NAT Standards for NAT Standards for Clinical VirologyClinical Virology

Sally Baylis, NIBSCSally Baylis, NIBSC

SoGAT XX, Warsaw 12-13 June SoGAT XX, Warsaw 12-13 June 20072007

Standardisation – Clinical VirologyStandardisation – Clinical Virology

NIBSC is working with the UK Clinical NIBSC is working with the UK Clinical Virology Network (CVN) & the Health Virology Network (CVN) & the Health Protection Agency (HPA) to develop a Protection Agency (HPA) to develop a standardisation programme to standardisation programme to provide run controls for diagnostic provide run controls for diagnostic laboratorieslaboratories

Initial StudiesInitial Studies

Panels of viruses have been distributed to Panels of viruses have been distributed to participating laboratories to select suitable participating laboratories to select suitable run control formulations, these have run control formulations, these have included:included:

Influenza A (H1N1, H3N2)Influenza A (H1N1, H3N2) Influenza BInfluenza B Herpes simplex virus (HSV-1 & HSV-2)Herpes simplex virus (HSV-1 & HSV-2) CytomegalovirusCytomegalovirus Norovirus GIINorovirus GII

Initial Studies contd.Initial Studies contd.

Viruses diluted into virus transport medium & Viruses diluted into virus transport medium & distributeddistributed

to the participating laboratoriesto the participating laboratories

Participants requested to test materials using routineParticipants requested to test materials using routineextraction & amplification/detection proceduresextraction & amplification/detection procedures

Data is returned electronically to NIBSC for analysis Data is returned electronically to NIBSC for analysis

Returned data is used to make decisions on suitableReturned data is used to make decisions on suitableformulations for further evaluationformulations for further evaluation

HCVM Stock Material Used in HCVM Stock Material Used in Phase I StudiesPhase I Studies

Human cytomegalovirus (HCMV), Towne Human cytomegalovirus (HCMV), Towne strain was cultured strain was cultured in vitroin vitro at the West of Scotland Specialist Virology Centre, Glasgow

Analysis of HCMV Results - Phase IAnalysis of HCMV Results - Phase I

Virus Dilution Ct Value (copies/ml)

Lab B Lab C Lab D Lab E Lab F

HCMV 10-4 22.79 32.65 26.23(1.9 x 106

copies/ml)6.8 x 105

copies/ml

-ve**

10-5 26.37 35.78 30.33(1.1 x 105

copies/ml)4.4 x 104

copies/ml

-ve**

10-6 30.00 39.27 34.15(7.5 x 103

copies/ml)3.5 x 103

copies/ml

-ve**

Extraction MDx MagNA MDx MDx Qiagen manual

Amplification/Detection Probe Probe Probe Probe Probe

Equiv. vol. of sampleamplified

16 μl 20 μl 26.5 μl ? ?

** Run controls as expected

ResultsResults

Laboratory F failed to generate Ct values for Laboratory F failed to generate Ct values for HCMV distributed in Phase I of the studyHCMV distributed in Phase I of the study

Extensive follow up was performed to identify Extensive follow up was performed to identify why this and another laboratory using the why this and another laboratory using the same assay had unexpected resultssame assay had unexpected results

Analysis of reactions on agarose gels Analysis of reactions on agarose gels revealed that product of the expected size revealed that product of the expected size was being amplified was being amplified

Alignment of Towne Strain with Alignment of Towne Strain with TaqMan ProbeTaqMan Probe

Assay targets glycoprotein gene of HCMVAssay targets glycoprotein gene of HCMV Analysis of the primer sequences revealed Analysis of the primer sequences revealed

a mismatch in the middle of the reverse a mismatch in the middle of the reverse primerprimer

Analysis of sequence of probe vs Towne Analysis of sequence of probe vs Towne strain of HCMV revealed 2 mismatches:strain of HCMV revealed 2 mismatches:

GAGCGCCATCTGTTCCTTGTCGAGCAACATACGACGCACAGGGTCTTGAC TGTCGAGCAGCATACGGCGCA

Evaluation of Candidate Run Evaluation of Candidate Run Controls for Norovirus GIIControls for Norovirus GII

+

Evaluation of Candidate Run Controls Evaluation of Candidate Run Controls for Norovirus GIIfor Norovirus GII

Norovirus (previously known as the Norwalk-like Norovirus (previously known as the Norwalk-like viruses) is a common cause of gastroenteritisviruses) is a common cause of gastroenteritis

Detection has traditionally relied upon EMDetection has traditionally relied upon EM

Two genetic clusters of NoV occur; GI and GIITwo genetic clusters of NoV occur; GI and GII

Phase I of a study identified a suitable concentration of Phase I of a study identified a suitable concentration of NoV GII isolate to use as a candidate run controlNoV GII isolate to use as a candidate run control

ll

Faecal norovirus (GII) sample was obtainedFaecal norovirus (GII) sample was obtained

Sample was disrupted using glass beads in 10 mM Tris-Sample was disrupted using glass beads in 10 mM Tris-HCl, pH 7.4 containing 2% FCS, & treatment with HCl, pH 7.4 containing 2% FCS, & treatment with chloroform, from which a virus stock was preparedchloroform, from which a virus stock was prepared

Norovirus GII Results Phase INorovirus GII Results Phase I

Virus Dilution Ct Value

Lab A Lab B Lab C Lab D

NoV GII 10-3 30.97 22.70 35.20 30.10

10-4 34.80 25.98 37.30* 36.37

10-5 38.23 28.68* -ve -ve

Extraction MagNA MDx MagNA MDx

Amplification/Detection Probe SYBR Probe Probe

Equiv. vol. of sampleamplified

80 μl 16 μl 10 μl 26.5 μl

* One or more replicate tested negative

Evaluation of Candidate Run Controls Evaluation of Candidate Run Controls for Norovirus GIIfor Norovirus GII

This has been distributed to 15 laboratories for This has been distributed to 15 laboratories for on going analysison going analysis

Standards will eventually be -markedStandards will eventually be -marked

Norovirus GII Phase IINorovirus GII Phase II

0 5 10 15 20 250

5

10

15

20

25

30

35

40

Norovirus ResultsC

ross

ing p

oin

t (C

t)

Assay number

Lab A Lab B (16.9l) Lab G (5l) Lab H (40l) Lab J (13.9l) Lab K (12l) Lab M (10l) Lab N (20l) Lab O (40l)

Lab H failed to detect NoV GII

Future WorkFuture Work

Clinical panels have been proposed that include:Clinical panels have been proposed that include:

CSFCSF HSV-1, HSV-2, HCMV, EBV, VZVHSV-1, HSV-2, HCMV, EBV, VZVenterovirus, paraenterovirusenterovirus, paraenterovirus

TransplantTransplant HCMV, EBV, adenovirusHCMV, EBV, adenovirus

GenitalGenital HSV-1, HSV-2, HSV-1, HSV-2, TreponemaTreponema(ulcer)(ulcer)

Eye swabsEye swabs HSV-1, HSV-2, VZV, adenovirus, HSV-1, HSV-2, VZV, adenovirus, ChlamydiaChlamydia

Future Work cont.Future Work cont.

GastroenteritisGastroenteritis NoV, astrovirusNoV, astrovirus

RespiratoryRespiratory Influenza A (H1, H3), influenza B,Influenza A (H1, H3), influenza B,parainfluenza, RSV……parainfluenza, RSV……

Vaginal swabsVaginal swabs HSV-1, HSV-2, HSV-1, HSV-2, N. gonorrhoeaN. gonorrhoea, , M. genitalis, M. genitalis, C. trachomatisC. trachomatis

UrethritisUrethritis N. gonorrhoeaN. gonorrhoea, M. genitalis, , M. genitalis, C. trachomatisC. trachomatis

ProposalProposal

Prepare International Standards for Prepare International Standards for HCMV and EBVHCMV and EBV