC10SC10 pistils (compatible cross). Effects on pollination behavior were evaluated by 708

staining style squashes with decolorized aniline blue (Kho and Baer, 1968). The pollen 709

tubes were counted and their growth along of the style evaluated at 72 h after pollination, 710

using an AmScope FM320T microscope. 711

712

Development of a reliable model for the three dimensional structure of NaSIPP 713

Taking advantage of the distant relationship to ATP/ADP translocators (ANT) of NaSIPP 714

models were obtained form SAMT-T08 (Karplus, 2009), I-TASSER (Zhang, 2008), and 715

HHpred (Karplus et al., 1998)/modeller (Eswar et al., 2007), and scored for biological 716

appropriateness using Rd.HMM (Martínez-Castilla and Rodriguez-Sotres, 2010). The most 717



33

appropriate prediction (Rd.HMM) was placed in a mixed-lipid membrane (Martínez et al., 718

2009), and subjected to Molecular Dynamics (MD) simulations (NPT cubic box, TIP3P 719

water, 0.15 M NaCl PME electrostatics, SHAKE for C-H bonds, ∆t 2 fs, AMBER 99SB-720

ildn force-field, 9), with the following temperature and time scheme (T,t ): (i) 313K, 100 721

ns; 328K, 100 ns; (ii) five rounds of 298 to 413K,3 heating; 413K, 3ns; 413 to 320K 722

cooling, 10 ns; 320 to 298K cooling, 6 ns; (iii) five rounds of 298 to 413K heating, 3 ns; 723

398K, 10 ns; 398 to 320K cooling, 6 ns; 320 to 298K cooling, 6ns. Conformers were 724

recovered by clustering the 320-298K trajectory sections, and their energy was minimized. 725

The conformer with the highest Rd.HMM had departed significantly form the starting 726

template, but was comparable in quality to NMR structural solutions (Score of ~0.4 times 727

the length of the NaSIPP amino acid sequence; Martínez-Castilla and Rodriguez-Sotres, 728

2010). 729

730

Bimolecular fluorescence complementation (BiFC) assay 731

A. thaliana seedlings 732

The NaSIPP:pENTR and NaStEP:pENTR (described above) constructions was used for a 733

LR recombination in pUBC-nYFP and pUBC-cYFP vectors (Grefen et al., 2010); to yield 734

the NaStEP-nYFP and NaSIPP-cYFP fusion proteins. The BiFC analyses were performed 735

by transient transformation of A. thaliana seedlings (described above). A solution of 20 nM 736

MitoTracker Red FM (Invitrogen) was used as mitochondrial marker. 737

738

Tobacco pollen tubes 739



34

Seven micrograms of Lat52::NaSIPP-CVenus and Lat52::NaStEP-NVenus constructions 740

were mixed with 10 μl spermidine (0.1 M), 25 μl CaCl2 (2.5 M) and 25 μl of tungsten 741

particles (60 mg/ml). The pollen grains were transformed and germinated as described 742

above. A fluorescence microscope was used to observe the reestablishment of Venus 743

fluorescence. 744

745

In addition, the pollen grains were cobombarded with NaStEP-NV and empty vector (CV), 746

or with the NaSIPP-CV and empty vector (NV), as described above. A rapid screening was 747

performed looking for fluorescence in all the glass slides where the pollen grains were 748

deposited. Then, a screening was carried out with selected preparations, performing 749

detailed observations of the pollen tubes. An average of 200 pollen tubes were analyzed. 750

751

For the coexpression assays of NaStEP-GFP and NaSIPP-Tomato in pollen tubes, were 752

used five micrograms of Lat52::NaSIPP-Tomato construct and seven micrograms of the 753

Lat52::NaStEP-GFP construct. The transient transformation of pollen grains was done as 754

described above. 755

756

Microscopic Observations 757

Confocal images were obtained on Olympus FV1000 and Nikon E800 microscope. GFP 758

fluorescence was excited with the 458- or 488-nm Argon laser lines; YFP and Venus 759

fluorescence was excited with the 514-nm laser line; aniline blue fluorescence was excited 760



35

with the 390-nm laser line; MitoTracker Red FM (Invitrogen) and Tomato fluorescence 761

were excited with the 581 nm laser line. Emitted light was collected through a NFT515 762

dichroic and 505- to 530-nm (GFP), 535- to 590-nm (YFP), 380- to 390-nm (aniline blue) 763

and 600- to 650-nm (MitoTracker Red FM, Invitrogen) band-pass filters. 764

765

Accession Number 766

Sequence data from this article can be found in the GenBank accession number for 767

nucleotide sequence: BankIt1982585 Seq KY471417. 768

769

Figure legends 770

Figure 1. NaStEP interacts with the pollen protein NaSIPP. Interaction between NaStEP 771

and NaSIPP was detected by a Yeast Two Hybrid assay. (A) Cotransformed S. cerevisiae 772

growing on the QDO medium (SD/Trp-Leu-Ade-His). (B) Yeast growth on QDO medium 773

supplemented with X-α-Gal and Aureobasidin; positive interactions support growth and 774

turn blue. (C) Yeast growth on DDO medium (SD/Trp-Leu). BD= Binding Domain. AD= 775

Activation Domain. Full NaSIPP; the whole NaSIPP protein. Mir1; Mitochondrial 776

phosphate carrier of S. cerevisiae. BD and AD empty vectors were used as negative 777

controls. 778

779

Figure 2. NaSIPP is a phosphate transporter and partially complements the absence of Mir1 780

in S. cerevisiae. (A) Growth curve of the yeast mutant Δmir1, the wild-type (WT) strain and 781



36

the Δmir1 yeast transformed with the plasmid pYES-DEST52 (empty vector), with construct 782

Pic2::pYES-DEST52, with NaSIPP::pYES-DEST52 and Mir1::pYES-DEST52. Yeast were 783

grown on liquid glycerol medium at 30 ºC. (B) Yeast were grown on solid glycerol medium 784

at 30 ºC for ten days and (C) Replica-plated on solid glucose medium was incubated for 785

three days at 30 ºC. 786

Figure 3. Schematic representation of the predicted three-dimensional structure of NaSIPP. 787

(A) The model is shown as cartoons from the membrane side. A translucent cartoon 788

representation is shown from the top (B) showing the region indicated by the red dotted line 789

in (A), or from the bottom (C) showing the region indicated by the yellow dotted line in 790

(A). In (B) and (C) the amino acids atoms are represented as Van der Walls spheres and 791

colored by amino acid type: red, acidic; blue, basic; green, polar neutral; light gray, 792

hydrophobic. Prepared using Visual Molecular Dynamics (Humphrey et al., 1996). 793

Figure 4. Subcelullar localization of NaSIPP. Coexpression of NaSIPP-Tomato with the 794

mitochondrial marker Mit-GFP. Labeled compartments in N. tabacum pollen tubes 795

expressing: (A) NaSIPP-Tomato (red), (B) Mit-GFP (green) and (C) merge (yellow) are 796

shown. The white arrow shows the colocalization of NaSIPP-Tomato and Mit-GFP. The 797

pollen grains were transformed by microprojectile bombardment. Scale bar: 5μm. 798

Transiently transformed A. thaliana seedlings expressing (D) the 35S:NaSIPP:GFP 799

construct (green) in hypocotyl cells. (E) MitoTracker Red FM signal is observed in red (F, 800

G) merge (yellow). Scale bar: 40μm. 801

Figure 5. NaStEP interacts with NaSIPP in plant cells. Interaction between NaStEP and 802

NaSIPP was detected by Bimolecular Fluorescence Complementation (BiFC) assays. (A) 803



37

Coexpression of NaStEP-nYFP and NaSIPP-cYFP constructs in roots transiently 804

transformed in A. thaliana seedlings. (B) Merge of A and C. (C) Bright-field. (D) 805

Coexpression of NaStEP-nYFP and NaSIPP-cYFP constructs in hypocotyls transiently 806

transformed in A. thaliana seedlings. (E) Merge of D and F. (F) Bright-field. The YFP 807

fluorescence is shown in yellow. Scale bar: 50 μm. (G) Coexpression of NaStEP-NVen and 808

NaSIPP-CVen constructs of tobacco pollen tubes transformed by microprojectile 809

bombardment. (H) Merge of G and I. (I) Bright-field. The Venus fluorescence is shown in 810

yellow. Scale bar: 40 μm. 811

Figure 6. Physical interaction between NaStEP and NaSIPP occurs in mitochondria. 812

Colocalization of the BiFC signal with the mitochondrial marker MitoTracker Red in A. 813

thaliana seedlings. (A) Localization of the interaction between NaStEP-nYFP with 814

NaSIPP-cYFP (green) expressed in hypocotyl cells. (B) MitoTracker Red signal is 815

observed in red. C and D are merged signal (yellow). A. thaliana seedlings were transiently 816

transformed. Scale bar: 50 μm. 817

Figure 7. Interaction between NaStEP and NaSIPP occurs in the mitochondria of pollen 818

tube. (A) Localization pattern of NaSIPP-Tomato (red), (B) NaStEP-GFP (green) and (C) 819

The coexpression of NaSIPP-Tomato with NaStEP-GFP on red channel, (D) On green 820

channel and (E) Merge (yellow). The pollen tubes were transformed by microprojectile 821

bombardment. Scale bar: 10 μm. 822

823

Figure 8. The NaSIPP transcript is specifically accumulated in mature pollen of Nicotiana 824

species. mRNA levels of different MPC in (A) Different organs of N. alata. (B) 825



38

Developmental anthers stages, A1: 0.5-1.0 cm; A2: 1.1-2.0 cm; A3: 2.1-3.5 cm; A4: 3.5-6.0 826

cm; A5: 6.0 cm- mature flower. (C) Detection of transcripts in different genetic Nicotiana 827

backgrounds. Primers used were specific for the gene shown at the right: NaSIPP, 828

XM_0166322920.1 (20.1); XM_016649631.1 (31.1); XM_016600064.1 (64.1) and 829

Ubiquitin (UBQ) was used as a load control. SI: Self-incompatible and SC: Self-830

compatible. 831

Figure 9. Suppression of NaSIPP in pollen tubes disrupts SI in N. alata. Pistils from SI N. 832

alata were pollinated with SA2-pollen and prepared for imaging after 72 h of pollination. 833

(A) As shown in the diagram, the field of view is at or very near the base of the style. (B) 834

SI N. alata SA2SA2 pistils pollinated with untransformed SA2 –pollen. Epidermal tissue (ep) 835

is also visible. The untransformed control pollen shows normal S-allele specific pollen 836

rejection because no SA2-pollen tubes are evident. (C) SI N. alata SA2SA2 pistils pollinated 837

with SA2 -pollen bombarded with the empty vector. (D) Pollen tubes reaching the base of a 838

style of: SI N. alata SA2SA2, pollinated with SA2-pollen bombarded with the construct RNAi-839

NaSIPP. Pollen tubes (pt) appear as fiber with brightly stained callose plugs (arrows). (E) 840

SI N. alata SC10SC10 pistils pollinated with SA2-pollen bombarded with the construction 841

RNAi-NaSIPP. Scale bar: 50 μm. (F) Histogram of pollen tube lengths after of SI N. alata 842

SA2SA2 pistils were pollinated with untransformed SA2-pollen, with pollen grains bombarded 843

with empty vector and with the construct RNAi-NaSIPP. Results are the average and 844

standard error of 28 pollinations with untransformed pollen grains, 67 pollinations with 845

pollen grains transformed with the empty vector and 89 pollinations with pollen grains 846

transformed with the RNAi-NaSIPP construct. The error bars represent the SEM; asterisk 847

represents statistical significance (P < 0.05, One-way ANOVA with Dunett’s post test). 848



39

849

Supplementary Figure 1. The NaSIPP transcript is specifically detected in mature pollen in 850

N. rastroensis. Total RNA (5 μg) was loaded in each lane, blotted and probed with 32P-851

labelled C-terminal NaSIPP. To ascertain equal RNA loading, blots were stained with 852

methylene blue (lower section). 853

854

Supplementary Figure 2. (A) Sequence alignment of NaSIPP, functional and putative 855

Mitochondrial Phosphate Carrier (MPC). Functional MPC from: Saccharomyces cerevisiae 856

Mir1 (NP_012611) and Pic2 (NP_010973.3), Ipomoea tricolor (BAF64711), Lotus 857

japonicus (BAB83689), Glycine max (NP_001237304), Mus musculus (NP_598429), 858

Rattus novergicus (NP_620800), Homo sapiens isoform B (NP_002626), Arabidopsis 859

thaliana 3 (NP_190454), A. thaliana 5 (NP_196908). Putative MPC from: Solanum 860

tuberosum (XP_006347354), S. lycopersicum (XP_004242142), Ricinus communis 861

(XP_002512859.1), Populus trichocarpa (XP_002300143), Medicago truncatula 862

(XP_003624478), Danio rerio (AAH67565), Cricetulus griseus (ERE87819), Nicotiana 863

tomentosiformis (XP_009618018), Malus domestica (XP_008341244), A. thaliana 2 864

(NP_179319), N. alata (NaSIPP). These sequences were aligned using PSI/TM-Coffee 865

(http://tcoffee.crg.cat/apps/tcoffee/do:tmcoffee). Residues highlighted in pink correspond to 866

the predicted transmembrane region, in yellow the residues found in the inner part of the 867

membrane and purple the residues found in the external part of the membrane. The residues 868

indicated by downward asterisk are the amino acids, which were found critical or important 869

for the phosphate transport activity of Mir1 on the basis of mutagenesis studies (Briggs et 870

al., 1999; Phelps et al., 2001; Wohlrab et al., 2002). Position 1 corresponds to the first 871



40

amino acid of Mir1. (B) Phylogenetic tree of NaSIPP, functional and putative MPC. The 872

phylogenic analysis was originated from an alignment, which was performed by MUSCLE 873

(http://www.ebi.ac.uk/Tools/msa/muscle/). Alignment was delimited and curated by 874

Gblocks (http://molevol.cmima.csic.es/castresana/Gblocks_server.html). ProtTest 2.4 875

server determined the best model for amino acids substitution. The maximum likelihood 876

tree was estimated by PHYML (http://www.atgc-montpellier.fr/phyml/). 877

Supplementary Figure 3. BiFC assays controls. Fluorescence images of seedlings and 878

pollen tubes expressing (fluorescence, left; bright-field, right): (A-D) NaStEP-nYFP 879

coexpressed with empty vector (c-YFP) in root and hypocotyl of A. thaliana seedlings. (E-880

H) NaSIPP-cYFP coexpressed with empty vector (n-YFP) in root and hypocotyl of A. 881

thaliana seedlings. Scale bar: 50 μm. (I-J) NaStEP-NVen coexpressed with empty vector 882

(CVen) in tobacco pollen tubes. (K-L) NaSIPP-CVen coexpressed with empty vector 883

(NVen) in tobacco pollen tubes. Scale bar: 40 μm. 884

885

Supplementary Figure 4. Sequence alignment of different Nicotiana SIPP sequences. (A) 886

cDNA sequence of SI Nicotiana spp (N. alata, N. rast roensis and N. forgetiana ) and SC 887

Nicotiana spp (N. plumbaginifolia, N. tabacum and N. benthamiana ). The red boxes 888

indicate the first stop codon of each sequence. (B) Predicted protein sequences obtained 889

from cDNA of SI and SC Nicotiana spp. The alignment was performed by MUSCLE 890

(http://www.ebi.ac.uk/Tools/msa/muscle/). 891

892


http://www.ebi.ac.uk/Tools/msa/muscle/

http://www.atgc-montpellier.fr/phyml/

http://www.ebi.ac.uk/Tools/msa/muscle/


41

Supplementary Table 1. Evaluation of pollen tube length after RNAi-NaSIPP pollen 893

transformation. Pistils SI N. alata SA2SA2 were pollinated with: Untransformed SA2-pollen, 894

SA2-pollen transformed with empty vector and SA2-pollen transformed with RNAi-NaSIPP 895

construction by microprojectile bombardment. After 72 h of pollination, styles were 896

prepared for imaging and the pollen tube length was evaluated in each case. The mean and 897

standard error (SEM) was calculated. 898

899

Supplementary Table 2. NaSIPP suppression disrupts S-specific pollen rejection. SI N. 900

alata SA2SA2 pistils were pollinated with: Untransformed SA2-pollen, SA2-pollen transformed 901

with empty vector and SA2-pollen transformed with an RNAi-NaSIPP construction by 902

microprojectile bombardment. Analysis was performed after 72 h of pollination. Styles 903

were prepared for imaging and the pollen tube length was evaluated in each case. To test if 904

exist a statistical difference between treatments One-way ANOVA with Dunnett's post test 905

was performed using GraphPad Prism version 5.0b for Mac OS X, GraphPad Software, San 906

Diego California USA, www.graphpad.com. 907

908

LITERATURE CITED 909

Al-Nasser I, Crompton M (1986) The entrapment of the Ca2+ indicator arsenazo III in the 910

matrix space of rat liver mitochondria by permeabilization and resealing. Na+-911

dependent and -independent effluxes of Ca2+ in arsenazo III-loaded mitochondria. 912

Biochem J 239(1): 31-40 913

Anderson MA, Cornish EC, Mav SL, Williams EG, Hoggart R, Atkinson A, Boning I, 914

Greg B, Simpson RJ, Roche PJ, Haley JD, Penschow JD, Niall HD, Tregear GW, 915



42

Cohhlan JP, Crawford RJ, Clarke AE (1986) Cloning of cDNA for a stylar 916

glycoprotein associated with expression of self-incompatibility in Nicotiana alata. 917

Nature 321(6065): 38-44 918

Arpagaus S, Rawyler A, Braendle R (2002) Occurrence and characteristics of the 919

mitochondrial permeability transition in plants. J Bio Chem 277(3): 1780-1787 920

Ashkani J, Rees DJ (2016) A Comprehensive Study of Molecular Evolution at the Self-921

Incompatibility Locus of Rosaceae. J Mol Evol 82(2-3): 128-145 922

Balk J, Leaver CJ, McCabe PF (1999) Translocation of cytochrome c from the 923

mitochondria to the cytosol occurs during heat-induced programmed cell death in 924

cucumber plants. FEBS Lett 463(1-2): 151-154 925

Bàthori G, Parolini I, Tombola F, Szabò I, Messina A, Oliva M, De Pinto V, Lisanti 926

M, Sargiacomo M, Zoratti M (1999) Porin is present in the plasma membrane where 927

it is concentrated in caveolae and caveolae-related domains. J Biol Chem 274(42): 928

29607-29612 929

Bedhomme M, Hoffmann M, McCarthy EA, Gambonnet B, Moran RG, Rébeillé F, 930

Ravanel S (2005) Folate metabolism in plants: an Arabidopsis homolog of the 931

mammalian mitochondrial folate transporter mediates folate import into chloroplasts. J 932

Biol Chem 280(41): 34823-34831 933

Beecher B, McClure BA (2001) Expressing self-incompatibility RNases (S-RNases) in 934

transgenic plants. Methods Mol Biol 160: 65-85 935

Beers EP (1997) Programmed cell death during plant growth and development. Cell Death 936

Differ 4(8): 649-661 937



43

Bhosale G, Sharpe JA, Sundier SY, Duchen MR (2015) Calcium signaling as a mediator 938

of cell energy demand and a trigger to cell death. Ann N Y Acad Sci 1350: 107-116 939

Briggs C, Mincone L, Wohlrab H (1999) Replacements of basic and hydroxyl amino 940

acids identify structurally and functionally sensitive regions of the mitochondrial 941

phosphate transport protein. Biochemistry 38(16): 5096-5102 942

Busot GY, McClure B, Ibarra-Sánchez CP, Jiménez-Durán K, Vázquez-Santana S, 943

Cruz-García F (2008) Pollination in Nicotiana alata stimulates synthesis and transfer 944

to the stigmatic surface of NaStEP, a vacuolar Kunitz proteinase inhibitor homologue. 945

J Exp Bot 59(11): 3187-3201 946

Campanoni P, Sutter JU, Davis CS, Littlejohn GR, Blatt MR (2007) A generalized 947

method for transfecting root epidermis uncovers endosomal dynamics in Arabidopsis 948

root hair. Plant J 51: 322-330 949

Chen CY, Wong EI, Vidali L, Estavillo A, Hepler PK, Wu HM, Cheung AY (2002) 950

The regulation of actin organization by actin-depolimerizing factor in elongating 951

pollen tubes. Plant Cell 14(9): 2175-2190 952

Cheung AY, Wu HM (2008) Structural and signaling networks for the polar cell growth 953

machinery in pollen tubes. Annu. Rev. Plant Biol. 59: 547–72 954

Cheung AY, Chen CY, Glaven RH, de Graaf BH, Vidali L, Hepler PK, Wu HM 955

(2002) Rab2 GTPase regulates vesicle trafficking between the endoplasmic reticulum 956

and the Golgi bodies and is important to pollen tube growth. Plant Cell 14(4): 945-962 957

Covey PA, Kondo K, Welch L, Frank E, Sianta S, Kumar A, Nuñez R, Lopez-Casado 958

G, van der Knaap E, Rose JK, McClure BA, Bedinger PA (2010) Multiple features 959



44

that distinguish unilateral incongruity and self-incompatibility in the tomato clade. 960

Plant J 64(3): 367-378 961

Crompton M, Costi A (1988) Kinetic evidence for a heart mitochondrial pore activated by 962

Ca+2, inorganic phosphate and oxidative stress. A potential mechanism for 963

mitochondrial dysfunction during cellular Ca+2 overload. Eur J Biochem 178(2): 489-964

501 965

Crompton M, Costi A, Hayat L (1987) Evidence for the presence of a reversible Ca+2- 966

dependent pore activated by oxidative stress in heart mitochondria. Biochem J 245(3): 967

915-918 968

Cruz-García F, Hancock CN, Kim D, McClure B (2005) Stylar glycoproteins bind to S-969

RNase in vitro. Plant J 42(3): 295-304 970

de Nettancourt D (2001) Incompatibility and Incongruity in Wild and Cultivated Plants. 971

Springer-Verlag, New York 972

Doran E, Halestrap AP (2000) Cytochrome c release from isolated rat liver mitochondria 973

can occur independently of outer-membrane rupture: possible role of contact sites. 974

Biochem J 348:343–350 975

Entani T, Iwano M, Shiba H, Che FS, Isogai A, Takayama S (2003) Comparative 976

analysis of the self-incompatibility S-locus region of Prunus mume: identification of a 977

pollen-expressed F-box gene with allelic diversity. Genes Cells 8(3): 203-213 978

Eswar N, Webb B, Marti-Renom MA, Madhusudhan MS, Eramian D, Shen M, Pieper 979

U, Sali A (2007) Comparative protein structure modeling using MODELLER. Curr 980

Protoc Protein Sci Chapter 2:Unit 2.9 981



45

Fields S, Song O (1989) A novel genetic system to detect protein-protein interactions. 982

Nature 340(6230): 245-246 983

Fukao Y, Hayashi Y, Mano S, Hayashi M, Nishimura M (2001) Developmental analysis 984

of a putative ATP/ADP carrier protein localized on glyoxysomal membranes during 985

the peroxisome transition in pumpkin cotyledons. Plant Cell Physiol 42(8): 835-841 986

García-Fernández R, Peigneur S, Pons T, Alvarez C, González L, Chávez MA, Tytgat 987

J (2016) The Kunitz-Type Protein ShPI-1 Inhibits Serine Proteases and Voltage-Gated 988

Potassium Channels. Toxins (Basel) 8(4): 110 989

Goldraij A, Kondo K, Lee CB, Hancock CN, Sivaguru M, Vazquez-Santana S, Kim S, 990

Phillips TE, Cruz-García F, McClure BA (2006) Compartmentalization of S-RNase 991

and HT-B degradation in self-incompatible Nicotiana. Nature 439 (7078): 805-810 992

Grefen C, Donald N, Schumacher K, Blatt MR (2010) A Ubiquitin-10 promoter-based 993

vector set for fluorescent protein tagging facilitates temporal stability and native 994

protein distribution in transient and stable expression studies. Plant J 64(2): 355-365 995

Gutiérrez-Aguilar M1, Pérez-Martínez X, Chávez E, Uribe-Carvajal S (2010) In 996

Saccharomyces cerevisiae, the phosphate carrier is a component of the mitochondrial 997

unselective channel. Arch Biochem Biophys 494(2): 184-191 998

Halestrap AP, Clarke SJ, Javadov SA (2004) Mitochondrial permeability transition pore 999

opening during myocardial reperfusion-a target for cardioprotection. Cardiovasc Res 1000

61(3): 372-385 1001

Halestrap AP, Kerr PM, Javadov S, Woodfield KY (1998) Elucidating the molecular 1002

mechanism of the permeability transition pore and its role in reperfusion injury of the 1003

heart. Biochim Biophys Acta 1366(1-2): 79-94 1004



46

Hamel P, Saint-Georges Y, de Pinto B, Lachacinski N, Altamura N, Dujardin G 1005

(2004) Redundancy in the function of mitochondrial phosphate transport in 1006

Saccharomyces cerevisiae and Arabidopsis thaliana. Mol Microbiol 51:307-317 1007

Hancock CN, Kent L, McClure BA (2005) The stylar 120 kDa glycoprotein is required 1008

for S-specific pollen rejection in Nicotiana. Plant J 43(5): 716-723 1009

Harvey AL (2001) Twenty years of dendrotoxins. Toxicon 39(1): 15-26 1010

Haworth RA, Hunter DR (1979) The Ca+2-induced membrane transition in mitochondria: 1011

II. Nature of the Ca+2 trigger site. Arch Biochem and Biophys 195(2): 460-467 1012

Hua Z, Kao TH (2008) Identification of major lysine residues of S(3)-RNase of Petunia 1013

inflata involved in ubiquitin-26S proteasome-mediated degradation in vitro. Plant J 1014

54(6): 1094-1104 1015

Hunter DR, Haworth RA (1979) The Ca2+-induced membrane transition in mitochondria. 1016

I. The protective mechanism. Arch Biochem Biophys 195(2): 453-459 1017

Jiménez-Durán K, McClure B, García-Campusano F, Rodríguez-Sotres R, Cisneros J, 1018

Busot G, Cruz-García F (2013) NaStEP: a proteinase inhibitor essential to self-1019

incompatibility and positive regulator of the HT-B stability in Nicotiana alata pollen 1020

tubes. Plant Physiol 161(1): 97-107 1021

Karplus K, Barrett C, Hughey R (1998) Hidden Markov models for detecting remote

protein homologies. Bioinformatics 14(10): 846-856

Karplus K (2009) SAM-T08, HMM-based protein structure prediction. Nucleic Acids Res

37(Web Server issue): W492-7

Kho YO, Baer J (1968) Observing pollen tubes by means of fluorescence. Euphytica 17: 1022



47

298–302 1023

Kondo K, McClure B (2008) New microsome-associated HT-B family proteins from 1024

Nicotiana respond to pollination and define an HT/NOD-24 protein family. Mol Plant 1025

1(4): 634-644 1026

Kondo K, Yamamoto M, Matton DP, Sato T, Hirai M, Norioka S, Hattori T, 1027

Kowyama Y (2002) Cultivated tomato has defects in both S-RNase and HT genes 1028

required for stylar function of self-incompatibility. Plant J 29(5): 627-636 1029

Kubo K, Entani T, Takara A, Wang N, Field AM, Hua Z, Toyoda M, Kawashima S, 1030

Ando T, Isogai A, Kao TH, Takayama S (2010) Collaborative non-self recognition 1031

system in S-RNase–based self-incompatibility. Science 330(6005): 796-799 1032

Kushnareva YE, Haley LM, Sokolove PM (1999) The role of low (< or = 1mM) 1033

phosphate concentrations in regulation of mitochondrial permeability: modulation of 1034

matrix free Ca+2 concentration. Arch Biochem Biophys 363(1): 155-162 1035

Lai Z, Ma W, Han B, Liang L, Zhang Y, Hong G, Xue Y (2002) An F-box gene linked 1036

to the self-incompatibility (S) locus of Antirrhinum is expressed specifically in pollen 1037

and tapetum. Plant Mol Biol 50(1); 29-42 1038

Lam E, del Pozo O (2000) Caspase-like protease involvement in the control of plant cell 1039

death. Plant Mol Biol 44(3): 417-428 1040

Lancelin JM, Foray MF, Poncin M, Hollecker M, Marion D (1994) Proteinase inhibitor 1041

homologues as potassium channel blockers. Nat Struct Biol 1(4): 246-250 1042



48

Lee CB, Kim S, McClure B (2009) A pollen protein, NaPCCP, that binds pistil 1043

arabinogalactan proteins also binds phosphatidylinositol 3-phosphate and associates 1044

with the pollen tube endomembrane systems. Plant Physiol 149(2): 791-802 1045

Lee CB, Swatek KN, McClure B (2008) Pollen proteins bind to the C-terminal domain of 1046

Nicotiana alata pistil arabinogalactan proteins. J Biol Chem 283(40): 26965-26973 1047

Leroch M, Kirchberger S, Haferkamp I, Wahl M, Neuhaus HE, Tjaden J (2005) 1048

Identification and characterization of a novel plastidic adenine nucleotide uniporter 1049

from Solanum tuberosum. J Biol Chem 280(18): 17992-8000 1050

Leung AW, Varanyuwatana P, Halestrap AP (2008) The mitochondrial phosphate 1051

carrier interacts with cyclophilin D and may play a key role in the permeability 1052

transition. J Biol Chem 283(39): 26312-26323 1053

Lind JL, Bönig I, Clarke AE, Anderson MA (1996) A style-specific 120 kDa 1054

glycoprotein enters pollen tubes of Nicotiana alata in vivo. Sex Plant Reprod 9: 75-86 1055

Lisanti MP, Scherer PE, Tang Z, Sargiacomo M (1994) Caveolae, caveolin and 1056

caveolin-rich membrane domains: a signaling hypothesis. Trends Cell Biol 4(7): 231-1057

235 1058

Logan DC, Leaver CJ (2000) Mitochondria-target GFP highlights the heterogeneity of

mitochondrial shape, size and movement within living plant cells. J Exp Bot 51(346):

865-871

Luu DT, Qin X, Morse D, Cappadocia M (2000) S-RNase uptake by compatible pollen 1059

tubes in gametophytic self-incompatibility. Nature 407(6804): 649-651 1060

Martínez L, Andrade R, Birgin EG, Martínez JM (2009) PACKMOL: a package for

building initial configurations for molecular dynamics simulations. J Comput Chem

30(13): 2157-64



49

Martínez-Castilla LP, Rodríguez-Sotres R (2010) A score of the ability of a three-

dimensional protein model to retrieve its own sequence as a quantitative measure of its

quality and appropriateness. PLoS One 5(9): e12483

McClure BA, Cruz-García F, Romero C (2011) Compatibility and incompatibility in S-

RNase-based systems. Ann Bot 108(4): 647-658

McClure BA, Haring V, Ebert PR, Anderson MA, Simpson RJ, Sakiyama F, Clarke A 1061

(1989) Style self-incompatibility gene products of Nicotiana alata are ribonucleases. 1062

Nature 342(6252): 955-957 1063

McClure BA, Mou B, Canevascini S, Bernatzky (1999) A small asparagine-rich protein 1064

required for S-allele-specific pollen rejection in Nicotiana. Proc Natl Acad Sci USA. 1065

96(23): 13548-13553 1066

Meng D, Gu Z, Li W, Wang A, Yuan H, Yang Q, Li T (2014) Apple MdABCF assists in 1067

the transportation of S-RNase into pollen tubes. Plant J 78(6): 990-1002 1068

Murakami H, Blobel G, Pain D (1990) Isolation and characterization of the gene for a 1069

yeast mitochondrial import receptor. Nature 347(6292): 488-491 1070

Murffet J, Atherto TL, Mou B, Gasser CS, McClure BA (1994) S-RNase expressed in 1071

transgenic Nicotiana causes S-allele specific pollen rejection. Nature 367(6463): 563-1072

566 1073

Murffet J, Strabala TJ, Zurek DM, Mou B, Beecher B, McClure BA (1996) S-RNase 1074

and interspecific pollen rejection in the genus Nicotiana: Multiple pollen-rejection 1075

pathways contribute to unilateral incompatibility between self-incompatible and self-1076

compatible species. Plant Cell 8(6): 943-958 1077

O’Brien M, Kapfer C, Major G, Laurin M, Bertrand C, Kondo K, Kowyama Y, 1078

Matton DP (2002) Molecular analysis of the stylar-expressed Solanum chacoense 1079



50

small asparagine-rich protein family related to the HT modifier of gametophytic self-1080

incompatibility in Nicotiana. Plant J 32 (6): 985-996 1081

Palmieri F (1994) Mitochondrial carrier proteins. FEBS Lett 346(1): 48-54 1082

Palmieri F (2004) The mitochondrial transport family (SCL25): physiological and 1083

pathological implications. Pflugers Arch 447(5): 689-709 1084

Palmieri F, Pierri CL, De Grassi A, Nunes-Nesi A, Fernie AR (2011) Evolution, 1085

structure and function of mitochondrial carriers: a review with insights. Plant J 66(1): 1086

161-181 1087

Palmieri L, Rottensteiner H, Girzalsky W, Scarcia P, Palmieri F, Erdmann R (2001) 1088

Identification and functional reconstitution of the yeast peroxisomal adenine nucleotide 1089

transporter. EMBO J 20(18): 5049-5059 1090

Peigneur S, Billen B, Derua R, Waelkens E, Debaveye S, Béress L, Tytgat J (2011) A 1091

bifunctional sea anemone peptide with Kunitz type protease and potassium channel 1092

inhibiting properties. Biochem Pharmacol 82(1): 81-90 1093

Petronilli V, Nicolli A, Costantini P, Colonna R, Bernardi P (1994) Regulation of the 1094

permeability transition pore, a voltage-dependent mitochondrial channel inhibited by 1095

cyclosporin A. Biochim Biophys Acta 1187: 255-259 1096

Phelps A, Briggs C, Haefele A, Mincone L, Ligeti E, Wohlrab H (2001) Mitochondrial 1097

phosphate transport protein. Reversions of inhibitory conservative mutations identify 1098

four helices and a nonhelix protein segment with transmembrane interactions and 1099

Asp39, Glu137, and Ser158 as nonessential for transport. Biochemistry 40(7): 2080-1100

2086 1101



51

Puerta AR, Ushijima K, Koba T, Sassa H (2009) Identification and functional analysis of 1102

pistil self-incompatibility factor HT-B of Petunia. J Exp Bot 60(4): 1309–1318 1103

Qiao H, Wang H, Zhao J, Huang J, Zhang Y, Xue Y (2004) The F-box protein AhSLF-1104

S2 physically interacts with S-RNases that may be inhibited by the ubiquitin/26S 1105

proteasome pathway of protein degradation during compatible pollination in 1106

Antirrhinum. Plant Cell 16(3): 582-595 1107

Roldán J, Rojas HJ, Goldriaj A (2012) Disorganization of F-actin cytoskeleton precedes 1108

vacuolar disruption in pollen tubes during the in vivo self-incompatibility response in 1109

Nicotiana alata. Ann Bot 110(4): 787-795 1110

Sassa H, Hirano H (2006) Identification of a new class of pistil-specific proteins of 1111

Petunia inflata that is structurally similar to, but functionally distinct from the self-1112

incompatibility factor HT. Mol Genet and Genomics 275 (1): 97-104 1113

Schultz CJ, Hauser K, Lind JL, Atkinson AH, Pu Z, Anderson MA, Clarke AE (1997) 1114

Molecular characterization of a cDNA sequence encoding the backbone of a style 1115

specific 120kDa glycoprotein which has features of both extensions and 1116

arabinogalactan-proteins. Plant Mol Biol 35: 833-845 1117

Serrano I, Pelliccione S, Olmedilla A (2010) Programmed-cell-death hallmarks in 1118

incompatible pollen and papillar stigma cells of Olea europaea L. under free 1119

pollination. Plant Cell Rep 29(6): 561-572 1120

Sijacic P, Wang X, Skirpan AL, Wang Y, Dowd PE, McCubbin AG, Huang S, Kao 1121

TH (2004) Identification of the pollen determinant of S-RNase-mediated self-1122

incompatibility. Nature 429(6989): 302-305 1123

Stein JC, Hansen G (1999) Mannose induces an endonuclease responsible for DNA 1124



52

laddering in plant cells. Plant Physiol 121(1): 71-80 1125

Sun YL, Zhao Y, Hong X, Zhai ZH (1999) Cytochrome c release and caspase activation 1126

during menadione-induced apoptosis in plants. FEBS Lett 462(3): 317-321 1127

Thomas SG, Franklin-Tong VE (2004) Self-incompatibility triggers programmed cell 1128

death in Papaver pollen. Nature 429(6989): 305-309 1129

Twell D, Wing R, Yamaguchi J, McCormick S (1989) Isolation and expression of an 1130

anther-specific gene from tomato. Mol Gen Genet 217(2-3): 240-245 1131

Ushijima K, Sassa H, Dandekar AM, Gradziel TM, Tao R, Hirano H (2003) Structural 1132

and transcriptional analysis of the self-incompatibility locus of almond: identification 1133

of a pollen-expressed F-box gene with haplotype-specific polymorphism 15(3): 771-1134

781 1135

Varanyuwatana P, Halestrap AP (2012) The roles of phosphate and the phosphate carrier 1136

in the mitochondrial permeability transition pore. Mitochondrion 12(1): 120-125 1137

Vierstra RD (2003) The ubiquitin/26S proteasome pathway, the complex last chapter in 1138

the life of many plant proteins. Trends Plant Sci 8(3): 135-142 1139

Wandrey M, Trevaskis B, Brewin N, Udvardi MK (2004) Molecular and cell biology of 1140

a family of voltage-dependent anion channel porins in Lotus japonicus. Plant Physiol 1141

134(1): 182-193 1142

Wang Y, Tsukamoto T, Yi KW, Wang X, Huang S, McCubbin AG, Kao TH (2004) 1143

Chromosome walking in the Petunia inflata self-incompatibility (S-) locus and gene 1144

identification in an 881-kb contig containing S2-RNase. Plant Mol Biol 54(5): 727–74 1145



53

Wang CL, Xu GC, Jiang XT, Chen G, Wu J, Wu HQ, Zhang SL (2009) S-RNase 1146

triggers mitochondrial alteration and DNA degradation in the incompatible pollen tube 1147

of Pyrus pyrifolia. Plant J 57(2): 220-9 1148

Wang CL, Zhang SL (2011) A cascade signal pathway occurs in self-incompatibility of 1149

Pyrus pyrifolia. Plant Signal Behav 6(3): 420-1 1150

Wheeler D, Newbigin E (2007) Expression of 10 S-class SLF-like genes in Nicotiana alata 1151

pollen and its implications for understanding the pollen factor of the S locus. Genetics 1152

177(4): 2171-2180 1153

Williams JS, Wu L, Lis S, Sun P, Kao TH (2015) Insight into S-RNase-based self-1154

incompatibility in Petunia: recent findings and future directions. Front Plant Sci 6:41 1155

Wohlrab H, Annese V, Haefele A (2002) Single replacement constructs of all hydroxyl, 1156

basic, and acidic amino acids identify new function and structure-sensitive regions of 1157

the mitochondrial phosphate transport protein. Biochemistry 41(9): 3254-3261 1158

Xu G, Ma H, Nei M, Kong H (2009) Evolution of F-box genes in plants: different modes 1159

of sequence divergence and their relationships with functional diversification. Proc 1160

Natl Acad Sci USA 106(3): 835-840 1161

Zhang Y (2008) I-TASSER server for protein 3D structure prediction. BMC 1162

Bioinformatics 9:40 1163

Zhang Y, Xue Y (2008) Molecular Biology of S-RNase-Based Self-Incompatibility. Self-1164

Incompatibility in Flowering Plants: Evolution, Diversity, and Mechanisms. Springer-1165

Verlag Berlin Heidelberg 1166



Parsed CitationsAl-Nasser I, Crompton M (1986) The entrapment of the Ca2+ indicator arsenazo III in the matrix space of rat liver mitochondria bypermeabilization and resealing. Na+-dependent and -independent effluxes of Ca2+ in arsenazo III-loaded mitochondria. Biochem J239(1): 31-40

Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Anderson MA, Cornish EC, Mav SL, Williams EG, Hoggart R, Atkinson A, Boning I, Greg B, Simpson RJ, Roche PJ, Haley JD, PenschowJD, Niall HD, Tregear GW, Cohhlan JP, Crawford RJ, Clarke AE (1986) Cloning of cDNA for a stylar glycoprotein associated withexpression of self-incompatibility in Nicotiana alata. Nature 321(6065): 38-44


Arpagaus S, Rawyler A, Braendle R (2002) Occurrence and characteristics of the mitochondrial permeability transition in plants. J BioChem 277(3): 1780-1787


Ashkani J, Rees DJ (2016) A Comprehensive Study of Molecular Evolution at the Self-Incompatibility Locus of Rosaceae. J Mol Evol82(2-3): 128-145


Balk J, Leaver CJ, McCabe PF (1999) Translocation of cytochrome c from the mitochondria to the cytosol occurs during heat-inducedprogrammed cell death in cucumber plants. FEBS Lett 463(1-2): 151-154


Bàthori G, Parolini I, Tombola F, Szabò I, Messina A, Oliva M, De Pinto V, Lisanti M, Sargiacomo M, Zoratti M (1999) Porin is present inthe plasma membrane where it is concentrated in caveolae and caveolae-related domains. J Biol Chem 274(42): 29607-29612


Bedhomme M, Hoffmann M, McCarthy EA, Gambonnet B, Moran RG, Rébeillé F, Ravanel S (2005) Folate metabolism in plants: anArabidopsis homolog of the mammalian mitochondrial folate transporter mediates folate import into chloroplasts. J Biol Chem 280(41):34823-34831


Beecher B, McClure BA (2001) Expressing self-incompatibility RNases (S-RNases) in transgenic plants. Methods Mol Biol 160: 65-85Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Beers EP (1997) Programmed cell death during plant growth and development. Cell Death Differ 4(8): 649-661Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Bhosale G, Sharpe JA, Sundier SY, Duchen MR (2015) Calcium signaling as a mediator of cell energy demand and a trigger to celldeath. Ann N Y Acad Sci 1350: 107-116


Briggs C, Mincone L, Wohlrab H (1999) Replacements of basic and hydroxyl amino acids identify structurally and functionally sensitiveregions of the mitochondrial phosphate transport protein. Biochemistry 38(16): 5096-5102


Busot GY, McClure B, Ibarra-Sánchez CP, Jiménez-Durán K, Vázquez-Santana S, Cruz-García F (2008) Pollination in Nicotiana alatastimulates synthesis and transfer to the stigmatic surface of NaStEP, a vacuolar Kunitz proteinase inhibitor homologue. J Exp Bot59(11): 3187-3201

Pubmed: Author and TitleCrossRef: Author and Title www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from

Copyright © 2017 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=Al%2DNasser I%2C Crompton M %281986%29 The entrapment of the Ca2%2B indicator arsenazo III in the matrix space of rat liver mitochondria by permeabilization and resealing%2E Na%2B%2Ddependent and %2Dindependent effluxes of Ca2%2B in arsenazo III%2Dloaded mitochondria%2E Biochem J 239%281%29%3A 31%2D40&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Al-Nasser I, Crompton M (1986) The entrapment of the Ca2+ indicator arsenazo III in the matrix space of rat liver mitochondria by permeabilization and resealing. Na+-dependent and -independent effluxes of Ca2+ in arsenazo III-loaded mitochondria. Biochem J 239(1): 31-40

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Al-Nasser&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The entrapment of the Ca2+ indicator arsenazo III in the matrix space of rat liver mitochondria by permeabilization and resealing&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The entrapment of the Ca2+ indicator arsenazo III in the matrix space of rat liver mitochondria by permeabilization and resealing&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Al-Nasser&as_ylo=1986&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Anderson MA%2C Cornish EC%2C Mav SL%2C Williams EG%2C Hoggart R%2C Atkinson A%2C Boning I%2C Greg B%2C Simpson RJ%2C Roche PJ%2C Haley JD%2C Penschow JD%2C Niall HD%2C Tregear GW%2C Cohhlan JP%2C Crawford RJ%2C Clarke AE %281986%29 Cloning of cDNA for a stylar glycoprotein associated with expression of self%2Dincompatibility in Nicotiana alata%2E Nature 321%286065%29%3A 38%2D44&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Anderson MA, Cornish EC, Mav SL, Williams EG, Hoggart R, Atkinson A, Boning I, Greg B, Simpson RJ, Roche PJ, Haley JD, Penschow JD, Niall HD, Tregear GW, Cohhlan JP, Crawford RJ, Clarke AE (1986) Cloning of cDNA for a stylar glycoprotein associated with expression of self-incompatibility in Nicotiana alata. Nature 321(6065): 38-44

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Anderson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Cloning of cDNA for a stylar glycoprotein associated with expression of self-incompatibility in Nicotiana alata&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Cloning of cDNA for a stylar glycoprotein associated with expression of self-incompatibility in Nicotiana alata&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Anderson&as_ylo=1986&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Arpagaus S%2C Rawyler A%2C Braendle R %282002%29 Occurrence and characteristics of the mitochondrial permeability transition in plants%2E J Bio Chem 277%283%29%3A 1780%2D1787&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Arpagaus S, Rawyler A, Braendle R (2002) Occurrence and characteristics of the mitochondrial permeability transition in plants. J Bio Chem 277(3): 1780-1787

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Arpagaus&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Occurrence and characteristics of the mitochondrial permeability transition in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Occurrence and characteristics of the mitochondrial permeability transition in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Arpagaus&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Ashkani J%2C Rees DJ %282016%29 A Comprehensive Study of Molecular Evolution at the Self%2DIncompatibility Locus of Rosaceae%2E J Mol Evol 82%282%2D3%29%3A 128%2D145&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ashkani J, Rees DJ (2016) A Comprehensive Study of Molecular Evolution at the Self-Incompatibility Locus of Rosaceae. J Mol Evol 82(2-3): 128-145

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ashkani&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ashkani&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Balk J%2C Leaver CJ%2C McCabe PF %281999%29 Translocation of cytochrome c from the mitochondria to the cytosol occurs during heat%2Dinduced programmed cell death in cucumber plants%2E FEBS Lett 463%281%2D2%29%3A 151%2D154&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Balk J, Leaver CJ, McCabe PF (1999) Translocation of cytochrome c from the mitochondria to the cytosol occurs during heat-induced programmed cell death in cucumber plants. FEBS Lett 463(1-2): 151-154

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Balk&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Balk&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=B�thori G%2C Parolini I%2C Tombola F%2C Szab� I%2C Messina A%2C Oliva M%2C De Pinto V%2C Lisanti M%2C Sargiacomo M%2C Zoratti M %281999%29 Porin is present in the plasma membrane where it is concentrated in caveolae and caveolae%2Drelated domains%2E J Biol Chem 274%2842%29%3A 29607%2D29612&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=B�thori G, Parolini I, Tombola F, Szab� I, Messina A, Oliva M, De Pinto V, Lisanti M, Sargiacomo M, Zoratti M (1999) Porin is present in the plasma membrane where it is concentrated in caveolae and caveolae-related domains. J Biol Chem 274(42): 29607-29612

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=B�thori&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Porin is present in the plasma membrane where it is concentrated in caveolae and caveolae-related domains&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Porin is present in the plasma membrane where it is concentrated in caveolae and caveolae-related domains&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=B�thori&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Bedhomme M%2C Hoffmann M%2C McCarthy EA%2C Gambonnet B%2C Moran RG%2C R�beill� F%2C Ravanel S %282005%29 Folate metabolism in plants%3A an Arabidopsis homolog of the mammalian mitochondrial folate transporter mediates folate import into chloroplasts%2E J Biol Chem 280%2841%29%3A 34823%2D34831&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bedhomme M, Hoffmann M, McCarthy EA, Gambonnet B, Moran RG, R�beill� F, Ravanel S (2005) Folate metabolism in plants: an Arabidopsis homolog of the mammalian mitochondrial folate transporter mediates folate import into chloroplasts. J Biol Chem 280(41): 34823-34831

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bedhomme&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Folate metabolism in plants: an Arabidopsis homolog of the mammalian mitochondrial folate transporter mediates folate import into chloroplasts&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Folate metabolism in plants: an Arabidopsis homolog of the mammalian mitochondrial folate transporter mediates folate import into chloroplasts&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bedhomme&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Beecher B%2C McClure BA %282001%29 Expressing self%2Dincompatibility RNases %28S%2DRNases%29 in transgenic plants%2E Methods Mol Biol 160%3A 65%2D85&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Beecher B, McClure BA (2001) Expressing self-incompatibility RNases (S-RNases) in transgenic plants. Methods Mol Biol 160: 65-85

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Beecher&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Expressing self-incompatibility RNases (S-RNases) in transgenic plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Expressing self-incompatibility RNases (S-RNases) in transgenic plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Beecher&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Beers EP %281997%29 Programmed cell death during plant growth and development%2E Cell Death Differ 4%288%29%3A 649%2D661&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Beers EP (1997) Programmed cell death during plant growth and development. Cell Death Differ 4(8): 649-661

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Beers&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Programmed cell death during plant growth and development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Programmed cell death during plant growth and development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Beers&as_ylo=1997&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Bhosale G%2C Sharpe JA%2C Sundier SY%2C Duchen MR %282015%29 Calcium signaling as a mediator of cell energy demand and a trigger to cell death%2E Ann N Y Acad Sci 1350%3A 107%2D116&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Bhosale G, Sharpe JA, Sundier SY, Duchen MR (2015) Calcium signaling as a mediator of cell energy demand and a trigger to cell death. Ann N Y Acad Sci 1350: 107-116

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bhosale&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Calcium signaling as a mediator of cell energy demand and a trigger to cell death&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Calcium signaling as a mediator of cell energy demand and a trigger to cell death&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bhosale&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Briggs C%2C Mincone L%2C Wohlrab H %281999%29 Replacements of basic and hydroxyl amino acids identify structurally and functionally sensitive regions of the mitochondrial phosphate transport protein%2E Biochemistry 38%2816%29%3A 5096%2D5102&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Briggs C, Mincone L, Wohlrab H (1999) Replacements of basic and hydroxyl amino acids identify structurally and functionally sensitive regions of the mitochondrial phosphate transport protein. Biochemistry 38(16): 5096-5102

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Briggs&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Replacements of basic and hydroxyl amino acids identify structurally and functionally sensitive regions of the mitochondrial phosphate transport protein&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Replacements of basic and hydroxyl amino acids identify structurally and functionally sensitive regions of the mitochondrial phosphate transport protein&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Briggs&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Busot GY%2C McClure B%2C Ibarra%2DS�nchez CP%2C Jim�nez%2DDur�n K%2C V�zquez%2DSantana S%2C Cruz%2DGarc�a F %282008%29 Pollination in Nicotiana alata stimulates synthesis and transfer to the stigmatic surface of NaStEP%2C a vacuolar Kunitz proteinase inhibitor homologue%2E J Exp Bot 59%2811%29%3A 3187%2D3201&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Busot GY, McClure B, Ibarra-S�nchez CP, Jim�nez-Dur�n K, V�zquez-Santana S, Cruz-Garc�a F (2008) Pollination in Nicotiana alata stimulates synthesis and transfer to the stigmatic surface of NaStEP, a vacuolar Kunitz proteinase inhibitor homologue. J Exp Bot 59(11): 3187-3201


Google Scholar: Author Only Title Only Author and Title

Campanoni P, Sutter JU, Davis CS, Littlejohn GR, Blatt MR (2007) A generalized method for transfecting root epidermis uncoversendosomal dynamics in Arabidopsis root hair. Plant J 51: 322-330


Chen CY, Wong EI, Vidali L, Estavillo A, Hepler PK, Wu HM, Cheung AY (2002) The regulation of actin organization by actin-depolimerizing factor in elongating pollen tubes. Plant Cell 14(9): 2175-2190


Cheung AY, Wu HM (2008) Structural and signaling networks for the polar cell growth machinery in pollen tubes. Annu. Rev. Plant Biol.59: 547-72


Cheung AY, Chen CY, Glaven RH, de Graaf BH, Vidali L, Hepler PK, Wu HM (2002) Rab2 GTPase regulates vesicle trafficking betweenthe endoplasmic reticulum and the Golgi bodies and is important to pollen tube growth. Plant Cell 14(4): 945-962


Covey PA, Kondo K, Welch L, Frank E, Sianta S, Kumar A, Nuñez R, Lopez-Casado G, van der Knaap E, Rose JK, McClure BA,Bedinger PA (2010) Multiple features that distinguish unilateral incongruity and self-incompatibility in the tomato clade. Plant J 64(3):367-378


Crompton M, Costi A (1988) Kinetic evidence for a heart mitochondrial pore activated by Ca+2, inorganic phosphate and oxidativestress. A potential mechanism for mitochondrial dysfunction during cellular Ca+2 overload. Eur J Biochem 178(2): 489-501


Crompton M, Costi A, Hayat L (1987) Evidence for the presence of a reversible Ca+2- dependent pore activated by oxidative stress inheart mitochondria. Biochem J 245(3): 915-918


Cruz-García F, Hancock CN, Kim D, McClure B (2005) Stylar glycoproteins bind to S-RNase in vitro. Plant J 42(3): 295-304Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

de Nettancourt D (2001) Incompatibility and Incongruity in Wild and Cultivated Plants. Springer-Verlag, New YorkPubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Doran E, Halestrap AP (2000) Cytochrome c release from isolated rat liver mitochondria can occur independently of outer-membranerupture: possible role of contact sites. Biochem J 348:343-350?


Entani T, Iwano M, Shiba H, Che FS, Isogai A, Takayama S (2003) Comparative analysis of the self-incompatibility S-locus region ofPrunus mume: identification of a pollen-expressed F-box gene with allelic diversity. Genes Cells 8(3): 203-213


Eswar N, Webb B, Marti-Renom MA, Madhusudhan MS, Eramian D, Shen M, Pieper U, Sali A (2007) Comparative protein structuremodeling using MODELLER. Curr Protoc Protein Sci Chapter 2:Unit 2.9


Fields S, Song O (1989) A novel genetic system to detect protein-protein interactions. Nature 340(6230): 245-246Pubmed: Author and TitleCrossRef: Author and Title www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from


http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Busot&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Pollination in Nicotiana alata stimulates synthesis and transfer to the stigmatic surface of NaStEP, a vacuolar Kunitz proteinase inhibitor homologue&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Pollination in Nicotiana alata stimulates synthesis and transfer to the stigmatic surface of NaStEP, a vacuolar Kunitz proteinase inhibitor homologue&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Busot&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Campanoni P%2C Sutter JU%2C Davis CS%2C Littlejohn GR%2C Blatt MR %282007%29 A generalized method for transfecting root epidermis uncovers endosomal dynamics in Arabidopsis root hair%2E Plant J 51%3A 322%2D330&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Campanoni P, Sutter JU, Davis CS, Littlejohn GR, Blatt MR (2007) A generalized method for transfecting root epidermis uncovers endosomal dynamics in Arabidopsis root hair. Plant J 51: 322-330

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Campanoni&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A generalized method for transfecting root epidermis uncovers endosomal dynamics in Arabidopsis root hair&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A generalized method for transfecting root epidermis uncovers endosomal dynamics in Arabidopsis root hair&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Campanoni&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Chen CY%2C Wong EI%2C Vidali L%2C Estavillo A%2C Hepler PK%2C Wu HM%2C Cheung AY %282002%29 The regulation of actin organization by actin%2Ddepolimerizing factor in elongating pollen tubes%2E Plant Cell 14%289%29%3A 2175%2D2190&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Chen CY, Wong EI, Vidali L, Estavillo A, Hepler PK, Wu HM, Cheung AY (2002) The regulation of actin organization by actin-depolimerizing factor in elongating pollen tubes. Plant Cell 14(9): 2175-2190

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The regulation of actin organization by actin-depolimerizing factor in elongating pollen tubes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The regulation of actin organization by actin-depolimerizing factor in elongating pollen tubes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chen&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Cheung AY%2C Wu HM %282008%29 Structural and signaling networks for the polar cell growth machinery in pollen tubes%2E Annu%2E Rev%2E Plant Biol%2E 59%3A 547%2D72&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Cheung AY, Wu HM (2008) Structural and signaling networks for the polar cell growth machinery in pollen tubes. Annu. Rev. Plant Biol. 59: 547-72

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cheung&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Structural and signaling networks for the polar cell growth machinery in pollen tubes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Structural and signaling networks for the polar cell growth machinery in pollen tubes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cheung&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Cheung AY%2C Chen CY%2C Glaven RH%2C de Graaf BH%2C Vidali L%2C Hepler PK%2C Wu HM %282002%29 Rab2 GTPase regulates vesicle trafficking between the endoplasmic reticulum and the Golgi bodies and is important to pollen tube growth%2E Plant Cell 14%284%29%3A 945%2D962&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Cheung AY, Chen CY, Glaven RH, de Graaf BH, Vidali L, Hepler PK, Wu HM (2002) Rab2 GTPase regulates vesicle trafficking between the endoplasmic reticulum and the Golgi bodies and is important to pollen tube growth. Plant Cell 14(4): 945-962

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cheung&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Rab2 GTPase regulates vesicle trafficking between the endoplasmic reticulum and the Golgi bodies and is important to pollen tube growth&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Rab2 GTPase regulates vesicle trafficking between the endoplasmic reticulum and the Golgi bodies and is important to pollen tube growth&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cheung&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Covey PA%2C Kondo K%2C Welch L%2C Frank E%2C Sianta S%2C Kumar A%2C Nu�ez R%2C Lopez%2DCasado G%2C van der Knaap E%2C Rose JK%2C McClure BA%2C Bedinger PA %282010%29 Multiple features that distinguish unilateral incongruity and self%2Dincompatibility in the tomato clade%2E Plant J 64%283%29%3A 367%2D378&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Covey PA, Kondo K, Welch L, Frank E, Sianta S, Kumar A, Nu�ez R, Lopez-Casado G, van der Knaap E, Rose JK, McClure BA, Bedinger PA (2010) Multiple features that distinguish unilateral incongruity and self-incompatibility in the tomato clade. Plant J 64(3): 367-378

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Covey&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Multiple features that distinguish unilateral incongruity and self-incompatibility in the tomato clade&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Multiple features that distinguish unilateral incongruity and self-incompatibility in the tomato clade&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Covey&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Crompton M%2C Costi A %281988%29 Kinetic evidence for a heart mitochondrial pore activated by Ca%2B2%2C inorganic phosphate and oxidative stress%2E A potential mechanism for mitochondrial dysfunction during cellular Ca%2B2 overload%2E Eur J Biochem 178%282%29%3A 489%2D501&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Crompton M, Costi A (1988) Kinetic evidence for a heart mitochondrial pore activated by Ca+2, inorganic phosphate and oxidative stress. A potential mechanism for mitochondrial dysfunction during cellular Ca+2 overload. Eur J Biochem 178(2): 489-501

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Crompton&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Crompton&as_ylo=1988&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Crompton M%2C Costi A%2C Hayat L %281987%29 Evidence for the presence of a reversible Ca%2B2%2D dependent pore activated by oxidative stress in heart mitochondria%2E Biochem J 245%283%29%3A 915%2D918&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Crompton M, Costi A, Hayat L (1987) Evidence for the presence of a reversible Ca+2- dependent pore activated by oxidative stress in heart mitochondria. Biochem J 245(3): 915-918

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Crompton&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Evidence for the presence of a reversible Ca+2- dependent pore activated by oxidative stress in heart mitochondria&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Evidence for the presence of a reversible Ca+2- dependent pore activated by oxidative stress in heart mitochondria&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Crompton&as_ylo=1987&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Cruz%2DGarc�a F%2C Hancock CN%2C Kim D%2C McClure B %282005%29 Stylar glycoproteins bind to S%2DRNase in vitro%2E Plant J 42%283%29%3A 295%2D304&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Cruz-Garc�a F, Hancock CN, Kim D, McClure B (2005) Stylar glycoproteins bind to S-RNase in vitro. Plant J 42(3): 295-304

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cruz-Garc�a&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Stylar glycoproteins bind to S-RNase in vitro&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Stylar glycoproteins bind to S-RNase in vitro&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cruz-Garc�a&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=de Nettancourt D %282001%29 Incompatibility and Incongruity in Wild and Cultivated Plants%2E Springer%2DVerlag%2C New York&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=de Nettancourt D (2001) Incompatibility and Incongruity in Wild and Cultivated Plants. Springer-Verlag, New York

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=de&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Incompatibility and Incongruity in Wild and Cultivated Plants.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Incompatibility and Incongruity in Wild and Cultivated Plants.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=de&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Doran E%2C Halestrap AP %282000%29 Cytochrome c release from isolated rat liver mitochondria can occur independently of outer%2Dmembrane rupture%3A possible role of contact sites%2E Biochem J 348%3A343%2D350%3F&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Doran E, Halestrap AP (2000) Cytochrome c release from isolated rat liver mitochondria can occur independently of outer-membrane rupture: possible role of contact sites. Biochem J 348:343-350?

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Doran&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Cytochrome c release from isolated rat liver mitochondria can occur independently of outer-membrane rupture: possible role of contact sites&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Cytochrome c release from isolated rat liver mitochondria can occur independently of outer-membrane rupture: possible role of contact sites&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Doran&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Entani T%2C Iwano M%2C Shiba H%2C Che FS%2C Isogai A%2C Takayama S %282003%29 Comparative analysis of the self%2Dincompatibility S%2Dlocus region of Prunus mume%3A identification of a pollen%2Dexpressed F%2Dbox gene with allelic diversity%2E Genes Cells 8%283%29%3A 203%2D213&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Entani T, Iwano M, Shiba H, Che FS, Isogai A, Takayama S (2003) Comparative analysis of the self-incompatibility S-locus region of Prunus mume: identification of a pollen-expressed F-box gene with allelic diversity. Genes Cells 8(3): 203-213

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Entani&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Comparative analysis of the self-incompatibility S-locus region of Prunus mume: identification of a pollen-expressed F-box gene with allelic diversity&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Comparative analysis of the self-incompatibility S-locus region of Prunus mume: identification of a pollen-expressed F-box gene with allelic diversity&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Entani&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Eswar N%2C Webb B%2C Marti%2DRenom MA%2C Madhusudhan MS%2C Eramian D%2C Shen M%2C Pieper U%2C Sali A %282007%29 Comparative protein structure modeling using MODELLER%2E Curr Protoc Protein Sci Chapter 2%3AUnit 2%2E9&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Eswar N, Webb B, Marti-Renom MA, Madhusudhan MS, Eramian D, Shen M, Pieper U, Sali A (2007) Comparative protein structure modeling using MODELLER. Curr Protoc Protein Sci Chapter 2:Unit 2.9

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Eswar&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Comparative protein structure modeling using MODELLER&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Comparative protein structure modeling using MODELLER&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Eswar&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Fields S%2C Song O %281989%29 A novel genetic system to detect protein%2Dprotein interactions%2E Nature 340%286230%29%3A 245%2D246&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Fields S, Song O (1989) A novel genetic system to detect protein-protein interactions. Nature 340(6230): 245-246


Google Scholar: Author Only Title Only Author and Title

Fukao Y, Hayashi Y, Mano S, Hayashi M, Nishimura M (2001) Developmental analysis of a putative ATP/ADP carrier protein localized onglyoxysomal membranes during the peroxisome transition in pumpkin cotyledons. Plant Cell Physiol 42(8): 835-841


García-Fernández R, Peigneur S, Pons T, Alvarez C, González L, Chávez MA, Tytgat J (2016) The Kunitz-Type Protein ShPI-1 InhibitsSerine Proteases and Voltage-Gated Potassium Channels. Toxins (Basel) 8(4): 110


Goldraij A, Kondo K, Lee CB, Hancock CN, Sivaguru M, Vazquez-Santana S, Kim S, Phillips TE, Cruz-García F, McClure BA (2006)Compartmentalization of S-RNase and HT-B ?degradation in self-incompatible Nicotiana. Nature 439 (7078): 805-810


Grefen C, Donald N, Schumacher K, Blatt MR (2010) A Ubiquitin-10 promoter-based vector set for fluorescent protein taggingfacilitates temporal stability and native protein distribution in transient and stable expression studies. Plant J 64(2): 355-365


Gutiérrez-Aguilar M1, Pérez-Martínez X, Chávez E, Uribe-Carvajal S (2010) In Saccharomyces cerevisiae, the phosphate carrier is acomponent of the mitochondrial unselective channel. Arch Biochem Biophys 494(2): 184-191


Halestrap AP, Clarke SJ, Javadov SA (2004) Mitochondrial permeability transition pore opening during myocardial reperfusion-a targetfor cardioprotection. Cardiovasc Res 61(3): 372-385


Halestrap AP, Kerr PM, Javadov S, Woodfield KY (1998) Elucidating the molecular mechanism of the permeability transition pore andits role in reperfusion injury of the heart. Biochim Biophys Acta 1366(1-2): 79-94


Hamel P, Saint-Georges Y, de Pinto B, Lachacinski N, Altamura N, Dujardin G (2004) Redundancy in the function of mitochondrialphosphate transport in Saccharomyces cerevisiae and Arabidopsis thaliana. Mol Microbiol 51:307-317


Hancock CN, Kent L, McClure BA (2005) The stylar 120 kDa glycoprotein is required for S-specific pollen rejection in Nicotiana. Plant J43(5): 716-723


Harvey AL (2001) Twenty years of dendrotoxins. Toxicon 39(1): 15-26Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Haworth RA, Hunter DR (1979) The Ca+2-induced membrane transition in mitochondria: II. Nature of the Ca+2 trigger site. ArchBiochem and Biophys 195(2): 460-467


Hua Z, Kao TH (2008) Identification of major lysine residues of S(3)-RNase of Petunia inflata involved in ubiquitin-26S proteasome-mediated degradation in vitro. Plant J 54(6): 1094-1104


Hunter DR, Haworth RA (1979) The Ca2+-induced membrane transition in mitochondria. I. The protective mechanism. Arch BiochemBiophys 195(2): 453-459


http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fields&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A novel genetic system to detect protein-protein interactions&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A novel genetic system to detect protein-protein interactions&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fields&as_ylo=1989&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Fukao Y%2C Hayashi Y%2C Mano S%2C Hayashi M%2C Nishimura M %282001%29 Developmental analysis of a putative ATP%2FADP carrier protein localized on glyoxysomal membranes during the peroxisome transition in pumpkin cotyledons%2E Plant Cell Physiol 42%288%29%3A 835%2D841&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Fukao Y, Hayashi Y, Mano S, Hayashi M, Nishimura M (2001) Developmental analysis of a putative ATP/ADP carrier protein localized on glyoxysomal membranes during the peroxisome transition in pumpkin cotyledons. Plant Cell Physiol 42(8): 835-841

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fukao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Developmental analysis of a putative ATP/ADP carrier protein localized on glyoxysomal membranes during the peroxisome transition in pumpkin cotyledons&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Developmental analysis of a putative ATP/ADP carrier protein localized on glyoxysomal membranes during the peroxisome transition in pumpkin cotyledons&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fukao&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Garc�a%2DFern�ndez R%2C Peigneur S%2C Pons T%2C Alvarez C%2C Gonz�lez L%2C Ch�vez MA%2C Tytgat J %282016%29 The Kunitz%2DType Protein ShPI%2D1 Inhibits Serine Proteases and Voltage%2DGated Potassium Channels%2E Toxins %28Basel%29 8%284%29%3A 110&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Garc�a-Fern�ndez R, Peigneur S, Pons T, Alvarez C, Gonz�lez L, Ch�vez MA, Tytgat J (2016) The Kunitz-Type Protein ShPI-1 Inhibits Serine Proteases and Voltage-Gated Potassium Channels. Toxins (Basel) 8(4): 110

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Garc�a-Fern�ndez&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Kunitz-Type Protein ShPI-1 Inhibits Serine Proteases and Voltage-Gated Potassium Channels.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Kunitz-Type Protein ShPI-1 Inhibits Serine Proteases and Voltage-Gated Potassium Channels.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Garc�a-Fern�ndez&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Goldraij A%2C Kondo K%2C Lee CB%2C Hancock CN%2C Sivaguru M%2C Vazquez%2DSantana S%2C Kim S%2C Phillips TE%2C Cruz%2DGarc�a F%2C McClure BA %282006%29 Compartmentalization of S%2DRNase and HT%2DB %3Fdegradation in self%2Dincompatible Nicotiana%2E Nature 439 %287078%29%3A 805%2D810&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Goldraij A, Kondo K, Lee CB, Hancock CN, Sivaguru M, Vazquez-Santana S, Kim S, Phillips TE, Cruz-Garc�a F, McClure BA (2006) Compartmentalization of S-RNase and HT-B ?degradation in self-incompatible Nicotiana. Nature 439 (7078): 805-810

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Goldraij&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Goldraij&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Grefen C%2C Donald N%2C Schumacher K%2C Blatt MR %282010%29 A Ubiquitin%2D10 promoter%2Dbased vector set for fluorescent protein tagging facilitates temporal stability and native protein distribution in transient and stable expression studies%2E Plant J 64%282%29%3A 355%2D365&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Grefen C, Donald N, Schumacher K, Blatt MR (2010) A Ubiquitin-10 promoter-based vector set for fluorescent protein tagging facilitates temporal stability and native protein distribution in transient and stable expression studies. Plant J 64(2): 355-365

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Grefen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A Ubiquitin-10 promoter-based vector set for fluorescent protein tagging facilitates temporal stability and native protein distribution in transient and stable expression studies&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A Ubiquitin-10 promoter-based vector set for fluorescent protein tagging facilitates temporal stability and native protein distribution in transient and stable expression studies&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Grefen&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Guti�rrez%2DAguilar M1%2C P�rez%2DMart�nez X%2C Ch�vez E%2C Uribe%2DCarvajal S %282010%29 In Saccharomyces cerevisiae%2C the phosphate carrier is a component of the mitochondrial unselective channel%2E Arch Biochem Biophys 494%282%29%3A 184%2D191&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Guti�rrez-Aguilar M1, P�rez-Mart�nez X, Ch�vez E, Uribe-Carvajal S (2010) In Saccharomyces cerevisiae, the phosphate carrier is a component of the mitochondrial unselective channel. Arch Biochem Biophys 494(2): 184-191

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Guti�rrez-Aguilar&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=In Saccharomyces cerevisiae, the phosphate carrier is a component of the mitochondrial unselective channel&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=In Saccharomyces cerevisiae, the phosphate carrier is a component of the mitochondrial unselective channel&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Guti�rrez-Aguilar&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Halestrap AP%2C Clarke SJ%2C Javadov SA %282004%29 Mitochondrial permeability transition pore opening during myocardial reperfusion%2Da target for cardioprotection%2E Cardiovasc Res 61%283%29%3A 372%2D385&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Halestrap AP, Clarke SJ, Javadov SA (2004) Mitochondrial permeability transition pore opening during myocardial reperfusion-a target for cardioprotection. Cardiovasc Res 61(3): 372-385

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Halestrap&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Mitochondrial permeability transition pore opening during myocardial reperfusion-a target for cardioprotection&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Mitochondrial permeability transition pore opening during myocardial reperfusion-a target for cardioprotection&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Halestrap&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Halestrap AP%2C Kerr PM%2C Javadov S%2C Woodfield KY %281998%29 Elucidating the molecular mechanism of the permeability transition pore and its role in reperfusion injury of the heart%2E Biochim Biophys Acta 1366%281%2D2%29%3A 79%2D94&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Halestrap AP, Kerr PM, Javadov S, Woodfield KY (1998) Elucidating the molecular mechanism of the permeability transition pore and its role in reperfusion injury of the heart. Biochim Biophys Acta 1366(1-2): 79-94

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Halestrap&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Halestrap&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Hamel P%2C Saint%2DGeorges Y%2C de Pinto B%2C Lachacinski N%2C Altamura N%2C Dujardin G %282004%29 Redundancy in the function of mitochondrial phosphate transport in Saccharomyces cerevisiae and Arabidopsis thaliana%2E Mol Microbiol 51%3A307%2D317&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hamel P, Saint-Georges Y, de Pinto B, Lachacinski N, Altamura N, Dujardin G (2004) Redundancy in the function of mitochondrial phosphate transport in Saccharomyces cerevisiae and Arabidopsis thaliana. Mol Microbiol 51:307-317

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hamel&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Redundancy in the function of mitochondrial phosphate transport in Saccharomyces cerevisiae and Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Redundancy in the function of mitochondrial phosphate transport in Saccharomyces cerevisiae and Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hamel&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Hancock CN%2C Kent L%2C McClure BA %282005%29 The stylar 120 kDa glycoprotein is required for S%2Dspecific pollen rejection in Nicotiana%2E Plant J 43%285%29%3A 716%2D723&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hancock CN, Kent L, McClure BA (2005) The stylar 120 kDa glycoprotein is required for S-specific pollen rejection in Nicotiana. Plant J 43(5): 716-723

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hancock&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The stylar 120 kDa glycoprotein is required for S-specific pollen rejection in Nicotiana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The stylar 120 kDa glycoprotein is required for S-specific pollen rejection in Nicotiana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hancock&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Harvey AL %282001%29 Twenty years of dendrotoxins%2E Toxicon 39%281%29%3A 15%2D26&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Harvey AL (2001) Twenty years of dendrotoxins. Toxicon 39(1): 15-26

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Harvey&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Twenty years of dendrotoxins&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Twenty years of dendrotoxins&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Harvey&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Haworth RA%2C Hunter DR %281979%29 The Ca%2B2%2Dinduced membrane transition in mitochondria%3A II%2E Nature of the Ca%2B2 trigger site%2E Arch Biochem and Biophys 195%282%29%3A 460%2D467&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Haworth RA, Hunter DR (1979) The Ca+2-induced membrane transition in mitochondria: II. Nature of the Ca+2 trigger site. Arch Biochem and Biophys 195(2): 460-467

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Haworth&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Ca+2-induced membrane transition in mitochondria: II&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Ca+2-induced membrane transition in mitochondria: II&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Haworth&as_ylo=1979&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Hua Z%2C Kao TH %282008%29 Identification of major lysine residues of S%283%29%2DRNase of Petunia inflata involved in ubiquitin%2D26S proteasome%2Dmediated degradation in vitro%2E Plant J 54%286%29%3A 1094%2D1104&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hua Z, Kao TH (2008) Identification of major lysine residues of S(3)-RNase of Petunia inflata involved in ubiquitin-26S proteasome-mediated degradation in vitro. Plant J 54(6): 1094-1104

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hua&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Identification of major lysine residues of S(3)-RNase of Petunia inflata involved in ubiquitin-26S proteasome-mediated degradation in vitro&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Identification of major lysine residues of S(3)-RNase of Petunia inflata involved in ubiquitin-26S proteasome-mediated degradation in vitro&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hua&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1



Jiménez-Durán K, McClure B, García-Campusano F, Rodríguez-Sotres R, Cisneros J, Busot G, Cruz-García F (2013) NaStEP: aproteinase inhibitor essential to self-incompatibility and positive regulator of the HT-B stability in Nicotiana alata pollen tubes. PlantPhysiol 161(1): 97-107


Karplus K, Barrett C, Hughey R (1998) Hidden Markov models for detecting remote protein homologies. Bioinformatics 14(10): 846-856Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Karplus K (2009) SAM-T08, HMM-based protein structure prediction. Nucleic Acids Res 37(Web Server issue): W492-7Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Kho YO, Baer J (1968) Observing pollen tubes by means of fluorescence. Euphytica 17: 298-302Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Kondo K, McClure B (2008) New microsome-associated HT-B family proteins from Nicotiana respond to pollination and define anHT/NOD-24 protein family. Mol Plant 1(4): 634-644


Kondo K, Yamamoto M, Matton DP, Sato T, Hirai M, Norioka S, Hattori T, Kowyama Y (2002) Cultivated tomato has defects in both S-RNase and HT genes required for stylar function of self-incompatibility. Plant J 29(5): 627-636


Kubo K, Entani T, Takara A, Wang N, Field AM, Hua Z, Toyoda M, Kawashima S, Ando T, Isogai A, Kao TH, Takayama S (2010)Collaborative non-self recognition system in S-RNase-based self-incompatibility. Science 330(6005): 796-799


Kushnareva YE, Haley LM, Sokolove PM (1999) The role of low (< or = 1mM) phosphate concentrations in regulation of mitochondrialpermeability: modulation of matrix free Ca+2 concentration. Arch Biochem Biophys 363(1): 155-162


Lai Z, Ma W, Han B, Liang L, Zhang Y, Hong G, Xue Y (2002) An F-box gene linked to the self-incompatibility (S) locus of Antirrhinum isexpressed specifically in pollen and tapetum. Plant Mol Biol 50(1); 29-42


Lam E, del Pozo O (2000) Caspase-like protease involvement in the control of plant cell death. Plant Mol Biol 44(3): 417-428Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lancelin JM, Foray MF, Poncin M, Hollecker M, Marion D (1994) Proteinase inhibitor homologues as potassium channel blockers. NatStruct Biol 1(4): 246-250


Lee CB, Kim S, McClure B (2009) A pollen protein, NaPCCP, that binds pistil arabinogalactan proteins also binds phosphatidylinositol3-phosphate and associates with the pollen tube endomembrane systems. Plant Physiol 149(2): 791-802


Lee CB, Swatek KN, McClure B (2008) Pollen proteins bind to the C-terminal domain of Nicotiana alata pistil arabinogalactan proteins.J Biol Chem 283(40): 26965-26973

Pubmed: Author and Title www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=Hunter DR%2C Haworth RA %281979%29 The Ca2%2B%2Dinduced membrane transition in mitochondria%2E I%2E The protective mechanism%2E Arch Biochem Biophys 195%282%29%3A 453%2D459&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Hunter DR, Haworth RA (1979) The Ca2+-induced membrane transition in mitochondria. I. The protective mechanism. Arch Biochem Biophys 195(2): 453-459

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hunter&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The Ca2+-induced membrane transition in mitochondria&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The Ca2+-induced membrane transition in mitochondria&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hunter&as_ylo=1979&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Jim�nez%2DDur�n K%2C McClure B%2C Garc�a%2DCampusano F%2C Rodr�guez%2DSotres R%2C Cisneros J%2C Busot G%2C Cruz%2DGarc�a F %282013%29 NaStEP%3A a proteinase inhibitor essential to self%2Dincompatibility and positive regulator of the HT%2DB stability in Nicotiana alata pollen tubes%2E Plant Physiol 161%281%29%3A 97%2D107&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Jim�nez-Dur�n K, McClure B, Garc�a-Campusano F, Rodr�guez-Sotres R, Cisneros J, Busot G, Cruz-Garc�a F (2013) NaStEP: a proteinase inhibitor essential to self-incompatibility and positive regulator of the HT-B stability in Nicotiana alata pollen tubes. Plant Physiol 161(1): 97-107

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Jim�nez-Dur�n&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=NaStEP: a proteinase inhibitor essential to self-incompatibility and positive regulator of the HT-B stability in Nicotiana alata pollen tubes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=NaStEP: a proteinase inhibitor essential to self-incompatibility and positive regulator of the HT-B stability in Nicotiana alata pollen tubes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Jim�nez-Dur�n&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Karplus K%2C Barrett C%2C Hughey R %281998%29 Hidden Markov models for detecting remote protein homologies%2E Bioinformatics 14%2810%29%3A 846%2D856&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Karplus K, Barrett C, Hughey R (1998) Hidden Markov models for detecting remote protein homologies. Bioinformatics 14(10): 846-856

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Karplus&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Hidden Markov models for detecting remote protein homologies&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Hidden Markov models for detecting remote protein homologies&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Karplus&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Karplus K %282009%29 SAM%2DT08%2C HMM%2Dbased protein structure prediction%2E Nucleic Acids Res 37%28Web Server issue%29%3A W492%2D7&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Karplus K (2009) SAM-T08, HMM-based protein structure prediction. Nucleic Acids Res 37(Web Server issue): W492-7

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Karplus&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Karplus&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kho YO%2C Baer J %281968%29 Observing pollen tubes by means of fluorescence%2E Euphytica 17%3A 298%2D302&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kho YO, Baer J (1968) Observing pollen tubes by means of fluorescence. Euphytica 17: 298-302

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kho&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Observing pollen tubes by means of fluorescence&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Observing pollen tubes by means of fluorescence&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kho&as_ylo=1968&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kondo K%2C McClure B %282008%29 New microsome%2Dassociated HT%2DB family proteins from Nicotiana respond to pollination and define an HT%2FNOD%2D24 protein family%2E Mol Plant 1%284%29%3A 634%2D644&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kondo K, McClure B (2008) New microsome-associated HT-B family proteins from Nicotiana respond to pollination and define an HT/NOD-24 protein family. Mol Plant 1(4): 634-644

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kondo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=New microsome-associated HT-B family proteins from Nicotiana respond to pollination and define an HT/NOD-24 protein family&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=New microsome-associated HT-B family proteins from Nicotiana respond to pollination and define an HT/NOD-24 protein family&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kondo&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kondo K%2C Yamamoto M%2C Matton DP%2C Sato T%2C Hirai M%2C Norioka S%2C Hattori T%2C Kowyama Y %282002%29 Cultivated tomato has defects in both S%2DRNase and HT genes required for stylar function of self%2Dincompatibility%2E Plant J 29%285%29%3A 627%2D636&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kondo K, Yamamoto M, Matton DP, Sato T, Hirai M, Norioka S, Hattori T, Kowyama Y (2002) Cultivated tomato has defects in both S-RNase and HT genes required for stylar function of self-incompatibility. Plant J 29(5): 627-636

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kondo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Cultivated tomato has defects in both S-RNase and HT genes required for stylar function of self-incompatibility&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Cultivated tomato has defects in both S-RNase and HT genes required for stylar function of self-incompatibility&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kondo&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kubo K%2C Entani T%2C Takara A%2C Wang N%2C Field AM%2C Hua Z%2C Toyoda M%2C Kawashima S%2C Ando T%2C Isogai A%2C Kao TH%2C Takayama S %282010%29 Collaborative non%2Dself recognition system in S%2DRNase%2Dbased self%2Dincompatibility%2E Science 330%286005%29%3A 796%2D799&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kubo K, Entani T, Takara A, Wang N, Field AM, Hua Z, Toyoda M, Kawashima S, Ando T, Isogai A, Kao TH, Takayama S (2010) Collaborative non-self recognition system in S-RNase-based self-incompatibility. Science 330(6005): 796-799

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kubo&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Collaborative non-self recognition system in S-RNase-based self-incompatibility&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Collaborative non-self recognition system in S-RNase-based self-incompatibility&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kubo&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kushnareva YE%2C Haley LM%2C Sokolove PM %281999%29 The role of low %28%3C or %3D 1mM%29 phosphate concentrations in regulation of mitochondrial permeability%3A modulation of matrix free Ca%2B2 concentration%2E Arch Biochem Biophys 363%281%29%3A 155%2D162&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Kushnareva YE, Haley LM, Sokolove PM (1999) The role of low (< or = 1mM) phosphate concentrations in regulation of mitochondrial permeability: modulation of matrix free Ca+2 concentration. Arch Biochem Biophys 363(1): 155-162

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kushnareva&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The role of low (< or = 1mM) phosphate concentrations in regulation of mitochondrial permeability: modulation of matrix free Ca+2 concentration&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The role of low (< or = 1mM) phosphate concentrations in regulation of mitochondrial permeability: modulation of matrix free Ca+2 concentration&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kushnareva&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lai Z%2C Ma W%2C Han B%2C Liang L%2C Zhang Y%2C Hong G%2C Xue Y %282002%29 An F%2Dbox gene linked to the self%2Dincompatibility %28S%29 locus of Antirrhinum is expressed specifically in pollen and tapetum%2E Plant Mol Biol 50%281%29%3B 29%2D42&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lai Z, Ma W, Han B, Liang L, Zhang Y, Hong G, Xue Y (2002) An F-box gene linked to the self-incompatibility (S) locus of Antirrhinum is expressed specifically in pollen and tapetum. Plant Mol Biol 50(1); 29-42

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lai&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=An F-box gene linked to the self-incompatibility (S) locus of Antirrhinum is expressed specifically in pollen and tapetum&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=An F-box gene linked to the self-incompatibility (S) locus of Antirrhinum is expressed specifically in pollen and tapetum&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lai&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lam E%2C del Pozo O %282000%29 Caspase%2Dlike protease involvement in the control of plant cell death%2E Plant Mol Biol 44%283%29%3A 417%2D428&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lam E, del Pozo O (2000) Caspase-like protease involvement in the control of plant cell death. Plant Mol Biol 44(3): 417-428

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lam&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Caspase-like protease involvement in the control of plant cell death&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Caspase-like protease involvement in the control of plant cell death&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lam&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lancelin JM%2C Foray MF%2C Poncin M%2C Hollecker M%2C Marion D %281994%29 Proteinase inhibitor homologues as potassium channel blockers%2E Nat Struct Biol 1%284%29%3A 246%2D250&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lancelin JM, Foray MF, Poncin M, Hollecker M, Marion D (1994) Proteinase inhibitor homologues as potassium channel blockers. Nat Struct Biol 1(4): 246-250

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lancelin&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Proteinase inhibitor homologues as potassium channel blockers&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Proteinase inhibitor homologues as potassium channel blockers&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lancelin&as_ylo=1994&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lee CB%2C Kim S%2C McClure B %282009%29 A pollen protein%2C NaPCCP%2C that binds pistil arabinogalactan proteins also binds phosphatidylinositol 3%2Dphosphate and associates with the pollen tube endomembrane systems%2E Plant Physiol 149%282%29%3A 791%2D802&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lee CB, Kim S, McClure B (2009) A pollen protein, NaPCCP, that binds pistil arabinogalactan proteins also binds phosphatidylinositol 3-phosphate and associates with the pollen tube endomembrane systems. Plant Physiol 149(2): 791-802

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lee&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A pollen protein, NaPCCP, that binds pistil arabinogalactan proteins also binds phosphatidylinositol 3-phosphate and associates with the pollen tube endomembrane systems&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A pollen protein, NaPCCP, that binds pistil arabinogalactan proteins also binds phosphatidylinositol 3-phosphate and associates with the pollen tube endomembrane systems&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lee CB%2C Swatek KN%2C McClure B %282008%29 Pollen proteins bind to the C%2Dterminal domain of Nicotiana alata pistil arabinogalactan proteins%2E J Biol Chem 283%2840%29%3A 26965%2D26973&dopt=abstract


CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Leroch M, Kirchberger S, Haferkamp I, Wahl M, Neuhaus HE, Tjaden J (2005) Identification and characterization of a novel plastidicadenine nucleotide uniporter from Solanum tuberosum. J Biol Chem 280(18): 17992-8000


Leung AW, Varanyuwatana P, Halestrap AP (2008) The mitochondrial phosphate carrier interacts with cyclophilin D and may play a keyrole in the permeability transition. J Biol Chem 283(39): 26312-26323


Lind JL, Bönig I, Clarke AE, Anderson MA (1996) A style-specific 120 kDa glycoprotein enters pollen tubes of Nicotiana alata in vivo.Sex Plant Reprod 9: 75-86


Lisanti MP, Scherer PE, Tang Z, Sargiacomo M (1994) Caveolae, caveolin and caveolin-rich membrane domains: a signaling hypothesis.Trends Cell Biol 4(7): 231-235


Logan DC, Leaver CJ (2000) Mitochondria-target GFP highlights the heterogeneity of mitochondrial shape, size and movement withinliving plant cells. J Exp Bot 51(346): 865-871


Luu DT, Qin X, Morse D, Cappadocia M (2000) S-RNase uptake by compatible pollen tubes in gametophytic self-incompatibility. Nature407(6804): 649-651


Martínez L, Andrade R, Birgin EG, Martínez JM (2009) PACKMOL: a package for building initial configurations for molecular dynamicssimulations. J Comput Chem 30(13): 2157-64


Martínez-Castilla LP, Rodríguez-Sotres R (2010) A score of the ability of a three-dimensional protein model to retrieve its ownsequence as a quantitative measure of its quality and appropriateness. PLoS One 5(9): e12483


McClure BA, Cruz-García F, Romero C (2011) Compatibility and incompatibility in S-RNase-based systems. Ann Bot 108(4): 647-658Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

McClure BA, Haring V, Ebert PR, Anderson MA, Simpson RJ, Sakiyama F, Clarke A (1989) Style self-incompatibility gene products ofNicotiana alata are ribonucleases. Nature 342(6252): 955-957


McClure BA, Mou B, Canevascini S, Bernatzky (1999) A small asparagine-rich protein required for S-allele-specific pollen rejection inNicotiana. Proc Natl Acad Sci USA. 96(23): 13548-13553


Meng D, Gu Z, Li W, Wang A, Yuan H, Yang Q, Li T (2014) Apple MdABCF assists in the transportation of S-RNase into pollen tubes.Plant J 78(6): 990-1002


Murakami H, Blobel G, Pain D (1990) Isolation and characterization of the gene for a yeast mitochondrial import receptor. Nature347(6292): 488-491 www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from


http://search.crossref.org/?page=1&rows=2&q=Lee CB, Swatek KN, McClure B (2008) Pollen proteins bind to the C-terminal domain of Nicotiana alata pistil arabinogalactan proteins. J Biol Chem 283(40): 26965-26973

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lee&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Pollen proteins bind to the C-terminal domain of Nicotiana alata pistil arabinogalactan proteins&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Pollen proteins bind to the C-terminal domain of Nicotiana alata pistil arabinogalactan proteins&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Leroch M%2C Kirchberger S%2C Haferkamp I%2C Wahl M%2C Neuhaus HE%2C Tjaden J %282005%29 Identification and characterization of a novel plastidic adenine nucleotide uniporter from Solanum tuberosum%2E J Biol Chem 280%2818%29%3A 17992%2D8000&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Leroch M, Kirchberger S, Haferkamp I, Wahl M, Neuhaus HE, Tjaden J (2005) Identification and characterization of a novel plastidic adenine nucleotide uniporter from Solanum tuberosum. J Biol Chem 280(18): 17992-8000

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Leroch&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Identification and characterization of a novel plastidic adenine nucleotide uniporter from Solanum tuberosum&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Identification and characterization of a novel plastidic adenine nucleotide uniporter from Solanum tuberosum&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Leroch&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Leung AW%2C Varanyuwatana P%2C Halestrap AP %282008%29 The mitochondrial phosphate carrier interacts with cyclophilin D and may play a key role in the permeability transition%2E J Biol Chem 283%2839%29%3A 26312%2D26323&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Leung AW, Varanyuwatana P, Halestrap AP (2008) The mitochondrial phosphate carrier interacts with cyclophilin D and may play a key role in the permeability transition. J Biol Chem 283(39): 26312-26323

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Leung&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The mitochondrial phosphate carrier interacts with cyclophilin D and may play a key role in the permeability transition&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The mitochondrial phosphate carrier interacts with cyclophilin D and may play a key role in the permeability transition&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Leung&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lind JL%2C B�nig I%2C Clarke AE%2C Anderson MA %281996%29 A style%2Dspecific 120 kDa glycoprotein enters pollen tubes of Nicotiana alata in vivo%2E Sex Plant Reprod 9%3A 75%2D86&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lind JL, B�nig I, Clarke AE, Anderson MA (1996) A style-specific 120 kDa glycoprotein enters pollen tubes of Nicotiana alata in vivo. Sex Plant Reprod 9: 75-86

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lind&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A style-specific 120 kDa glycoprotein enters pollen tubes of Nicotiana alata in vivo&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A style-specific 120 kDa glycoprotein enters pollen tubes of Nicotiana alata in vivo&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lind&as_ylo=1996&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lisanti MP%2C Scherer PE%2C Tang Z%2C Sargiacomo M %281994%29 Caveolae%2C caveolin and caveolin%2Drich membrane domains%3A a signaling hypothesis%2E Trends Cell Biol 4%287%29%3A 231%2D235&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Lisanti MP, Scherer PE, Tang Z, Sargiacomo M (1994) Caveolae, caveolin and caveolin-rich membrane domains: a signaling hypothesis. Trends Cell Biol 4(7): 231-235

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lisanti&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Caveolae, caveolin and caveolin-rich membrane domains: a signaling hypothesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Caveolae, caveolin and caveolin-rich membrane domains: a signaling hypothesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lisanti&as_ylo=1994&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Logan DC%2C Leaver CJ %282000%29 Mitochondria%2Dtarget GFP highlights the heterogeneity of mitochondrial shape%2C size and movement within living plant cells%2E J Exp Bot 51%28346%29%3A 865%2D871&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Logan DC, Leaver CJ (2000) Mitochondria-target GFP highlights the heterogeneity of mitochondrial shape, size and movement within living plant cells. J Exp Bot 51(346): 865-871

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Logan&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Mitochondria-target GFP highlights the heterogeneity of mitochondrial shape, size and movement within living plant cells&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Mitochondria-target GFP highlights the heterogeneity of mitochondrial shape, size and movement within living plant cells&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Logan&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Luu DT%2C Qin X%2C Morse D%2C Cappadocia M %282000%29 S%2DRNase uptake by compatible pollen tubes in gametophytic self%2Dincompatibility%2E Nature 407%286804%29%3A 649%2D651&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Luu DT, Qin X, Morse D, Cappadocia M (2000) S-RNase uptake by compatible pollen tubes in gametophytic self-incompatibility. Nature 407(6804): 649-651

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Luu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=S-RNase uptake by compatible pollen tubes in gametophytic self-incompatibility&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=S-RNase uptake by compatible pollen tubes in gametophytic self-incompatibility&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Luu&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Mart�nez L%2C Andrade R%2C Birgin EG%2C Mart�nez JM %282009%29 PACKMOL%3A a package for building initial configurations for molecular dynamics simulations%2E J Comput Chem 30%2813%29%3A 2157%2D64&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mart�nez L, Andrade R, Birgin EG, Mart�nez JM (2009) PACKMOL: a package for building initial configurations for molecular dynamics simulations. J Comput Chem 30(13): 2157-64

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mart�nez&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=PACKMOL: a package for building initial configurations for molecular dynamics simulations&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=PACKMOL: a package for building initial configurations for molecular dynamics simulations&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mart�nez&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Mart�nez%2DCastilla LP%2C Rodr�guez%2DSotres R %282010%29 A score of the ability of a three%2Ddimensional protein model to retrieve its own sequence as a quantitative measure of its quality and appropriateness%2E PLoS One 5%289%29%3A e12483&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Mart�nez-Castilla LP, Rodr�guez-Sotres R (2010) A score of the ability of a three-dimensional protein model to retrieve its own sequence as a quantitative measure of its quality and appropriateness. PLoS One 5(9): e12483

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mart�nez-Castilla&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A score of the ability of a three-dimensional protein model to retrieve its own sequence as a quantitative measure of its quality and appropriateness.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A score of the ability of a three-dimensional protein model to retrieve its own sequence as a quantitative measure of its quality and appropriateness.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mart�nez-Castilla&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=McClure BA%2C Cruz%2DGarc�a F%2C Romero C %282011%29 Compatibility and incompatibility in S%2DRNase%2Dbased systems%2E Ann Bot 108%284%29%3A 647%2D658&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=McClure BA, Cruz-Garc�a F, Romero C (2011) Compatibility and incompatibility in S-RNase-based systems. Ann Bot 108(4): 647-658

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=McClure&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Compatibility and incompatibility in S-RNase-based systems&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Compatibility and incompatibility in S-RNase-based systems&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=McClure&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=McClure BA%2C Haring V%2C Ebert PR%2C Anderson MA%2C Simpson RJ%2C Sakiyama F%2C Clarke A %281989%29 Style self%2Dincompatibility gene products of Nicotiana alata are ribonucleases%2E Nature 342%286252%29%3A 955%2D957&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=McClure BA, Haring V, Ebert PR, Anderson MA, Simpson RJ, Sakiyama F, Clarke A (1989) Style self-incompatibility gene products of Nicotiana alata are ribonucleases. Nature 342(6252): 955-957


http://scholar.google.com/scholar?as_q=Style self-incompatibility gene products of Nicotiana alata are ribonucleases&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Style self-incompatibility gene products of Nicotiana alata are ribonucleases&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=McClure&as_ylo=1989&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=McClure BA%2C Mou B%2C Canevascini S%2C Bernatzky %281999%29 A small asparagine%2Drich protein required for S%2Dallele%2Dspecific pollen rejection in Nicotiana%2E Proc Natl Acad Sci USA%2E 96%2823%29%3A 13548%2D13553&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=McClure BA, Mou B, Canevascini S, Bernatzky (1999) A small asparagine-rich protein required for S-allele-specific pollen rejection in Nicotiana. Proc Natl Acad Sci USA. 96(23): 13548-13553


http://scholar.google.com/scholar?as_q=A small asparagine-rich protein required for S-allele-specific pollen rejection in Nicotiana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A small asparagine-rich protein required for S-allele-specific pollen rejection in Nicotiana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=McClure&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Meng D%2C Gu Z%2C Li W%2C Wang A%2C Yuan H%2C Yang Q%2C Li T %282014%29 Apple MdABCF assists in the transportation of S%2DRNase into pollen tubes%2E Plant J 78%286%29%3A 990%2D1002&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Meng D, Gu Z, Li W, Wang A, Yuan H, Yang Q, Li T (2014) Apple MdABCF assists in the transportation of S-RNase into pollen tubes. Plant J 78(6): 990-1002

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Meng&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Apple MdABCF assists in the transportation of S-RNase into pollen tubes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Apple MdABCF assists in the transportation of S-RNase into pollen tubes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Meng&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1



Murffet J, Atherto TL, Mou B, Gasser CS, McClure BA (1994) S-RNase expressed in transgenic Nicotiana causes S-allele specificpollen rejection. Nature 367(6463): 563-566


Murffet J, Strabala TJ, Zurek DM, Mou B, Beecher B, McClure BA (1996) S-RNase and interspecific pollen rejection in the genusNicotiana: Multiple pollen-rejection pathways contribute to unilateral incompatibility between self-incompatible and self-compatiblespecies. Plant Cell 8(6): 943-958


O'Brien M, Kapfer C, Major G, Laurin M, Bertrand C, Kondo K, Kowyama Y, Matton DP (2002) Molecular analysis of the stylar-expressed Solanum chacoense small asparagine-rich protein family related to the HT modifier of gametophytic self-incompatibility inNicotiana. Plant J 32 (6): 985-996


Palmieri F (1994) Mitochondrial carrier proteins. FEBS Lett 346(1): 48-54Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Palmieri F (2004) The mitochondrial transport family (SCL25): physiological and pathological implications. Pflugers Arch 447(5): 689-709Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Palmieri F, Pierri CL, De Grassi A, Nunes-Nesi A, Fernie AR (2011) Evolution, structure and function of mitochondrial carriers: a reviewwith insights. Plant J 66(1): 161-181


Palmieri L, Rottensteiner H, Girzalsky W, Scarcia P, Palmieri F, Erdmann R (2001) Identification and functional reconstitution of theyeast peroxisomal adenine nucleotide transporter. EMBO J 20(18): 5049-5059


Peigneur S, Billen B, Derua R, Waelkens E, Debaveye S, Béress L, Tytgat J (2011) A bifunctional sea anemone peptide with Kunitz typeprotease and potassium channel inhibiting properties. Biochem Pharmacol 82(1): 81-90


Petronilli V, Nicolli A, Costantini P, Colonna R, Bernardi P (1994) Regulation of the permeability transition pore, a voltage-dependentmitochondrial channel inhibited by cyclosporin A. Biochim Biophys Acta 1187: 255-259?


Phelps A, Briggs C, Haefele A, Mincone L, Ligeti E, Wohlrab H (2001) Mitochondrial phosphate transport protein. Reversions ofinhibitory conservative mutations identify four helices and a nonhelix protein segment with transmembrane interactions and Asp39,Glu137, and Ser158 as nonessential for transport. Biochemistry 40(7): 2080-2086


Puerta AR, Ushijima K, Koba T, Sassa H (2009) Identification and functional analysis of pistil self-incompatibility factor HT-B of Petunia.J Exp Bot 60(4): 1309-1318


Qiao H, Wang H, Zhao J, Huang J, Zhang Y, Xue Y (2004) The F-box protein AhSLF-S2 physically interacts with S-RNases that may beinhibited by the ubiquitin/26S proteasome pathway of protein degradation during compatible pollination in Antirrhinum. Plant Cell 16(3):582-595

Pubmed: Author and Title www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from Copyright © 2017 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=Murakami H%2C Blobel G%2C Pain D %281990%29 Isolation and characterization of the gene for a yeast mitochondrial import receptor%2E Nature 347%286292%29%3A 488%2D491&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Murakami H, Blobel G, Pain D (1990) Isolation and characterization of the gene for a yeast mitochondrial import receptor. Nature 347(6292): 488-491

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Murakami&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Isolation and characterization of the gene for a yeast mitochondrial import receptor&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Isolation and characterization of the gene for a yeast mitochondrial import receptor&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Murakami&as_ylo=1990&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Murffet J%2C Atherto TL%2C Mou B%2C Gasser CS%2C McClure BA %281994%29 S%2DRNase expressed in transgenic Nicotiana causes S%2Dallele specific pollen rejection%2E Nature 367%286463%29%3A 563%2D566&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Murffet J, Atherto TL, Mou B, Gasser CS, McClure BA (1994) S-RNase expressed in transgenic Nicotiana causes S-allele specific pollen rejection. Nature 367(6463): 563-566

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Murffet&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=S-RNase expressed in transgenic Nicotiana causes S-allele specific pollen rejection&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=S-RNase expressed in transgenic Nicotiana causes S-allele specific pollen rejection&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Murffet&as_ylo=1994&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Murffet J%2C Strabala TJ%2C Zurek DM%2C Mou B%2C Beecher B%2C McClure BA %281996%29 S%2DRNase and interspecific pollen rejection in the genus Nicotiana%3A Multiple pollen%2Drejection pathways contribute to unilateral incompatibility between self%2Dincompatible and self%2Dcompatible species%2E Plant Cell 8%286%29%3A 943%2D958&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Murffet J, Strabala TJ, Zurek DM, Mou B, Beecher B, McClure BA (1996) S-RNase and interspecific pollen rejection in the genus Nicotiana: Multiple pollen-rejection pathways contribute to unilateral incompatibility between self-incompatible and self-compatible species. Plant Cell 8(6): 943-958

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Murffet&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=S-RNase and interspecific pollen rejection in the genus Nicotiana: Multiple pollen-rejection pathways contribute to unilateral incompatibility between self-incompatible and self-compatible species&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=S-RNase and interspecific pollen rejection in the genus Nicotiana: Multiple pollen-rejection pathways contribute to unilateral incompatibility between self-incompatible and self-compatible species&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Murffet&as_ylo=1996&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=O%27Brien M%2C Kapfer C%2C Major G%2C Laurin M%2C Bertrand C%2C Kondo K%2C Kowyama Y%2C Matton DP %282002%29 Molecular analysis of the stylar%2Dexpressed Solanum chacoense small asparagine%2Drich protein family related to the HT modifier of gametophytic self%2Dincompatibility in Nicotiana%2E Plant J 32 %286%29%3A 985%2D996&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=O'Brien M, Kapfer C, Major G, Laurin M, Bertrand C, Kondo K, Kowyama Y, Matton DP (2002) Molecular analysis of the stylar-expressed Solanum chacoense small asparagine-rich protein family related to the HT modifier of gametophytic self-incompatibility in Nicotiana. Plant J 32 (6): 985-996

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=O'Brien&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=O'Brien&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Palmieri F %281994%29 Mitochondrial carrier proteins%2E FEBS Lett 346%281%29%3A 48%2D54&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Palmieri F (1994) Mitochondrial carrier proteins. FEBS Lett 346(1): 48-54

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Palmieri&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Mitochondrial carrier proteins&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Mitochondrial carrier proteins&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Palmieri&as_ylo=1994&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Palmieri F %282004%29 The mitochondrial transport family %28SCL25%29%3A physiological and pathological implications%2E Pflugers Arch 447%285%29%3A 689%2D709&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Palmieri F (2004) The mitochondrial transport family (SCL25): physiological and pathological implications. Pflugers Arch 447(5): 689-709


http://scholar.google.com/scholar?as_q=The mitochondrial transport family (SCL25): physiological and pathological implications&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The mitochondrial transport family (SCL25): physiological and pathological implications&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Palmieri&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Palmieri F%2C Pierri CL%2C De Grassi A%2C Nunes%2DNesi A%2C Fernie AR %282011%29 Evolution%2C structure and function of mitochondrial carriers%3A a review with insights%2E Plant J 66%281%29%3A 161%2D181&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Palmieri F, Pierri CL, De Grassi A, Nunes-Nesi A, Fernie AR (2011) Evolution, structure and function of mitochondrial carriers: a review with insights. Plant J 66(1): 161-181


http://scholar.google.com/scholar?as_q=Evolution, structure and function of mitochondrial carriers: a review with insights&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Evolution, structure and function of mitochondrial carriers: a review with insights&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Palmieri&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Palmieri L%2C Rottensteiner H%2C Girzalsky W%2C Scarcia P%2C Palmieri F%2C Erdmann R %282001%29 Identification and functional reconstitution of the yeast peroxisomal adenine nucleotide transporter%2E EMBO J 20%2818%29%3A 5049%2D5059&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Palmieri L, Rottensteiner H, Girzalsky W, Scarcia P, Palmieri F, Erdmann R (2001) Identification and functional reconstitution of the yeast peroxisomal adenine nucleotide transporter. EMBO J 20(18): 5049-5059


http://scholar.google.com/scholar?as_q=Identification and functional reconstitution of the yeast peroxisomal adenine nucleotide transporter&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Identification and functional reconstitution of the yeast peroxisomal adenine nucleotide transporter&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Palmieri&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Peigneur S%2C Billen B%2C Derua R%2C Waelkens E%2C Debaveye S%2C B�ress L%2C Tytgat J %282011%29 A bifunctional sea anemone peptide with Kunitz type protease and potassium channel inhibiting properties%2E Biochem Pharmacol 82%281%29%3A 81%2D90&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Peigneur S, Billen B, Derua R, Waelkens E, Debaveye S, B�ress L, Tytgat J (2011) A bifunctional sea anemone peptide with Kunitz type protease and potassium channel inhibiting properties. Biochem Pharmacol 82(1): 81-90

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Peigneur&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A bifunctional sea anemone peptide with Kunitz type protease and potassium channel inhibiting properties&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A bifunctional sea anemone peptide with Kunitz type protease and potassium channel inhibiting properties&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Peigneur&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Petronilli V%2C Nicolli A%2C Costantini P%2C Colonna R%2C Bernardi P %281994%29 Regulation of the permeability transition pore%2C a voltage%2Ddependent mitochondrial channel inhibited by cyclosporin A%2E Biochim Biophys Acta 1187%3A 255%2D259%3F&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Petronilli V, Nicolli A, Costantini P, Colonna R, Bernardi P (1994) Regulation of the permeability transition pore, a voltage-dependent mitochondrial channel inhibited by cyclosporin A. Biochim Biophys Acta 1187: 255-259?

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Petronilli&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of the permeability transition pore, a voltage-dependent mitochondrial channel inhibited by cyclosporin A&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of the permeability transition pore, a voltage-dependent mitochondrial channel inhibited by cyclosporin A&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Petronilli&as_ylo=1994&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Phelps A%2C Briggs C%2C Haefele A%2C Mincone L%2C Ligeti E%2C Wohlrab H %282001%29 Mitochondrial phosphate transport protein%2E Reversions of inhibitory conservative mutations identify four helices and a nonhelix protein segment with transmembrane interactions and Asp39%2C Glu137%2C and Ser158 as nonessential for transport%2E Biochemistry 40%287%29%3A 2080%2D2086&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Phelps A, Briggs C, Haefele A, Mincone L, Ligeti E, Wohlrab H (2001) Mitochondrial phosphate transport protein. Reversions of inhibitory conservative mutations identify four helices and a nonhelix protein segment with transmembrane interactions and Asp39, Glu137, and Ser158 as nonessential for transport. Biochemistry 40(7): 2080-2086

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Phelps&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Mitochondrial phosphate transport protein&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Mitochondrial phosphate transport protein&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Phelps&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Puerta AR%2C Ushijima K%2C Koba T%2C Sassa H %282009%29 Identification and functional analysis of pistil self%2Dincompatibility factor HT%2DB of Petunia%2E J Exp Bot 60%284%29%3A 1309%2D1318&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Puerta AR, Ushijima K, Koba T, Sassa H (2009) Identification and functional analysis of pistil self-incompatibility factor HT-B of Petunia. J Exp Bot 60(4): 1309-1318

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Puerta&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Identification and functional analysis of pistil self-incompatibility factor HT-B of Petunia&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Identification and functional analysis of pistil self-incompatibility factor HT-B of Petunia&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Puerta&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Qiao H%2C Wang H%2C Zhao J%2C Huang J%2C Zhang Y%2C Xue Y %282004%29 The F%2Dbox protein AhSLF%2DS2 physically interacts with S%2DRNases that may be inhibited by the ubiquitin%2F26S proteasome pathway of protein degradation during compatible pollination in Antirrhinum%2E Plant Cell 16%283%29%3A 582%2D595&dopt=abstract


CrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Roldán J, Rojas HJ, Goldriaj A (2012) Disorganization of F-actin cytoskeleton precedes vacuolar disruption in pollen tubes during thein vivo self-incompatibility response in Nicotiana alata. Ann Bot 110(4): 787-795


Sassa H, Hirano H (2006) Identification of a new class of pistil-specific proteins of Petunia inflata that is structurally similar to, butfunctionally distinct from the self-incompatibility factor HT. Mol Genet and Genomics 275 (1): 97-104


Schultz CJ, Hauser K, Lind JL, Atkinson AH, Pu Z, Anderson MA, Clarke AE (1997) Molecular characterization of a cDNA sequenceencoding the backbone of a style specific 120kDa glycoprotein which has features of both extensions and arabinogalactan-proteins.Plant Mol Biol 35: 833-845


Serrano I, Pelliccione S, Olmedilla A (2010) Programmed-cell-death hallmarks in incompatible pollen and papillar stigma cells of Oleaeuropaea L. under free pollination. Plant Cell Rep 29(6): 561-572


Sijacic P, Wang X, Skirpan AL, Wang Y, Dowd PE, McCubbin AG, Huang S, Kao TH (2004) Identification of the pollen determinant of S-RNase-mediated self-incompatibility. Nature 429(6989): 302-305


Stein JC, Hansen G (1999) Mannose induces an endonuclease responsible for DNA laddering in plant cells. Plant Physiol 121(1): 71-80Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Sun YL, Zhao Y, Hong X, Zhai ZH (1999) Cytochrome c release and caspase activation during menadione-induced apoptosis in plants.FEBS Lett 462(3): 317-321


Thomas SG, Franklin-Tong VE (2004) Self-incompatibility triggers programmed cell death in Papaver pollen. Nature 429(6989): 305-309Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Twell D, Wing R, Yamaguchi J, McCormick S (1989) Isolation and expression of an anther-specific gene from tomato. Mol Gen Genet217(2-3): 240-245


Ushijima K, Sassa H, Dandekar AM, Gradziel TM, Tao R, Hirano H (2003) Structural and transcriptional analysis of the self-incompatibility locus of almond: identification of a pollen-expressed F-box gene with haplotype-specific polymorphism 15(3): 771-781


Varanyuwatana P, Halestrap AP (2012) The roles of phosphate and the phosphate carrier in the mitochondrial permeability transitionpore. Mitochondrion 12(1): 120-125


Vierstra RD (2003) The ubiquitin/26S proteasome pathway, the complex last chapter in the life of many plant proteins. Trends Plant Sci8(3): 135-142


Wandrey M, Trevaskis B, Brewin N, Udvardi MK (2004) Molecular and cell biology of a family of voltage-dependent anion channelporins in Lotus japonicus. Plant Physiol 134(1): 182-193 www.plantphysiol.orgon June 12, 2020 - Published by Downloaded from


http://search.crossref.org/?page=1&rows=2&q=Qiao H, Wang H, Zhao J, Huang J, Zhang Y, Xue Y (2004) The F-box protein AhSLF-S2 physically interacts with S-RNases that may be inhibited by the ubiquitin/26S proteasome pathway of protein degradation during compatible pollination in Antirrhinum. Plant Cell 16(3): 582-595

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Qiao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The F-box protein AhSLF-S2 physically interacts with S-RNases that may be inhibited by the ubiquitin/26S proteasome pathway of protein degradation during compatible pollination in Antirrhinum&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The F-box protein AhSLF-S2 physically interacts with S-RNases that may be inhibited by the ubiquitin/26S proteasome pathway of protein degradation during compatible pollination in Antirrhinum&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Qiao&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Rold�n J%2C Rojas HJ%2C Goldriaj A %282012%29 Disorganization of F%2Dactin cytoskeleton precedes vacuolar disruption in pollen tubes during the in vivo self%2Dincompatibility response in Nicotiana alata%2E Ann Bot 110%284%29%3A 787%2D795&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Rold�n J, Rojas HJ, Goldriaj A (2012) Disorganization of F-actin cytoskeleton precedes vacuolar disruption in pollen tubes during the in vivo self-incompatibility response in Nicotiana alata. Ann Bot 110(4): 787-795

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Rold�n&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Disorganization of F-actin cytoskeleton precedes vacuolar disruption in pollen tubes during the in vivo self-incompatibility response in Nicotiana alata&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Disorganization of F-actin cytoskeleton precedes vacuolar disruption in pollen tubes during the in vivo self-incompatibility response in Nicotiana alata&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Rold�n&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Sassa H%2C Hirano H %282006%29 Identification of a new class of pistil%2Dspecific proteins of Petunia inflata that is structurally similar to%2C but functionally distinct from the self%2Dincompatibility factor HT%2E Mol Genet and Genomics 275 %281%29%3A 97%2D104&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sassa H, Hirano H (2006) Identification of a new class of pistil-specific proteins of Petunia inflata that is structurally similar to, but functionally distinct from the self-incompatibility factor HT. Mol Genet and Genomics 275 (1): 97-104

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sassa&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sassa&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Schultz CJ%2C Hauser K%2C Lind JL%2C Atkinson AH%2C Pu Z%2C Anderson MA%2C Clarke AE %281997%29 Molecular characterization of a cDNA sequence encoding the backbone of a style specific 120kDa glycoprotein which has features of both extensions and arabinogalactan%2Dproteins%2E Plant Mol Biol 35%3A 833%2D845&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Schultz CJ, Hauser K, Lind JL, Atkinson AH, Pu Z, Anderson MA, Clarke AE (1997) Molecular characterization of a cDNA sequence encoding the backbone of a style specific 120kDa glycoprotein which has features of both extensions and arabinogalactan-proteins. Plant Mol Biol 35: 833-845

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schultz&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular characterization of a cDNA sequence encoding the backbone of a style specific 120kDa glycoprotein which has features of both extensions and arabinogalactan-proteins&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular characterization of a cDNA sequence encoding the backbone of a style specific 120kDa glycoprotein which has features of both extensions and arabinogalactan-proteins&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schultz&as_ylo=1997&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Serrano I%2C Pelliccione S%2C Olmedilla A %282010%29 Programmed%2Dcell%2Ddeath hallmarks in incompatible pollen and papillar stigma cells of Olea europaea L%2E under free pollination%2E Plant Cell Rep 29%286%29%3A 561%2D572&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Serrano I, Pelliccione S, Olmedilla A (2010) Programmed-cell-death hallmarks in incompatible pollen and papillar stigma cells of Olea europaea L. under free pollination. Plant Cell Rep 29(6): 561-572

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Serrano&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Programmed-cell-death hallmarks in incompatible pollen and papillar stigma cells of Olea europaea L&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Programmed-cell-death hallmarks in incompatible pollen and papillar stigma cells of Olea europaea L&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Serrano&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Sijacic P%2C Wang X%2C Skirpan AL%2C Wang Y%2C Dowd PE%2C McCubbin AG%2C Huang S%2C Kao TH %282004%29 Identification of the pollen determinant of S%2DRNase%2Dmediated self%2Dincompatibility%2E Nature 429%286989%29%3A 302%2D305&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sijacic P, Wang X, Skirpan AL, Wang Y, Dowd PE, McCubbin AG, Huang S, Kao TH (2004) Identification of the pollen determinant of S-RNase-mediated self-incompatibility. Nature 429(6989): 302-305

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sijacic&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Identification of the pollen determinant of S-RNase-mediated self-incompatibility&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Identification of the pollen determinant of S-RNase-mediated self-incompatibility&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sijacic&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Stein JC%2C Hansen G %281999%29 Mannose induces an endonuclease responsible for DNA laddering in plant cells%2E Plant Physiol 121%281%29%3A 71%2D80&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Stein JC, Hansen G (1999) Mannose induces an endonuclease responsible for DNA laddering in plant cells. Plant Physiol 121(1): 71-80

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Stein&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Mannose induces an endonuclease responsible for DNA laddering in plant cells&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Mannose induces an endonuclease responsible for DNA laddering in plant cells&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Stein&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Sun YL%2C Zhao Y%2C Hong X%2C Zhai ZH %281999%29 Cytochrome c release and caspase activation during menadione%2Dinduced apoptosis in plants%2E FEBS Lett 462%283%29%3A 317%2D321&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Sun YL, Zhao Y, Hong X, Zhai ZH (1999) Cytochrome c release and caspase activation during menadione-induced apoptosis in plants. FEBS Lett 462(3): 317-321

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sun&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Cytochrome c release and caspase activation during menadione-induced apoptosis in plants&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Cytochrome c release and caspase activation during menadione-induced apoptosis in plants&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sun&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Thomas SG%2C Franklin%2DTong VE %282004%29 Self%2Dincompatibility triggers programmed cell death in Papaver pollen%2E Nature 429%286989%29%3A 305%2D309&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Thomas SG, Franklin-Tong VE (2004) Self-incompatibility triggers programmed cell death in Papaver pollen. Nature 429(6989): 305-309

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Thomas&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Self-incompatibility triggers programmed cell death in Papaver pollen&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Self-incompatibility triggers programmed cell death in Papaver pollen&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Thomas&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Twell D%2C Wing R%2C Yamaguchi J%2C McCormick S %281989%29 Isolation and expression of an anther%2Dspecific gene from tomato%2E Mol Gen Genet 217%282%2D3%29%3A 240%2D245&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Twell D, Wing R, Yamaguchi J, McCormick S (1989) Isolation and expression of an anther-specific gene from tomato. Mol Gen Genet 217(2-3): 240-245

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Twell&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Twell&as_ylo=1989&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Ushijima K%2C Sassa H%2C Dandekar AM%2C Gradziel TM%2C Tao R%2C Hirano H %282003%29 Structural and transcriptional analysis of the self%2Dincompatibility locus of almond%3A identification of a pollen%2Dexpressed F%2Dbox gene with haplotype%2Dspecific polymorphism 15%283%29%3A 771%2D781&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Ushijima K, Sassa H, Dandekar AM, Gradziel TM, Tao R, Hirano H (2003) Structural and transcriptional analysis of the self-incompatibility locus of almond: identification of a pollen-expressed F-box gene with haplotype-specific polymorphism 15(3): 771-781

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ushijima&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ushijima&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Varanyuwatana P%2C Halestrap AP %282012%29 The roles of phosphate and the phosphate carrier in the mitochondrial permeability transition pore%2E Mitochondrion 12%281%29%3A 120%2D125&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Varanyuwatana P, Halestrap AP (2012) The roles of phosphate and the phosphate carrier in the mitochondrial permeability transition pore. Mitochondrion 12(1): 120-125

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Varanyuwatana&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The roles of phosphate and the phosphate carrier in the mitochondrial permeability transition pore&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The roles of phosphate and the phosphate carrier in the mitochondrial permeability transition pore&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Varanyuwatana&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Vierstra RD %282003%29 The ubiquitin%2F26S proteasome pathway%2C the complex last chapter in the life of many plant proteins%2E Trends Plant Sci 8%283%29%3A 135%2D142&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Vierstra RD (2003) The ubiquitin/26S proteasome pathway, the complex last chapter in the life of many plant proteins. Trends Plant Sci 8(3): 135-142

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Vierstra&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The ubiquitin/26S proteasome pathway, the complex last chapter in the life of many plant proteins&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The ubiquitin/26S proteasome pathway, the complex last chapter in the life of many plant proteins&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Vierstra&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1



Wang Y, Tsukamoto T, Yi KW, Wang X, Huang S, McCubbin AG, Kao TH (2004) Chromosome walking in the Petunia inflata self-incompatibility (S-) locus and gene identification in an 881-kb contig containing S2-RNase. Plant Mol Biol 54(5): 727-74


Wang CL, Xu GC, Jiang XT, Chen G, Wu J, Wu HQ, Zhang SL (2009) S-RNase triggers mitochondrial alteration and DNA degradation inthe incompatible pollen tube of Pyrus pyrifolia. Plant J 57(2): 220-9


Wang CL, Zhang SL (2011) A cascade signal pathway occurs in self-incompatibility of Pyrus pyrifolia. Plant Signal Behav 6(3): 420-1Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Wheeler D, Newbigin E (2007) Expression of 10 S-class SLF-like genes in Nicotiana alata pollen and its implications for understandingthe pollen factor of the S locus. Genetics 177(4): 2171-2180


Williams JS, Wu L, Lis S, Sun P, Kao TH (2015) Insight into S-RNase-based self-incompatibility in Petunia: recent findings and futuredirections. Front Plant Sci 6:41


Wohlrab H, Annese V, Haefele A (2002) Single replacement constructs of all hydroxyl, basic, and acidic amino acids identify newfunction and structure-sensitive regions of the mitochondrial phosphate transport protein. Biochemistry 41(9): 3254-3261


Xu G, Ma H, Nei M, Kong H (2009) Evolution of F-box genes in plants: different modes of sequence divergence and their relationshipswith functional diversification. Proc Natl Acad Sci USA 106(3): 835-840


Zhang Y (2008) I-TASSER server for protein 3D structure prediction. BMC Bioinformatics 9:40Pubmed: Author and TitleCrossRef: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Zhang Y, Xue Y (2008) Molecular Biology of S-RNase-Based Self-Incompatibility. Self-Incompatibility in Flowering Plants: Evolution,Diversity, and Mechanisms. Springer-Verlag Berlin Heidelberg



http://www.ncbi.nlm.nih.gov/pubmed?term=Wandrey M%2C Trevaskis B%2C Brewin N%2C Udvardi MK %282004%29 Molecular and cell biology of a family of voltage%2Ddependent anion channel porins in Lotus japonicus%2E Plant Physiol 134%281%29%3A 182%2D193&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wandrey M, Trevaskis B, Brewin N, Udvardi MK (2004) Molecular and cell biology of a family of voltage-dependent anion channel porins in Lotus japonicus. Plant Physiol 134(1): 182-193

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wandrey&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular and cell biology of a family of voltage-dependent anion channel porins in Lotus japonicus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular and cell biology of a family of voltage-dependent anion channel porins in Lotus japonicus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wandrey&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wang Y%2C Tsukamoto T%2C Yi KW%2C Wang X%2C Huang S%2C McCubbin AG%2C Kao TH %282004%29 Chromosome walking in the Petunia inflata self%2Dincompatibility %28S%2D%29 locus and gene identification in an 881%2Dkb contig containing S2%2DRNase%2E Plant Mol Biol 54%285%29%3A 727%2D74&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wang Y, Tsukamoto T, Yi KW, Wang X, Huang S, McCubbin AG, Kao TH (2004) Chromosome walking in the Petunia inflata self-incompatibility (S-) locus and gene identification in an 881-kb contig containing S2-RNase. Plant Mol Biol 54(5): 727-74

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Chromosome walking in the Petunia inflata self-incompatibility (S-) locus and gene identification in an 881-kb contig containing S2-RNase&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Chromosome walking in the Petunia inflata self-incompatibility (S-) locus and gene identification in an 881-kb contig containing S2-RNase&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wang CL%2C Xu GC%2C Jiang XT%2C Chen G%2C Wu J%2C Wu HQ%2C Zhang SL %282009%29 S%2DRNase triggers mitochondrial alteration and DNA degradation in the incompatible pollen tube of Pyrus pyrifolia%2E Plant J 57%282%29%3A 220%2D9&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wang CL, Xu GC, Jiang XT, Chen G, Wu J, Wu HQ, Zhang SL (2009) S-RNase triggers mitochondrial alteration and DNA degradation in the incompatible pollen tube of Pyrus pyrifolia. Plant J 57(2): 220-9


http://scholar.google.com/scholar?as_q=S-RNase triggers mitochondrial alteration and DNA degradation in the incompatible pollen tube of Pyrus pyrifolia&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=S-RNase triggers mitochondrial alteration and DNA degradation in the incompatible pollen tube of Pyrus pyrifolia&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wang CL%2C Zhang SL %282011%29 A cascade signal pathway occurs in self%2Dincompatibility of Pyrus pyrifolia%2E Plant Signal Behav 6%283%29%3A 420%2D1&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wang CL, Zhang SL (2011) A cascade signal pathway occurs in self-incompatibility of Pyrus pyrifolia. Plant Signal Behav 6(3): 420-1


http://scholar.google.com/scholar?as_q=A cascade signal pathway occurs in self-incompatibility of Pyrus pyrifolia&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A cascade signal pathway occurs in self-incompatibility of Pyrus pyrifolia&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wheeler D%2C Newbigin E %282007%29 Expression of 10 S%2Dclass SLF%2Dlike genes in Nicotiana alata pollen and its implications for understanding the pollen factor of the S locus%2E Genetics 177%284%29%3A 2171%2D2180&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wheeler D, Newbigin E (2007) Expression of 10 S-class SLF-like genes in Nicotiana alata pollen and its implications for understanding the pollen factor of the S locus. Genetics 177(4): 2171-2180

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wheeler&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Expression of 10 S-class SLF-like genes in Nicotiana alata pollen and its implications for understanding the pollen factor of the S locus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Expression of 10 S-class SLF-like genes in Nicotiana alata pollen and its implications for understanding the pollen factor of the S locus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wheeler&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Williams JS%2C Wu L%2C Lis S%2C Sun P%2C Kao TH %282015%29 Insight into S%2DRNase%2Dbased self%2Dincompatibility in Petunia%3A recent findings and future directions%2E Front Plant Sci 6%3A41&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Williams JS, Wu L, Lis S, Sun P, Kao TH (2015) Insight into S-RNase-based self-incompatibility in Petunia: recent findings and future directions. Front Plant Sci 6:41

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Williams&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Insight into S-RNase-based self-incompatibility in Petunia: recent findings and future directions.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Insight into S-RNase-based self-incompatibility in Petunia: recent findings and future directions.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Williams&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wohlrab H%2C Annese V%2C Haefele A %282002%29 Single replacement constructs of all hydroxyl%2C basic%2C and acidic amino acids identify new function and structure%2Dsensitive regions of the mitochondrial phosphate transport protein%2E Biochemistry 41%289%29%3A 3254%2D3261&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Wohlrab H, Annese V, Haefele A (2002) Single replacement constructs of all hydroxyl, basic, and acidic amino acids identify new function and structure-sensitive regions of the mitochondrial phosphate transport protein. Biochemistry 41(9): 3254-3261

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wohlrab&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Single replacement constructs of all hydroxyl, basic, and acidic amino acids identify new function and structure-sensitive regions of the mitochondrial phosphate transport protein&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Single replacement constructs of all hydroxyl, basic, and acidic amino acids identify new function and structure-sensitive regions of the mitochondrial phosphate transport protein&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wohlrab&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Xu G%2C Ma H%2C Nei M%2C Kong H %282009%29 Evolution of F%2Dbox genes in plants%3A different modes of sequence divergence and their relationships with functional diversification%2E Proc Natl Acad Sci USA 106%283%29%3A 835%2D840&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Xu G, Ma H, Nei M, Kong H (2009) Evolution of F-box genes in plants: different modes of sequence divergence and their relationships with functional diversification. Proc Natl Acad Sci USA 106(3): 835-840

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Xu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Evolution of F-box genes in plants: different modes of sequence divergence and their relationships with functional diversification&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Evolution of F-box genes in plants: different modes of sequence divergence and their relationships with functional diversification&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Xu&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhang Y %282008%29 I%2DTASSER server for protein 3D structure prediction%2E BMC Bioinformatics 9%3A40&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhang Y (2008) I-TASSER server for protein 3D structure prediction. BMC Bioinformatics 9:40

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=I-TASSER server for protein 3D structure prediction.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=I-TASSER server for protein 3D structure prediction.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhang Y%2C Xue Y %282008%29 Molecular Biology of S%2DRNase%2DBased Self%2DIncompatibility%2E Self%2DIncompatibility in Flowering Plants%3A Evolution%2C Diversity%2C and Mechanisms%2E Springer%2DVerlag Berlin Heidelberg&dopt=abstract

http://search.crossref.org/?page=1&rows=2&q=Zhang Y, Xue Y (2008) Molecular Biology of S-RNase-Based Self-Incompatibility. Self-Incompatibility in Flowering Plants: Evolution, Diversity, and Mechanisms. Springer-Verlag Berlin Heidelberg

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular Biology of S-RNase-Based Self-Incompatibility.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Molecular Biology of S-RNase-Based Self-Incompatibility.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1


nasipp mediates self-incompatibility in nicotiana · 95 several species avoid self-fertilization...

Documents