natural foods from plant sources in preventing

Evidence-Based Complementary and Alternative Medicine

Natural Foods from Plant Sources in Preventing Nontransmissible Diseases

Special Issue Editor in Chief Almir Gonccedilalves WanderleyGuest Editors Randhir Singh Dahiya and Seacutergio Faloni de Andrade

Natural Foods from Plant Sources inPreventing Nontransmissible Diseases



Special Issue Editor in Chief Almir Gonccedilalves WanderleyGuest Editors Randhir Singh Dahiyaand Seacutergio Faloni de Andrade

Copyright copy 2018 Hindawi All rights reserved

This is a special issue published in ldquoEvidence-Based Complementary and Alternative Medicinerdquo All articles are open access articlesdistributed under the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in anymedium provided the original work is properly cited

Editorial Board

Mona Abdel-Tawab GermanyRosaria Acquaviva ItalyGabriel A Agbor CameroonU Paulino Albuquerque BrazilSamir Lutf Aleryani USAM S Ali-Shtayeh PalestineGianni Allais ItalyTerje Alraek NorwayAdolfo Andrade Cetto MexicoIsabel Anduacutejar SpainLetizia Angiolella ItalyMakoto Arai JapanHyunsu Bae Republic of KoreaGiacinto Bagetta ItalyOnesmo B Balemba USAWinfried Banzer GermanySamra Bashir PakistanJairo Kennup Bastos BrazilArpita Basu USASujit Basu USADaniela Beghelli ItalyAlvin J Beitz USAJuana Benediacute SpainBettina Berger GermanyMaria Camilla Bergonzi ItalyAndresa A Berretta BrazilAnna Rita Bilia ItalyYong C Boo Republic of KoreaMonica Borgatti ItalyFrancesca Borrelli ItalyGioacchino Calapai ItalyGiuseppe Caminiti ItalyRaffaele Capasso ItalyFrancesco Cardini ItalyPierre Champy FranceShun-Wan Chan Hong KongKevin Chen USAEvan P Cherniack USASalvatore Chirumbolo ItalyJae Youl Cho Republic of KoreaK Bisgaard Christensen DenmarkShuang-En Chuang TaiwanY Clement Trinidad And TobagoIan Cock Australia

Marisa Colone ItalyLisa A Conboy USAKieran Cooley CanadaEdwin L Cooper USAMaria T Cruz PortugalRoberto K N Cuman BrazilAdemar A Da Silva Filho BrazilGiuseppe DrsquoAntona ItalyVincenzo De Feo ItalyRociacuteo De la Puerta SpainLaura De Martino ItalyAntonio C P de Oliveira BrazilArthur De Saacute Ferreira BrazilNunziatina De Tommasi ItalyAlexandra Deters GermanyFarzad Deyhim USAClaudia Di Giacomo ItalyAntonella Di Sotto ItalyM-G Dijoux-Franca FranceLuciana Dini ItalyCaigan Du CanadaJeng-Ren Duann USANativ Dudai IsraelThomas Efferth GermanyAbir El-Alfy USAGiuseppe Esposito ItalyKeturah R Faurot USANianping Feng ChinaYibin Feng Hong KongAntonella Fioravanti ItalyJohannes Fleckenstein GermanyFilippo Fratini ItalyBrett Froeliger USASiew H Gan MalaysiaJian-Li Gao ChinaSusana Garcia de Arriba GermanyDolores Garciacutea Gimeacutenez SpainGabino Garrido ChileIpek Goktepe QatarYuewen Gong CanadaSusana Gorzalczany ArgentinaSebastian Granica PolandSettimio Grimaldi ItalyMaruti Ram Gudavalli USA

Narciacutes Gusi SpainSvein Haavik NorwaySolomon Habtemariam UKAbid Hamid IndiaMichael G Hammes GermanyKuzhuvelil B Harikumar IndiaCory S Harris CanadaKen Haruma JapanThierry Hennebelle FranceMarkus Horneber GermanyChing-Liang Hsieh TaiwanBenny T K Huat SingaporeHelmut Hugel AustraliaCiara Hughes IrelandAttila Hunyadi HungaryH Stephen Injeyan CanadaChie Ishikawa JapanAngelo A Izzo ItalyG K Jayaprakasha USALeopold Jirovetz AustriaTakahide Kagawa JapanAtsushi Kameyama JapanWen-yi Kang ChinaShao-Hsuan Kao TaiwanJuntra Karbwang JapanTeh Ley Kek MalaysiaDeborah A Kennedy CanadaCheorl-Ho Kim Republic of KoreaYoun C Kim Republic of KoreaYoshiyuki Kimura JapanToshiaki Kogure JapanJian Kong USATetsuya Konishi JapanKarin Kraft GermanyOmer Kucuk USAVictor Kuete CameroonYiu-Wa Kwan Hong KongKuang C Lai TaiwanIlaria Lampronti ItalyLixing Lao Hong KongMario Ledda ItalyChristian Lehmann CanadaGeorge B Lenon AustraliaMarco Leonti Italy

Lawrence Leung CanadaChun-Guang Li AustraliaMin Li ChinaXiu-Min Li USAGiovanni Li Volti ItalyBi-Fong Lin TaiwanHo Lin TaiwanKuo-Tong Liou TaiwanChristopher G Lis USAGerhard Litscher AustriaI-Min Liu TaiwanMonica Loizzo ItalyViacutector Loacutepez SpainAnderson Luiz-Ferreira BrazilThomas Lundeberg SwedenDawn M Bellanti USAMichel M Machado BrazilFilippo Maggi ItalyValentina Maggini ItalyJamal A Mahajna IsraelJuraj Majtan SlovakiaToshiaki Makino JapanNicola Malafronte ItalyFrancesca Mancianti ItalyCarmen Mannucci ItalyArroyo-Morales Manuel SpainFatima Martel PortugalSimona Martinotti ItalyCarlos H G Martins BrazilFulvio Marzatico ItalyStefania Marzocco ItalyAndrea Maxia ItalyJames H Mcauley AustraliaKristine McGrath AustraliaJames S McLay UKLewis Mehl-Madrona USAA Guy Mensah-Nyagan FranceOliver Micke GermanyMaria G Miguel PortugalLuigi Milella ItalyRoberto Miniero ItalyLetteria Minutoli ItalyAlbert Moraska USAGiuseppe Morgia ItalyMark Moss UKYoshiharu Motoo JapanKamal D Moudgil USA

Yoshiki Mukudai JapanSakthivel Muniyan USAMinKyun Na Republic of KoreaMassimo Nabissi ItalyHajime Nakae JapanTakao Namiki JapanSrinivas Nammi AustraliaKrishnadas Nandakumar IndiaVitaly Napadow USAMichele Navarra ItalyIsabella Neri ItalyPratibha V Nerurkar USAFerdinando Nicoletti ItalyMarcello Nicoletti ItalyCristina Nogueira BrazilMenachem Oberbaum IsraelMartin Offenbaecher GermanyKi-Wan Oh Republic of KoreaYoshiji Ohta JapanOlumayokun A Olajide UKEster Pagano ItalySokcheon Pak AustraliaSiyaram Pandey CanadaBhushan Patwardhan IndiaClaacuteudia H Pellizzon BrazilFlorian Pfab GermanySonia Piacente ItalyAndrea Pieroni ItalyRichard Pietras USAAndrew Pipingas AustraliaJoseacute M Prieto UKHaifa Qiao USAXianqin Qu AustraliaRoja Rahimi IranKhalid Rahman UKDanilo Ranieri ItalyElia Ranzato ItalyKe Ren USAMan Hee Rhee Republic of KoreaLuigi Ricciardiello ItalyDaniela Rigano ItalyJoseacute L Rios SpainBarbara Romano ItalyMariangela Rondanelli ItalyOmar Said IsraelAvni Sali AustraliaMohd Z Salleh Malaysia

Andreas Sandner-Kiesling AustriaManel Santafe SpainTadaaki Satou JapanMichael A Savka USAJana Sawynok CanadaRoland Schoop SwitzerlandSven Schroumlder GermanyVeronique Seidel UKSenthamil R Selvan USAHongcai Shang ChinaKaren J Sherman USARonald Sherman USAYukihiro Shoyama JapanMorry Silberstein AustraliaKuttulebbai N S Sirajudeen MalaysiaFrancisco Solano SpainChang G Son Republic of KoreaCon Stough AustraliaAnnarita Stringaro ItalyShan-Yu Su TaiwanOrazio Taglialatela-Scafati ItalyTakashi Takeda JapanGhee T Tan USANorman Temple CanadaMencherini Teresa ItalyMayank Thakur GermanyMenaka C Thounaojam USAEvelin Tiralongo AustraliaMichał Tomczyk PolandLoren Toussaint USALuigia Trabace ItalyYew-Min Tzeng TaiwanDawn M Upchurch USAKonrad Urech SwitzerlandTakuhiro Uto JapanPatricia Valentao PortugalSandy van Vuuren South AfricaLuca Vanella ItalyAlfredo Vannacci ItalyAntonio Vassallo ItalyMiguel Vilas-Boas PortugalAristo Vojdani USAAlmir Gonccedilalves Wanderley BrazilChong-Zhi Wang USAShu-Ming Wang USAJonathan L Wardle AustraliaKenji Watanabe Japan

J Wattanathorn ThailandSilvia Wein GermanyJanelle Wheat AustraliaJenny M Wilkinson AustraliaD R Williams Republic of Korea

Christopher Worsnop AustraliaHaruki Yamada JapanNobuo Yamaguchi JapanJunqing Yang ChinaLing Yang China

Albert S Yeung USAArmando Zarrelli ItalyChris Zaslawski AustraliaSuzanna M Zick USA

Contents

Natural Foods from Plant Sources in Preventing Nontransmissible DiseasesAlmir Gonccedilalves Wanderley Randhir Singh Dahiya and Seacutergio Faloni De AndradeEditorial (2 pages) Article ID 6120103 Volume 2018 (2018)

Exploring theTherapeutic Ability of Fenugreek against Type 2 Diabetes and Breast Cancer EmployingMolecular Docking andMolecular Dynamics SimulationsShailima Rampogu Saravanan Parameswaran Mary Rampogu Lemuel and KeunWoo LeeResearch Article (12 pages) Article ID 1943203 Volume 2018 (2018)

In Vitro and Ex Vivo Chemopreventive Action ofMauritia flexuosa ProductsJoilane Alves Pereira-Freire George Laylson da Silva Oliveira Layana Karine Farias LimaCarla Lorena Silva Ramos Stella Regina Arcanjo-Medeiros Ana Cristina Silva de LimaSabrina Almondes Teixeira Guilherme Antocircnio Lopes de Oliveira Naacutercia Mariana Fonseca NunesVivianne Rodrigues Amorim Luciano da Silva Lopes Larissa Arauacutejo Rolim Joaquim Soares da Costa-Juacutenior and Paulo Michel Pinheiro FerreiraResearch Article (12 pages) Article ID 2051279 Volume 2018 (2018)

In Vitro Antioxidant Potential and Effect of a Glutathione-Enhancer Dietary Supplement on SelectedRat Liver Cytochrome P450 Enzyme ActivityBenoit B Nrsquoguessan Seth K Amponsah George J Dugbartey Kwabena D Awuah Eunice Dotse Abigail Aning Kennedy K E Kukuia Isaac J Asiedu-Gyekye and Regina Appiah-OpongResearch Article (8 pages) Article ID 7462839 Volume 2018 (2018)

Which Benefits and Harms of Using Fenugreek as a Galactogogue Need to Be Discussed during ClinicalConsultations A Delphi Study among BreastfeedingWomen Gynecologists Pediatricians FamilyPhysicians Lactation Consultants and PharmacistsRamzi Shawahna Sara Qiblawi and Haifa GhanayemResearch Article (13 pages) Article ID 2418673 Volume 2018 (2018)

Glehnia littoralis Root Extract Inhibits Fat Accumulation in 3T3-L1 Cells and High-Fat Diet-InducedObese Mice by Downregulating Adipogenic Gene ExpressionHeeok Hong Joseph F dela Cruz Won Seob Kim Kiyeol Yoo and Seong Gu HwangResearch Article (10 pages) Article ID 1243049 Volume 2018 (2018)

Treatment of Urolithiasis with Medicinal Plant Salvia miltiorrhiza A Nationwide Cohort StudyWen-Chi Chen San-Yuan Wu Po-Chi Liao Tzu-Yang Chou Huey-Yi Chen Jen-Huai ChiangYuan-Chih Su Kee-Ming Man Ming-Yen Tsai and Yung-Hsiang ChenResearch Article (7 pages) Article ID 8403648 Volume 2018 (2018)

Effect of Resveratrol Dry Suspension on Immune Function of PigletsQiuting Fu Qiankun Cui Yi Yang Xinghong Zhao Xu Song Guangxi Wang Lu Bai Shufan Chen Ye TianYuanfeng Zou Lixia Li Guizhou Yue Renyong Jia and Zhongqiong YinResearch Article (10 pages) Article ID 5952707 Volume 2018 (2018)

EditorialNatural Foods from Plant Sources in PreventingNontransmissible Diseases

Almir GonccedilalvesWanderley 1 Randhir Singh Dahiya 2

and Seacutergio Faloni De Andrade 3

1Universidade Federal de Pernambuco Departamento de Fisiologia e Farmacologia Recife Brazil2Maharishi Markandeshwar University Ambala India3Nucleo de Investigacoes Quımico-Farmaceuticas (NIQFAR) Universidade do Vale do Itajaı (UNIVALI) Rua Uruguai458 Centro 88302-202 Itajaı SC Brazil

Correspondence should be addressed to Almir Goncalves Wanderley almirwanderleyufpebr

Received 12 September 2018 Accepted 12 September 2018 Published 27 September 2018

Copyright copy 2018 Almir Goncalves Wanderley et al This is an open access article distributed under the Creative CommonsAttribution License which permits unrestricted use distribution and reproduction in any medium provided the original work isproperly cited

The nontransmissible diseases also known as noncommuni-cable diseases (NCDs) or chronic diseases are noninfectioushealth condition that cannot spread from person to personGenerally these diseases have slow progression and longduration In accordance with World Health Organizationthere are fourmain types ofNCDs (1) cardiovascular diseases(like heart attacks and stroke) (2) cancer (3) chronic respira-tory diseases (such as chronic obstructed pulmonary diseaseand asthma) and (4) diabetes These diseases are responsiblefor 63 of all annual deaths provoking the death of morethan 36 million people Currently these diseases kill morethan all communicable diseases such as HIV malaria andtuberculosis diarrhea

There is growing evidence that positively correlates theconsumption of natural foods with the reductionpreventionof diseases mainly noncommunicable diseases Within thiscriteria consumption of plants and their derivatives rep-resents important options in prevention of these diseasesConsidering these view points special issue in ECAM hasbeen published in order to report contributions of severalresearchers in this area

In the present issue seven articles have been publishedwhich are briefly described below

In one of the articles B B Nrsquoguessan et al investigatedthe effect of CellGevity on rat liver microsomal cytochromeP450 (CYP) enzymes This preparation is a dietary sup-plement contained riboceine (D-ribose-L-cysteine) a GSH-precursor molecule which is reported to effectively deliver

cysteine into the cell and enhance GSH level BesidesCellGevity contains other constituents such as turmericroot extract (curcumin) resveratrol aloe extract milk thistlequercetin broccoli seed extract alpha lipoic acid grapeseed extract vitamin C selenomethionine cordyceps andpiperine Moreover antioxidant potential of this dietarysupplement in vitro was also estimated The results showedthat CellGevity dietary supplement possesses moderateantioxidant activity in vitro and possesses inhibitory effecton selected rat liver CYP enzymes suggesting its potentialinteraction with drugs metabolized by CYP enzymes

In another study S Rampogu et al undertook the chem-ical analyses from fenugreek (Trigonella foenum-graecum)seeds and also evaluated the potential of their main com-pounds against type 2 diabetes and breast cancer usingmolecular docking and molecular dynamics simulation-based computational drug discovery methods The maincompounds identified have been galactomannan and 4-hydroxyisoleucine and computational analysis displayed thatgalactomannan is an interesting compound from fenugreekseeds with a docking score compared to established drugssuch as canagliflozin and anastrozole in binding simulationsof therapeutics against type 2 diabetes and breast cancerrespectively Of this mode the authors concluded that galac-tomannan derived from fenugreek seeds is a candidate forfurther experiments considering its value as a possible drugto treat type 2 diabetes and breast cancer

HindawiEvidence-Based Complementary and Alternative MedicineVolume 2018 Article ID 6120103 2 pageshttpsdoiorg10115520186120103

2 Evidence-Based Complementary and Alternative Medicine

In some countries fenugreek is commonly recommendedas a galactagogue to breastfeeding women in case ofhypogalactia Thus R Shawahna et al have analyzed the useof fenugreek among lactating women in order to achieve for-mal consensus among breastfeeding women and healthcareproviders on which potential harms and benefits of usingfenugreek need to be communicated and discussed duringthe clinical consultations The study involved breastfeedingwomen and healthcare providers to achieve formal consensuson a list of 24 and 16 items related to potential harmsand benefits of fenugreek consumption during lactation Itachieved consensus about 21 potential harms and 14 potentialbenefits of using fenugreek to enhance human milk supplythat needs to be discussed with breastfeeding women duringconsultations Moreover the authors pointed out that furtherobservational studies are needed to assess what is beingdiscussed in daily consultations when herbal remedies arerecommended as galactagogue agents

J A Pereira-Freire et al investigated the phytochem-istry profile and antioxidant potential of Mauritia flexuosa(Arecaceae) fruits and determined the bioaccessibility of itsphenolic compounds M flexuosa is a palm tree widely dis-tributed in South America especially in the Amazon regionand Brazilian Cerrado In the Brazilian food industry thepeel and endocarp are commonly discarded or underutilizedThe results have shown higher values for phenols flavonoidscarotenoids tannins and ascorbic acid in peels when com-pared to the pulps and endocarps Moreover phenolic com-pounds identified by HPLC have shown reduced bioacces-sibility after in vitro simulated gastrointestinal digestion Allsamples showed capacity to scavenger free radicals but peelspresented higher scavenger action in all methods exploredand also protected rat blood cells against lysis induced byperoxyl radicals Based on results authors highlighted thenutritional characteristics of these by-products for humanor livestock which otherwise are commonly discarded or areused as feed for ruminant animals only

Another contribution of this special issue was the workof the H Hong et al which assessed the effects of Glehnialittoralis (GLE) root hot water extract and its underlyingmechanism on 3T3-L1 cell adipogenesis and in high fat diet-induced obese mice The GLE dose-dependently inhibited3T3-L1 adipocyte differentiation and intracellular lipid accu-mulation in differentiated adipocytes Further body weightgain and fat accumulation were significantly lower in theGLE-treated HFD mice than in the untreated HFD miceand treatment suppressed the expression of adipogenic genessuch as peroxisome proliferator-activated receptor (PPAR)120574 CCAATenhancer-binding protein (CEBP) 120572 fatty acidsynthase (aP2) and fatty acid synthase (FAS) These resultssuggested that GLE inhibits adipocyte differentiation andintracellular lipid accumulation by downregulating the adi-pogenic gene expression both in vitro and in vivo

A Nationwide Cohort study was carried out by W-C Chen et al to evaluate the effect of Salvia miltiorrhiza(Danshen) in the treatment of urolithiasis The authorsdescribed that usage of S miltiorrhiza decreased the ratio ofsubsequent stone treatment after the first treatment in thestudy population there was no increased bleeding risk due

to long-term use of it Therefore they suggested this is a safeherb having a potential for calculus prevention

Finally the effect of resveratrol suspension on theimmune function of piglets has been evaluated by Q Fu et alshowing that the treatmentwith it provoked significant effectson the development maturation proliferation and trans-formation of T lymphocytes The activity appears related toregulation of the humoral immune responses by upregulatingthe release of IFN-120574 and downregulating the release of TNF-120572 Moreover there was significant increase in antibody titersof the piglets after immunization using swine fever vaccine(CSFV) and foot-and-mouth disease vaccine (FMDV)Thesepositive effects indicate that resveratrol could be consideredas an adjuvant to enhance the bodyrsquos immune response tovaccines as well as dietary additive for animals in order toenhance humoral and cellular immunity

Thus with contributions from research groups fromdifferent countries this special issue exhibited that naturalproducts have great potential to be explored in the preventionand treatment of not transmissible diseasesThe editors of thespecial issue would like to thank all authors which submittedtheir works and allowed the success of this special issue

Conflicts of Interest

The authors declare that there are no conflicts of interest

Almir Goncalves WanderleyRandhir Singh Dahiya

Sergio Faloni de Andrade

Research ArticleExploring the Therapeutic Ability of Fenugreek againstType 2 Diabetes and Breast Cancer Employing MolecularDocking and Molecular Dynamics Simulations

Shailima Rampogu 1 Saravanan Parameswaran1

Mary Rampogu Lemuel2 and KeunWoo Lee 1

1Division of Life Science Division of Applied Life Science (BK21 Plus) Plant Molecular Biology andBiotechnology Research Center (PMBBRC) Research Institute of Natural Science (RINS) Gyeongsang National University (GNU)501 Jinju-daero Jinju 52828 Republic of Korea2West Thames College London UK

Correspondence should be addressed to Keun Woo Lee kwleegnuackr

Received 9 February 2018 Revised 12 June 2018 Accepted 24 June 2018 Published 11 July 2018

Academic Editor Almir Goncalves Wanderley

Copyright copy 2018 Shailima Rampogu et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Fenugreek (Trigonella foenum-graecum) is used as a spice throughout the world It is known for its medicinal properties such asantidiabetic anticarcinogenic and immunological activities The present study shows the properties and the nutritional qualityof fenugreek seed extract and focuses on screening of active compounds in drug designing for type 2 diabetes and breast cancerQuantitative analysis was used to calculate the percentages of protein carbohydrates moisture fatty acid galactomannan oil andamino acid Phytochemical analysis revealed the presence of flavonoids terpenoids phenols proteins saponins and tannins infenugreek seed extracts Molecular docking and molecular dynamics simulation-based computational drug discovery methodswere employed to address the role of fenugreek seed constituents against type 2 diabetes and breast cancer The computationalresults reveal that the compound galactomannan can be ascribed as potential drug candidate against breast cancer and type 2diabetes rendered by higher molecular dock scores stable molecular dynamics (MD) simulations results and lower binding energycalculations

1 Introduction

The legume fenugreek (Trigonella foenum-graecum) is a shortannual plant from the Fabaceae family [1 2] The nameTrigonella foenum-graecum is a Latin-Greek name as itbears a typical triangular shaped flowers and is employedas a common fodder for animals in Greece [1] It is foundin various parts of the globe and is often used as spicecondiment and medication [3 4] Largely fenugreek leavesand seeds have been used as spices in different parts of theglobe In Africa fenugreek is used as supplement duringbread preparation and the seed components of fenugreekare known to enhance the nutritional quality of the breadIn India the leaves and seeds are utilized as favouring andseasoning agents [1] In China it is used as cure edema

while the ancient Egyptians employed fenugreek to incensethe mummies [1 5 6] Additionally fenugreek is used asa medicine to treat several diseases besides being used asantioxidant [7] against inflammation [8 9] as anticancer[10] as hepatoprotective agent [11 12] as antibacterial [13ndash15]and as antifungal [16] Additionally fenugreek is also used asoff-season fodder and animal food supplement [17]

Fenugreek seeds are widely studied part of the plantThe powdered fenugreek is used as condiment and the seedendosperm serves to secure fenugreek gum [1] The seedshave a strong aromawith bitter taste [18]Themajor chemicalconstituents found in fenugreek seed are galactomannan(fibre) diosgenin (sapogenin) trigonelline (alkaloid) and 4-hydroxyisoleucine that have the antidiabetic properties andare also employed to treat breast cancer [19]



Diabetes mellitus is a common and chronic diseaseconcern globally associated with a ten-year shorter lifeexpectancy [20] According to WHO type 2 diabetes occursbecause either body does not produce enough insulin orbody resists the effects of insulin [21 22] Type 2 dia-betes is dominant in developing countries and accounts toaround 85ndash90 worldwide [20 21] Fenugreek is anotherpromising antidiabetic drug [23] It was also confirmedthat consuming fenugreek as a dietary supplement in theprediabetic patients could efficiently reduce the outbreak oftype 2 diabetes [24] Additionally it was further reported thatthe socked fenugreek seeds can act as adjuvant in mitigatingthe type 2 diabetes and also in noninsulin dependent diabetes[25 26] and serum lipids in type I diabetes [27] Additionallyit is well evidenced that the fenugreek seeds are antidiabeticin nature [24 28 29]

Fenugreek also possesses anticancer properties andchemical constituents of fenugreek are known to induceapoptosis [30 31] Furthermore it induces dose-dependenteffect on human breast cancer cell line [32] Breast canceris the most common cause of death in female worldwide[33 34] The discovery of BRCA1 and BRCA2 genes helpedto understand that hereditary factor is the main cause ofmost cancers [35] Chloroform seed extract studies by Khojaet al proved the effective killing of MCF-7 human immor-talized breast cells [30] Amin et al (2005) studies suggestthat fenugreek seed chemical constituents have preventiveeffect against breast cancer which inhibit MDA 231-inducedmammary hyperplasia [36] However it is not yet delineatedon the most effective compound that can act on boththe morbidities Therefore in the current investigation weemployed the computational technique such as moleculardocking and molecular dynamics simulations to identifycandidate compound as compared with the reference com-pounds

Molecular docking is one of the widely adapted methodsto predict the binding affinities between the ligand andthe target protein and further the lead optimization [37]Additionally the molecular docking imparts knowledge onthe interactions at the atomic level [37] and predicts the idealbindingmode [33 38]Molecular dockingmechanism gener-ally evaluates the binding conformations its orientation andthe accommodation of the small molecule at the active siteof the proteins binding site and are read as scores [39] Themolecular dynamics simulation imparts knowledge on thenature of the small molecules at the proteins binding pocketthereby affirming the appropriate binding modes [38] Theidentified Hits that have demonstrated a higher dock scorethan the reference compounds or the known drugs exhibit-ing the interactions with the key residues complemented bystable molecular dynamics simulation results are consideredthe most promising candidate compounds

In the current investigation the quantitative analysisof fenugreek seeds was conducted to gain information onthe components and further the computational analysiswas performed to discover the potential compound againstbreast cancer and type 2 diabetes The in silico results haveilluminated galactomannan as the prospective compoundagainst both diseases

2 Materials and Methods

Fenugreek seeds were used as a sample to test the medicinalproperties Fenugreek seedswere sourced from a localmarket(Hyderabad India) and were of high quality grade Theywere shade dried cleaned and finely powdered and used forchemical analysis

21 Biochemical Analysis The biochemical studies were car-ried out to identify the protein content total soluble carbohy-drates oil content and fatty acid values free amino acids andsoluble fibres from the collected seed samples

211 Estimation of Total Protein Percentage of proteinaceousnitrogen and proteins was estimated by the Micro-kjeldahlmethod [40] Proteinaceous nitrogen was calculated by thefollowing formula

of Nitrogen = (T minus B) timesN times 10 times 1428times S (1)

T is titration reading of the sampleB is blank reading of the sampleS is the amount of sample taken in gramsN is normality of hydrochloric acid (N28)

To calculate the percentage of protein the nitrogen value wasmultiplied by the factor 625

212 Estimation of Total Carbohydrate Total carbohydratecontent of the seed samples was estimated by the proceduresuggested by Loewis (1952) [41] Anthrone reagent was usedand the developed colour was read at 620nm in a colorimeteragainst blank

213 Estimation of Oil Content Total oil content of the saidspices was estimated as suggested by Meara (1955) [42]

Percentage of oil was calculated by following formula

of oil = WoWstimes 100 (2)

Wo is the weight of oil extractedWs is the weight of seed taken

214 Estimation of Fatty Acid Value Method used to esti-mate the fatty acid value is suggested by Meara (1955) [42]

Fatty acid value was calculated using the formula

Fatty acid value = U times 561W

(3)

U is the volume of titration of 01 n KOHW is the grams of oil taken

Evidence-Based Complementary and Alternative Medicine 3

215 Isolation of Amino Acids Column chromatography wasused to isolate free amino acids from fenugreek seeds [43]

To find the concentration of 4-hydroxyisoleucine firstthe total amino acid content was determined by usingspectrophotometric method Then the relative concentrationof 4-hydroxyisoleucine in the mixture of amino acid wasdetermined by high performance thin layer chromatography(HPTLC)

216 Isolation of Galactomannans Extraction and isolationof the water-soluble polysaccharides (galactomannans) fromendospermof fenugreek seedswere done using the procedureof Kooiman (1971) [44]

217 Estimation of Moisture Percentage Moisture content ofseeds was estimated by ldquoDry air ovenrdquo method association ofofficial analytical chemists (AOAC) (anonymous 1947)[45]and the percentage was calculated from the following for-mula

moisture = f resh weight of the seed

minusdry wt of the seeddry wt of the seed

times 100(4)

22 Molecular Docking Simulations and Free Energy Calcu-lations To further assess the suitability of the compoundsas antidiabetic and potential breast cancer agents the inves-tigation proceeds employing the computational methodssuch as molecular docking recruiting CDOCKER avail-able on Discovery Studio (DS) v45 molecular dynamics(MD) simulations conducted usingGROningenMAchine forChemical Simulations (Gromacs) v50 which was followedby MMPBSA calculations

221 Molecular Docking For the execution of the dockingprotocol the proteins for both the diseases were importedfrom protein data bank (PDB) of high resolutionThe proteinwith the PDB id 3EQM (29A) was chosen for breast cancerand 1GFY (21A) was elected for type 2 diabetes respectivelyThese proteins were prepared on DS by initiating the cleanproteinmodule embedded with the DS and subsequently het-eroatoms together with the water molecules were dislodgedand the addition of hydrogens was performed adapting theCHARMm force field accessible on the DS The active siteswere selected in accordance with the co-crystal geometrythereby considering the residues around 10 A radius [46 47]

Phytochemicals along with the type 2 diabetic and breastcancer drugs canagliflozin [48] and anastrozole [49] wereused to comparatively evaluate the effect of the prospectivedrugmolecules on the diseases labelling the latter as referencedrugThese compounds were imported onto the DS to obtaintheir 3D structures and were subsequently minimized Theprepared proteins and the ligands were subjected to molecu-lar docking studies employing the CDOCKER protocol

CDOCKER available on the DS happens to be the mostreliablemethod as it employs the CHARMm-based dynamicsmethods [50] Subsequently 30 conformations were allowedto be generated for each ligand while the other parame-ters were set at default The results were evaluated based

upon the higher ndashCDOCKER interaction energy and higherndashCDOCKER energy that significantly correspond to thefavourable binding The most appropriate binding mode wasjudged by the maximum clusters formed and was thereforesubjected to MD simulations to understand its dynamicbehaviour

222 MD Simulations Molecular dynamics (MD) simula-tions were performed for the favourable systems obtainedafter docking using GROMACS 50 with CHARMm27 forcefield Ligand topologies were generated adapting the Swiss-Param [51] All the parameters were attributed as describedearlier [52ndash56] Dodecahedron water box was generated andthe systems were solvated comprising three-site transferrableintermolecular potential (TIP3P) water model to which thecounter ions were added The system was energy minimizedwith steepest descent algorithm with 10000 steps which wasthen subjected to equilibration using constant number Nvolume V and temperature T (NVT) [57] and constantnumber N pressure P and temperature T (NPT) [58]During this process the protein backbone was restrainedand the periodic boundary conditions were fostered to avoidbad effects Thereafter the MD run was conducted for 10ns saving the data for every one picosecond (ps) Visualmolecular dynamics (VMD)[59] and DS were utilized toanalyse the MD results

223 Binding Free Energy Calculations Molecular Mechan-icsPoisson Boltzmann Surface Area (MMPBSA) wasrecruited to compute the binding free energy calculations[60 61] 10 snapshots were evenly extracted from theMD tra-jectories of the protein ligand complex A variety of energeticvalues were calculated using

ΔGbinding = Gcomplex minus (Gprotein + Gligand)

GX = EMM + Gsolvation

EMM = Ebonded + Enon-bonded

= Ebonded + (Evdw + Eelec)

Gsolvation = Gpolar + Gnon-polar

Gnon polar = 120574SASA + b

(5)

3 Results

31 Biochemical Analysis The total seed percentage revealedthat galactomannan and 4-hydroxyisoleucine were present in264 and 13 percentages respectively as in Table 1

Further phytochemical screening of acetone seed extractof fenugreek was carried out to test the presence of tanninsphenols terpenoids flavonoids saponins and alkaloids [62]and are tabulated in Table 2

Test for flavonoids 1 ml of extract in a test tube and 5mlof diluted ammonium solution were added followed by fewdrops of concentrated sulphuric acid Formation of yellowcolour indicated the presence of flavonoids [62]


Table 1 Percentage of the seed contents

Contents of fenugreekseed extract

Average percentage ofthe seed extracts ()

protein 285carbohydrate 162oils 53fatty acid 38galactomannan 264moisture 684-hydroxyisoleucine 13

Table 2 Summary of Phytochemicals in Acetone Extract of Fenu-greek Seed

Tests ResultsFlavanoid +veTannin +veTerpenoids +veAlkaloids +veSaponins +ve

Test for tannins Formation of reddish-brown colourindicated the presence of tannins (ferric chloride test) when1 ferric chloride solution was added to 1 ml of extract offenugreek seeds [62]

Test for terpenoids To find out the presence of ter-penoids Salkowski test was conducted 1 ml of extract wastaken and dissolved in chloroform and then a few drops ofconcentrated sulphuric acid were added to it On the innerface a reddish-brown colour was formed that indicated thepresence of terpenoids [62]

Test for alkaloidsDragendorffarsquos test results indicated thepresence of alkaloids by giving orange-red precipitate when 1ml of Dragendroffarsquos reagent was added (potassium bismuthiodide solution) to 1 ml of extract [62]

Test for saponins Frothing test was conducted to test forsaponins in the seed extract 1ml of extract was vigorouslyshaken with distilled water and was allowed to stand for 10min Stable froth indicated the presence of saponins [62]

32 Molecular Docking Simulations and FreeEnergy Calculations

321 Molecular Docking Studies Molecular docking wasexecuted independently for diabetes and breast cancer Theligands along with their respective proteins were docked toassess their binding affinities It was interesting to note that 4-hydroxyisoleucine has generated a relatively lower dock scorewhile galactomannan produced higher dock score as com-pared to their respective reference compounds as in Table 3Therefore 4-hydroxyisoleucine was refrained from furthercalculations and the other systems were proceeded forward

322 Molecular Dynamics Simulations To secure the resultsobtained from the docking the MD simulations were per-formed to establish themost reliable ligand-receptor complex

Table 3 Molecular dock scores between the drug targets and thecompounds

S no Name of thecompound

-CDOCKERinteraction energy

Dock scores of diabetes mellitus1 canagliflozin 36552 galactomannan 43193 4-hydroxyisoleucine 2827Dock scores of breast cancer1 anastrozole 34052 galactomannan 58153 4-hydroxyisoleucine 2388

and additionally to understand their behaviour at proteinsactive site [52 53] The MD for 10 ns was initiated andthe behaviour of each system was monitored Accordinglyroot mean square deviation (RMSD) root mean squarefluctuation (RMSF) and potential energies were calculatedfor each system The RMSD for the breast cancer systemswere observed to be stable after 4000 ps with no signifi-cant variation thereafter implying that the system is wellconverged as in Figure 1 Moreover the RMSD values weredemonstrated to be less than 025 nm Similar results werenoted with RMSF values as well as in Figure 2 The potentialenergy further states that there were no abnormal behavioursof the systems which were stable throughout the simulationsas in Figure 3 The last 5ns trajectories were retrieved tostudy the binding mode analysis Upon superimposition itwas conceived that the binding mode pattern of the referenceand the galactomannan were similar as in Figure 4 Theinteractions of the ligand with the protein were evaluatedwith the key residues located at the active site The referencecompound anastrozole was seen to form a hydrogen bondwith the NH atom ofMet374 residue joined by N5 atomwitha bond length of 29 A Phe134 was found to form the 120587 ndash120587 with the ligand molecule Galactomannan was found tointeract with the protein by forming 7 hydrogen bonds TheO13 atom of the ligand has interacted with the HH22 atom ofArg115 with a bond length of 28 AThe HH21 atom of Arg115has interacted with O15 atom of the ligand with a bond lengthof 25 A The O atom of Ile132 has joined with H62 of theligand displaying a bond length of 26 A Another hydrogenbond was observed between the HH11 atom of Arg145 andthe O14 atom of the ligand with a length of 20 A The OD2atom of the residue Asp309 has interacted with the H57 ofthe ligand with a bond distance of 28 A The O atom ofthe key residue Met374 has interacted with the H53 atomof the ligand with a bond length of 25 A The SG atom ofthe Cys437 residue has interacted with the H63 atom of theligand with a distance of 25 A The details of the interactionare represented in Figure 5 and Table 4 Furthermore theintermolecular hydrogen bond interactions were recordedduring the simulations to elucidate deposition of the ligandwithin the active site It was observed that the referencemolecule displayed an average of 03 hydrogen bonds whilethose within 035 nm were observed to be 07 as in Figure 6


Table 4 The molecular interactions between the compounds and the protein

S no Compound LigandAtom

Aminoacid

Aminoacidatom

Bond length(A) Hydrophobic interactions

1 anastrozole N5 Met374 HN 29Ile133Asp309Val370 Leu372

Val373Pro429Phe430Cys437Leu477

2 galactomannan O13 Arg115 HH22 28

Ala306 Asp309 Phe430

O15 Arg115 HH21 25H62 Ile132 O 26O14 Arg145 HH11 20H57 Asp309 OD2 28H53 Met374 O 25H63 Cys437 SG 25

ReferenceGalactomannan

2000 4000 6000 8000 100000Time (ps)

0

005

01

015

02

025

03

RMSD

(nm

)

Figure 1 RMSD plots for backbone atoms


0

01

02

03

04

05

RMSF

(nm

)

1000 2000 3000 4000 5000 6000 7000 80000Number of atoms

Figure 2 RMSF profiles for backbone atoms

while the candidate molecule demonstrated an average of 13hydrogen bonds and the bonds within 035 nmwere 44 as inFigure 7

Similar types of calculations were determined for the type2 diabetes disease target and its respective ligandsTheRMSDwas recorded to be stable after 7000 ps for both the referenceand galactomannan Further it was noted that the RMSD

Pote

ntia

l energ

y

Time (ps)

0 2000 4000 6000 8000 10000minus792000minus796000minus800000minus804000minus808000minus812000minus816000minus820000minus824000minus828000

(kJ

mol

)


Figure 3 Potential energy graphs of the systems

of the reference was established to be within 02 nm whilethe drug-like molecule demonstrated a RMSD within 015nm as in Figure 8 However no major fluctuations werenoticed during the simulations referring to the stability of thesystems The same results were depicted through the RMSFas in Figure 9 and the potential energy calculations as inFigure 10 Therefore to examine the binding mode of theligand molecules the last 5 ns trajectories were extractedand were superimposed The results represented a similarbindingmode between the reference and the galactomannanas in Figure 11 Furthermore intermolecular interactionswereinspected with the key residues residing at the active siteIt revealed that the reference molecule has formed threehydrogen bonds with the active site residues The F2 of theligand has interacted with the HG atom of Cys215 with bondlength of 26 A The other two hydrogen bonds are formedwith HN and HE atoms of Arg221 and 21 A each Tyr46 andPhe182 have been involved with the 120587 ndash 120587 interactions Onthe contrary Galactomannan on the other hand generatedeight hydrogen bonds two hydrogen bonds with Lys120 andAsp181 amino acid residues and one hydrogen bond withArg221 Ser216 Gln262 and Gln266 respectively The detailsof the interactions are tabulated in Figure 12 and Table 5 Fur-thermore the intermolecular hydrogen bonds were evaluatedthroughout the simulations The average hydrogen bondswere computed to be 009 and those within 035 nm were


Figure 4 Bindingmode assessment of the reference (cyan) and galactomannan (pink) Superimposition of the representative structures (left)and zoomed (right)


Gly436

Thr310

Arg145

Ile132 Cys437

Arg115

Asp309

Met374

Met375

Phe134

Figure 5 Depiction of hydrogen bond interactions and binding conformations Only polar atoms are displayed for clarity

found to be 07 as in Figure 13The prospective drugmoleculehowever has represented average hydrogen bonds of 39while the bonds within 035 nm were enumerated to be 44projecting the superiority of galactomannan as in Figure 14

33 Binding Free Energy Analysis Binding free energies arecomputed after the MD simulations that inspect proteinfluctuations and ligand conformations thereby ensuring asuitable positioning of the ligand within the binding site TheMMPBSA calculations have produced a favourable ΔG thatranged between -10 to 100 kJmol for breast cancer target as inFigure 15 Furthermore the average binding energy producedby reference was -4245 kJmol while that generated bygalactomannan was -4795 kJmol respectively as in Table 6

The binding free energies were subsequently calculatedfor canagliflozin-protein and galactomannan-protein sys-tems for type 2 diabetes 10 snapshots were evenly extractedand the binding energies were computed accordingly Thebinding energies ranged between -15 kJmol and -100 kJmolas in Figure 16 Additionally it was observed that the averagebinding energy was calculated as -5175 kJmol for thereference and -6811 kJmol for galactomannan as in Table 7

From the results it is evident that galactomannan has rep-resented higher ndashCDOCKER interaction energy values andlower binding free energies than their respective referencecompounds These results demonstrate that galactomannanhas stronger binding affinities than the reference inhibi-tors



Sno Compound LigandAtom

Aminoacid

Aminoacid atom

Bondlength A Hydrophobic interactions

1 canagliflozin F2 Cys215 HG 26 Lys120Lys116Ser216Gly218Ile219Gly220Ala217Gln262

F2 Arg221 HN 21F2 Arg221 HE 21

2 galactomannan O9 Lys120 HZ2 17

Tyr46Lys116Phe182Gly183Cys215Ser216

Gly218Ile219 Gly220

O3 Lys120 HZ1 20H66 Asp181 OD1 23H64 Asp181 OD1 19O14 Arg221 HN 24O16 Ser216 HN 24H62 Gln262 OE1 21O13 Gln266 HE22 24

Table 6 Comparative assessment between dock scores and the binding energies of breast cancer systems

S no Name of the compound -CDOCKER interaction energy Average binding energy (kJmol)1 anastrozole 3405 -42452 galactomannan 5815 -4795

Hydrogen bondsPairs within 035nm

2000 4000 6000 8000 100000Time (ps)

005

115

225

335

445

Num

ber

Figure 6 Graphical depiction of number of intermolecular hydro-gen bond interactions between the protein and the referencecompound

Hydrogen bondsPairs within 035 nm

0

2

4

6

8

10

12

Num

ber

2000 4000 6000 8000 100000Time (ps)

Figure 7 Graphical depiction of number of intermolecular hydro-gen bond interactions between the protein and the candidatecompound

4 Discussion

In the present study the seed extract showed the presence ofproteins carbohydrates fatty acids oils saponin flavonoidstannins terpenoids alkaloids soluble fibre galactomannanand amino acid 4 hydroxyisoleusine (Tables 1 and 2) Somechemicals screened are similar to the work done by Yadav Ret al 2014 [63]

Out of these chemicals the special interest in this investi-gation is on the percentages of soluble fibre galactomannan264 and free amino acids 4 hydroxyleucine 13 andthe presence saponins as these are linked to human healthbenefits mainly in the reduction of plasma glucose levels andanticancer activities [64]

In order to further evaluate molecular inhibitory effectof the selected phytochemicals the investigation proceeds insilico Computational results have revealed that the phyto-chemical 4 hydroxyisoleucine could not induce the inhibitoryactivity against both the diseases Although reports exist toexplain its antidiabetic and antibreast cancer activity thepresent finding foretells its inability as an inhibitor [31 65]Therefore this amino acid was not forwarded for furtherstudies The other compound galactomannan has proved tobe potential against both the diseasesThiswas represented bythe RMSD RMSF and the potential energy valuesThe resultswere found to be unaltered as compared with the referencethroughout the simulations Moreover the binding energiesof the prospective drug molecules are found to be less whilerendering the highest ndashCDOCKER interaction energies It isdocumented from the previous reports regarding the role ofbreast cancer inhibitors on diabetes mellitus as there exists alinkage between them [66 67] All the above results concludethat galactomannan could be considered as a potential drugfor both the diseases



2000 4000 6000 8000 100000Time (ps)

0

005

01

015

02

025

RMSD

(nm

)


1000 2000 3000 4000 5000 60000Number of atoms

0

005

01

015

02

025

RMSF

(nm

)



0 2000 4000 6000 8000 10000

Time (ps)

minus533000

minus543000

minus553000

minus563000

Pote

ntia

l energ

y (k

Jm

ol)



Chemically galactomannan is a polysaccharide moleculecomprising a mannose backbone and the galactose sidegroups hence the name More precisely they exist with 1-6 alpha-D-galactopyranose linkage However in fenugreekmannose and galactose are linked by 11 linkage Uponobserving the docking conformations it can be elucidatedthat the galactose side groups have involved in forming thehydrogen bond interaction with the active side residues withthe ring structures of the mannose involved in the formationof the 120587 bond interactions

In conclusion the present study has examined the activecomponents of fenugreek seeds against two common butdifferent diseases viz-a-viz type-2 diabetes and breast can-cer using a well-established computational drug discoverymethod The chemical composition of fenugreek seeds wasassessed and galactomannan and 4-hydroxyisoleucine wereidentified as major components and are similar to previousstudies [68] The therapeutic potential of these two identifiedactive components was further assessed using moleculardocking and molecular dynamics simulations Our results


Figure 11 Binding mode assessment of the reference (purple) and galactomannan (orange) Superimposition of the representative structures(left) and zoomed (right)

Lys120

Gln262

Ser216

Asp181

Arg221

Gln226

Cys215

Arg221



identify galactomannan as a potential active component offenugreek seeds with a docking score compared to estab-lished drugs such as canagliflozin and anastrozole in bindingsimulations of therapeutics against type-2 diabetes and breastcancer respectively These results establish galactomannanderived from fenugreek seeds as a potential candidate forfurther drug discovery experiments in establishing theirvalue as therapeutics against type-2 diabetes and breastcancer

Data Availability

The data used to support the findings of this study areavailable from the corresponding author upon request


The authors declare that they have no conflicts of interest

Authorsrsquo Contributions

Shailima Rampogu and Saravanan Parameswaran con-tributed equally to this work

Acknowledgments

This research was supported by the Pioneer Research CenterProgram (NRF-2015M3C1A3023028) through the National


Table 7 Comparative assessment between dock scores and the binding energies type 2 diabetes systems

S no Name of the compound -CDOCKER interaction energy Average binding energy (kJmol)1 canagliflozin 3655 -51752 galactomannan 4319 -6811

0

05

1

15

2

25

3

35

Num

ber

2000 4000 6000 8000 100000Time (ps)




0

2

4

6

8

10

12

Num

ber

2000 4000 6000 8000 100000Time (ps)



0minus20minus40minus60minus80

minus100minus120

Bind

ing

energy

(kJ

mol

)

0 2000 4000 6000 8000 10000

Time (ps)

Figure 15 MMPBSA binding energy representation of the refer-ence and the candidate compound


0 2000 4000 6000 8000 10000

Time (ps)0

minus10minus20minus30minus40minus50minus60minus70minus80minus90

minus100

Bind

ing

energy

(kJ

mol

)


Research Foundation of Korea (NRF) funded by theMinistryof Science ICT and Future Planning

References

[1] K C Nagulapalli Venkata A Swaroop D Bagchi and ABishayee ldquoA small plantwith big benefits Fenugreek (Trigonellafoenum-graecum Linn) for disease prevention and healthpromotionrdquo Molecular Nutrition amp Food Research vol 61 no6 Article ID 1600950 2017

[2] C Poole B Bushey C Foster et al ldquoThe effects of a commer-cially available botanical supplement on strength body com-position power output and hormonal profiles in resistance-trained malesrdquo Journal of the International Society of SportsNutrition vol 7 2010

[3] S Shabbeer M Sobolewski R K Anchoori et al ldquoFenugreek anaturally occurring edible spice as an anticancer agentrdquo CancerBiology ampTherapy vol 8 no 3 pp 272ndash278 2009

[4] S AWani and P Kumar ldquoFenugreek A review on its nutraceu-tical properties and utilization in various food productsrdquoJournal of the Saudi Society of Agricultural Sciences vol 17 no2 pp 97ndash106 2018

[5] E Basch C Ulbricht G Kuo P Szapary and M Smith ldquoTher-apeutic applications of fenugreekrdquoAlternativeMedicine Reviewvol 8 no 1 pp 20ndash27 2003

[6] D Tiran ldquoThe use of fenugreek for breast feeding womenrdquoComplementary Therapies in Nursing and Midwifery vol 9 no3 pp 155-156 2003

[7] K Szabo R Gesztelyi N Lampe et al ldquoFenugreek (TrigonellaFoenum-Graecum) Seed Flour and Diosgenin Preserve Endo-thelium-DependentArterial Relaxation in aRatModel of Early-Stage Metabolic Syndromerdquo International Journal of MolecularSciences vol 19 no 3 p 798 2018

[8] N Sharma S Suresh A Debnath and S Jha ldquoTrigonellaseed extract ameliorates inflammation via regulation of theinflammasome adaptor protein ASCrdquo Frontiers in Bioscience -Elite vol 9 no 2 pp 246ndash257 2017

[9] K Pundarikakshudu D H Shah A H Panchal and G CBhavsar ldquoAnti-inflammatory activity of fenugreek (Trigonella


foenum-graecum Linn) seed petroleum ether extractrdquo IndianJournal of Pharmacology vol 48 no 4 pp 441ndash444 2016

[10] G Sethi M Shanmugam S Warrier et al ldquoPro-Apoptotic andAnti-Cancer Properties of Diosgenin A Comprehensive andCritical Reviewrdquo Nutrients vol 10 no 5 p 645 2018

[11] A R Shivashankara A Azmidah R Haniadka M P Rai RArora and M S Baliga ldquoDietary agents in the prevention ofalcohol-induced hepatotoxicty Preclinical observationsrdquo Foodamp Function vol 3 no 2 pp 101ndash109 2012

[12] S Kaviarasan and C V Anuradha ldquoFenugreek (Trigonellafoenum graecum) seed polyphenols protect liver from alcoholtoxicity a role on hepatic detoxification system and apoptosisrdquoDie Pharmazie vol 62 no 4 pp 299ndash304 2007

[13] D BanoH TabassumAAhmadAMabood and I Z AhmadldquoThe medicinal significance of the bioactive compounds oftrigonella foenum-graecum a reviewrdquo International Journal ofResearch in Ayurveda amp Pharmacy vol 7 no 4 pp 84ndash91 2016

[14] S Goyal N Gupta and S Chatterjee ldquoInvestigating therapeuticpotential of trigonella foenum-graecum L As our defensemechanism against several human diseasesrdquo Journal of Toxicol-ogy vol 2016 2016

[15] R Premanath J Sudisha N L Devi and S M Aradhya ldquoAnti-bacterial and anti-oxidant activities of fenugreek (Trigonellafoenum graecum L) leavesrdquo Research Journal of MedicinalPlant vol 5 no 6 pp 695ndash705 2011

[16] R Haouala S Hawala A El-Ayeb R Khanfir and N Bough-anmi ldquoAqueous and organic extracts of Trigonella foenum-graecum L inhibit the mycelia growth of fungirdquo Journal ofEnvironmental Sciences vol 20 no 12 pp 1453ndash1457 2008

[17] A Ahmad S S Alghamdi K Mahmood and M Afzal ldquoFenu-greek a multipurpose crop Potentialities and improvementsrdquoSaudi Journal of Biological Sciences vol 23 no 2 pp 300ndash3102016

[18] E Altuntas E Ozgoz and O F Taser ldquoSome physical propertiesof fenugreek (Trigonella foenum-graceum L) seedsrdquo Journal ofFood Engineering vol 71 no 1 pp 37ndash43 2005

[19] S Rizvi and N Mishra ldquoTraditional Indian Medicines Usedfor the Management of Diabetes Mellitusrdquo Journal of DiabetesResearch vol 2013 Article ID 712092 pp 1ndash11 2013

[20] M S Kirkman V J Briscoe N Clark et al ldquoDiabetes in olderadultsrdquo Diabetes Care vol 35 no 12 pp 2650ndash2664 2012

[21] H Schneider J Shaw and P Zimmet ldquoGuidelines for theDetec-tion of DiabetesMellitus - Diagnostic Criteria and Rationale forScreeningrdquo The Clinical Biochemist Reviews vol 24 no 3 pp77ndash80 2003

[22] L Bellamy J P Casas A D Hingorani and D Williams ldquoType2 diabetesmellitus after gestational diabetes a systematic reviewandmeta-analysisrdquoTheLancet vol 373 no 9677 pp 1773ndash17792009

[23] F H Moghadam B Vakili-Zarch M Shafiee and A MirjalilildquoFenugreek seed extract treats peripheral neuropathy in pyri-doxine induced neuropathic micerdquo EXCLI Journal vol 12 pp282ndash290 2013

[24] A Gaddam C Galla S Thummisetti R K Marikanty U DPalanisamy and P V Rao ldquoRole of Fenugreek in the preventionof type 2 diabetes mellitus in prediabetesrdquo Journal of Diabetesand Metabolic Disorders vol 14 no 1 2015

[25] Z Madar R Abel S Samish and J Arad ldquoGlucose-loweringeffect of fenugreek in non-insulin dependent diabeticsrdquo Euro-pean Journal of Clinical Nutrition vol 42 no 1 pp 51ndash54 1988

[26] M Attokaran Effectiveness of phytotherapy in supportive treat-ment of type 2 diabetesmellitus II Fenugreek (Trigonella foenum-graecum) Ceska a slovenska farmacie vol 64 pp 67ndash71 2015

[27] R D Sharma T C Raghuram and N S Rao ldquoEffect of fenu-greek seeds on blood glucose and serum lipids in type I dia-betesrdquo European Journal of Clinical Nutrition vol 44 1990

[28] G S Kumar A K Shetty K Sambaiah and P V SalimathldquoAntidiabetic property of fenugreek seed mucilage and spentturmeric in streptozotocin-induced diabetic ratsrdquo NutritionResearch vol 25 no 11 pp 1021ndash1028 2005

[29] N Neelakantan M Narayanan R J De Souza and R MVan Dam ldquoEffect of fenugreek (Trigonella foenum-graecum L)intake on glycemia A meta-analysis of clinical trialsrdquoNutritionJournal vol 13 no 1 article no 7 2014

[30] K K Khoja G Shafi T N Hasan et al ldquoFenugreek a naturallyoccurring edible spice kills MCF-7 human breast cancer cellsvia an apoptotic pathwayrdquo Asian Pacific Journal of CancerPrevention vol 12 no 12 pp 3299ndash3304 2011

[31] M I M Khalil MM Ibrahim G A El-Gaaly and A S SultanldquoTrigonella foenum (Fenugreek) Induced Apoptosis in Hepa-tocellular Carcinoma Cell Line HepG2 Mediated by Upregu-lation of p53 and Proliferating Cell Nuclear Antigenrdquo BioMedResearch International vol 2015 Article ID 914645 pp 1ndash112015

[32] S Vıgh Z Zsver-Vadas C Pribac et al ldquoFenugreek (Trigonellafoenum-graecum l) extracts are inducing dose-dependenthormetic response and cytotoxic effects in case of human breastcancer cell linesrdquo Studia Universitatis Vasile Goldis Arad SeriaStiintele Vietii vol 26 no 4 pp 435ndash448 2016

[33] S Rampogu M Son A Baek et al ldquoTargeting natural com-pounds against HER2 kinase domain as potential anticancerdrugs applying pharmacophore based molecular modellingapproachesrdquo Computational Biology and Chemistry vol 74 pp327ndash338 2018

[34] J Ferlay H R Shin F Bray D Forman C Mathers and DM Parkin ldquoEstimates of worldwide burden of cancer in 2008GLOBOCAN2008rdquo International Journal of Cancer vol 127 no12 pp 2893ndash2917 2010

[35] N Petrucelli M B Daly and G L Feldman ldquoHereditary breastand ovarian cancer due to mutations in BRCA1 and BRCA2rdquoGenetics in Medicine vol 12 no 5 pp 245ndash259 2010

[36] A Amin A Alkaabi S Al-Falasi and S A Daoud ldquoChemo-preventive activities of Trigonella foenum graecum (Fenugreek)against breast cancerrdquo Cell Biology International vol 29 no 8pp 687ndash694 2005

[37] G Wang and W Zhu ldquoMolecular docking for drug discoveryand development a widely used approach but far from perfectrdquoFuture Medicinal Chemistry vol 8 no 14 pp 1707ndash1710 2016

[38] S Rampogu A Baek A Zeb and K W Lee ldquoExplorationfor novel inhibitors showing back-to-front approach againstVEGFR-2 kinase domain (4AG8) employingmolecular dockingmechanism and molecular dynamics simulationsrdquo BMC Can-cer vol 18 no 1 2018

[39] X-Y Meng H-X Zhang M Mezei and M Cui ldquoMoleculardocking a powerful approach for structure-based drug discov-eryrdquoCurrent Computer-AidedDrug Design vol 7 no 2 pp 146ndash157 2011

[40] HWangN PampatiWMMcCormick and L BhattacharyyaldquoProtein nitrogen determination by kjeldahl digestion and ionchromatographyrdquo Journal of Pharmaceutical Sciences vol 105no 6 pp 1851ndash1857 2016


[41] F A Loewus ldquoImprovement in AnthroneMethod for Determi-nation of Carbohydratesrdquo Analytical Chemistry vol 24 no 1 p219 1952

[42] K Paech and M V Tracey Modern Methods of Plant Analysis Moderne Methoden der Pflanzenanalyse Springer Berlin Hei-delberg Berlin Heidelberg 1955

[43] V Rolland-Fulcrand M Rolland M-L Roumestant andJ Martinez ldquoChemoenzymatic synthesis of enantiomericallypure (2S3R4S)-4- hydroxyisoleucine an insulinotropic aminoacid isolated from fenugreek seedsrdquo European Journal ofOrganic Chemistry no 4 pp 873ndash877 2004

[44] P Kooiman ldquoStructures of the galactomannans from seeds ofAnnona muricata Arenga saccharifera Cocos nucifera Con-volvulus tricolor and Sophora japonicardquo Carbohydrate Re-search vol 20 no 2 pp 329ndash337 1971

[45] S S Nielsen ldquoDetermination of Moisture Contentrdquo in FoodAnalysis Laboratory Manual Food Science Texts Series pp 17ndash27 Springer US Boston MA 2010

[46] D Ghosh J GriswoldM Erman andW Pangborn ldquoStructuralbasis for androgen specificity and oestrogen synthesis in humanaromataserdquo Nature vol 457 no 7226 pp 219ndash223 2009

[47] G H Peters L F Iversen S Branner et al ldquoResidue 259 Isa Key Determinant of Substrate Specificity of Protein-tyrosinePhosphatases 1B and 120572rdquoThe Journal of Biological Chemistry vol275 no 24 pp 18201ndash18209 2000

[48] Y Toderika and N Ferguson ldquoCanagliflozin A new class ofantidiabetic agent targeting the sodium-glucose cotransporterrdquoCardiology in Review vol 22 no 2 pp 97ndash104 2014

[49] M Sanford andG L Plosker ldquoAnastrozole A review of its use inpostmenopausal women with early-stage breast cancerrdquo Drugsvol 68 no 9 pp 1319ndash1340 2008

[50] S Rampogu and M Rampogu Lemuel ldquoNetwork BasedApproach in the Establishment of the Relationship betweenType 2DiabetesMellitus and Its Complications at theMolecularLevel Coupled with Molecular Docking Mechanismrdquo BioMedResearch International vol 2016 Article ID 6068437 pp 1ndash62016

[51] V Zoete M A Cuendet A Grosdidier and O MichielinldquoSwissParam a fast force field generation tool for small organicmoleculesrdquo Journal of Computational Chemistry vol 32 no 11pp 2359ndash2368 2011

[52] S RampoguM Son C Park H Kim J Suh and K Lee ldquoSulfo-nanilide Derivatives in Identifying Novel Aromatase Inhibitorsby Applying Docking Virtual Screening and MD SimulationsStudiesrdquo BioMed Research International vol 2017 pp 1ndash17 2017

[53] S RampoguA BaekM Son et al ldquoComputational Explorationfor Lead Compounds That Can Reverse the Nuclear Morphol-ogy in Progeriardquo BioMed Research International vol 2017 pp1ndash15 2017

[54] D van der Spoel E Lindahl B Hess G Groenhof A E Markand H J C Berendsen ldquoGROMACS fast flexible and freerdquoJournal of Computational Chemistry vol 26 no 16 pp 1701ndash1718 2005

[55] B Hess H Bekker H J C Berendsen and J G E M FraaijeldquoLINCS a linear Constraint Solver for molecular simulationsrdquoJournal of Computational Chemistry vol 18 no 12 pp 1463ndash1472 1997

[56] T Darden D York and L Pedersen ldquoParticle mesh Ewald anNsdotlog(N) method for Ewald sums in large systemsrdquoThe Journalof Chemical Physics vol 98 no 12 pp 10089ndash10092 1993

[57] H J C Berendsen J P M Postma W F Van Gunsteren ADinola and J R Haak ldquoMolecular dynamics with coupling toan external bathrdquoThe Journal of Chemical Physics vol 81 no 8pp 3684ndash3690 1984

[58] M Parrinello and A Rahman ldquoPolymorphic transitions insingle crystals a new molecular dynamics methodrdquo Journal ofApplied Physics vol 52 no 12 pp 7182ndash7190 1981

[59] W Humphrey A Dalke and K Schulten ldquoVMD visualmolecular dynamicsrdquo Journal of Molecular Graphics vol 14 no1 pp 33ndash38 1996

[60] N A Baker D Sept S Joseph M J Holst and J A McCam-mon ldquoElectrostatics of nanosystems application to micro-tubules and the ribosomerdquo Proceedings of the National Acadamyof Sciences of the United States of America vol 98 no 18 pp10037ndash10041 2001

[61] R Kumari R Kumar and A Lynn ldquog mmpbsamdashAGROMACStool for high-throughput MM-PBSA calculationsrdquo Journal ofChemical Information andModeling vol 54 no 7 pp 1951ndash19622014

[62] M A Hossain K A S AL-Raqmi Z H AL-Mijizy A MWeliand Q Al-Riyami ldquoStudy of total phenol flavonoids contentsand phytochemical screening of various leaves crude extracts oflocally grownThymus vulgarisrdquoAsian Pacific Journal of TropicalBiomedicine vol 3 no 9 pp 705ndash710 2013

[63] R Yadav R Tiwari P Chowdhary and C K Pradhan ldquoA phar-macognostical monogroaph of Trigonella foenum-graecumseedsrdquo International Journal of Pharmacy and PharmaceuticalSciences vol 3 pp 442ndash445 2011

[64] Z Madar and I Shomer ldquoPolysaccharide Composition of aGel Fraction Derived from Fenugreek and Its Effect on StarchDigestion and Bile Acid Absorption in Ratsrdquo Journal of Agri-cultural and Food Chemistry vol 38 no 7 pp 1535ndash1539 1990

[65] M I Zafar and F Gao ldquo4-Hydroxyisoleucine A Potential NewTreatment for Type 2 Diabetes Mellitusrdquo BioDrugs vol 30 no4 pp 255ndash262 2016

[66] S D V Rampogu ldquoRole of breast cancer inhibitors on dia-betes mellitus- an in silico approachrdquo Journal of Diabetes andMetabolic Disorders vol 14 no 1 11 pages 2015

[67] H Ahmadieh and S T Azar ldquoType 2 Diabetes Mellitus OralDiabetic Medications Insulin Therapy and Overall BreastCancer Riskrdquo ISRN Endocrinology vol 2013 pp 1ndash8 2013

[68] J EThomasM Bandara E L Lee DDriedger and S AcharyaldquoBiochemical monitoring in fenugreek to develop functionalfood and medicinal plant variantsrdquo New Biotechnology vol 28no 2 pp 110ndash117 2011

Research ArticleIn Vitro and Ex Vivo Chemopreventive Actionof Mauritia flexuosa Products

Joilane Alves Pereira-Freire12 George Laylson da Silva Oliveira3

Layana Karine Farias Lima2 Carla Lorena Silva Ramos2 Stella Regina Arcanjo-Medeiros1

Ana Cristina Silva de Lima4 Sabrina Almondes Teixeira5

Guilherme Antocircnio Lopes de Oliveira2 Naacutercia Mariana Fonseca Nunes26

Vivianne Rodrigues Amorim26 Luciano da Silva Lopes26 Larissa Arauacutejo Rolim 7

Joaquim Soares da Costa-Juacutenior8 and PauloMichel Pinheiro Ferreira 26

1Department of Nutrition Federal University of Piauı 64607-670 Picos Brazil2Postgraduate Programs in Pharmaceutical Sciences and Biotechnology Federal University of Piauı 64049-550 Teresina Brazil3Department of Biology Center for Higher Studies of Coelho Neto State University of Maranhao 65620-000 Coelho Neto Brazil4Postgraduate Program in Biotechnology Federal University of Ceara 60020-181 Fortaleza Brazil5Postgraduate Program in Foods and Nutrition Federal University of Piauı 64049-550 Teresina Brazil6Department of Biophysics and Physiology Laboratory of Experimental Cancerology Federal University of Piauı64049-550 Teresina Brazil

7Department of Pharmaceutical Sciences Federal University of Vale do Sao Francisco 56304-205 Petrolina Brazil8Federal Institute of Piauı 64000-060 Teresina Brazil

Correspondence should be addressed to Paulo Michel Pinheiro Ferreira pmpfufpiedubr

Received 5 February 2018 Revised 14 April 2018 Accepted 2 May 2018 Published 3 June 2018

Academic Editor Sergio Faloni De Andrade

Copyright copy 2018 Joilane Alves Pereira-Freire et al This is an open access article distributed under the Creative CommonsAttribution License which permits unrestricted use distribution and reproduction in any medium provided the original work isproperly cited

Mauritia flexuosa (Arecaceae) known as ldquoBuritirdquo is a Brazilian palm tree with high economic potential for local communitiesHerein we investigated the phytochemistry profile and antioxidant potential of M flexuosa fruits and determined thebioaccessibility of phenolic compounds Peels revealed upper values for phenols flavonoids carotenoids tannins and ascorbicacid when compared to the pulps and endocarps All samples showed capacity to scavenger free radicals (05 10 20 40 and80mgmL) but peels presentedhigher scavenger action in allmethods explored Phenolic compounds identifiedbyHPLCdisplayedreduced bioaccessibility after in vitro simulated gastrointestinal digestion for pulp (387) peel (187) and endocarp (223)extracts (119875 lt 005) Buriti fruits also protected rat blood cells against lysis induced by peroxyl radicals We demonstrated thepromising chemopreventive potentialities ofM flexuosa fruits and their by-products and peels with higher quantities of bioactivecompounds and phenolic substances before and after in vitro bioaccessibility investigation In Brazil these parts are discarded orunderused mainly as feed for ruminant animals Consequently it is extremely important to explore nutritional characteristicsof these by-products for humanlivestock foods and to install biofriendly techniques and sustainable biotechnology handling ofnatural resources

1 Introduction

Bioactive compounds have natural functions in plants suchas sensory properties (color aroma flavor and astringency)and defense against microorganisms and predators [1] On

the other hand intake of vegetal nutrients has functionalbenefits for consumers and enables increasing supply forhealthy foods A diet rich in antioxidant compounds asso-ciated with endogenous enzymatic mechanisms can helpto minimize the development of oxidative damage caused



by free radicals (free electrons) mainly reactive oxygen(ROS)nitrogen (RNS)sulfur (RSS)and chlorine speciessince these unstable molecules are consequence of nor-mal andor unbalanced metabolic activities and studieshave demonstrated epidemiological and biological correla-tions with chronic or nonchronic diseases such as hyper-cholesterolemia atherosclerosis hypertension ischemia-reperfusion injury inflammation cystic fibrosis diabetesParkinsonrsquos disease Alzheimer cancer and aging processitself or premature aging [2ndash8]

In this context plant species produce secondary metabo-lites belonging to different chemical groups such as alkaloidsand cyanogenic glycosides and nonnitrogenous compoundssuch as tannins flavonoids terpenes and anthocyaninswhich present antioxidant activity [9ndash12]

ldquoBuritirdquo Mauritia flexuosa L f belongs to the familyArecaceae a palm tree widely distributed in South Americaespecially in the Amazon region and Brazilian Cerradowhere it has demonstrated high economic potential for thebiotechnology development based on the sustainability ofnatural resources In the Brazilian food industry the peel andendocarp are commonly discarded or underutilized for thepreparation of candies ice creams juices jams porridgesandor oils [13] Additionally some studies have emphasizedpharmacological potentialities of the M flexuosa parts suchas antimicrobial [14ndash16] antitumor [16] hypolipemiant [17]hypoglycemiant [18] and healing activities [19]

For exotic and underexploited plants in particular thereis little and shallow knowledge about key interfering factorsin the biological significance of foods on human healthintake of nutrients and their bioaccessibilitybioavailabilitythroughout the gastrointestinal tract [20 21] In this per-spective the development of studies on the use of regionaland tropical fruits should be encouraged advancing aboutthe knowledge and exploring the use of fresh fruits forResearch and Development (RampD) of novel products [2223] Herein we investigated the phytochemistry profile andantioxidant potential of M flexuosa fruits and determinedthe bioaccessibility of phenolic compounds using in vitrosimulated gastrointestinal digestion


21 Chemical Reagents Chemical reagents 22-diphenyl-1-picrylhydrazyl (DPPH∙) 220-azino-bis(3-ethylbenzothia-zoline-6-sulfonic acid) (ABTS∙+) thiobarbituric acid trichlo-roacetic acid ferric chloride potassium ferricyanide dihy-drochloride 221015840-azobis(2-amidinopropane) dihydrochloride(AAPH) sodium nitroprusside (SNP) Triton X-100 Folin-Ciocalteu sodium carbonate gallic acid aluminum chloridequercetin 120573-carotene potassium iodide and potassium per-sulfate were obtained from Sigma-AldrichCo (St LouisMOUSA)

22 Plant Material Origin and Preparation A sample ofMauritia flexuosa was deposited in the Graziela BarrosoHerbarium at Federal University of Piauı (UFPI) (voucherspecimen 30567) About 300 fruits were collected inAgua Branca Piauı Brazil in December 2014 (latitude

5∘54101584050510158401015840S longitude 42∘38101584003410158401015840W) and taken to the Fed-eral Institute of Piauı Teresina Brazil Fruits were selectedregarding sanity and same maturation stage and cleaned inwater containing 25 ppm of commercial sodium hypochlo-rite These fruits presented an elongated oval shape sur-rounded by the epicarp (peel) of reddish brown color meso-carp (pulp) orange and endocarp with a white or yellowishspongy tissue [24] Subsequently fruits were separated inpulp peel and endocarp These parts were frozen separatelyat minus70∘C For the lyophilization process stainless steel trayof lyophilizer model L101 (Liotop Sao Carlos Brazil) wasused Lyophilization conditions (temperature 40∘C vacuumpressure lt500mmHg lyophilization rate 1mh) were wellcontrolled during 72 h [25] After such process fruits werepackaged in plastic bags under refrigeration at 4∘C beforeprocess for preparation of powder samples using rotor mill(008mm) (Figure 1)

23 Content of Phenols Flavonoids Carotenoids Tannins andAscorbic Acid Pulverized pulp peel and endocarp sampleswere submitted to extraction of bioactive compounds withmethanol Samples were mixed with mortar and pestle for10min (1 10 samplesolvent) until reaching uniform consis-tency Methanol extracts were stored at 4∘C for 2 days up toquantification of bioactive compounds (phenols flavonoidscarotenoids and tannins) and antioxidant activity respec-tively All analyses of bioactive compounds were carried outin quintuplicate

231 Total Phenolics The total phenolic content was deter-mined with Folin-Ciocalteu reagent according to [3] withsome modifications For 1mL of pulp peel and endo-carp methanol solution (10mgmL) 1mL of Folin-Ciocalteureagent (1 4) and 1mL of 15 sodium carbonate (Na2CO3)were added and the final volumewas filledwith distilledwaterto 10mLThemixture wasmaintained for 2 h and centrifugedat 4000 rpm during 4min The supernatant was measuredat 750 nm Stock solution without fruit parts was used asnegative control Results were expressed as mg of gallic acidequivalents per 100 g of sample (mg GAE100 g sample) and agallic acid calibration curve was determined (09497119909 119910 = minus00527 1199032 = 0999)

232 Total Flavonoids The content of total flavonoidswas determined based on the formation of the flavonoid-aluminum complex according to [3] with some modifica-tions For 1mL of pulp peel and endocarpmethanol solution(10mgmL) 1mL of 20 aluminum chloride and 100120583L of50 acetic acid were added The mixture was maintainedfor 30min and centrifuged at 4000 rpm during 4min Thesupernatant was measured at 420 nm Results were expressedas mg of quercetin equivalent per 100 g of sample (mgEQE100 g sample) and a quercetin calibration curve wasprepared (119910 = 00136119909 minus 00422 1199032 = 0999)

233 Total Carotenoids Total carotenoids were determinedaccording to [26] with some modifications A total of 01 g ofpulp peel and endocarp diluted in 10mL of acetone hexanesolution (4 6) was stirred for 10min at room temperature


Figure 1 Preparation ofMauritia flexuosa fruits lyophilization pulverization and stocking preceded phytochemical and biological analysis

(400 rpm) and centrifuged for 4min at 4000 rpm Readingwas performed at 450 nm and the results were expressedas mg of 120573-carotene equivalent per 100 g of sample (mg120573CTE100 g sample) A 120573-carotene calibration curve wasprepared (119910 = 03099119909 minus 0341 1199032 = 0991)

234 Condensed Tannins The content of condensed tanninswas determined using the methodology of vanillin [27] Tothe methanol solution containing 1mL of pulp peel andendocarp (10mgmL) 3mL of 2 vanillin prepared withsulfuric acid (70) was added Subsequently the reactionmixture was performed in water bath at 20∘C for 15minSamples were centrifuged for 4min at 4000 rpm and readingwas carried out in digital spectrophotometer at 500 nmResults were expressed as milligrams of catechin equivalentsper gram of sample (mg CTQ100 g sample) A catechincalibration curve was performed (119910 = 0008119909 + 0096 1199032 =0999)

235 Hydrolysable Tannins The hydrolysable tannin con-centration was determined using potassium iodide accordingto [28] One milliliter of saturated potassium iodide solutionwas added to the methanol solution containing 3mL of

pulp peel and endocarp (10mgmL) and allowed to rest atroom temperature for 40min and centrifuged for 4 minutesat 4000 rpm and the absorbance was measured at 550nmResults were expressed as mg of tannic acid equivalents pergram of sample (mg ACT100 g sample) and a tannic acidcalibration curve (00122119909 + 119910 = 026 1199032 = 0981) wasperformed

236 Ascorbic Acid Ascorbic acid content was determinedusing the titrimetric Tillmansrsquo method We used a solutionof oxalic acid as a solvent to substitute metaphosphoric acidTwenty milliliters was mixed with 80mL of 1 oxalic acidand 10mLof such solutionwas titratedwith Tillmans reagentusing 26-dichlorophenolindophenol Results were calculatedbased on a standard solution of ascorbic acid and expressedin mg100mL

24 In Vitro Quantification of Total Phenolics after SimulatedGastrointestinal Digestion The digestion was performedusing simulated gastric (pepsin solubilized with 01molLHCl) and intestinal fluids (pancreatin-bile salts solubilizedwith 01molL NaHCO3) which were prepared according to[29] We added 1mL of pulp peel and endocarp methanol


solution (10mgmL) to 100mLof 001molLHCl and pHwasadjusted to 2 with 2molL HCl solution Equal quantity ofphenols was used as positive control (10mgmL) Afterwards32mL of pepsin was added maintaining samples understirring at 37∘C for 2 h to simulate food digestion in thestomachThen to simulate the pH found in human intestinestitration was carried out with 05molL NaOH to obtain pH75 Subsequently a dialysis process was performed for 2 h(dialysis membrane with 33 times 21mm molecular weight of12000 to 16000 and porosity of 25 angstroms Inlab Brazil)with 01molL NaHCO3 equivalent to titratable acidity AfterpH adjustment dialysis membranes were added and thesolution was stirred in water bath at 37∘C30minThen 5mLof pancreatin-bile salts solution was added and the mixturewas stirred again for additional 2 h to mimic food digestionin the intestine Finally themembrane content (dialysate) wasremoved and samples were stored at 20∘C until analysis

Finally dialyzed material was analyzed to determine totalphenolics [3] Results were expressed as mg gallic acid100 gsample The bioaccessible percentage was calculated accord-ing to [20] bioaccessible = 100 times (DPCCPC) where Fis the content of dialyzable phenolic compounds (mg gallicacid100 g sample) and G corresponds to the content ofphenolic compounds in the sample (mg gallic acid100 gsample)

25 In Vitro Antioxidant Capacity For in vitro antioxi-dant evaluation the antioxidant capacity of the sampleswas assayed against 11-diphenyl-2-picrylhydrazyl [DPPH∙][30] 221015840-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid[ABTS∙+] [31] reducing potential [Fe3+Fe2+] [32] lipid per-oxidation [thiobarbituric acid reactive substances (TBARS)removal [33 34] and nitrite content [nitrite productioninduced by sodium nitroprusside [35 36] Aqueous stocksolutions of the samples (pulp peel and endocarp 0510 20 40 and 80mgmL) DPPH∙ (40 120583gmL) ABTS∙+(7mM) 1 potassium ferricyanide sodium nitroprusside(10mM) and 067 thiobarbituric acid were preparedTrolox (05mgmL) was used as positive standard

Values of 50 effective concentration (EC50) for Buritiextracts were spectrophotometrically quantified (T80+UVVIS Spectrometer PG Instruments Ltd LeicestershireUK) at 515 nm for DPPH∙ 734 nm for ABTS∙+ 700 nm forpotassium ferricyanide 532 nm for TBARS (thiobarbituricacid reactive substances) and 540 nm for nitrite radicals30min after the reaction started Antioxidant evaluation wasperformed in triplicate from two independent experimentsand absorbance values were converted to the inhibitionpercentage (I) of radicals using the equation of [37] () =[(absorbance of negative control minus absorbance of sample) times100]absorbance of negative control where absorbance ofnegative control is for example the initial absorbance forDPPH∙ solution and absorbance of sample is the absorbancefor reaction mixture (DPPH∙ and sample)

26 Ex Vivo Analysis on Murine Erythrocytes All procedureswere approved by the Committee on Animal Research atUFC (0542014) and they are in accordance with Brazilian(COBEA Colegio Brasileiro de Experimentacao Animal) and

international guidelines on the care and use of experimentalanimals (Directive 201063EU of the European Parliamentand of the Council)

Blood was collected from retroorbital plexus of anes-thetized female Wistar rats (180ndash220 g) with ketamine(90mgkg ip) and xylazine (10mgkg ip) Blood wasmixed with 085 NaCl solution containing 10mM CaCl2and submitted to three centrifugations (2000 rpm5min)Erythrocytes were suspended in NaCl to obtain a cell sus-pension (10) Hemolytic investigations were performed in96-well plates following the method described by [38]

261 Hemolytic Capacity Determination Each well received50120583L of 085 NaCl The first well was the negative controlthat contained only the vehicle (PBS) and in the second well50120583L of test substance that was diluted in half was addedThe extracts were tested at concentrations ranging from 05to 8 gmL The last well received 50 120583L of 02 Triton X-100 (in 085 saline) to obtain 100 hemolysis Then eachwell received 50120583L of a 10 suspension of mice erythrocytesin 085 saline containing 10mM CaCl2 After incubationat room temperature for 2 h cells were centrifuged thesupernatant was removed and the liberated hemoglobin wasmeasured spectroscopically as absorbance at 540 nm Forcomparison a solution of 05mgmL Triton X-100 was usedas positive control

262 Antioxidant Capacity against Oxidative HemolysisThe antioxidant capacity against oxidative hemolysis wasperformed by inhibition of oxidative hemolysis induced byperoxyl radicals generated following thermal decompositionof 221015840-azobis(2-amidinopropane) dihydrochloride (AAPH)inmethod described by [39] with somemodifications Brieflyaliquots of pulp peel and endocarp aqueous extracts (05to 8mgmL) were mixed with 30120583L of 10 erythrocytesuspension and 50 120583L of AAPH (200mM in PBS pH 74) in96-well plates The reaction mixture was incubated for 120minutes at 37∘CAfterwards the reactionmixturewas dilutedwith 240 120583L of PBS and centrifuged at 2000 rpm for 5min andthe liberated hemoglobin was measured spectroscopically asabsorbance at 540 nm Results were expressed as percentageinhibition of hemolysis compared to the complete hemolysisof erythrocyte suspensions induced by AAPH Liberatedhemoglobin was measured spectroscopically as absorbanceat 540 nm The inhibition of erythrocyte hemolysis was cal-culated as (1 minus119860 sample119860control) times 100 Trolox (05mgmL)was used as positive standard

27 Chromatographic Analysis For chromatographic anal-ysis methanol extracts of pulp peel and endocarp wereused Mobile phases were represented by solvents AndashC usingthree pumps associated with the chromatograph (Shimadzuliquid chromatograph with a diode array detector Japansolvent A 01 trifluoroacetic acid in acetonitrile solventB 01 trifluoroacetic acid in HPLC grade water solvent C100 methanol) A TSK-GEL Super-ODS (Supelco) columnwas usedThe effluentwasmonitored at 250 and 330 nm Flowrate was fixed at 10mLmin and column temperature wasmaintained at 37∘C throughout the test Initially the solvent


Table 1 Quantification of phenols flavonoids carotenoids condensed tannins and hydrolysable tannins in the lyophilized methanolicextracts of pulp peel and endocarp fromMauritia flexuosa fruits

Class ofcompounds Pulp Peel Endocarp

Total phenols(mg GAE100 g)

5535 plusmn 77b 12880 plusmn 104ac 5971 plusmn 65b

Total flavonoids(mg EQE100 g) 2644 plusmn 21bc 3394 plusmn 39ac 1454 plusmn 102ab

Total carotenoids(mg 120573CTE100 g) 589 plusmn 01bc 883 plusmn 03ac 191 plusmn 02ab

Hydrolysabletannins(mg ACT100 g)

474 plusmn 03bc 562 plusmn 04ac 01 plusmn 002ab

Condensed tannins(mg CTQ100 g)


Ascorbic acid(mg100mL) 43 plusmn 13c 59 plusmn 02c 25 plusmn 03ab

Data were presented as mean plusmn standard error of the mean (SEM) a119875 lt 005 compared to pulp b119875 lt 005 compared to peel c119875 lt 005 compared to endocarpby ANOVA followed by Student-Newman-Keuls test

was represented by 100 solvent B but a linear gradient wasused to increase solvent A from 0 to 10 within 7min Itscomposition was maintained at an isocratic flow for 3minThen solvent A increased from 10 to 40 during 20minSuch composition was maintained for additional 2min andreturned to the initial condition in 3min A volume of 20 120583Lfor the standards substances and samples was injected foreach HPLC analysis

28 Statistical Analysis Data were presented as mean plusmnstandard error of the mean (SEM) and compared by one-way analysis of variance (ANOVA) followed by Student-Newman-Keuls test usingGraphPadPrism software 50 (SanDiego CA USA) EC50 values were calculated by nonlinearregression (95) Statistical correlation among experimentaldata was performed using the Pearson coefficient (119903) andresults were statistically significant when 119875 lt 005

3 Results

31 Bioactive Compounds and Bioaccessibility The screeningof bioactive compounds in M flexuosa fruit is describedin Table 1 Peel revealed the highest values for phenols(12880 plusmn 104mg GAE100 g) flavonoids (3394 plusmn 39mgEQE100 g) carotenoids (883 plusmn 03mg 120573CTE100 g) tannins(hydrolysable 562 plusmn 04mg ACT100 g condensed 1183 plusmn21mg CTQ100 g) and ascorbic acid (59 plusmn 02mg100mL)when compared to the pulp and endocarp (119875 lt 005)

The correlation of chromatographic peaks was achievedby comparison of experimental retention times (119905119877) withreference standards (Table 2) All chromatographic analyseswere carried out in triplicate and revealed phenolic com-pounds (protocatechuic acid quercetin apigenin catechinand epicatechin) with the following 119905119877 163 336 417 536and 493 minutes respectively

Subsequently we analyzed the quantity of phenolic com-pounds before and after in vitro simulated gastrointestinaldigestion for pulp peel and endocarp (Table 3) All samples(pulp peel and endocarp) displayed reduction in bioac-cessibility after in vitro digestion of 387 187 and 223respectively (119875 lt 005)

32 In Vitro AntioxidantCapacity In this step we carried outquantification of the antioxidant capacity of Buriti samples(pulp peel and endocarp) at concentrations of 05 1 2 4 and8mgmL This capacity is described as free radical inhibition(Figure 2)

For all parameters and samples we determined EC50values 16 plusmn 01 01 plusmn 01 and 15 plusmn 01mgmL (DPPH∙)23 plusmn 01 01 plusmn 01 and 19 plusmn 01mgmL (ABTS∙+) 21 plusmn 0312 plusmn 01 and 19 plusmn 04mgmL (potassium ferricyanide)16plusmn02 07plusmn01 and 23plusmn02mgmL (TBARS) and 26plusmn0111plusmn01 and 64plusmn014mgmL (nitrite content) for pulp peeland endocarp respectively Trolox (05mgmL) the positivestandard showed free radical inhibition capacity upper to90 for the antioxidant assessments (Figure 2)Then all sam-ples showed growing capacity in a concentration-dependentmanner to scavenger free radicals but it is important to notethat peelsrsquo samples presented a higher scavenger capacity inall methods explored (119875 lt 005)

33 Antioxidant Capacity against Oxidative HemolysisFirstly we analyzed the capacity of the samples to causehemolysis None of the extracts induced lysis of raterythrocytes even 80mgmL On the other hand TritonX-100 used as positive control caused 100 hemolysis

Based on these promising findings (scavenger of freeradicals and absence for cellular lysis) we evaluated theantioxidant capacity against oxidative hemolysis induced byAAPH (100 hemolysis) Once again all concentrations


Table 2 Identification of compounds by high-performance liquid chromatography (HPLC) inMauritia flexuosa samples

IUPAC NameChemical Name Chemical structures Class Retention time

(min) Sample

34-Dihydroxybenzoic acid(protocatechuic acid) Phenol 163 Pulp

2-(34-dihydroxyphenyl)-357-trihydroxychromen-4-one(quercetin)

Flavonoid 336 Pulp

4101584057-Trihydroxyflavone(apigenin) Flavonoid 417 Pulp

Endocarp

(minus)-trans-3310158404101584057-pentahydroxyflavane(2S3R)-2-(34-dihydroxyphenyl)-34-dihydro-1(2H)-benzopyran-357-triol(catechin)

Condensed tannin 536Endocarp

PeelPulp

(minus)-cis-3310158404101584057-pentahydroxyflavane(2R3R)-2-(34-dihydroxyphenyl)-34-dihydro-1(2H)-benzopyran-357-triol(epicatechin)

Condensed tannin 483 Peel

Table 3 Contents of phenolic compounds in the lyophilized methanolic extracts of pulp peel and endocarp from Mauritia flexuosa fruitsbefore and after simulated gastrointestinal digestion

SampleBioaccessibility before in

vitro digestion(mgL)

Bioaccessibility afterin vitro digestion

(mgL)Reduction ()

Pulp 5535 plusmn 77 1022 plusmn 04lowast 187Peel 12880 plusmn 104 4985 plusmn 139lowast 387Endocarp 5971 plusmn 65 1334 plusmn 78lowast 223lowast119875 lt 005 compared to bioaccessibility before in vitro digestionby ANOVA followed by Student-Newman-Keuls test


05 1 2 4 80

20

40

60

80

100

(mgmL)

lowast

lowast lowastlowast

lowast

lowast

lowast

lowast lowast

lowast

lowast

lowast

lowastlowast

lowast

PulpPeel

EndocarpTrolox

lowastD

PPH

inhi

bitio

n (

)

(a)

PulpPeel

EndocarpTrolox

05 1 2 4 80

20

40

60

80

100

(mgmL)

lowastlowast lowast

lowast

lowast

lowastlowastlowast

lowastlowast

lowast

lowastlowast

lowastlowast

lowast

inhi

bitio

n (

)A

BTS+

(b)

PulpPeel

EndocarpTrolox

05 1 2 4 80

1

2

3

(mgmL)

lowast lowast

lowast lowastlowast

lowastlowast

lowastlowast

lowast

lowast lowast

lowast

lowast

lowastlowast

(absorbance)

Redu

cing

pot

entia

l(Fe

+F

e+)

(c)

PulpPeel

EndocarpTrolox

05 1 2 4 80

20

40

60

80

100

lowast

lowast

lowast

lowast

lowast

lowast

lowast

lowast

lowast

lowast

lowast

lowastlowast

lowast lowast

(mgmL)

lowast

TBA

RS in

hibi

tion

()

(d)

PulpPeel

EndocarpTrolox

05 1 2 4 80

20

40

60

80

100

(mgmL)

lowastlowast

lowastlowast

lowast

lowast

lowast

lowast lowast lowast

lowastlowast

lowast

lowastlowast

lowast

Nitr

ite co

nten

t inh

ibiti

on (

)

(e)

Figure 2 Effects of lyophilized fruits (pulp peel and endocarp) fromMauritia flexuosa (05 1 2 4 and 8mgmL) on the removal of (a) 11-diphenyl-2-picrylhydrazyl (DPPH∙) (b) 220-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS∙+) (c) reducing potential (Fe3+Fe2)(d) reactive substances to thiobarbituric acid [TBARS levels induced by 221015840-azo-bis (2-methylpropionamidine]) dihydrochloride AAPH)and (e) nitrite content (induced by sodium nitroprusside) Trolox (05mgmL) was used as positive standard Results are expressed as meanplusmn standard error of measurement (SEM) from two independent experiments in triplicate Negative control was treated with the solutionused for diluting the tested substance With exception of reducing potential absorbance values were converted to inhibition (119868) percentageof radicals 119868 () = [(absorbance of negative control minus absorbance of sample) times 100]absorbance of negative control lowast119875 lt 005 compared tonegative control by ANOVA followed by Student-Newman-Keuls test

used (05 10 20 40 and 80mgmL) were able to protectblood cells when compared to positive control exposed toperoxyl radicals generated following thermal decompositionof AAPH as follows pulp (150 plusmn 11 269 plusmn 07 276 plusmn 04368plusmn01 and 493plusmn27) peel (269plusmn06 469plusmn12 512plusmn03601plusmn08 and 743plusmn05) and endocarp (196plusmn17 257plusmn09285plusmn03 318plusmn05 and 402plusmn07) respectively (Figure 3)

Trolox showed an antioxidant perceptual protection of 732plusmn05EC50 valueswere 77plusmn04 18plusmn01 and 114plusmn05mgmLfor pulp peel and endocarp respectively

Pearsonrsquos correlation a measure of the strength oflinear relationship between two variables revealed a posi-tive relationship between bioactive compounds (total phe-nol total flavonoids total carotenoids and condensed and


Table 4 Analysis of Pearsonrsquos correlation among bioactive compounds and antioxidant capacity in samples of pulp peel and endocarp fromMauritia flexuosa

Class of compounds DPPH∙ ABTS∙+ Reducing potential TBARS Nitrite content Oxidative hemolysisPulp

Total phenols 0956lowast 0978lowast 0978lowast 0867 0931lowast 0954lowast

Total flavonoids 0957lowast 0979lowast 0978lowast 0869 0933lowast 0956lowast

Total carotenoids 0951lowast 0974lowast 0975lowast 0859 0926lowast 0951lowast

Condensed tannins 0955lowast 0977lowast 0978lowast 0866 0930lowast 0954lowast

Hydrolysable tannins 0923lowast 0953lowast 0956lowast 0822 0898lowast 0935lowast

PeelTotal phenols 0681 0847 0928lowast 0749 0854 0907lowast


Total carotenoids 0966lowast 0984lowast 0983lowast 0881lowast 0941lowast 0959lowast


Hydrolysable tannins 0972lowast 0988lowast 0987lowast 0890lowast 0947lowast 0961lowast

EndocarpTotal phenols 0682 0848 0930lowast 0751 0854 0907lowast



Condensed tannins 0952lowast 0975lowast 0976 lowast 0861 0927lowast 0952lowast

Hydrolysable tannins 0948lowast 0972lowast 0973 lowast 0855 0923lowast 0950lowastlowast119875 lt 005 Pearsonrsquos correlation coefficient was calculated using Studentrsquos 119905-test for all variables at 5 significance levels 11-Diphenyl-2-picrylhydrazyl

(DPPH∙) 221015840-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid (ABTS∙+) reducing potential (Fe3+Fe2) reactive substances to thiobarbituric acid [TBARSlevels induced by 221015840-azo-bis (2-methylpropionamidine]) dihydrochloride AAPH) and nitrite content (induced by sodium nitroprusside)

05 1 2 4 8(mgmL)

lowast

lowastlowast

lowast

lowast

lowast

lowast lowast

lowast

lowastlowast

lowast

lowast

lowastlowast

lowast

TroloxPulpPeel

Endocarp

0

20

40

60

80

Inhi

bitio

n of

oxi

dativ

ehe

mol

ysis

()

Figure 3 Protection against oxidative hemolysis induced by per-oxyl radicals generated following thermal decomposition of 221015840-azobis(2-amidinopropane) dihydrochloride (AAPH) by lyophilizedfruits (pulp peel and endocarp) fromMauritia flexuosa (05 1 2 4and 8mgmL) Trolox (05mgmL) was used as positive standardResults are expressed as mean plusmn standard error of measurement(SEM) from two independent experiments in triplicate Negativecontrol was treated with the solution used for diluting the testedsubstance lowast119875 lt 005 compared to control by ANOVA followed byStudent-Newman-Keuls test

hydrolysable tannins) and antioxidant capacity (119903 gt 0881119875 lt 005) and bioactive compounds and protection againstoxidative hemolysis (119903 gt 0907 119875 lt 005) (Table 4) On theother hand Pearsonrsquos correlation did not show associationbetween antioxidant activity against TBARS and presence of

bioactive compounds for most correlations analyzed (119875 gt005)

4 Discussion

Since oxidative damage contributes significantly to patholo-gies herein we performed different biochemical methods tosupport the antioxidant and functional action ofM flexuosafruits

Peels from M flexuosa fruits presented highest val-ues of bioactive compounds when compared to the pulpand endocarps Previously studies demonstrated that pulpextracts from Amazon Buriti have mainly quinic acid caf-feic acid chlorogenic acid ferulic acid p-Coumaric acidprotocatechuic acid catechin epicatechin luteolin apigeninmyricetin kaempferol and quercetin some of them alsofound in lower concentrations [18] Moreover as confirmedhere Buriti seems to be an excellent source of carotenoids(44600120583g100 g) especially 120572- and 120573-carotene and cis- andtrans-aacuteţđ-carotene [40ndash43] which are normally found in car-rots and are considered the most known and accepted sourceby consumers justifying its use to treat hypovitaminosis A

Our results presented differences per 100 g of dry mate-rial since Buriti samples were collected under natural con-ditions from Cerrado Brazilian (a type of savanna) and moststudies presented outcomes with fruits from Amazon regionThese findings are explained by differences in biome con-ditions Amazon is hot and humid while Cerrado presentsa dryer climate Besides the Cerrado soil is more acidand rich in aluminum salts which will probably generate


higher oxidative stress for the plants They react producingantioxidant agents [41]

Polyphenol substances with high in vitro antioxidantactivity do not necessarily have similar actions after gas-trointestinal process and absorption [20 44] Therefore weverified the bioaccessibility of phenolic compounds frompulp peel and endocarp methanol extracts For this we usedan in vitro method that has recently gained much attentionbecause it simulates the process of gastrointestinal digestionenabling studying changes that occur in the diet componentsduring gastric and intestinal digestion Moreover in vitrotechniques have the advantage to substitute animals and aretime-efficient and cost-effective and require less manpower[21 23 44 45] Interestingly M flexuosa methanol extractsshowed reduction of bioaccessible polyphenols after diges-tion simulation ranging from 187 (pulp) to 387 (peel)

It is important to note that only solubilized nutrients fromthe foodmatrix which are not destroyed during gastrointesti-nal digestion are bioaccessible and potentially bioavailable[22 23] Since dietary fiber components are not absorbedthey achieve the large intestine and provide the substratefor intestinal digestion Soluble fibers are usually fermentedquickly while insoluble fibers are slowly or only partiallyfermented The fermentation is carried out by anaerobicbacteria of the colon (eg Lactobacillus and Bifidobacteriumgenera) leading to the production of lactic acid short-chainfatty acids and gas events that can alter food componentsand their bioavailability [46] Furthermore the consumptionof high quantities of phytates and oxalates can cause chelationofmetal ions (eg calciumand zinc) and induce cholelithiasis[24]

Although M flexuosa fruits have been associated withmultiple nutritional properties that can be favorable tothe human health their fibers and polyphenols may linkto macromolecular compounds that are not dialyzable orgeneratemineral complexes further decreasing solubility andbioaccessibility of phenols [47 48] Furthermore becausedialysis process during in vitro gastrointestinal digestion sep-arates bioactive substances this can interfere with biologicalactivity and quantity of phenolic compounds which maywork more efficiently together rather than individually assynergists to reduce free radicals [49]

Investigators working with cashew fruits from Anacardi-um occidentaleL another typical natural delight fromBrazil-ianNortheast known as ldquocajurdquo ldquoacajuıbardquo and ldquoacajaıbardquo butmore popular accepted studied and economically exploitedthanM flexuosa also showed a considerable loss of phenoliccompounds in cashew apple juice and cashew apple fiberafter bioaccessibility tests mainly due to the type of foodmatrix elements and this often alters absorption of phenoliccompounds [44]

In vitro antioxidant activity is mainly based on chemicalassays that assess the ability of a substance to reduce theconcentration of free radicals in a specific reaction medium[50 51] Then we performed methods to determine the invitro scavenging actions

Firstly we used the DPPH method since it is a rapidsimple accurate and inexpensive assay for measuring theability of different compounds to act as free radical scavengers

or hydrogen donors and to evaluate the antioxidant activityof foods and beverages independent of sample polarity [1152] In the ABTS test 221015840-azino-bis (3-ethylbenzthiazoline-6-acid) (ABTS) is converted into its radical (ABTS∙+) byaddition of sodium persulphate and is reactive towards mostantioxidants Since it is not affected by ionic strength itcan be used to determine both hydrophilic and hydrophobicantioxidant capacities [10] The total antioxidant activity wasalso measured by the ferric reducing antioxidant power assayFlavonoids and phenolic acids presented in the medicinalplants exhibit strong antioxidant activity which is dependingon their potential to form the complex with metal atomsparticularly iron and copper This method is based on theprinciple of increase in the absorbance of the reaction mix-tures [32] Subsequently lipid peroxidation was determinedby TBARS removal Since polyunsaturated fatty acids are easytargets for oxidants and the process of lipid peroxidation isonce initiated a self-sustaining free radical chain processthe accumulation of lipid peroxidation products providesthe most common biochemical marker of oxidative stress[33 34] Finally nitrite ion technique was carried out basedon the decomposition of sodium nitroprusside in nitricoxide at physiological pH under aerobic conditions whichproduces nitrites [35 36] It was important to perform theevaluation of samples against RNS since these radicals maycause damage to biological components such as the aromaticamino acid tyrosine andDNAbases particularly in guaninesby nitration or hydroxylation [51]

Buriti samples presented antioxidant capacity and peelextracts were more active scavengers References [14] alsodemonstrated antioxidant potential in leaves (iron reductiontest) and fruit pulps (DPPHmethod) fromMauritia flexuosaDifferences in the antioxidant action found are probablyassociated with distinctive concentrations of the chemicalconstituents in each part of the plant mainly flavonoids andanthocyanins [53] So there is a huge possibility that thiseffect repeats in Buriti fruits in different Brazilian regionsonce M flexuosa in the ldquoCerradordquo biome is exposed to ahigher incidence of sunlight in a soil of dry climate [54]It is supposed that climate conditions interfere even inthe constitution of the general parts with average valuesof 221ndash251 11ndash242 210 and 326ndash639 for peel pulpendocarp and seed respectively [25 55]

Typically phenols and carotenoids are found in higherconcentrations in peels due to their pigmentation regulationof enzymatic activity and protection against sunlight andpathogenic microorganisms [1 56] So we noted superiorpresence of phenolic compounds (570 and 536) flavonoids(221 and 572) tannins (hydrolysable 157 and 998condensed 411 and 691) and ascorbic acid levels in peelswhen compared to pulp and endocarp respectively whichimproved antioxidant activity in peels respectively Takinginto consideration the fact that the Dietary Reference Intake(DRI) of ascorbic acid for adults is 45mgday [57] onecup with 200mL of peel extract from M flexuosa fruits(117mgmL) would correspond to 26 of the RDI whileconsumption of pulp would reach 191 Anyway it isimportant to note that vitamin C is converted to oxalate whenit is present in higher concentrations [24]


For M flexuosa fruit protection by antioxidant com-pounds is required and could be a reason for the higherconcentration of bioactive compounds found in the peel thanin pulp and endocarp Using Pearsonrsquos correlation we founda good correlation index among bioactive compounds andantioxidant capacity for pulp peel and endocarp fromMau-ritia flexuosa which supports the suggestion that protectionagainst oxidative hemolysis is directly associated with levelsof bioactive substances

Since vegetal extracts are rich in different classes of com-pounds that can attack or interact with cellular membraneshemolysis assay is frequently used to test materials com-pounds or mixture of compounds at defined pHs that mimicextracellular environments So the evaluation of membranestability during exposure to phytotherapeutic products mustbe routinely considered in their evaluation since the con-sumption of these products is increasing globally and mayconstitute a serious public health problem So membranestability represents the capacity of this biological complex tomaintain its structure under chaotropic conditions such ashypotonicity pH extremes heat and the presence of solutes(such as ethanol urea and guanidine) and oxidative stress[38 58ndash60] When submitted to the cell assays none ofthe Buriti samples caused lysis of erythrocytes and reversedhemolysis induced by peroxyl radicals and once again betterresults were found with peel extracts

The antihemolytic action described for fruit extracts fromM flexuosa may be associated with an osmotic stabilizationof erythrocytes It is possible that the exacerbation of Van derWaals contacts inside the lipid bilayer could be a source ofmembrane stabilization though such membrane protectionis normally related to the prevention of lipoperoxidationtriggered by secondary metabolites such as flavonoids andphenols that can be incorporated into erythrocyte mem-branes [39 58 61] Indeed there is a strong correlationbetween thiobarbituric acid-reactive substances (TBARS) asa marker of lipid peroxidation and products that protectcells against oxidative damage [50] Such protection canexplain at least in part some folk uses and pharmacologicalproperties of these fruits such as protective effects againstcognitive impairment [24 62] antiplatelet antithrombotic[63] lowering cholesterol [43 64] and healing [19 41]activities

5 Conclusions

In summary the antioxidant analysis of M flexuosa fruitsand their by-products showed promising chemopreventivepotentialities and peels demonstrated higher quantities ofbioactive compounds and phenolic substances before andafter in vitro bioaccessibility investigation Since the pro-cessing of M flexuosa fruits generates a large quantity ofagricultural residues such as peels endocarps and seedsmost of them are commonly discarded or are used as feed forruminant animals only especially after production of sweetsand oil extraction Consequently it is extremely important toexplore the nutritional characteristics of these by-productsfor humanlivestock foods and to install biofriendly tech-niques and sustainable biotechnology handling of natural

resources For Brazilian local communities it is really impor-tant to reuse such residues especially for people from poorregions as a way to give better opportunities and improvequality of life

Data Availability



All authors declare that there are no conflicts of interest

Acknowledgments

This research was partially funded by the public Brazilianagency ldquoFundacao do Amparo a Pesquisa do Estado do Piauırdquo[FAPEPI (Grant no 0042016)] The corresponding author isgrateful toConselhoNacional deDesenvolvimentoCientıficoe Tecnologicordquo [CNPq (3050862016-2)] for the personalscholarship

References

[1] M Murkovic ldquoPhenolic compounds occurrence classes andanalysisrdquo inThe Encyclopedia of Food and Health B CaballeroP Finglas and F Toldra Eds pp 346ndash351 2016

[2] C C Benz and C Yau ldquoAgeing oxidative stress and cancerparadigms in parallaxrdquoNature Reviews Cancer vol 8 no 11 pp875ndash879 2008

[3] G L D S Oliveira A L Gomes-J R M Freitas et alldquoAssessment of antioxidant capacity in vitro and in vivo ofthe ethanol extract of Copernicia prunifera (Mill) HE MoorerdquoRevista Bszligsica e Aplicada vol 35 no 2 pp 293ndash300 2015

[4] E J F de Araujo G A L de Oliveira L Q de Sousa etal ldquoCounteracting effects on free radicals and histologicalalterations induced by a fraction with casearinsrdquo Anais daAcademia Brasileira de Ciencias vol 87 no 3 pp 1791ndash18072015

[5] G P Morais M V O B Alencar T Islam et al ldquoCytogenotoxicand oxidative status evaluation of Morinda citrifoliardquo Interna-tional Archives of Medicine vol 9 no 96 pp 1ndash13 2016

[6] J A Tur and M M Bibiloni ldquoFunctional foodsrdquo in TheEncyclopedia of Food and Health B Caballero P Finglas andF Toldra Eds pp 157ndash161 2016

[7] T Srdic-Rajic and A Konic Ristic ldquoAntioxidants role on healthand preventionrdquo in The Encyclopedia of Food and Health BCaballero P Finglas and F Toldra Eds pp 227ndash233 2016

[8] J A Rodrıguez-Sanchez M T Cruz y Victoria and B EBarragan-Huerta ldquoBetaxanthins and antioxidant capacity inStenocereuspruinosus Stability and use in foodrdquo Food ResearchInternational vol 91 pp 63ndash71 2017

[9] D Krishnaiah R Sarbatly and R Nithyanandam ldquoA review ofthe antioxidant potential of medicinal plant speciesrdquo Food andBioproducts Processing vol 89 no 3 pp 217ndash233 2011

[10] C Lopez-Alarcon and A Denicola ldquoEvaluating the antioxidantcapacity of natural products a review on chemical and cellular-based assaysrdquo Analytica Chimica Acta vol 763 pp 1ndash10 2013

[11] D F Farias T M Souza M P Viana et al ldquoAntibacterialantioxidant and anticholinesterase activities of plant seed


extracts from Brazilian semiarid regionrdquo BioMed ResearchInternational vol 2013 Article ID 510736 9 pages 2013

[12] J A Pereira-Freire K B N T Barros L K F Lima et al ldquoPhy-tochemistry profile nutritional properties and pharmacologicalactivities of Mauritia flexuosardquo Journal of Food Science vol 81pp 2611ndash2622 2016

[13] T L Chaves L Ricardo J de Paula-Souza and M D GL Brandao ldquoUseful Brazilian plants under the view of thewriter-naturalist Joao Guimaraes Rosardquo Revista Brasileira deFarmacognosia vol 25 no 5 pp 437ndash444 2015

[14] H H F Koolen F M A da Silva F C Gozzo A Q Lde Souza and A D L de Souza ldquoAntioxidant antimicrobialactivities and characterization of phenolic compounds fromburiti (Mauritia flexuosa L f) by UPLC-ESI-MSMSrdquo FoodResearch International vol 51 no 2 pp 467ndash473 2013

[15] H H Koolen E R Soares FM da Silva et al ldquoMauritic acid anew dammarane triterpene from the roots of rdquo Natural ProductResearch (Formerly Natural Product Letters) vol 27 no 22 pp2118ndash2125 2013

[16] E P Siqueira A A Andrade E M Souza-Fagundes et al ldquoInvitro antibacterial action onmethicillin susceptible (MSSA) andmethicillin-resistant (MRSA) Staphylococcus aureus and anti-tumor potential of Mauritia flexuosa L frdquo Journal of MedicinalPlants Research vol 8 no 48 pp 1408ndash1417 2014

[17] J S Aquino D C N D Pessoa K L G V Araujo et alldquoRefining of buriti oil (Mauritia flexuosa L) originated fromthe Brazilian Cerrado physicochemical thermal-oxidative andnutritional implicationsrdquo Journal of the Brazilian ChemicalSociety vol 23 no 2 pp 212ndash219 2012

[18] G A Bataglion F M A da Silva M N Eberlin and H H FKoolen ldquoSimultaneous quantification of phenolic compoundsin buriti fruit (Mauritia flexuosa Lf) by ultra-high performanceliquid chromatography coupled to tandem mass spectrometryrdquoFood Research International vol 66 pp 396ndash400 2014

[19] J S Batista R G Olinda V B Medeiros et al ldquoAtividadeantibacteriana e cicatrizante do oleo de buriti Mauritia flexuosaLrdquo Ciencia Rural vol 42 no 1 pp 136ndash141 2012

[20] V Briones-Labarca G Venegas-Cubillos S Ortiz-Portilla MChacana-Ojeda and H Maureira ldquoEffects of high hydrostaticpressure (HHP) on bioaccessibility as well as antioxidantactivity mineral and starch contents in Granny Smith applerdquoFood Chemistry vol 128 no 2 pp 520ndash529 2011

[21] H Palafox-Carlos J F Ayala-Zavala and G A Gonzalez-Aguilar ldquoThe role of dietary fiber in the bioaccessibility andbioavailability of fruit and vegetable antioxidantsrdquo Journal ofFood Science vol 76 no 1 pp R6ndashR15 2011

[22] J Parada and J M Aguilera ldquoFood microstructure affects thebioavailability of several nutrientsrdquo Journal of Food Science vol72 no 2 pp R21ndashR32 2007

[23] D Tagliazucchi E Verzelloni D Bertolini and A ConteldquoIn vitro bio-accessibility and antioxidant activity of grapepolyphenolsrdquo FoodChemistry vol 120 no 2 pp 599ndash606 2010

[24] I M Cattani and J Baruque-Ramos ldquoBrazilian Buriti palmfiber (Mauritia flexuosa Mart)rdquo in Natural Fibres Advances inScience and Technology Towards Industrial Applications FromScience to Market R Fangueiro and S Rana Eds pp 89ndash98Springer Dordrecht Netherlands 2016

[25] B T Carneiro and J G M Carneiro ldquoFruit and pulp buriti(Mauritia flexuosa L) physical chemical and technologicalaspectsrdquo Revista Verde vol 6 pp 105ndash111 2011

[26] Q ZhangWChen J Zhao andW Xi ldquoFunctional constituentsand antioxidant activities of eight Chinese native goji geno-typesrdquo Food Chemistry vol 200 pp 230ndash236 2016

[27] R B Broadhurst and W T Jones ldquoAnalysis of condensedtannins using acidified vanillinrdquo Journal of the Science of Foodand Agriculture vol 29 no 9 pp 788ndash794 1978

[28] C M Bossu E C Ferreira F S Chaves E A Menezes and AR A Nogueira ldquoFlow injection system for hydrolysable tannindeterminationrdquoMicrochemical Journal vol 84 no 1-2 pp 88ndash92 2006

[29] N C De Moura and S G Canniatti-Brazaca ldquoEvluation ofiron availabilty of the common bean in comparson with bovinemeatrdquoCiencia e Tecnologia de Alimentos vol 26 no 2 pp 270ndash276 2006

[30] W Brand-Williams M E Cuvelier and C Berset ldquoUse of a freeradical method to evaluate antioxidant activityrdquo LWT - FoodScience and Technology vol 28 no 1 pp 25ndash30 1995

[31] R Re N Pellegrini A ProteggenteA PannalaM Yang andCRice-Evans ldquoAntioxidant activity applying an improved ABTSradical cation decolorization assayrdquo Free Radical Biology ampMedicine vol 26 no 9-10 pp 1231ndash1237 1999

[32] G K B Lopes H M Schulman and M Hermes-LimaldquoPolyphenol tannic acid inhibits hydroxyl radical formationfrom Fenton reaction by complexing ferrous ionsrdquo Biochimicaet Biophysica Acta (BBA) - General Subjects vol 1472 no 1-2pp 142ndash152 1999

[33] H Esterbauer and K H Cheeseman ldquoDetermination ofaldehydic lipid peroxidation products malonaldehyde and 4-hydroxynonenalrdquoMethods in Enzymology vol 186 pp 407ndash4211990

[34] A G Guimaraes G F Oliveira M S Melo et al ldquoBioassay-guided evaluation of antioxidant and antinociceptive activitiesof carvacrolrdquo Clinical Pharmacology amp Toxicology vol 107 no6 pp 949ndash957 2010

[35] L C Green S R Tannenbaum and P Goldman ldquoNitratesynthesis in the germfree and conventional ratrdquo Science vol 212no 4490 pp 56ndash58 1981

[36] S Basu and B Hazra ldquoEvaluation of nitric oxide scavengingactivity in vitro and ex vivo of selected medicinal plants tradi-tionally used in inflammatory diseasesrdquo Phytotherapy Researchvol 20 no 10 pp 896ndash900 2006

[37] E J F D Araujo L K F Lima O A Silva et al ldquoIn vitroantioxidant antitumor and leishmanicidal activity of riparinA an analog of the Amazon alkamides from Aniba riparia(Lauraceae)rdquoActa Amazonica vol 46 no 3 pp 309ndash314 2016

[38] d Carvalho ldquoBiological screening of extracts of Brazilian Aster-aceae plantsrdquo African Journal of Pharmacy and Pharmacologyvol 7 no 28 pp 2000ndash2005 2013

[39] R L M de Freitas G L da Silva Oliveira R M de Freitas etal ldquoIn vitro effects of arylhydrocoumarin on free radicals andoxidative stress in erythrocytes and Saccharomyces cerevisiaerdquoCurrent Pharmaceutical Biotechnology vol 15 no 11 pp 1069ndash1082 2014

[40] A L D S Lima K D S C Lima M J Coelho J M Silva R LD O Godoy and P Sidney ldquoEvaluation of gamma irradiationeffects on carotenoids ascorbic acid and sugar contents of Buritifruit (Mauritia flexuosa L)rdquo Acta Amazonica vol 39 no 3 pp649ndash654 2009

[41] T L N Candido M R Silva and T S Agostini-Costa ldquoBioac-tive compounds and antioxidant capacity of buriti (Mauritiaflexuosa Lf) from the Cerrado and Amazon biomesrdquo FoodChemistry vol 177 pp 313ndash319 2015


[42] M D F G Santos R V S Mamede M D S M Rufino etal ldquoAmazonian Native Palm Fruits as Sources of AntioxidantBioactive Compoundsrdquo Antioxidants vol 4 no 3 pp 591ndash6022015

[43] J S Aquino M H A Aquino D C N P Pessoa et al ldquoIntakeof cookies made with buriti oil (Mauritia flexuosa) improvesvitamin A status and lipid profiles in young ratsrdquo Food ampFunction Royal Society of Chemistry vol 7 no 10 pp 4442ndash4450 2016

[44] A C S De Lima D J Soares L M R Da Silva R W DeFigueiredo P H M De Sousa and E De Abreu MenezesldquoIn vitro bioaccessibility of copper iron zinc and antioxidantcompounds of whole cashew apple juice and cashew applefibre (Anacardium occidentale L) following simulated gastro-intestinal digestionrdquo Food Chemistry vol 161 pp 142ndash147 2014

[45] B R Shah C Zhang Y Li and B Li ldquoBioaccessibility andantioxidant activity of curcumin after encapsulated by nanoand Pickering emulsion based on chitosan-tripolyphosphatenanoparticlesrdquo Food Research International vol 89 pp 399ndash407 2016

[46] S M I Saad ldquoProbiotics and prebiotics the state of the artrdquoRevista Brasileira de Ciencias Farmaceuticas vol 42 no 1-62006

[47] L R T Manhaes and A U O Sabaa-Srur ldquoCentesimal compo-sition and bioactive compounds in fruits of buriti collected inparardquo Ciencia e Tecnologia de Alimentos vol 31 no 4 pp 856ndash863 2011

[48] J Bouayed L Hoffmann and T Bohn ldquoTotal phenolicsflavonoids anthocyanins and antioxidant activity followingsimulated gastro-intestinal digestion and dialysis of apple vari-eties Bioaccessibility and potential uptakerdquo Food Chemistryvol 128 no 1 pp 14ndash21 2011

[49] U Gawlik-Dziki M Jezyna M Swieca D Dziki B Baraniakand J Czyz ldquoEffect of bioaccessibility of phenolic compoundson in vitro anticancer activity of broccoli sproutsrdquo FoodResearch International vol 49 no 1 pp 469ndash476 2012

[50] A V Badarinath K M Rao C M S Chetty S Ramkanth TV S Rajan and K Gnanaprakash ldquoA review on in-vitro antiox-idant methods comparisions correlations and considerationsrdquoInternational Journal of PharmTech Research vol 2 no 2 pp1276ndash1285 2010

[51] M Carocho and I C F R Ferreira ldquoA review on antioxidantsprooxidants and related controversy natural and syntheticcompounds screening and analysis methodologies and futureperspectivesrdquo Food and Chemical Toxicology vol 51 no 1 pp15ndash25 2013

[52] K Marxen K H Vanselow S Lippemeier R Hintze ARuser and U-P Hansen ldquoDetermination of DPPH radicaloxidation caused by methanolic extracts of some microalgalspecies by linear regression analysis of spectrophotometricmeasurementsrdquo Sensors vol 7 no 10 pp 2080ndash2095 2007

[53] B S Ferreira C G De Almeida L P Faza et al ldquoComparativeproperties of amazonian oils obtained by different extractionmethodsrdquoMolecules vol 16 no 7 pp 5874ndash5885 2011

[54] K Mori N Goto-Yamamoto M Kitayama and K HashizumeldquoLoss of anthocyanins in red-wine grape under high tempera-turerdquo Journal of Experimental Botany vol 58 no 8 pp 1935ndash1945 2007

[55] R L Barbosa A D Lima and M M Junior Biometria defrutos do buriti (Mauritia flexuosa Lf Arecaceae) estimativas deprodutividade de polpa e oleo vegetal em uma area de savana emRoraima INPA CPEC Amazonia Brazil 2009

[56] R K Saini S H Nile and S W Park ldquoCarotenoids from fruitsand vegetables Chemistry analysis occurrence bioavailabilityand biological activitiesrdquo Food Research International vol 76pp 735ndash750 2015

[57] N Martı P Mena J A Canovas V Micol and D SauraldquoVitamin C and the role of citrus juices as functional foodrdquoNatural Product Communications (NPC) vol 4 no 5 pp 677ndash700 2009

[58] P Sharma and J D Sharma ldquoIn vitro hemolysis of humanerythrocytes by plant extracts with antiplasmodial activityrdquoJournal of Ethnopharmacology vol 74 no 3 pp 239ndash243 2001

[59] M Roselli M S Britti I Le Huerou-Luron H Marfaing WY Zhu and E Mengheri ldquoEffect of different plant extracts andnatural substances (PENS) against membrane damage inducedby enterotoxigenic Escherichia coli K88 in pig intestinal cellsrdquoToxicology in Vitro vol 21 no 2 pp 224ndash229 2007

[60] A Ceriello R Testa and S Genovese ldquoClinical implicationsof oxidative stress and potential role of natural antioxidantsin diabetic vascular complicationsrdquo Nutrition Metabolism ampCardiovascular Diseases vol 26 no 4 pp 285ndash292 2016

[61] S Chaudhuri A Banerjee K Basu B Sengupta and PK Sengupta ldquoInteraction of flavonoids with red blood cellmembrane lipids and proteins antioxidant and antihemolyticeffectsrdquo International Journal of Biological Macromolecules vol41 no 1 pp 42ndash48 2007

[62] L K R Leao A M Herculano C Maximino et al ldquoMauritiaflexuosa L protects against deficits in memory acquisition andoxidative stress in rat hippocampus induced by methylmercuryexposurerdquoNutritional Neuroscience vol 20 no 5 pp 297ndash3042016

[63] E Fuentes W Rodrıguez-Perez L Guzman et al ldquoMauri-tia flexuosa presents in vitro and in vivo antiplatelet andantithrombotic activitiesrdquo Evidence-Based Complementary andAlternativeMedicine vol 2013 Article ID 653257 11 pages 2013

[64] J De Souza Aquino J K B Soares MMagnani et al ldquoEffects ofdietary brazilian palm oil (Mauritia flexuosa L) on Cholesterolprofile and Vitamin A and e status of ratsrdquo Molecules vol 20no 5 pp 9054ndash9070 2015

Research ArticleIn Vitro Antioxidant Potential and Effect of aGlutathione-Enhancer Dietary Supplement on Selected Rat LiverCytochrome P450 Enzyme Activity

Benoit B Nrsquoguessan 1 Seth K Amponsah 1 George J Dugbartey1

Kwabena D Awuah1 Eunice Dotse 2 Abigail Aning2 Kennedy K E Kukuia1

Isaac J Asiedu-Gyekye1 and Regina Appiah-Opong 2

1Department of Pharmacology and Toxicology School of Pharmacy College of Health Sciences University of Ghana Ghana2Department of Clinical Pathology Noguchi Memorial Institute for Medical Research College of Health SciencesUniversity of Ghana Ghana

Correspondence should be addressed to Seth K Amponsah skamponsahugedugh

Received 2 March 2018 Accepted 3 May 2018 Published 24 May 2018


Copyright copy 2018 Benoit B Nrsquoguessan et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Background There is considerable evidence that many people take dietary supplements including those of herbal origin as analternative therapy to improve their health One such supplement with an amalgam of constituents is CellGevity Howeverthe effect of this dietary supplement on drug-metabolizing enzymes is poorly understood as it has not been studied extensivelyTherefore we investigated the effect of CellGevity dietary supplement on selected rat liver microsomal cytochrome P450 (CYP)enzymes the most common drug-metabolizing enzymes We also determined the total antioxidant potential of this dietarysupplement in vitro Methods To determine the antioxidant potential of CellGevity dietary supplement 22-diphenyl-2-picryl-hydrazyl (DPPH) total phenolic and flavonoid assays were used after initial preparation of a solution form of the supplement (lowdose LD 4mgkg and high dose HD 8mgkg) Rats received oral administration of these doses of the supplement for 7 daysafter which the effect of the supplement on selected liver CYP enzymes was assessed using probe substrates and spectroscopic andhigh-performance liquid chromatographicmethods Rats which received daily administration of 80mgkg of phenobarbitone anddistilled water served as positive and negative controls respectively Results The IC

50value of the supplement 034 plusmn 007mgml

compared to 0076 plusmn 003mgml of the BHT (positive control) The total phenolic content of the supplement at a concentration of25mgml was 3497 g gallic acid equivalent (GAE)100 g while its total flavonoid content at a concentration of 25mgml was 6 gquercetin equivalent (QE)100 g The supplement significantly inhibited rat CYP2B12B2 (LDT 924 HDT 100) CYP3A4 (LDT812 HDT 717) and CYP2C9 (LDT 217 HDT 285) while it had no significant inhibitory effect on CYPs 1A11A2 CYP1A2and CYP2D6 Conclusion CellGevity dietary supplement possesses moderate antioxidant activity in vitro and has an inhibitoryeffect on selected rat liver CYP enzymes suggesting its potential interaction with drugs metabolized by CYP enzymes

1 Introduction

Noncommunicable diseases (NCDs) such as cardiomy-opathies asthma diabetes mellitus and cancer are themost common causes of death globally with a higherpercentage of premature deaths happening in developingnations than in developed nations [1] This highlights thecrucial need for simple and effective preventive strategiesand treatments to reduce the current inequities within

and among countries At least half of these NCDs-relateddeaths are caused by common risk factors including mal-nutrition a condition that represents a critical publichealth concern [2 3] Malnutrition occurs when the nutri-tional needs for growth (protein and calories) are notmet within the context of either undernutrition or over-nutrition and lead to deficiencies of essential micronutri-ents with detrimental and sometimes irreversible effects[4]



The use of alternative therapies in the form of dietarysupplements is becoming very common throughout theworld as many people nowadays are adopting a variety oflifestyle habits that contribute to healthy living [5] Dietarysupplements comprise a wide range of products intended foringestion to meet essential nutritional needs They may beindividual components or combinations of vitamins miner-als amino acids or herbal products and have intermediateform between foods and drugs [6] Thus they possess bothfood and drug characteristics a number of them being morefood-like or drug-like depending on their nature

Dietary supplements are essential when nutritional needsare not covered by diet alone however the use of dietary sup-plementation when nutritional sufficiency has already beenachieved remains controversial as possible toxic effects ofexcessive intake have been reported for some micronutrientssuch as120573-carotene and vitamin E [7 8]Whereas the quest forimproved health with dietary supplements is commendablethere is a paucity of scientific data on some of the purportedtherapeutic efficacies of these dietary supplements

Dietary supplements including those of herbal originare known to alter the pharmacokinetics of concomitantlyadministered conventional drugs [9] These supplements (ortheir constituents) often induce or inhibit drug-metabolizingenzymes such as cytochrome P450 (CYP) which play signif-icant roles in phase I biotransformation reactions convertinglipophilic agents into hydrophilic metabolites and therebyfacilitating excretion [10] A typical example of a dietarysupplement (herb) that modulates the activities of CYPenzymes is St Johnrsquos wort (Hypericum perforatum) [11 12]

A number of dietary supplements currently available onthe market have been reported to replenish levels of reducedglutathione (GSH) the most abundant naturally occurringantioxidant in the body [13] Despite a scarcity of availablescientific evidence these GSH-enhancer dietary supplementsare purported to play a potential role in the preventionof NCDs especially those mediated by free radicals andcharacterized by depleted stores of tissue GSH [14] One ofsuch supplements CellGevity contains the GSH-precursormolecule riboceine (D-ribose-L-cysteine) which has beenreported to effectively deliver cysteine into the cell andenhance GSH level [15] Riboceine has been shown to besignificantly more effective than other glutathione enhancers[16] hence the rationale for the choice of this dietarysupplement in the present study

In addition to riboceine CellGevity contains an amalgamof constituents comprising turmeric root extract (curcumin)resveratrol aloe extract milk thistle quercetin broccoli seedextract alpha lipoic acid grape seed extract vitamin Cselenomethionine cordyceps and piperine Some of theseconstituents are known as inducers andor inhibitors of CYPenzymes Curcumin and resveratrol for example are potentinhibitors of CYP enzymes [17ndash19] while aloe vera inducesCYP reductase and some Phase II enzymes [20]

Given the reported cases of induction andor inhibi-tion of CYP enzymes by some of its constituents and thepotential supplement-drug interaction that may ensue thepresent study investigates the effect of CellGevity dietary

supplement on the activities of selected rat liver microsomalCYP enzymes and evaluates its total antioxidant potential


Ethical Statement All animal work was conducted accordingto the guidelines of the National Institute of Health for theCare of Laboratory Animals [21] and was approved by theScientific and Technical Committee of Noguchi MemorialInstitute for Medical Research University of Ghana

Experimental Animals Prior to experiment 20 male SpragueDawley rats weighing 300 plusmn 50 g (ge8 weeks old) from theAnimal Experimentation Unit Center for Plant MedicineResearch Mampong-Akuapem Ghana were fed ad libitumusing standard animal lab pellet (Sankofa Flour and FeedsAccra Ghana) and were housed in 4 groups of 5 animalsper cage under standard laboratory conditions (25 plusmn 1∘Cambient temperature 60ndash70 relative humidity and 1212 hlight dark cycle) to acclimatize to the laboratory conditionfor 7 days

Treatment Groups Following acclimatization rats were ran-domly assigned to one of the four experimental groups beinglow dose supplement treatment (LDT 119899 = 5) high dosesupplement treatment (HDT 119899 = 5) positive control (PC119899 = 5) and negative control (NC 119899 = 5) The LDT groupreceived a daily dose of 4mgkg of the supplement while theHDT group received 8mgkg The PC group received a dailyadministration of 80mgkg of phenobarbitone whereas theNC groupwas given distilled water daily Each group receivedtheir respective treatment via oral route for 7 days Following7 days of treatment animals were sacrificed by injection of anoverdose of sodium pentobarbital intraperitoneally and liversamples were harvested and snap-frozen in liquid nitrogenand stored at minus80∘C until further analysis

21 Antioxidant Assays

22-Diphenyl-2-Picryl-Hydrazyl (DPPH) Assay The DPPHmethod usedwas amodification of one reported byBlois [22]Briefly 20mg of the supplement (CellGevity powder MaxInternational Ghana) was dissolved in 10ml of dimethylsulfoxide (DMSO Sigma Aldrich USA) to obtain a stocksolution of 20mgml Twofold serial dilutions of the stockwere made to obtain concentrations of 10 5 25 125 0625and 03125mgml Twofold serial dilutions of the positivecontrol butylated hydroxyl toluene (BHT St Louis MOUSA) were made to obtain concentrations of 05 0250125 00625 003125 and 0015625mgml One hundredmicroliters of each of the samples and BHT dilutions waspipetted separately in triplicate into 96-well plates A volumeof 100120583L of 05mM DPPH solution (Steinheim Germany)was then added to each of the wells to obtain a total volumeof 200 120583L The plates were incubated in the dark at roomtemperature for 20 minutes and absorbance was read at awavelength of 517 nm

Total Phenolic Assay The assay used to estimate total phenolsin the supplement was a modification of one reported by


Marinova et al [23] Briefly a stock solution of the supple-mentwas prepared by dissolving 20 mgof the sample in 10 mlof DMSO Twofold serial dilutions of this stock were madeto obtain concentrations of 100 50 25 and 125mgmlThe standard was prepared by dissolving 10mg of gallic acid(generously provided by the Department of Nutrition andFood Science University of Ghana) in 10 absolute ethanolTwofold serial dilutions were made to obtain concentrationsof 05 025 0125 00625 003125 and 0015625mgml Onehundred microliters of each of the sample dilutions andthe standard was pipetted separately in triplicate into 96-well plates A volume of 100 120583L of Folin-Ciocalteu reagent(Buchs Switzerland) was then added to each well followed by200120583L of sodium bicarbonate solution (02 gml) to obtaina total volume of 400 120583L The plates were incubated atroom temperature for 120 minutes and absorbance read at awavelength of 650 nm

Total Flavonoid Assay The total flavonoid assay used wasone adapted from Ordonez et al [24] Briefly a stocksolution of the supplementwas prepared and diluted to obtainconcentrations of 100 50 25 and 125mgml Quercetinstandard (Buchs Switzerland) was prepared and diluted toobtain concentrations of 01 005 0025 00125 0006250003125 and 00015625mgml One hundred microliters ofeach of the sample dilutions and the standard was pipettedseparately in triplicate into 96-well plates A volume of 100 120583Lof aluminumchloride solution (2 wv SigmaAldrichUSA)was added to each of the wells to obtain a final volume of200120583L per well The plates were then incubated at roomtemperature for 20 minutes after which absorbance was readat a wavelength of 415 nm

22 Rat Liver CYP Enzyme InductionInhibition Assays

Preparation of Microsomal Fractions and Protein Level Deter-mination Liver samples weighing 782 g were homogenizedseparately with two volumes of potassium phosphate buffer(pH 74) in a mortar with pestle The homogenate wascentrifuged at 4500 rpm for 20 minutes at 4∘C and thesupernatant collected Next the supernatant was furthercentrifuged at 40000 rpm for 60 minutes at 4∘C with anultra-centrifuge (Beckman Avanti J-25 USA) Followingultra-centrifugation the resultant supernatant (cytosol) wasseparated from the pellet (microsomes) The microsomesobtained were then homogenized in potassium phosphatebuffer (pH 74) to form a solution Fourfold serial dilutionswere carried out on the microsomal solutions using potas-sium phosphate buffer Serial dilutions (2-fold 6 dilutions)were also made with a protein standard bovine serumalbumin (BSA St Louis MO USA) Ten microliters of theBSAand 200 120583L of Biorad reagent (Bio-Rad Laboratories IncUSA) was added to each microsomal dilution in a 96-wellplate and incubated at room temperature for 5 minutes andabsorbance was read at a wavelength of 590nm

CYP1A11A2-EthoxyresorufinO-Deethylase (EROD) CYP1A2-Methoxyresorufin O-Demethylase (MROD) CYP3A4-Benzyl-oxyresorufinO-Debenzylase (BROD) and CYP2B12B2-Pen-toxyresorufin O-Depentylase (PROD) Assays Inhibition of

CYP 1A11A2 1A2 3A4 and 2B12B2 enzymes by thesupplement was determined using fluorimetric assays sim-ilar to ones described by Appiah-Opong et al [17] andUmegaki et al [25] but with slight modification Briefly70120583L of potassium phosphate buffer (pH 74) was pipettedin triplicate into a 96-well plate followed by addition of10120583L of each substrate (ethoxyresorufin methoxyresorufinbenzyloxyresorufin and pentoxyresorufin purchased fromSt Louis MO USA) Next 10 120583L of the rat liver microsomalfraction obtained from each treatment group was addedand incubated at 37∘C for 5min Ten microliters (100120583M)of nicotinamide adenine dinucleotide phosphate (NADPHSt Louis MO USA) was added to each of the wells andincubated at 37∘C for 10 20 and 30min (for CYPs 1A11A2and 1A2 2B12B2 and 3A4 respectively) A volume of 40 120583Lof stopping solution (20 05M Tris and 80 acetonitrile)was added and the plate gently was shaken Fluorescence wasread at specific wavelengths at 586 nm

CYP2D6-Dextromethorphan O-Demethylation Assay Theeffect of the supplement on dextromethorphan O-demeth-ylation by CYP2D6 was assayed as described by Appiah-Opong et al [17] Briefly 350120583L of potassium phosphatebuffer (pH 74) was pipetted into Eppendorf tubes in tripli-cate Fifty microliters of 025mM dextromethorphan (MilanItaly) was added followed by 50 120583L of microsomes obtainedfrom each group Preincubation was done at 37∘C for 5minutes in awater bath after which 50120583L of NADPH solution(100120583M) was added Further incubation was done for 45minutes followed by the addition of 100120583L of stoppingsolution (300mM zinc sulphate heptahydrate) The mixturewas centrifuged at 4000 rpm for 15min at room temperatureand the supernatant was collected in vials and analyzed usingan isocratic HPLC method with a C18 column (150mm times46mm VP-ODS) The mobile phase consisted of 24 (vv)acetonitrile and 01 (vv) trimethylamine adjusted to pH 30with perchloric acidThe carrier flow rate was 08mlmin andpeaks were monitored at wavelengths of 280 nm (excitation)and 310 nm (emission)

CYP2C9-Diclofenac Hydroxylation Assay The effect of thesupplement on hydroxylation of diclofenac to 4-hydroxy-diclofenac by CYP2C9 was determined as described byAppiah-Opong et al [26] Briefly 350120583L of potassiumphosphate buffer (pH 74) was pipetted into Eppendorftubes followed by 50 120583L of 005mM diclofenac (OverrijseBelgium) Next 50 120583L of the microsomal fraction obtainedfrom each treatment group was added (in triplicate) andpreincubated at 37∘C for 5 minutes in a water bath A volumeof 50120583L of NADPH solution (100120583M) was added to eachtube and further incubated in the water bath at 37∘C for 10minutes The reaction was terminated by addition of 200 120583Lof stopping solution (ice-cold methanol) and the mixture wascentrifuged at 12000 rpm for 8minutes at room temperatureThe supernatants were collected in vials and analyzed usinghigh-performance liquid chromatography (HPLC) [Agilent1100 Series Germany] The HPLC conditions for the assaycomprised an injection volume of 50120583L a flow rate of08mlmin a C18 column (150mm times 46mm VP-ODS) a


(a) (b)

Figure 1 Concentration-response curves showing IC50values for butylated hydroxytoluene (BHT positive control (a)) andCellGevity dietary

supplement (b)

temperature of 40∘C and a maximum pressure of 40 barA diode array served as the detector Products formed weremeasured using an isocraticHPLCmethodThemobile phaseconsisted of 60 of 20mM potassium phosphate buffer (pH74) 225 methanol and 175 acetonitrile

23 Statistical Analysis All values are expressed as mean plusmnstandard deviation (SD) Differences between groups weretested for significance using a One-Way ANOVA 119901 val-ues lt 005 were considered statistically significant Signifi-cant differences were calculated with Bonferronirsquos MultipleComparison Tests and graphs were produced using GraphPad Prism Software Version 7 (GraphPad Software IncUSA)

3 Results

31 Antioxidant Assays To evaluate the antioxidant potentialof CellGevity dietary supplement DPPH total phenolicand flavonoid assays were used The concentration of thesupplement required to inhibit 50 of free radicals (IC

50)

was 034 plusmn 007mgml compared to 0076 plusmn 003mgml ofthe BHT (positive control) The total phenolic content of thesupplement at a concentration of 25mgml was 3497 g gallicacid equivalent (GAE)100 g while its total flavonoid contentat a concentration of 25mgml was 6 g quercetin equivalent(QE)100 g Figures 1(a) and 1(b) show the IC

50values of

CellGevity as compared to BHT

32 CYP Enzyme Assays In order to determine the effectof CellGevity dietary supplement on rat liver microsomal

cytochrome P450 (CYP) enzyme activities selected CYPassays were used

CYP1A11A2 and CYP1A2 Assays There was no significantdifference in the activity of CYP1A11A2 enzyme among NCLDT and HDT groups (Figure 2(a) 119901 gt 005) However theCYP1A11A2 enzyme activity of these three groups markedlydecreased compared to PC group (Figure 2(a) 119901 lt 005)A similar observation was made in CYP1A2 enzyme activity(Figure 2(b))

CYP2B12B2 and CYP3A4 Assays Unlike CYP1A11A2 andCYP1A2 enzyme activities which showed no significant dif-ference between NC LDT and HDT groups in the microso-mal fractions the activity of the CYP2B12B2 enzyme in LDTandHDTgroupsmarkedly decreased compared toNC group(Figure 2(c) 119901 lt 0001) A similar pattern was observedin Figure 2(d) However whereas the PC group showedmarkedly reduced CYP2B12B2 enzyme activity compared toNC group in Figure 2(c) (119901 lt 005) that in CYP3A4 inFigure 2(d) showed no difference in comparison with the NCgroup (119901 gt 005)

CYP2D6 and CYP2C9 Assays CYP2D6 enzyme activity inLDT group increased significantly compared to HDT group(Figure 2(e) 119901 lt 005) In addition NC group showeda markedly high CYP2D6 activity in comparison with PCgroup (Figure 2(e) 119901 lt 0001) As seen in Figure 2(b) theactivity of CYP2C9 followed a similar pattern in which nosignificant difference was observed between LDT and HDTgroups while activity in NC group also markedly decreased(Figure 2(f) 119901 lt 005)


(a) (b) (c)

(d) (e) (f)

Figure 2 (a) Effect of CellGevity dietary supplement on CYP1A11A2 activity in rat liver microsomes Negative control (NC distilled water)positive control (PC phenobarbitone 80mgkg) low dose treatment (LDT 4mgkg supplement) and high dose treatment (HDT 8mgkgsupplement) Data represent mean plusmn standard deviations lowast and lowastlowast are values statistically different as indicated with 119901 lt 005 and 119901 lt 0001respectively (b) Effect of CellGevity dietary supplement on CYP1A2 activity in rat liver microsomes Negative control (NC distilled water)positive control (PC phenobarbitone 80mgkg) low dose treatment (LDT 4mgkg supplement) and high dose treatment (HDT 8mgkgsupplement) Data represent mean plusmn standard deviations lowast and lowastlowast are values statistically different as indicated with 119901 lt 005 and 119901 lt 0001respectively (c) Effect of CellGevity dietary supplement on CYP2B12B2 activity in rat liver microsomes Negative control (NC distilled water)positive control (PC phenobarbitone 80mgkg) low dose treatment (LDT 4mgkg supplement) and high dose treatment groups (HDT8mgkg supplement) Data represent mean plusmn standard deviations lowast and lowastlowast are values statistically different as indicated with 119901 lt 005 and119901 lt 0001 respectively (d) Effect of CellGevity dietary supplement on CYP3A4 activity in rat liver microsomes Negative control (NC distilledwater) positive control (PC phenobarbitone 80mgkg) low dose treatment (LDT 4mgkg supplement) and high dose treatment (HDT8mgkg supplement) Data represent mean plusmn standard deviations lowast and lowastlowast are values statistically different as indicated with 119901 lt 005 and119901 lt 0001 respectively (e) Effect of CellGevity dietary supplement on CYP2D6 activity in rat liver microsomes Negative control (NC distilledwater) positive control (PC phenobarbitone 80mgkg) low dose treatment (LDT 4mgkg supplement) and high dose treatment (HDT8mgkg supplement) Data represent mean plusmn standard deviations lowast and lowastlowast are values statistically different as indicated with 119901 lt 005 and119901 lt 0001 respectively (f) Effect of CellGevity dietary supplement on CYP2C9 in rat liver microsome Negative control (NC distilled water)positive control (PC phenobarbitone 80mgkg) low dose treatment (LDT 4mgkg supplement) and high dose treatment (HDT 8mgkgsupplement) Charts represent mean plusmn standard deviations lowast are values statistically different as indicated with 119901 lt 005

Overall Effect of the Supplement on Rat CYP Enzymes Theoverall effect of this supplement on selected CYP enzymesis summarized in Table 1 Inhibition of CYP enzyme activityby the supplement was not dose-dependent The generaltrend of enzyme inhibition (highest to lowest) by both dosesof the supplement was CYP2B1 gt CYP3A4 gt CYP2C9 gtCYP1A11A2 gt CYP1A2 gt CYP2D6

4 Discussion

In the current study we evaluated the antioxidant potentialof CellGevity dietary supplement comprising an aggregateof ingredients and the effect of this supplement on theactivities of selected rat liver microsomal enzymesThis studyfocuses on CYP enzymes (one of the conserved entities


Table 1 A summary of the effect of the supplement on rat CYP enzymes

CYP isoform Assay Effect of supplement on CYP activityCYP 1A11A2 EROD No significant decrease in enzyme activityCYP 1A2 MROD No significant decrease in enzyme activity

CYP 2B12B2 PROD Significant decrease in enzyme activity(119901 lt 0001 LDT and HDT)

CYP 2C9 Diclofenac hydroxylation Significant decrease in enzyme activity(119901 lt 005 LDT)

CYP 2D6 Dextromethorphan O-demethylation No significant decrease in enzyme activity

CYP 3A4 BROD Significant decrease in enzyme activity(LDT 119901 lt 0001 HDT 119901 lt 005)

among species) which are the main enzymes involved innumerous oxidative reactions and often play a critical rolein the metabolism and pharmacokinetics of xenobiotics Itis well established that some rat CYP enzymes are closelyrelated to those of humans For example CYP1A shows astrong conservation among species with an identity to humangt 80 in rat (83 and 80 respectively for CYP1A1 and -1A2)[27 28]

Some constituents of CellGevity dietary supplement suchas curcumin resveratrolmilk thistle quercetin and piperineare known inhibitors of CYP3A4 [17ndash19 29ndash31] Hence itis not surprising that this isoform was one of the enzymessignificantly inhibited by the dietary supplement CYP3A4is one the most abundant CYP isoforms in human liverand is involved in the biotransformation of the majority ofdrugs [32] However some discrepancies between rats andhuman CYP3A4 isoforms in the metabolism of drugs such asdihydropyridine calcium-channel blockers (eg nifedipine)have been reported probably suggesting that rat is not a goodmodel to study CYP3A4 induction [28 33 34] Thereforedata from the current study suggesting that CellGevitydietary supplement could alter the metabolism of somedrugs that serve as human CYP3A4 substrates should beinterpreted cautiously

Our study also showed that CellGevity dietary supple-ment significantly inhibited rat CYP2B12B2 Curcumin oneof the constituents of the supplement is a less potent inhibitorof rat CYP2B12B2 compared to CYP1A11A2 enzyme [35]This earlier report contradicts our finding as we observeda significant inhibitory effect of the dietary supplement onCYP2B12B2 enzyme activity but not on the activities ofCYP1A11A2 and CYP1A2 enzymes As the dietary supple-ment has several constituents that affect CYP enzyme activityit is possible that these refuting observations could be dueto the synergistic inhibitory action of other constituentson CYP2B12B2 activity besides curcumin It is importantto note that the CYP2B subfamily is more abundant inrodents than in humans In humans however the ortholo-gous form of CYP2B12B2 is CYP2B6 [36] Appiah-Oponget al [17] reported that curcumin inhibited the humanCYP2B6 enzyme which is consistent with our observationin rats This inhibitory effect on CYP2B activity suggests

potential interaction when CellGevity dietary supplement iscoadministered with drugs metabolized by this subfamily ofCYP enzymes

Another CYP enzyme significantly inhibited by Cell-Gevity dietary supplement was CYP2C9 Although the effectof individual constituents of this dietary supplement onCYP enzyme activity was not investigated in our studyrodent and human microsome studies have shown thatresveratrol a constituent of this dietary supplement is apotent inhibitor of CYP2C9 [37 38] A diet containing05ww resveratrol fed to mice for 12 weeks was found toenhance the anticoagulant activity of warfarin suggestingpossible inhibition of CYP2C9 [37] Using losartan as a probedrug a daily dose of 10 g of resveratrol administered for4 weeks was found to inhibit human CYP2C9 by 271-fold[38] Previous reports also suggest that curcumin is a potentinhibitor of human recombinant CYP2C9 [17] Additionallytwo flavonolignans from milk thistle (another constituentof this dietary supplement) were found to inhibit humanCYP2C9-mediated warfarin metabolism [39]These pieces ofevidence suggest that CellGevity dietary supplement couldmodulate human CYP2C9 enzyme activity

In the current study the EC50value of CellGevity dietary

supplement was 034 plusmn 007mgml compared to 0076 plusmn003mgml of the BHT The total phenolic content of thesupplement at a concentration of 25mgml was 3497 g gallicacid equivalent (GAE)100 g while its total flavonoid contentat a concentration of 25mgml was 6 g quercetin equivalent(QE)100 g This antioxidant potential is moderately highcompared to a related study where the authors reporteda synergistic antioxidant activity of a green tea of herbalorigin determined by an EC

50value of 335mgml a total

phenolic and flavonoid content of 25 g GAE10 g and 12 gQE10 g respectively [40] Furthermore there have beenstudies including ours in which authors reported antioxidantpotential of dietary supplements using in vitro assays [41]However a constituent of CellGevity dietary supplementriboceine is a prodrug which requires bioactivation in vivoOnce in circulation riboceine is metabolized into cysteineand ribose which are transported into cells [15] It is note-worthy that cysteine is a substrate for GSH synthesis inthe liver and other organs [42] suggesting that CellGevity


dietary supplement activates GSH pathway and possiblyother endogenous antioxidants pathways thereby bolsteringthe endogenous antioxidant defense system

5 Conclusion

In conclusion this study reports that CellGevity dietarysupplement possesses antioxidant property in vitro and alsoinhibits activities of rat liver CYP2B1 CYP3A4 and CYP2C9enzymes Inhibition of these selected CYP enzymes by thisdietary supplement suggests the possibility that CellGevitydietary supplement may contribute to supplement (herb-)drug interactions in humans

Data Availability



The authors declared that no conflicts of interest exist

Acknowledgments

The authors would like to thank Mr Ismaila Adams fordesigning the graphs

References

[1] World Health Organization ldquoWorld health statistics 2014rdquohttpappswhointirisbitstream106654484419789241564441engpdf

[2] R Beaglehole R Bonita G Alleyne et al ldquoUNhigh-levelmeet-ing on non-communicable diseases addressing four questionsrdquoThe Lancet vol 378 no 9789 pp 449ndash455 2011

[3] International Food Policy Research Institute ldquo2014 globalnutrition report actions and accountability to accelerate theworldrsquos progress onnutritionrdquo 2014 httpebraryifpriorgutilsgetfilecollectionp15738coll2id128484filename128695pdf

[4] World Health Organization ldquoThe global prevalence of anaemiain 2011rdquo (2015) httpappswhointirisbitstream1066517709419789241564960 engpdf

[5] R Pitetti S Singh D Hornyak S E Garcia and S HerrldquoComplementary and alternative medicine use in childrenrdquoPediatric Emergency Care vol 17 no 3 pp 165ndash169 2001

[6] Food and Drug Administration (FDA) Dietary SupplementsWhat You Need to Know Rockville MD USA Food and DrugAdministration 2016

[7] G Bjelakovic D Nikolova L L Gluud R G Simonetti andC Gluud ldquoAntioxidant supplements for prevention of mortalityin healthy participants and patients with various diseasesrdquoCochrane Database of Systematic Reviews vol 14 no 3 ArticleID CD007176 2012

[8] S Rautiainen J E Manson A H Lichtenstein and H DSesso ldquoDietary supplements and disease preventionmdasha globaloverviewrdquoNature Reviews Endocrinology vol 12 no 7 pp 407ndash420 2016

[9] S J Brantley A A Argikar Y S Lin S Nagar and M FPaine ldquoHerb-drug interactions challenges and opportunities

for improved predictionsrdquo Drug Metabolism and Dispositionvol 42 no 3 pp 301ndash317 2014

[10] A I Cederbaum ldquoMolecular mechanisms of the microsomalmixed function oxidases and biological and pathological impli-cationsrdquo Redox Biology vol 4 pp 60ndash73 2015

[11] L GMiller ldquoHerbalmedicinals selected clinical considerationsfocusing on known or potential drug-herb interactionsrdquo JAMAInternal Medicine vol 158 no 20 pp 2200ndash2211 1998

[12] Z Wang J Gorski M Hamman S Huang L Lesko and SHall ldquoThe effects of St Johnrsquos wort (Hypericum perforatum)on human cytochrome P450 activityrdquo Clinical Pharmacology ampTherapeutics vol 70 no 4 pp 317ndash326 2001

[13] TM Bray andC G Taylor ldquoEnhancement of tissue glutathionefor antioxidant and immune functions in malnutritionrdquo Bio-chemical Pharmacology vol 47 no 12 pp 2113ndash2123 1994

[14] Y-Z Fang S Yang andGWu ldquoFree radicals antioxidants andnutritionrdquo Nutrition Journal vol 18 no 10 pp 872ndash879 2002

[15] J C Roberts R L Charyulu R T Zera and H T NagasawaldquoProtection Against Acetaminophen Hepatotoxicity by Ribose-Cysteine (RibCys)rdquo Pharmacology amp Toxicology vol 70 no 4pp 281ndash285 1992

[16] H S Oz T S Chen and H Nagasawa ldquoComparative efficaciesof 2 cysteine prodrugs and a glutathione delivery agent in acolitis modelrdquo Translational Research vol 150 no 2 pp 122ndash129 2007

[17] R Appiah-Opong J N M Commandeur B van Vugt-Lussenburg and N P E Vermeulen ldquoInhibition of humanrecombinant cytochrome P450s by curcumin and curcumindecomposition productsrdquo Toxicology vol 235 no 1-2 pp 83ndash91 2007

[18] W K Chan and A B Delucchi ldquoResveratrol a red wineconstituent is a mechanism-based inactivator of cytochromeP450 3A4rdquo Life Sciences vol 67 no 25 pp 3103ndash3112 2000

[19] B Piver F Berthou Y Dreano and D Lucas ldquoInhibition ofCYP3A CYP1A and CYP2E1 activities by resveratrol and othernon volatile red wine componentsrdquo Toxicology Letters vol 125no 1ndash3 pp 83ndash91 2001

[20] R P Singh S Dhanalakshmi and A R Rao ldquoChemomodula-tory action of Aloe vera on the profiles of enzymes associatedwith carcinogen metabolism and antioxidant status regulationin micerdquo Phytomedicine vol 7 no 3 pp 209ndash219 2000

[21] National Institutes of Health ldquoMemorandum of understandingbetween the office of Laboratory Animal Welfare NationalInstitutes of Health US Department of Health and HumanServices and the Office of Research Oversight and the Office ofResearch and Development Veterans Health AdministrationUS Department of Veterans Affairs Concerning LaboratoryAnimalWelfarerdquo Bethesda Office of Extramural Research NIH2007 httpgrantsnihgovgrantsolawreferencesmou olawva 2007 11htm

[22] M S Blois ldquoAntioxidant determinations by the use of a stablefree radicalrdquo Nature vol 181 no 4617 pp 1199-1200 1958

[23] D Marinova F Ribarova and M Atanassova ldquoTotal phenolicsand total flavonoids in Bulgarian fruits and vegetablesrdquo Journalof the University of Chemical Technology andMetallurgy vol 40no 3 pp 255ndash260 2005

[24] A A L Ordonez J D Gomez M A Vattuone and M I IslaldquoAntioxidant activities of Sechium edule (Jacq) Swartz extractsrdquoFood Chemistry vol 97 no 3 pp 452ndash458 2006

[25] K Umegaki K Saito Y Kubota H Sanada K Yamadaand K Shinozuka ldquoGinkgo biloba extract markedly induces


pentoxyresorufinO-dealkylase activity in ratsrdquo Japanese Journalof Pharmacology vol 90 no 4 pp 345ndash351 2002

[26] R Appiah-Opong I de Esch J N M Commandeur MAndarini and N P E Vermeulen ldquoStructure-activity relation-ships for the inhibition of recombinant human cytochromesP450 by curcumin analoguesrdquo European Journal of MedicinalChemistry vol 43 no 8 pp 1621ndash1631 2008

[27] C AMugford and G L Kedderis ldquoSex-dependent metabolismof xenobioticsrdquoDrugMetabolismReviews vol 30 no 3 pp 441ndash498 1998

[28] M Martignoni G M Groothuis and R d Kanter ldquoSpeciesdifferences between mouse rat dog monkey and human CYP-mediated drug metabolism inhibition and inductionrdquo ExpertOpinion onDrugMetabolismamp Toxicology vol 2 no 6 pp 875ndash894 2006

[29] R Venkataramanan V Ramachandran B J Komoroski SZhang P L Schiff and S C Strom ldquoMilk thistle a herbalsupplement decreases the activity of CYP3A4 and uridinediphosphoglucuronosyl transferase in human hepatocyte cul-turesrdquo Drug Metabolism and Disposition vol 28 no 11 pp1270ndash1273 2000

[30] S N Umathe P V Dixit V Kumar K U Bansod and M MWanjari ldquoQuercetin pretreatment increases the bioavailabilityof pioglitazone in rats involvement of CYP3A inhibitionrdquoBiochemical Pharmacology vol 75 no 8 pp 1670ndash1676 2008

[31] R K Bhardwaj H Glaeser L Becquemont U Klotz S KGupta and M F Fromm ldquoPiperine a major constituent ofblack pepper inhibits humanP-glycoprotein andCYP3A4rdquoTheJournal of Pharmacology and Experimental Therapeutics vol302 no 2 pp 645ndash650 2002

[32] G K Dresser J D Spence and D G Bailey ldquoPharmacokinetic-pharmacodynamic consequences and clinical relevance ofcytochrome P450 3A4 inhibitionrdquo Clinical Pharmacokineticsvol 38 no 1 pp 41ndash57 2000

[33] F P Guengerich ldquoComparisons of catalytic selectivity ofcytochrome P450 subfamily enzymes from different speciesrdquoChemico-Biological Interactions vol 106 no 3 pp 161ndash182 1997

[34] D A Smith ldquoSpecies differences in metabolism and phar-macokinetics Are we close to an understandingrdquo DrugMetabolism Reviews vol 23 no 3-4 pp 355ndash373 1991

[35] S Oetari M Sudibyo J N M Commandeur R Samhoedi andN P E Vermeulen ldquoEffects of curcumin on cytochrome P450and glutathione S-transferase activities in rat liverrdquo BiochemicalPharmacology vol 51 no 1 pp 39ndash45 1996

[36] F J Gonzalez and H V Gelboin ldquoRole of human cytochromesp450 in the metabolic activation of chemical carcinogens andtoxinsrdquo Drug Metabolism Reviews vol 26 no 1-2 pp 165ndash1831994

[37] T Chiba Y Kimura S Suzuki T Tatefuji and K UmegakildquoTrans-resveratrol enhances the anticoagulant activity of war-farin in a mouse modelrdquo Journal of Atherosclerosis and Throm-bosis vol 23 no 9 pp 1099ndash1110 2016

[38] H-H S Chow L L Garland C-H Hsu et al ldquoResveratrolmodulates drug- and carcinogen-metabolizing enzymes in ahealthy volunteer studyrdquo Cancer Prevention Research vol 3 no9 pp 1168ndash1175 2010

[39] S J Brantley N H Oberlies D J Kroll and M F Paine ldquoTwoflavonolignans from milk thistle (Silybum marianum) inhibitCYP2C9-mediatedwarfarinmetabolism at clinically achievableconcentrationsrdquoThe Journal of Pharmacology and ExperimentalTherapeutics vol 332 no 3 pp 1081ndash1087 2010

[40] D Jain S Pancholi and R Patel ldquoSynergistic antioxidantactivity of green tea with some herbsrdquo Journal of AdvancedPharmaceutical Technologyamp Research vol 2 no 3 pp 177ndash1832011

[41] R L Prior X Wu and K Schaich ldquoStandardized methodsfor the determination of antioxidant capacity and phenolicsin foods and dietary supplementsrdquo Journal of Agricultural andFood Chemistry vol 53 no 10 pp 4290ndash4302 2005

[42] A E Saltman ldquoD-ribose-l-cysteine supplementation enhanceswound healing in a rodent modelrdquo The American Journal ofSurgery vol 210 no 1 pp 153ndash158 2015

Research ArticleWhich Benefits and Harms of Using Fenugreek asa Galactogogue Need to Be Discussed during ClinicalConsultations A Delphi Study among Breastfeeding WomenGynecologists Pediatricians Family Physicians LactationConsultants and Pharmacists

Ramzi Shawahna 12 Sara Qiblawi3 and Haifa Ghanayem3

1Department of Physiology Pharmacology and Toxicology Faculty of Medicine and Health Sciences An-Najah National UniversityNablus State of Palestine2An-Najah BioSciences Unit Centre for Poisons Control Chemical and Biological Analyses An-Najah National UniversityNablus State of Palestine3Department of Medicine Faculty of Medicine and Health Sciences An-Najah National University Nablus State of Palestine

Correspondence should be addressed to Ramzi Shawahna ramzi shawahnahotmailcom

Received 16 January 2018 Accepted 27 March 2018 Published 23 April 2018


Copyright copy 2018 Ramzi Shawahna et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Background Breastfeeding women with hypogalactia are commonly recommended to use fenugreek as a galactogogue This studyaimed to achieve formal consensus among breastfeeding women and healthcare providers on which potential harms and benefitsof using fenugreek need to be communicated and discussed during clinical consultations Methods A two-iterative round Delphitechnique was used in two separate panels of breastfeeding women (119899 = 65) and healthcare providers (119899 = 56) to achieve formalconsensus on a list of 24 and 16 items related to potential harms and benefits of fenugreek Results About 70 of thehealthcare providers recommended quite often herbal remedies for breastfeeding women and about 68 of the women had beenrecommended to use herbal remedies many times by their healthcare providers Consensus was achieved on 21 potential harmsand 14 potential benefits of using fenugreek to enhance human milk supply that need to be discussed with breastfeeding womenduring consultations Conclusion Probably potential harms and benefits of recommending fenugreek as herbal galactogoguefor breastfeeding women seeking recommendations to increase their human milk supply need to be discussed during clinicalconsultations Further observational studies are needed to assess what is being discussed in daily consultations when herbalremedies are recommended

1 Introduction

Human milk has been recognized as the ideal form ofenteral nutrition for term and preterm infants [1 2] Exclusivebreastfeeding for the first sixmonths of life has been shown toconfer substantial benefits to both the mother and her infant[2]Therefore global health authorities recommend exclusivebreastfeeding for all infants in the first six months of lifewhich might then be continued alongside other solid foodsas long as the mother and her infant desire [3] According

to recent estimates only 37 of infants younger than sixmonths of age are nourished exclusively on human milkin low and middle income countries [2] In the US andAustralia about half of the infants were receiving humanmilk at all by 6 months and in the UK only one-third weredoing so [2]These low figures cannot be explainedmerely byweak intentions to breastfeed because in the UK more than80 of women expressed their intention to breastfeed theirinfants [3 4] Certainly some figures might be explained byinsufficient human milk supply



Insufficient breast milk supply was frequently reportedas the main reason for discontinuing breastfeeding [5 6]Many women particularly those who delivered preterminfants suffer difficulties producing enough quantities ofhuman milk It is noteworthy mentioning here that evenmothers of term infants under certain circumstances likematernal illness cesarean delivery excessive smoking breastsurgery separation between mother and her infant andpsychosomatic illnesses might suffer insufficient humanmilksupply [3]

Nonpharmacological interventions remain the first linein managing insufficient human milk supply although pre-scribing medications and recommending herbal galacto-gogues are common [7]Womenwho discontinue breastfeed-ing as a result of insufficient human milk supply might beprovided with adequate educational interventions regardingbreastfeeding practices andor might then be prescribedpharmacological agents to increase their human milk supplyAgents used to increase human milk supply are calledgalactogogues [5] Metoclopramide and domperidone are themost commonly prescribed pharmacological galactogogues[5 8 9] However these agents have not received approval assafe and effective galactogogues from any health regulatoryauthority and currently are being used ldquooff-labelrdquo [10 11]In addition these agents are excreted in human milk andthus bear potential side effects and harms to infants [10ndash12] Moreover little guidance is available on the appropriatedosage of these agents when used as galactogogues [913 14] Therefore interventions to increase human milksupply using pharmacological agents might be complicatedby safety concerns to women and their infants Traditionallyherbal remedies have been viewed as good alternatives toprescription medications [15 16]

In classical views herbal remedies have been regardedas safe Probably this belief has emerged by advertisingherbal remedies as mild gentle safe and having uniqueattributes that are not found in prescriptionmedications [15]This myth was perpetuated by some healthcare providerswhen labeling herbal remedies as ldquonaturalrdquo which are in turnmistakenly regarded as safe or in the worst case scenariosafer than prescription medications [17ndash19] The myth thatherbal remedies can never be harmful is perpetuated andcommonly believed by many patients However this mythlacks scientific evidence Herbal remedies contain chemicalsthat could resemble some active ingredients present in manyprescription medications thus these chemicals would act bysimilar pharmacological mechanisms of action and have theability to cause side effects and harm [15 20] It is noteworthymentioning that herbal remedies are like prescription med-ications have intended indications are contraindicated insome cases should be used with caution in some patientsand are associated with side effects [17 18] Therefore herbalremedies should be recommended considering the 5 rights(right person time dose frequency and route of adminis-tration)

Herbal galactogogues have received considerable atten-tion across different societies and cultures Anecdotal reportsofmany herbal remedies supported their potential to enhancehumanmilk supplyThese herbal remedies include fenugreek

anise caraway fennel milk thistle and many others [1618 21] Fenugreek (Trigonella arabica Delile) which belongsto the pea family (Leguminosae) is the most widely usedherbal galactogogue to enhance human milk supply in manycountries [22] Seeds of fenugreek which is an annualherbaceous plant are traditionally used as condiment andin folk medicine in many countries including the Indiansubcontinent China and the Middle East [22] A recentstudy in Kuwait showed that fenugreek was recommendedfor breastfeeding women with insufficient breast milk supply[23] Anecdotal reports of the successful use of fenugreek asan herbal galactogogue have surfaced in 1940s Little is knownof the mechanism of action explaining how fenugreek mightenhance milk supply A theory suggested that fenugreekstimulate sweat production and as the breast is a modifiedform of sweat gland fenugreek might be able to stimulate thebreast to supply an increasing amount of milk [21 24] Therehave been anecdotal reports of fenugreek increasing humanmilk supply in some 1200 breastfeeding women within24ndash72 hours after consumption [24 25] Once the breast isstimulated fenugreek consumption can be stopped as far thebreast is stimulated and emptying continued Fenugreek asgalactogogue might be consumed in 2-3 capsules 3 timesdaily and each capsule might contain a variable quantity offenugreek At present requirements for herbal products havenot been standardized for consumption by patient [24] It isnoteworthy mentioning that the use of fenugreek is not freefrom side effects and has been associated with health relatedeffects like excessive sweating diarrhea and worsening ofasthma symptoms

In modern healthcare delivery patients are informedabout the potential harms and benefits of therapeutic alterna-tives in order to develop their preferences In general makinga decision on therapeutic alternatives involves balancingtheir potential benefits against their potential harms takinginto account the preferences of the patients The benefitsof informing patients are multifold including better experi-enced quality of life coping with side effects and preventionof overestimation of the impact of therapy on cure [15]There-fore healthcare providers like gynecologistsobstetricianspediatricians lactation consultants family physicians andpharmacists who are often consulted by breastfeedingwomenseeking recommendations to enhance their human milksupply should discuss herbal galactogogues balancing theirpotential benefits again potential harms in case they wantedto opt for herbal remedies considering the preferences ofthe women concerned Little was narrated on the poten-tial harms and benefits of using fenugreek to enhancehuman milk supply in breastfeeding women that shouldbe discussed during clinical consultations from the view-points of breastfeeding women gynecologistsobstetricianspediatricians family physicians lactation consultants andpharmacists who are often consulted by breastfeedingwomenseeking recommendations to enhance their human milksupply In general recommendations on which potentialharms and benefits of using fenugreek to communicate toand discuss with patients during clinical consultations arelacking The aim of this study was to fill this gap in theliterature


The aims of this study was to achieve consensus amongbreastfeeding women gynecologistsobstetricians pediatri-cians family physicians lactation consultants and pharma-cists who are often consulted by breastfeedingwomen seekingrecommendations to enhance their human milk supply onwhich potential harms and benefits of using fenugreek as agalactogogue that need to be communicated to and discussedwith breastfeeding women during clinical consultations inwhich a decision to use fenugreek would be taken Thisconsensual core list of potential harms and benefits mightpromote congruence in daily healthcare delivery


21 Gathering Information on Herbal Galactogogues Recom-mended in Clinical Practice We contacted and interviewed10 key contact healthcare providers who were often consultedby breastfeeding women seeking recommendations to useherbal galactogogues to enhance their human milk supplyWe also interviewed 5 women who previously have soughtrecommendations and used herbal galactogogues to enhancetheir human milk supply

The key contact healthcare providers were asked toprovide their consent to include their initials and detailsas experts who were interviewed in this study Participantswere given the option to remain anonymous upon theirdesire Key contacts provided their age gender academicdegrees specialty number of years in practice approximatenumber of breastfeedingwomen cared for on amonthly basisherbal galactogogues they often recommend the potentialharms and benefits of herbal galactogogues that need to becommunicated to and discussed with breastfeeding womenduring the clinical consultations

The key contact women were asked to provide theirconsent to include their initials and details as experts whowere interviewed in this study Women were also given theoption to remain anonymous upon their desireWomen wereasked to provide their age academic degrees employmentstatus and the potential harms and benefits of galactogoguesthat need to be communicated to and discussed with breast-feedingwomen during the clinical consultationsThedetailedsociodemographic and practice details of the interviewees areprovided as Supplementary Materials (Table S1)

Healthcare providers and women narrated their expe-rience with herbal galactogogues in terms of benefits andharms Herbal galactogogues mentioned by the intervie-wees are listed in Supplementary Materials (Table S2) Allinterviewees (healthcare providers and women) mentionedfenugreek as one of themost frequently recommended herbalgalactogogues As all interviewees mentioned fenugreek as agalactogogue we decided to gather all potential harms andbenefits of this herbal galactogogue that need to be commu-nicated to and discussed with breastfeeding women duringthe clinical consultations between breastfeeding women andtheir caring healthcare providers in which fenugreek is to berecommended All potential harms and benefits mentionedby the interviewees were collected An extensive literaturereview was then conducted to gather other potential harmsand benefits of using fenugreek that could be found in other

studies [4 6 12 13 17 18 21 22 24ndash46] All potentialharms and benefits found in the previous studies were notedPotential harms and benefits collected were rephrased intostatements We discarded all potential harms and benefitsrelated to costs convenience and inconvenience Statementswere piloted for clarity and comprehensibility with 5 medicalstudents and 5 lay persons Some statements were revisedbased on the feedback of the pilot and all statements werecompiled into a questionnaire

22 The Consensual Technique In this study we used theDelphi technique as a tool to achieve formal consensusamong panelists on which potential harms and benefitsof using fenugreek by breastfeeding women to enhancetheir human milk supply should be communicated to anddiscussed with breastfeeding women during the clinicalconsultations between breastfeeding women and their caringhealthcare providers Recently this formal consensus tech-nique has evolved as one of the most frequently employedtechniques in achieving consensus on issues lacking con-sensus in healthcare [15 47ndash49] This technique has manyadvantages over other techniques like round table meetingfocus and nominal groups The advantages of this techniqueinclude guarding the anonymity of the participants abilityto recruit panelists from different locations conveniencesaving the costs of bringing the panelists to a round tablemeeting and immunity against individual domination ofthe discussion and influencing opinions of other panelistsThe Delphi technique combines both quantitative as wellas qualitative methods in which a multiround questionnairesystem is completed in two or more iterative stages knownas rounds over a period of time within one or more panelsuntil consensus is achieved [50] The panelists are oftenrequested to express the level of their disagreement oragreement with a list containing items in a questionnaireConsensus is defined a priori and items on which consensuswas not reached in one round are included in a revisedquestionnaire for a subsequent round and the process iscontinued until reaching a conclusion that consensus on theremaining items is no longer likely to be achieved [15 47ndash49] Sharing statistical summaries and comments with thepanelists in a trial to decrease the number of rounds neededto reach consensus on the items included is commonlypracticed

As the views and opinions of women and healthcareproviders could be different from each other we soughtconsensus in two separate panels [15] A panel includedhealthcare providers who are often consulted by breast-feeding women seeking recommendations to increase theirhuman milk supply and the other panel was composedof women who sought recommendations and used herbalgalactogogues to enhance their human milk supply

23 Panel of Healthcare Providers A judgmental samplingtechnique was used to recruit panelists who were healthcareproviders that were often consulted by breastfeeding womenseeking recommendations to increase their humanmilk sup-ply Potential panelists were identified by personal contacts inthe field As breastfeeding women seeking recommendations


to increase their human milk supply often consult gynecolo-gistsobstetricians lactation consultant nurses pediatriciansfamily medicine specialists and pharmacists we aimed torecruit panelists with these specialties Because the Delphitechnique implies that the panelists have to be rich withexperience and information to narrate it is well-establishedthat selection and recruitment of the panel members areamong the most captious steps in the Delphi technique [15]In the current study panelists were approached and invited toparticipate as panel members based on their qualificationsspecialty and experience in the field of recommendingherbal galactogogues for breastfeeding women seeking rec-ommendations to enhance their human milk supply Fieldresearchers approached in person and invited the potentialpanelists to participate as panelmembers in the current studyField researchers explained the design and objectives of thestudy to potential panelists and obtained their verbal consentbefore participation The inclusion criteria were (1) havinga basic or advanced qualification in a healthcare specialtyrelated to being consulted by breastfeeding women seekingrecommendations to enhance their human milk supply (2)having a license to practice in Palestine (3) having 5 or moreyears of practicing experience in a healthcare establishmentattended by breastfeeding women seeking recommendationsto enhance their human milk supply and this was impor-tant as possessing previous knowledge of the subject beingresearched is a critical prerequisite for a panelist to takepart in the Delphi technique [15] (4) consultation with5 or more breastfeeding women on a monthly basis (5)knowledge of the use of herbal galactogogues in enhancinghuman milk supply In this study 56 panelists were recruitedand participated in the panel of healthcare providers Thepanelists were not offered any financial incentives

24 Panel of Women In this study snowball sampling wasused to identify and recruit women who sought recom-mendations and used herbal galactogogues to enhance theirmilk supply Potential panelists were identified using personalcontacts in the field Potential panelists were approached byfield researchers in person and invited them to participatein this study The field researchers explained the design andobjectives of the study to the potential panelists and obtainedtheir verbal consent before they were recruited to the panelWomen were invited and recruited to the panel when theymet the inclusion criteria of (1) having breastfed at least oneinfant (2) having been recommended at least once to useherbal galactogogues to enhance their humanmilk supply (3)using one or more herbal galactogogue to enhance humanmilk production and (4) willingness to take part in thecurrent study In this study 65 women were recruited tothe panel Again participants were not offered any financialincentives

25 The Iterative Delphi Technique Rounds

251 Delphi Round 01 In the first Delphi round the ques-tionnaire was given by hand to all 56 healthcare providersand 65 women The questionnaire consisted of 2 sectionsIn the 1st section the panelists were requested to disclose

their sociodemographic details The healthcare professionalsprovided their gender age academic qualifications numberof years in practice specialty how often they recommendedherbal galactogogues for breastfeeding women in their clini-cal practice and howoften they communicated and discussedharms and benefits of herbal galactogogues that breastfeedingwomen might be consuming during clinical consultationsFemale healthcare professionals were also requested to pro-vide if they have breastfed before and the number of infantsthey breastfed Women were requested to provide their ageeducational level employment status number of infants theybreastfed how often they have been recommended by theirhealthcare providers to use herbal remedies to enhance theirhuman milk supply and if they liked to have enough discus-sion with their healthcare providers on the potential harmsand benefits of using herbal remedies during breastfeedingThe 2nd section of the questionnaire contained a list of24 and 16 items related to potential harms and benefitsrespectively of using fenugreek as a herbal galactogogue toenhance humanmilk supply and the panelists were requestedto express the degree towhich they disagree or agree that eachpresented item needs to be communicated to and discussedwith breastfeeding women during consultations on a Likertscale of 9 points [15 47ndash49] When the panelists scored1ndash3 this indicated that they disagree with the importanceof communicating and discussing the presented potentialharm or benefit during the clinical consultation that isthey are of the opinion that the presented potential harm orbenefit should not be communicated to and discussed withbreastfeeding women during the consultations When thepanelists scored 7ndash9 this indicated that they agree with theimportance of communicating and discussing the presentedpotential harm or benefit to breastfeeding women during theclinical consultation that is they are of the opinion that theproposed potential harm or benefit should be communicatedto and discussed with breastfeeding women during theconsultation When the panelists scored 4ndash6 this indicatedthat the panelists partially agreed with the importance ofcommunicating and discussing the presented potential harmor benefit during the clinical consultation that is the pan-elists are inconclusive either the presented potential harmor benefit should be communicated to and discussed withbreastfeeding women or not during the consultations In thisstudy the panel members were requested and encouraged toadd written comments to justify andor qualify their scoreson the Likert scale as in previous studies [15 47ndash49]

252 Definition of Consensus and Analysis of the ScoresScores were analyzed using an Excel Sheet (Microsoft Excel2013) The first quartile (Q1) median (Q2) third quartile(Q3) and the interquartile range (IQR) were computed foreach item Scores of both panels were analyzed separatelyThedata were analyzed using the same definitions of consensusused in previous studies [15 47ndash49] Briefly the item includedthe list of important harms or benefits that need to becommunicated to and discussed with breastfeeding womenduring the consultation when the median score fell between7 and 9 and the interquartile range (IQR) fell between 1 and2 and the item was excluded from the list of important harms


or benefits that need to be communicated to and discussedwith breastfeeding women during the consultation when themedian score fell between 1 and 3 and the IQR fell between 1and 2 However the item was considered equivocal when themedian score fell between 4 and 6 or the IQR was larger than2 Equivocal items were included in a revised questionnairefor a subsequent Delphi round In this study consensus wasbased on at least 80 of the scores of the panelists in eachpanel separately

253 Delphi Round 02 A revised questionnaire containingall equivocal itemswas subjected to a secondDelphi round Ina trial to reduce the number ofDelphi rounds needed to reachconsensus we provided the panelists with (1) the medianscore and the IQR for each potential harm or benefit (2)reminder of their own scores in the previous Delphi roundand (3) summary of the comments made by the panelistseither to justify or qualify their scores

Scores in this roundwere computed and analyzed accord-ing to the same definitions used in the previous Delphiround After analyzing the scores and comments obtainedin the second Delphi round we came to a conclusion that itwas unlikely that consensus would be achieved if we wouldconduct further Delphi rounds

26 Ethical Considerations This study received ethicalapproval from the Institutional Review Board (IRB) com-mittee of An-Najah National University We obtained verbalconsent from all panelists before they participated in thecurrent study All views opinions and scores of the panelistsweighed equally in the analysis

3 Results

31 Response Rate Questionnaires were completed by 56healthcare providers who are often consulted by breastfeed-ing women and 65 women who breastfed before in thefirst Delphi round therefore the response rate was 100However in the second Delphi round 48 (857) of thehealthcare providers and 40 (615) of the women completedand returned the questionnaire

32 Characteristics of the PanelistsWho Took Part in the Study

321 The Panel of Healthcare Providers In this study thepanelists who were healthcare providers were of different agegroups belonged to both genders had variable number ofyears in practice had different academic qualifications andhad various specialties More than half of the panelists weremale in gender physicians and 40 years and older About56 of the panelists were either gynecologistsobstetricianspediatricians or family medicine specialists About 59 ofthe panelists were in practice for 10 or more years Thedetailed characteristics of the panelists are shown in Table 1

322 The Panel of Women The women who took part aspanelists in this study were of different age groups andhad different educational levels and employment status Themajority of the women (about 85) had a university degree

Table 1 Sociodemographic and practice details of the healthcareproviders who are often consulted by breastfeedingwomen (119899 = 56)

Variable 119899 Gender

Male 30 536Female 26 464

Age (years)lt40 30 536ge40 26 464

Have you breastfed beforea

Yes 19 731b

No 7 269b

Number of infants breastfeda

0 7 269b

1 4 154b

2 3 115b

ge3 12 462b

Academic qualificationsBS 21 375MS 5 89MD 28 500PhD 2 36

SpecialtyGynecologyobstetrics 10 179Pediatrics 5 89Family medicine 16 286Lactation consultant nurse 13 232Pharmacist 12 214

Number of years in practice5ndash9 23 411ge10 33 589

How often do you recommend herbalgalactagogues for breastfeeding women

Quite often 39 696Sometimes 17 304

How often do you discuss herbal galactagoguesthat breastfeeding women could be using duringyour consultations with them


aThe question was for healthcare providers who were female in genderbPercentages were based on the number of female panelists BS Bachelorof Science MS Master of Science MD Doctor of Medicine and PhDDoctor of Philosophy

and were 25 years and older About 43 of the womenbreastfed 3 or more infants The detailed variables of thewomen panelists who participated in this study are shown inTable 2

33 Use of Fenugreek for Enhancing Human Milk SupplyAbout 70 of the healthcare provider panelists stated that


Table 2 Sociodemographic details of the women who participatedin this study (119899 = 65)

Variable 119899 Age (years)lt25 10 154ge25 55 846

Educational levelSchool 16 246Bachelorrsquos degree 37 569Masterrsquos degree 12 185

Employment statusEmployed 39 600Unemployed 26 400

Number of infants breastfed1 22 3382 15 231ge3 28 431

How often have you been recommended by yourhealthcare provider to use herbal remedies forenhancing your human milk supply

Many times 44 677Once or a few times 21 323

Do you like to have enough discussion with yourhealthcare provider on the potential harms andbenefits of using herbal remedies

Always 43 662Sometimes 22 338

they recommended quite often herbal remedies for breast-feeding women About 68 of the women had been rec-ommended many times by their healthcare providers to useherbal remedies for enhancing their human milk supply

About 57 of the panelists discussed quite often herbalremedies that breastfeeding women could be using duringtheir consultations with them About 66 of the womenstated that they would always like to have enough discussionwith their healthcare providers on the potential harms andbenefits of using herbal remedies for enhancing their humanmilk supply

34 Potential Harms of Using Fenugreek to Enhance HumanMilk Supply That Need to Be Communicated to and Discussedwith Breastfeeding Women during the Clinical ConsultationIn this study consensus was achieved in both panels on 21potential harms of using fenugreek to enhance human milksupply that need to be communicated to and discussed withbreastfeeding women during the consultation The detailedlist of these items is shown in Table 3

In general there was consensus on 6 potential harmsrelated to the anticoagulant effects of fenugreek 3 potentialharms related to the increased risk of abortion associatedwithusing fenugreek 4 potential harms related to comorbidities3 potential harms related to the effects of fenugreek on theblood pressure 2 potential harms related to the effects of

fenugreek on the blood glucose level and 3 other potentialharms related to the side effects of fenugreek

35 Potential Benefits of Using Fenugreek to Enhance HumanMilk Supply That Need to Be Communicated to and Discussedwith Breastfeeding Women during the Consultation In thisstudy consensus was achieved in both panels on 14 potentialbenefits of using fenugreek to enhance human milk supplythat need to be communicated to and discussed with breast-feeding women during the consultation A detailed list ofthese potential benefits is shown in Table 4

In general there was consensus on the potential benefitsof fenugreek related to enhancing human milk supply andfertility Consensus was also achieved to communicate anddiscuss other potential benefits of fenugreek related to itsantioxidant chemoprotective immunomodulatory antide-pressant and anti-infective properties with breastfeedingwomen

36 Potential Harms and Benefits of Using Fenugreek toEnhance Human Milk Supply That Need or Need Not to BeCommunicated to and Discussed with Breastfeeding Womenduring the Consultation Depending on the Individual ClinicalSituationrsquos Need Consensus was not achieved on 3 potentialharms and 2 potential benefits of using fenugreek to enhancehuman milk supply These equivocal items are listed inTable 5 Whether to communicate and discuss these itemsduring a clinical consultation was left to the choice of thehealthcare provider and depending on the individualrsquos needs

4 Discussion

In the present study we developed a consensual core list ofimportant potential harms and benefits of using fenugreekas herbal galactogogue that should be communicated toand discussed with breastfeeding women seeking recom-mendations to increase their human milk supply from theircaring healthcare providers in daily practice in two separatepanels of women and healthcare providers To the best ofour knowledge this consensual core list is the first attemptto develop guidance for healthcare providers to consultwhen recommending fenugreek-based herbal remedies topromote humanmilk supply in breastfeeding women seekingrecommendations to enhance their human milk supply

When gold standards are not existent consensual tech-niques might provide alternative methods to reduce biasenhance transparency and validity of judgmental methodswhen developing certain criteria [15] We believe that thisconsensual core list should appeal to healthcare providers andmight be consulted to guide communicating and discussingpotential harms and benefits of using fenugreek to promotehuman milk supply in breastfeeding women seeking recom-mendations to enhance their milk supply Judgmental sam-pling was used to recruit panelists for the panel of healthcareproviders and snowball samplingwas used to recruit panelistsfor the panel of women These nonprobability samplingtechniques have long been regarded as biased [51] Howeverfor this study design and objectives probability randomized


Table 3 Potential harms of using fenugreek to enhance humanmilk supply that need to be communicated to and discussedwith breastfeedingwomen during the clinical consultation

Item Potential harms Round on which consensus was achieved

Panel of healthcare providers Panel of womenFenugreek has anticoagulant effects

1 Breastfeeding women who have a history of any clotting related disorder need tobe warned not to take fenugreek 2 1

2 Breastfeeding women who have a history of vaginal bleeding disorder need to bewarned not to take fenugreek 1 1

3 Breastfeeding women who are at risk of any bleeding disorder need to be warnednot to take fenugreek 1 1

4 Breastfeeding women need to be warned that fenugreek might be associated withmenstrual breakthrough bleeding 2 1

5 Breastfeeding women who are on anticoagulants need to be warned not to takefenugreek 2 1

6 Breastfeeding women who are on non-steroidal anti-inflammatory drugs(NSAIDs) need to be warned not to take fenugreek 2 1

Fenugreek might be associated with abortion

7 Women planning to become pregnant need to be warned that fenugreek is apotential utero-stimulant and might cause spontaneous abortion 2 2

8 Women with a history of previous miscarriage need to be warned not to takefenugreek 1 1

9 Women planning to become pregnant need to be warned that fenugreek mightimpair fetal development 1 1

Risks associated with using fenugreek on other co-morbidities

10 Breastfeeding women need to be warned that fenugreek might cause nausea andvomiting 2 2

11 Breastfeeding women need to be warned that fenugreek might cause diarrhea inthe mother and her breastfed infant 2 1

12 Breastfeeding women with a history of asthma need to be warned that fenugreekmight worsen the symptoms of their asthma 1 1

13 Breastfeeding women need to be warned that fenugreek might cause dehydration 1 1Fenugreek could be associated with hypotension

14 Breastfeeding women with a history of or at risk of hypotension need to bewarned not to take fenugreek 1 1

15 Breastfeeding women with a history of or at risk of dizziness need to be warnednot to take fenugreek 2 1

16 Breastfeeding women who are on anti-hypertensive medications need to bewarned not to take fenugreek 1 1

Fenugreek could be associated with hypoglycemia

17 Breastfeeding women with a history of or at risk of hypoglycemia need to bewarned not to take fenugreek 2 1

18 Diabetic breastfeeding women whose disease is controlled by medications orinsulin need to be warned not to take fenugreek 1 1

Other adverse effects19 Breastfeeding women need to be warned that fenugreek might cause fever 2 1

20 Breastfeeding women need to be warned that fenugreek might cause excessivesweating 2 2

21Breastfeeding women taking diuretics laxatives mineralocorticoids andorother hypokalemic agents need to be warned that fenugreek may worsenhypokalemia

2 1


Table 4 Potential benefits of using fenugreek to enhance human milk supply that need to be communicated to and discussed withbreastfeeding women during the clinical consultation

Item Potential benefits Round on which consensus was achieved

Panel of healthcare providers Panel of women

1 Breastfeeding women might be informed that fenugreek can be beneficial inenhancing their human milk production 1 1

2 Breastfeeding women might be informed that fenugreek might improve theirfertility 2 2

3 Breastfeeding women might be informed that fenugreek has antioxidantproperties 2 2

4 Breastfeeding women might be informed that fenugreek has estrogenic effects 2 1

5 Breastfeeding women might be informed that fenugreek has immunomodulatoryeffect 1 1

6 Breastfeeding women might be informed that fenugreek has chemo-protectiveeffect against breast cancer 1 1

7 Breastfeeding women might be informed that fenugreek may decrease plasmacholesterol and triglycerides levels 1 1

8 Breastfeeding women might be informed that fenugreek may have antidepressantactivity 2 1

9 Breastfeeding women might be informed that fenugreek may have antibacterialactivity 1 1

10 Breastfeeding women might be informed that fenugreek may have antifungalactivity 1 1

11 Breastfeeding women might be informed that fenugreek could decrease theirappetite especially those with a history of eating disorders 2 1

12 Breastfeeding women might be informed that fenugreek can enhance weight loss 2 1

13 Breastfeeding women might be informed that fenugreek might have antipyreticactivity 2 1

14 Breastfeeding women might be informed that fenugreek may alleviate symptomsof ulcer 2 1

Table 5 Potential harms and benefits of using fenugreek to enhance human milk supply that need or need not to be communicated to anddiscussed with breastfeeding women during the consultation depending on the individual clinical situationrsquos need

Item

Panel of healthcareproviders Panel of women

Round 1 Round 2 Round 1 Round 2M IQR M IQR M IQR M IQR

Potential harms

1 Breastfeeding women need to be warned thatfenugreek may induce thirst 5 2 5 3 6 2 5 3

2Breastfeeding women need to be warned thatfenugreek may be associated with maple syruplike urine

4 3 5 2 5 2 6 3

3Breastfeeding women need to be warned thatfenugreek may be associated with maple syruplike sweat

5 2 4 3 4 3 4 2

Potential benefits

1 Breastfeeding women might be informed thatfenugreek may have antiparkinsonian activity 4 4 5 3 6 2 6 3

2 Breastfeeding women might be informed thatfenugreek may improve memory and cognition 4 2 4 3 5 3 5 3

M median IQR interquartile range


sampling techniques were not feasible Moreover judgmentaland snowball sampling techniques permitted the recruitmentof panelists with prior knowledge of the subject beinginvestigated who were rich in experience to narrate [15 47ndash49] The panel of healthcare providers was composed ofgynecologistsobstetricians pediatricians family physicianslactation consultants and pharmacists Those healthcareprofessionals would normally be consulted by breastfeedingwomen seeking recommendations to increase their humanmilk supply [17 52]Womenwhowere recruited for the panelof women experienced inadequate humanmilk supply soughtrecommendations from healthcare providers and used herbalgalactogogues

The number of panelists in the panel of healthcareproviders and panel of women was slightly larger than thoseused in previous studies in which consensus was soughton issues in healthcare [15 47ndash49] Currently there is noconsensus on the number of panelists in a panel of expertsPanel sizes varied greatly in previous studies and the sizesranged from 10 over 1000 panel members [51]

In this study a consensual core list of potential harmsand benefits of using fenugreek as herbal galactogogue wasdeveloped to guide healthcare providers on what harms andbenefits to discuss andor address during the clinical con-sultation when opting to recommend fenugreek for breast-feeding women seeking recommendations to increase theirhumanmilk supply Guidelines on what healthcare providersshould communicate and discuss in terms of potential harmsand benefits are currently lackingWe believe this consensualcore list should help healthcare providers and change theirbehaviors during consultations with breastfeeding womenseeking recommendations to increase their human milksupply It has been argued that professionals would changebehavior in response to recommendations they agree withrather than recommendations they do not agree with [15 47ndash49]

The use of herbal remedies was reported to be highamong women in Palestine [31 53] In this study about68 of the women reported that they were recommended touse herbal galactogogues many times Similarly about 70of the healthcare providers reported that they recommendquiet often herbal galactogogues for breastfeeding womenseeking recommendations to increase their human milksupply Our findings were consistent with those previouslyreported by Bazzano et al in the US in which 70 ofthe healthcare providers surveyed indicated that they oftenrecommend galactogogues [52] Similarly fenugreek wasthe most frequently recommended herbal galactogogue inBazzanorsquos study In this study about 68 of the womenreported that they always wanted to have enough discussionwith their caring healthcare providers on the potential harmsand benefits of herbal remedies Findings of this study wereconsistent with those reported in a previous study in which76 of pregnant women stated that they would like to haveenough discussion on the benefits and harms of gingerwhen recommended to alleviate symptoms of nausea andvomiting of pregnancy [15] In this study inclusion womenwho experienced human milk insufficiency and used herbalgalactogogues in the panel of women ensured inclusion of the

insecurities and concerns breastfeeding women would liketheir caring healthcare providers to address during clinicalconsultations Interestingly about 57 of the healthcareproviders reported that they quite often address potentialharms and benefits of herbal remedies during consultationswith breastfeeding women

In this study the response rate was high in both Delphirounds This was consistent with other studies seeking con-sensus on issues in healthcare using the Delphi technique[15 47ndash49] This strength adds to the validity of the findingsreported in this study The panel of healthcare providersincluded panelists of both genders different age groups geo-graphical locations practice settings specialties and numberof years in practice (Table 1) The panel of women includedpanelists from different geographical locations age groupsnumber of breastfed infants educational levels and employ-ment status (Table 2) This diversity adds to the strength andvalidity of the findings reported in this study

In this study consensus was achieved on potential harmsrelated to the anticoagulant potential of fenugreek thatneed to be discussed andor addressed during the clinicalconsultation (Table 3) These findings were consistent withthose reported in another study in which consensus wasachieved among healthcare professionals on addressing thepotential harms and benefits of using ginger to managenausea and vomiting of pregnancy especially harms relatedto the anticoagulant potential of ginger [15] Not surprisinglypatients were previously reported to want to hear more fromtheir healthcare providers on the best ways to make outof the therapies they are taking [54 55] The anticoagulanteffects of fenugreek were previously reported A recent studyshowed that aqueous extract of fenugreek inhibited bloodcoagulation process in vitro and increased prothrombin timein a dose dependent manner in blood samples obtainedfromhealthy individuals [41] Drug-herb interaction betweenfenugreek and warfarin was also reported [26] Professionalgroups like the American Society of Anesthesiologists haveadvised patients to stop consuming herbal therapies 2-3weeks prior to surgery as a safety precaution to avoid risksof bleeding [15 32] Findings of this study suggested that bothhealthcare providers and womenwanted the risks of bleedingassociated with the use of fenugreek by breastfeeding womento communicate and discuss during the consultation inwhich fenugreek is recommended to be used Informedbreastfeeding women could be in a better position to decidewhether to use fenugreek or opt for another safer alternative

In this study the panelists were of the opinion that therisks of abortion associated with using fenugreek should becommunicated to and discussed with breastfeeding womenduring the consultations Again these findings were con-sistent with those reported in a previous study in whichpregnant women and gynecologists agreed that the risksof abortion associated with using ginger for nausea andvomiting of pregnancy should be addressed during clinicalconsultations [15] Previous studies showed that aqueousextract of fenugreek had potential teratogenic effects inhumans and animals [33 39] Health regulatory bodies tendto recommend avoidance of herbal remedies even whenthe risks associated with their use are inconclusive As a


good example here the German E Commission and theFinnish Food Safety Authority recommended that pregnantwomen should avoid ginger even though the risks of abortionassociated with using ginger by pregnant women were largelyinconclusive [56] There could be cases in which breastfeed-ing women could become pregnant The panelists in thisstudy were of the opinion to warn women of these potentialrisks during the clinical consultations Conservative viewsimply that women should be warned even when the potentialrisks are still inconclusive [38 42]

The use of fenugreek could worsen the symptoms ofsome comorbidities For example fenugreek could worsenthe symptoms of asthma [38 42] It has been recommendedthat individuals with chronic asthma and allergy should avoidconsumption of fenugreek [28 38] Therefore in this studythe panelists were of the opinion that this risk should becommunicated to and discussed with breastfeeding womenduring consultations Many breastfeeding women could beasthmatics and should be warned of this potential harmof using fenugreek Again breastfeeding women should bewarned that fenugreek could cause nausea and vomitingwhich could be disturbing to the breastfeeding women andcould have negative effects on their reported quality oflife [39] Fenugreek could be associated with diarrhea andexcessive sweating for the breastfeeding women and theirbreastfed infants [34] Severe diarrhea and excessive sweatingcould result in huge fluid loss that might lead to dehydrationas well as serious consequences on the health of infantsThese risks should be communicated to and discussed withbreastfeeding during the consultations

The findings of this study suggested that the risks associ-atedwith the effects of fenugreek on the blood pressure bloodglucose and potassium levels should be communicated toand discussed with breastfeeding women during the consul-tations [29 30 37 40] Some breastfeeding women could beat risk of hypotension or hypoglycemia and should be warnedagainst these risks when using fenugreekThe blood pressureand blood glucose levels of some breastfeeding womenmightbe controlled by medications Using fenugreek might havenegative consequences of these controlled levels and hencebreastfeeding women at risk should be warned Similarlysome breastfeeding women could be taking diuretics laxa-tives mineralocorticoids or other hypokalemic agents Thepanelists in this study were of the opinion that breastfeedingwomen should be warned that fenugreek might worsen theirhypokalemia

The panelists in this study agreed that benefits relatedto enhancing human milk supply should be communicatedto and discussed with breastfeeding women during theconsultations [22] Enhancing human milk supply wouldbe the primary anticipated effect of using fenugreek as agalactogogue The panelists were of the opinion of informingthe breastfeeding women recommended to use fenugreek ofits antioxidant estrogenic and immunomodulatory prop-erties [35 43] Chemoprotective effects against breast can-cer and antidepressant effects of fenugreek might also becommunicated to and discussed with breastfeeding women[27 35 43] Many breastfeeding women might be concernedwith breast cancer and postpartum depression and could

be interested in learning about these potential benefits offenugreek Breastfeeding women might also be informed ofthe antibacterial antifungal and antipyretic effects of fenu-greek [42] Fenugreek might also be beneficial in controllingappetite promoting weight loss alleviate ulcer and decreas-ing cholesterol and triglycerides levels Many breastfeedingwomen could have gained weight during pregnancy andmight be interested in decreasing their weight Fenugreekmight offer some help toward this end

The opinions of the panelists were divisive on the impor-tance of communicating and discussing potential effects offenugreek in inducing thirst marble like urine and sweatSimilarly the opinions of the panelists were divisive whetherto communicate to and discuss with breastfeeding womenpotential benefits of fenugreek related to enhancing cog-nition memory and its antiparkinsonian effects [36 43]These potential harms and benefits might be or might not bediscussed depending on the needs of each individual case

In general care should be taken when breastfeedingwomen are recommended treatments as many medicationsand herbal remedies are excreted into the human milkTherefore both breastfeeding women and their breastfedinfants could be vulnerable In all cases potential benefitsshould be weighed against potential risks considering otheravailable safe alternatives Similarmeasures should be appliedwhen fenugreek-based herbal remedies are intended to berecommended as galactogogues for breastfeeding womenseeking recommendations to enhance their human milksupply

The findings of this study could be interpreted con-sidering a number of limitations First this was an obser-vational consensual study Observing healthcare providerrsquosrecommendations of fenugreek in daily clinical practice andwhy it was recommended for breastfeeding women couldhave shown other findings Second in this study we didnot classify potential harms and benefits into major harmsand minor harms However this classification goes beyondthe scope and objectives of this study Third we did nothierarchize the potential harms and benefits in order ofimportance The hierarchy would have helped healthcareproviders to prioritize the information to be communicatedand discussed in case they did not have enough time to goover all potential benefits and harms Fourth judgmental andsnowball sampling techniques were used to recruit panelistsfor this study These nonprobability sampling techniquesare viewed as biased in conservative views However thesetechniques are commonly used for this type of studies asprobability sampling techniques are not practically feasibleFinally the number of panelists who participated in eachpanel was relatively small However there is no consensus onthe number of panelists required for a Delphi technique Thenumber of panelists used in this study was slightly larger thansizes used in previous studies seeking consensus on issues inhealthcare

5 Conclusion

Panelists in this study were of the opinion that potentialharms and benefits of recommending the use of fenugreek


as herbal galactogogue for breastfeeding women seekingrecommendations to increase their human milk supply needto be discussed during the clinical consultations This couldbe important in promoting congruence in daily healthcaredelivery improving patientrsquos experience with therapy copingwith side effects of the therapy and enhancing patientreported quality of life In this study consensus was achievedon a core list of potential harms and benefits of usingfenugreek as herbal galactogogue in breastfeeding womenseeking recommendations to enhance their human milksupply that need to be communicated to and discussedwith breastfeeding women during the consultations in whichfenugreek-based herbal remedies are to be recommendedThis consensual list might be consulted as guidance byhealthcare providers who are often consulted by breast-feeding women seeking recommendations to enhance theirhuman milk supply Further randomized clinical trials arestill required to establish evidence-based benefits and harmsof fenugreek in breastfeeding women More observationalstudies are needed to assess what is being communicated anddiscussed in daily consultations when herbal remedies arerecommended



Supplementary Materials

Supplementary Table S1 provides the sociodemographic andpractice details of the key contacts who were interviewed inthis study (119899 = 15) Supplementary Table S2 provides detailsof the plants cited by the key contacts who were interviewedin this study (119899 = 15) (Supplementary Materials)

References

[1] E A Brownell J I Hagadorn M M Lussier et al ldquoOptimalperiods of exclusive breastfeeding associated with any breast-feeding duration through one yearrdquo Journal of Pediatrics vol166 no 3 pp 566ndash570 2015

[2] C G Victora R Bahl A J D Barros et al ldquoBreastfeeding in the21st century Epidemiology mechanisms and lifelong effectrdquoThe Lancet vol 387 no 10017 pp 475ndash490 2016

[3] A Brown ldquoBreastfeeding as a public health responsibilitya review of the evidencerdquo Journal of Human Nutrition andDietetics vol 30 no 6 pp 759ndash770 2017

[4] F McAndrew Infant feeding survey 2010 Leeds Health andSocial Care Information Centre 2012

[5] L E Grzeskowiak J A Dalton and A L Fielder ldquoFactors asso-ciated with domperidone use as a galactogogue at an australiantertiary teaching hospitalrdquo Journal of Human Lactation vol 31no 2 pp 249ndash253 2015

[6] AM Stuebe B J Horton E Chetwynd SWatkins K Grewenand S Meltzer-Brody ldquoPrevalence and risk factors for earlyundesired weaning attributed to lactation dysfunctionrdquo Journalof Womenrsquos Health vol 23 no 5 pp 404ndash412 2014

[7] B Haase S N Taylor J Mauldin T S Johnson and C LWagner ldquoDomperidone for Treatment of Low Milk Supply inBreast Pump-Dependent Mothers of Hospitalized Premature

Infants A Clinical Protocolrdquo Journal of Human Lactation vol32 no 2 pp 373ndash381 2015

[8] L E Grzeskowiak S W Lim A E Thomas U Ritchie andA L Gordon ldquoAudit of domperidone use as a galactogogueat an Australian tertiary teaching hospitalrdquo Journal of HumanLactation vol 29 no 1 pp 32ndash37 2013

[9] A Osadchy M E Moretti and G Koren ldquoEffect of domperi-done on insufficient lactation in puerperal women a systematicreview and meta-analysis of randomized controlled trialsrdquoObstetrics and Gynecology International vol 2012 Article ID642893 7 pages 2012

[10] L E Grzeskowiak and L H Amir ldquoUse of domperidoneto increase breast milk supply Further consideration of thebenefit-risk ratio is requiredrdquo Journal of Human Lactation vol31 no 2 pp 315-316 2015

[11] L Grzeskowiak ldquoUse of Domperidone to increase breast milksupply Are women really dying to breastfeedrdquo Journal ofHuman Lactation vol 30 no 4 pp 498-499 2014

[12] S A Doggrell and J C Hancox ldquoCardiac safety concerns fordomperidone an antiemetic and prokinetic and galactogoguemedicinerdquo Expert Opinion on Drug Safety vol 13 no 1 pp 131ndash138 2014

[13] S C Foong M L Tan L A Marasco J J Ho andW C FoongldquoOral galactagogues for increasing breast-milk production inmothers of non-hospitalised term infantsrdquo Cochrane Databaseof Systematic Reviews vol 4 2015

[14] C Paul M Zenut A Dorut et al ldquoUse of domperidone as agalactagogue drug a systematic review of the benefit-risk ratiordquoJournal of Human Lactation vol 31 no 1 pp 57ndash63 2015

[15] R Shawahna and A Taha ldquoWhich potential harms and benefitsof using ginger in the management of nausea and vomitingof pregnancy should be addressed A consensual study amongpregnant women and gynecologistsrdquo BMC Complementary andAlternative Medicine vol 17 no 1 article no 204 2017

[16] H Liu Y Hua H Luo Z Shen X Tao and X Zhu ldquoAnHerbal Galactagogue Mixture Increases Milk Production andAquaporin Protein Expression in the Mammary Glands ofLactatingRatsrdquoEvidence-BasedComplementary andAlternativeMedicine vol 2015 Article ID 760585 2015

[17] S Colaceci A Giusti A De Angelis et al ldquoMedications ldquonat-uralrdquo Products and Pharmacovigilance during BreastfeedingA Mixed-Methods Study on Womens Opinionsrdquo Journal ofHuman Lactation vol 32 no 2 pp 324ndash332 2015

[18] M R Amer G C Cipriano J V Venci and M A GandhildquoSafety of popular herbal supplements in lactating womenrdquoJournal of Human Lactation vol 31 no 3 pp 348ndash353 2015

[19] L Gori E Gallo V Mascherini A Mugelli A Vannacci andF Firenzuoli ldquoCan estragole in fennel seed decoctions really beconsidered a danger for human health A fennel safety updaterdquoEvidence-Based Complementary and Alternative Medicine vol2012 Article ID 860542 10 pages 2012

[20] S B Badgujar V V Patel and A H Bandivdekar ldquoFoeniculumvulgare Mill A review of its botany phytochemistry phar-macology contemporary application and toxicologyrdquo BioMedResearch International vol 2014 Article ID 842674 2014

[21] MMortel and S D Mehta ldquoSystematic review of the efficacy ofherbal galactogoguesrdquo Journal of Human Lactation vol 29 no2 pp 154ndash162 2013

[22] T M Khan D B-C Wu and A V Dolzhenko ldquoEffectivenessof fenugreek as a galactagogue A network meta-analysisrdquoPhytotherapy Research 2017


[23] A Albassam and A Awad ldquoCommunity pharmacistsrsquo servicesfor women during pregnancy and breast feeding in Kuwait across-sectional studyrdquo BMJ Open vol 8 no 1 p e018980 2018

[24] M P Gabay ldquoGalactogogues medications that induce lacta-tionrdquo Journal of Human Lactation vol 18 no 3 pp 274ndash2792002

[25] K Huggins Fenugreek One Remedy for Low Milk ProductionBreastfeeding Online 2017

[26] H-T Chan L-T So S-W Li C-W Siu C-P Lau andH-F TseldquoEffect of herbal consumption on time in therapeutic range ofwarfarin therapy in patients with atrial fibrillationrdquo Journal ofCardiovascular Pharmacology vol 58 no 1 pp 87ndash90 2011

[27] K El Bairi M Ouzir N Agnieszka and L Khalki ldquoAnticancerpotential of Trigonella foenum graecum Cellular and molecu-lar targetsrdquo Biomedicine amp Pharmacotherapy vol 90 pp 479ndash491 2017

[28] C K Faeligste E Namork andH Lindvik ldquoAllergenicity and anti-genicity of fenugreek (Trigonella foenum-graecum) proteins infoodsrdquoThe Journal of Allergy and Clinical Immunology vol 123no 1 pp 187ndash194 2009

[29] K Hamden H Keskes S Belhaj K Mnafgui A Feki and NAllouche ldquoInhibitory potential of omega-3 fatty and fenugreekessential oil on key enzymes of carbohydrate-digestion andhypertension in diabetes ratsrdquo Lipids in Health and Disease vol10 article no 226 2011

[30] A A Izzo G di Carlo F Borrelli and E Ernst ldquoCardiovascularpharmacotherapy and herbal medicines the risk of drug inter-actionrdquo International Journal of Cardiology vol 98 no 1 pp1ndash14 2005

[31] N A Jaradat R Shawahna A M Eid R Al-Ramahi M KAsma and A N Zaid ldquoHerbal remedies use by breast cancerpatients in the West Bank of Palestinerdquo Journal of Ethnophar-macology vol 178 pp 1ndash8 2016

[32] A D Kaye R C Clarke R Sabar et al ldquoHerbal medicinesCurrent trends in anesthesiology practice - A hospital surveyrdquoJournal of Clinical Anesthesia vol 12 no 6 pp 468ndash471 2000

[33] L Khalki S B Mrsquohamed M Bennis A Chait and Z SokarldquoEvaluation of the developmental toxicity of the aqueous extractfrom Trigonella foenum-graecum (L) in micerdquo Journal ofEthnopharmacology vol 131 no 2 pp 321ndash325 2010

[34] R Mebazaa B Rega and V Camel ldquoAnalysis of human malearmpit sweat after fenugreek ingestion Characterisation ofodour active compounds by gas chromatography coupled tomass spectrometry and olfactometryrdquo Food Chemistry vol 128no 1 pp 227ndash235 2011


[36] J Nathan S Panjwani V Mohan V Joshi and P A Thakur-desai ldquoEfficacy and safety of standardized extract of Trigonellafoenum-graecum l seeds as an adjuvant to L-dopa in themanagement of patients with Parkinsonrsquos diseaserdquo PhytotherapyResearch vol 28 no 2 pp 172ndash178 2014

[37] C Necyk and L Zubach-Cassano ldquoNatural Health Productsand Diabetes A Practical Reviewrdquo Canadian Journal of Dia-betes vol 41 no 6 pp 642ndash647 2017

[38] M Ouzir K El Bairi and S Amzazi ldquoToxicological propertiesof fenugreek (Trigonella foenum graecum)rdquo Food and ChemicalToxicology vol 96 pp 145ndash154 2016

[39] R Samavati E Ducza J Hajagos-Toth and R Gaspar ldquoHerballaxatives and antiemetics in pregnancyrdquo Reproductive Toxicol-ogy vol 72 pp 153ndash158 2017

[40] C R Sirtori C Galli J W Anderson E Sirtori and A ArnoldildquoFunctional foods for dyslipidaemia and cardiovascular riskpreventionrdquo Nutrition Research Reviews vol 22 no 2 pp 244ndash261 2009

[41] I M Taj Eldin M M Abdalmutalab and H E Bikir ldquoAnin vitro anticoagulant effect of Fenugreek (Trigonella foenum-graecum) in blood samples of normal Sudanese individualsrdquoSudanese Journal of Paediatrics vol 13 no 2 pp 52ndash56 2013

[42] U C S Yadav and N Z Baquer ldquoPharmacological effects ofTrigonella foenum-graecum L in health and diseaserdquo Pharma-ceutical Biology vol 52 no 2 pp 243ndash254 2014

[43] S Zameer A K Najmi D Vohora and M Akhtar ldquo A reviewon therapeutic potentials of rdquo Nutritional Neuroscience pp 1ndash72017

[44] A N Bazzano R Hofer S Thibeau V Gillispie M Jacobsand K P Theall ldquoA review of herbal and pharmaceuticalgalactagogues for breast-feedingrdquo The Ochsner Journal vol 16no 4 pp 511ndash524 2016

[45] M J Stanger L A Thompson A J Young and H R Lieber-man ldquoAnticoagulant activity of select dietary supplementsrdquoNutrition Reviews vol 70 no 2 pp 107ndash117 2012

[46] Z Chen et al ldquoEffects of Saponin from Trigonella Foenum-Graecum Seeds on Dyslipidemiardquo Iranian Journal of MedicalSciences vol 42 no 6 pp 577ndash585 2017

[47] R Shawahna ldquoWhich information on womenrsquos issues inepilepsy does a community pharmacist need to know ADelphiconsensus studyrdquo Epilepsy amp Behavior vol 77 pp 79ndash89 2017

[48] R Shawahna A Haddad B Khawaja R Raie S Zaneenand T Edais ldquoMedication dispensing errors in Palestiniancommunity pharmacy practice a formal consensus using theDelphi techniquerdquo International Journal of Clinical Pharmacyvol 38 no 5 pp 1112ndash1123 2016

[49] R Shawahna D Masri R Al-Gharabeh R Deek L Al-Thayba and M Halaweh ldquoMedication administration errorsfrom a nursing viewpoint A formal consensus of definition andscenarios using a Delphi techniquerdquo Journal of Clinical Nursingvol 25 no 3-4 pp 412ndash423 2016

[50] S Njuangang C Liyanage and A Akintoye ldquoApplication ofthe Delphi technique in healthcare maintenancerdquo InternationalJournal of Health Care Quality Assurance vol 30 no 8 pp 737ndash754 2017

[51] A Page K Potter R Clifford A McLachlan and C Etherton-Beer ldquoPrescribing for Australians living with dementia Studyprotocol using the Delphi techniquerdquo BMJ Open vol 5 no 8Article ID e008048 2015

[52] A N Bazzano L Littrell A Brandt S Thibeau K Thriemerand K P Theall ldquoHealth provider experiences with galact-agogues to support breastfeeding A cross-sectional surveyrdquoJournal ofMultidisciplinaryHealthcare vol 9 pp 623ndash630 2016

[53] R Shawahna and N A Jaradat ldquoEthnopharmacological surveyof medicinal plants used by patients with psoriasis in theWest Bank of Palestinerdquo BMC Complementary and AlternativeMedicine vol 17 no 1 article no 4 2017

[54] S M Dunlay and J J Strand ldquoHow to discuss goals of care withpatientsrdquo Trends in Cardiovascular Medicine vol 26 no 1 pp36ndash43 2016

[55] L EGrzeskowiakMHill andD S Kennedy ldquoPhone calls to anAustralian pregnancy and lactation counselling service regard-ing use of galactagogues during lactation - the MotherSafe


experiencerdquo Australian and New Zealand Journal of Obstetricsand Gynaecology

[56] D Tiran ldquoGinger to reduce nausea and vomiting during preg-nancy evidence of effectiveness is not the same as proof ofsafetyrdquoComplementaryTherapies in Clinical Practice vol 18 no1 pp 22ndash25 2012

Research ArticleGlehnia littoralis Root Extract Inhibits Fat Accumulationin 3T3-L1 Cells and High-Fat Diet-Induced Obese Mice byDownregulating Adipogenic Gene Expression

Heeok Hong1 Joseph F dela Cruz23 Won Seob Kim4

Kiyeol Yoo5 and Seong Gu Hwang 2

1Department of Medical Science School of Medicine Konkuk University Seoul 05029 Republic of Korea2Department of Animal Life and Environmental Science Hankyong National University Anseong 17579 Republic of Korea3College of Veterinary Medicine University of the Philippines Los Banos Philippines4Department of Animal Science and Technology Konkuk University Seoul 05029 Republic of Korea5Department of Biological Sciences Dankook University Cheonan 31116 Republic of Korea

Correspondence should be addressed to Seong Gu Hwang sghwanghknuackr

Received 14 December 2017 Accepted 4 March 2018 Published 18 April 2018

Academic Editor Randhir Singh

Copyright copy 2018 Heeok Hong et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Glehnia littoralis has been reported to have several pharmacological properties but no reports describing the antiadipogenic effectof this plant have been published This study was conducted to investigate the effects of Glehnia littoralis root hot water extract(GLE) and its underlying mechanism on 3T3-L1 cell adipogenesis and in high-fat diet- (HFD-) induced obese mice We measuredintracellular lipid accumulation using oil red O staining in vitro For in vivo study twenty-eight C57BL6Jmalemice were randomlydivided into four groups Control HFDHFD+ 1GLE andHFD+ 5GLE whichwas performed for eight weeksWe determinedthe expression levels of the adipogenesis-related proteins by RT-PCR and western blotting in HFD-induced obese mice TheGLE dose-dependently inhibited 3T3-L1 adipocyte differentiation and intracellular lipid accumulation in differentiated adipocytesFurther body weight gain and fat accumulation were significantly lower in the GLE-treated HFD mice than in the untreated HFDmice GLE treatment suppressed the expression of adipogenic genes such as peroxisome proliferator-activated receptor (PPAR) 120574CCAATenhancer-binding protein (CEBP) 120572 fatty acid synthase (aP2) and fatty acid synthase (FAS) These results suggest thatthe GLE inhibits adipocyte differentiation and intracellular lipid accumulation by downregulating the adipogenic gene expressionboth in vitro and in vivo

1 Introduction

The prevalence of obesity has increased dramatically world-wide owing to lifestyle and diet changes and is rapidly becom-ing a threat to human health Obesity has recently attractedincreasing attention owing to its association with severalmetabolic diseases including type II diabetes cardiovasculardisease and hypertension [1]

Obesity is caused by excess adipose tissue mass whichis the major energy reserve in the body [2] As the adiposetissue mass can be modulated by inhibiting adipogenesis(differentiation of preadipocytes to mature adipocytes) [3]obesity treatments are usually targeted at suppressing energy

or food intake preadipocyte differentiation and proliferationand lipogenesis while increasing energy expenditure lipol-ysis and fat oxidation [4] However no effective treatmentoptions are currently available for obesity Therefore plant-based bioactive materials are being isolated and their phar-macological properties are being actively researched [5 6]Several studies suggest that phytochemical treatments canregulate adipose tissue mass by inhibiting adipogenesis [3 78]

Glehnia littoralis Fr Schmidt ex Miq (Umbelliferae) is aperennial herb that grows on the sandy beaches of easternChina Korea Japan and North-west America [9] Its rootsand rhizomes which are listed in the Korean Chinese



and Japanese Pharmacopoeias [10] have traditionally beenused for their diaphoretic antipyretic antiphlogistic andanalgesic properties Further the aqueous extract of Glittoralis has been reported to have several pharmacologicalproperties including antioxidant [11] anticancer [12 13] anti-inflammatory [10] and some immunomodulatory properties[14 15] The major components of the underground parts ofG littoralis have been identified as quercetin isoquercetinrutin chlorogenic acid and caffeic acid [11]

To date no reports describing the antiadipogenic effectof this plant have been published High-fat diet- (HFD-)induced animal models of obesity and 3T3-L1 cells have beenwidely used for studying the antiobesity properties of variouscompounds [16] Therefore this study was conducted toelucidate the effects of theGlehnia littoralis root extract (GLE)on the adipogenic differentiation of 3T3-L1 cells bymeasuringintracellular lipid accumulation We also investigated themechanism underlying the inhibitory effects of GLE onadipocyte differentiation in HFD-induced obese mice todetermine the potential medicinal benefits of G littoralis asan antiobesity agent


21 Preparation of Glehnia littoralis Root Extract (GLE)G littoralis roots obtained from Fine Food Tech Co Ltd(Gongju Korea) were air-dried at 50∘C at an air velocity of15ms for 4 days blended and further ground to obtain afine powderThe powder (300 g) was soaked in 3 L of distilledwater and then heated at 100∘C for 4 h The crude extractwas collected filtered with a sterilized cloth freeze-dried atminus60∘C and stored in a deep freezer (minus70∘C) until use

22 Determination of the Polyphenol Components of GLEby High-Performance Liquid Chromatography (HPLC) TheHPLC analysis was performed on a Dionex Summit system(Thermo Scientific Waltham MA USA) equipped with anUVD 340U-photodiode array detector (Dionex SunnyvaleCA USA) using a reverse-phase C18 analytical column (46times 250mm id 5 120583m Shiseido Capcell Pak MG) The mobilephase was solvent A (methanol acetic acid and water at10 2 88 vvv) and solvent B (methanol acetic acid andwater at 90 3 7 vvv)The analysis was performed under thefollowing gradient conditions 100 A to 0 B (0ndash30min)100 B (30ndash40min) 100 B to 0 A (40ndash42min) and 100A (42ndash60min) with a flow rate of 1mLmin and a detectionwavelength of 280 nm with 1 nm bandwidth All standardswere purchased from Sigma-Aldrich (St Louis MO USA)

23 Cell Culture and Differentiation Murine 3T3-L1 pread-ipocytes were obtained from the Korean Cell Bank (SeoulKorea) and cultured to confluence in Dulbeccorsquos modi-fied Eaglersquos medium (DMEM Gibco Rockville MD USA)supplemented with 10 fetal bovine serum (FBS GibcoRockville MD USA) and 1 penicillin-streptomycin (GibcoRockville MD USA) in a humidified 5 CO2 atmosphereat 37∘C On day 2 after confluence (designated as day0) cell differentiation was induced with the MDI differ-entiation medium containing 1 120583M dexamethasone (DEX

Sigma-Aldrich St Louis MO USA) 05mM 3-isobutyl-1-methylxanthine (IBMX Sigma-Aldrich St LouisMOUSA)10 120583gmL insulin (INS Sigma-Aldrich St Louis MO USA)and DMEM supplemented with 10 FBS After 48 h (day 2)the culturemediumwas replaced with DMEM supplementedwith 10 FBS and this was repeated every 48 h until day 8The cells were treated with different concentrations of theGLE (0 50 100 200 and 400120583gmL) from day 0 to 8 anduntreated cells were used as a control

24 Determination of Cell Viability The effect of differentconcentrations of the GLE on 3T3-L1 preadipocyte viabilitywas determined by the cell counting kit-8 (CCK-8) assay(Dojindo Molecular Technologies Tokyo Japan) Briefly thecells were seeded in a 96-well plate at a density of 1 times104 cellswell and treated with the GLE (0ndash400120583gmL) for24 h 10 120583L of CCK-8 reagent was then added to each well andthe absorbance was measured at 450 nm using an InfiniteF50 microplate reader (Tecan Mannedorf Switzerland)The viability of the GLE-treated cells was expressed as apercentage of the control cell viability

25 Oil Red O Staining and Estimation of the IntracellularLipid Content The lipid accumulation in adipocytes whichindicates the extent of differentiation was measured using oilred O staining Briefly differentiated 3T3-L1 cells were fixedin 10 formaldehyde in PBS for 1 h washed with distilledwater and dried completely The cells were then stained with05 oil red O solution in 60 40 (vv) isopropanol tripledistilled water for 15min at room temperature washed fourtimes with triple distilled water and dried The treated cellswere observed under an Olympus microscope (BX51 TokyoJapan) and representative images were captured using anOlympus DP70 camera The cell differentiation was quanti-fied by elution of the stainwith isopropanol andmeasurementof the absorbance at 520 nm

26 Animals and Diets C57BL6J male mice (6- to 8-week-old) were purchased from Samtako Bio Korea CoLtd (Osan Korea) and initially acclimated to laboratoryconditions for 1 week prior to experimental use Afteracclimatization 28 mice were randomly divided into fourgroups namely the American Institute of Nutrition- (AIN-) 93G diet (control C) high-fat diet (HFD) HFD with 1GLE (HFD + 1 GLE) and HFD with 5 GLE (HFD + 5GLE) groups The HFD contained 455 fat (as soybean oiland lard) 20 protein and 345 carbohydrate (Table 1)

The mice were housed under a 12 12 h light-dark cycleat 22 plusmn 2∘C and 55 plusmn 5 relative humidity with ad libitumaccess to the specified diets and sterile drinking water for 8weeksThe food intake and bodyweight weremeasured everyweek and the feed efficiency ratio (FER) was calculated asthe total weight gaintotal food intake All experiments onanimals were carried out in accordance with the institutionalguidelines of the Hankyong National University AnseongKorea This study conformed to the Guide for the Care andUse of Laboratory Animals published by the US NationalInstitutes of Health (NIH publication number 85-23 revised1996 latest revision in 2011) and was approved by the


Table 1 Composition of experimental diets

Ingredient HFD HFD + 1 GLE HFD + 5 GLECasein 2331 2331 2331Sucrose 2014 2014 2014Dextrose 1165 1165 1165Corn starch 848 748 348Cellulose 583 583 583Soybean oil 291 291 291Lard 2069 2069 2069Mineral mix(1) 524 524 524Vitamin mix(1) 117 117 117L-Cysteine 035 035 035Choline bitartrate 023 023 023GLE(2) 100 500HFD high-fat diet HFD+ 1GLEHFD containing 1Glehnia littoralis root extract (GLE) HFD+ 5GLEHFD containing 5GLE (1)Mineral and vitaminmixtures were based on the AIN-93 standard diet for rodents (2)Glehnia littoralis root extract powder

Table 2 List of primers used in RT-PCR analysis

Gene Forward primer Reverse primerPPAR120574 GATGGAAGACCACTCGCATT AACCATTGGGTCAGCTCTTGCEBP120572 TGGACAAGAACAGCAACGAG TCACTGGTCAACTCCAGCACSREBP-1c GCTGTTGGCATCCTGCTATC TAGCTGGAAGTGACGGTGGTaP-2 TCAGCGTAAATGGGGATTTGG GTCTGCGGTGATTTCATCGGAFAS CCCTTGATGAAGAGGGATCA ACTCCACAGGTGGGAACAAGLeptin TGAGTTTGTCCAAGATGGACC GCCATCCAGGCT CTCTGG120573-Actin CAC CCC AGC CAT GTA CGT GTCCAGACGCAGGATGGC

Hankyong National University Animal Welfare Committee(Hankyong 2015-2)

At the end of the experimental period the animals werefasted overnight and administered mild ether anesthesia andblood was collected via puncture of the retroorbital sinusin ethylenediaminetetraacetic acid- (EDTA-) coated vialsThe animals were then euthanized by cervical dislocationunder mild ether anesthesia and the abdominal perirenaland epididymal fat pads were excised The fat samples wererinsed with saline and stored at minus70∘C until further analysis

27 RNA Extraction and Reverse Transcription-PolymeraseChain Reaction (RT-PCR) Total RNA was isolated from theepididymal fat samples of the experimental mice using theRNAisoPlus reagent (Takara Bio Inc Shiga Japan) accordingto the manufacturerrsquos instructions cDNA was synthesizedfrom 1 120583g of the total RNA in a 20 120583L reaction volumeusing a Maxime RT PreMix kit (iNtRON BiotechnologySeongnam Korea) containing the OptiScript reverse tran-scriptase and i-StarTaq DNA polymerase following themanufacturerrsquos recommended protocol The oligonucleotideprimers are shown in Table 2 The PCR conditions consistedof an initial denaturation step at 95∘C for 5min followedby 30 amplification cycles consisting of denaturation for40 s at 95∘C annealing for 40 s (temperature 56ndash62∘C) and

extension for 1min at 72∘CThePCRproducts were separatedon an agarose gel (15) by electrophoresis for 30min at 100VThe bands were visualized and their relative intensities wereanalyzed using the ImageJ software (National Institutes ofHealth Bethesda MD USA)

28 Western Blot Analysis Proteins were extracted fromthe epididymal fat samples using a protein extraction kit(iNtRON Biotechnology Seongnam Korea) The lysateswere centrifuged at 15000 rpm for 15min at 4∘C andthe protein content of the supernatant was determined byBio-Rad assay kit (Hercules CA USA) Diluted proteinsamples (30 120583g) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE 10) andtransferred to nitrocellulose membranes The membraneswere blocked overnight with 5 skim milk in Tris-bufferedsaline-Tween 20 (TBST 20mM Tris-HCl pH 76 140mMNaCl and 01 Tween 20) and incubated with the follow-ing primary antibodies (1 1000 dilution) PPAR120574 CEBP120572SREBP-1c aP2 leptin FAS and 120573-actin (Abcam Cam-bridge UK) The membranes were then washed four timeswith TBST buffer and incubated with the correspondinghorseradish-peroxidase- (HRP-) conjugated secondary anti-body (1 2000 dilution) The immunoreactive protein bandswere visualized using an enhanced chemiluminescence plus


300

200

100

21 40 60 80 100 120 140 160 180

Time (min)

Abso

rban

ce (m

AU)

minus20

1 2

Figure 1 HPLC profile and chemical structures of the polyphenolcomponents of the Glehnia littoralis root extract (GLE) Caffeic acid(peak 1) and ferulic acid (peak 2)

kit (Amersham Pharmacia Biotech Buckinghamshire UK)and their relative intensities were quantified using the ImageJ141 software

29 Statistical Analysis The results are expressed as themeanplusmn standard deviation (SD) of at least three independentexperiments Statistical differences between the groups wereevaluated by one-way analysis of variance (ANOVA) followedby Duncanrsquos multiple range test Values of 119901 lt 005 wereconsidered statistically significant The statistical analysissystem (SAS) software package version 92 (SAS Institute IncCary NC USA) was used for the analysis

3 Results and Discussion

31 Determination of Active Components of GLE When thecomposition of the GLE was investigated by comparingits HPLC profile with that of nine standard compoundsincluding cnidilide ligustilide neocnidilide butylphthalidesenkyunolide tetramethylpyrazine caffeic acid ferulic acidand perlolyrine eluted under the same conditions two com-pounds namely caffeic acid and ferulic acid were identifiedas the active constituents of the GLE (Figure 1)

32 Effect of the GLE on 3T3-L1 Cell Proliferation The cyto-toxicity of the GLE was evaluated prior to the investigationof its antiadipogenic effects on 3T3-L1 cells Treatment withdifferent concentrations (50ndash400120583gmL) of the GLE for 24 hstimulated the proliferation of 3T3-L1 cells with no cytotoxi-city observed following the treatment with 400120583gmL of theGLE for 24 h (Figure 2)

33 Effect of the GLE on 3T3-L1 Preadipocytes DifferentiationWe evaluated the effect of the GLE on postconfluent 3T3-L1 preadipocytes that were induced to differentiate in MDIdifferentiation medium for 2 days Oil red O staining wasused to monitor the changes in lipid accumulation duringpreadipocyte differentiation Representative images of the oilred O-stained GLE-treated cells acquired on day 8 of thedifferentiation period showed a dose-dependent suppressionof intracellular lipid accumulation (Figures 3(a) and 3(b))The lipid content decreased by 31 and 52 in response to

Cell

pro

lifer

atio

n (

)

0 50 100 200 4000

50

100

150

B B B A A

GLE (gmL)

Figure 2 Effect of the GLE on 3T3-L1 cell proliferation 3T3-L1 preadipocytes were cultured in serum-free medium with GLE(0ndash400 120583gmL) for 24 h Posttreatment cell viability was determinedby cell counting kit- (CCK-) 8 assay Values are expressed as mean plusmnSD (119899 = 3) Viability of untreated controls is set to 100Means withdifferent superscript letters are significantly different by Duncanrsquosmultiple range test (119901 lt 005) GLE Glehnia littoralis root extract

200 and 400120583gmL of the GLE respectively Adipogenesisthe stage of the cell differentiation process during whichpreadipocytes mature into adipocytes is accompanied bylipid accumulation as well as changes in gene expression andhormone sensitivity [17] These results show the inhibitoryeffect of the GLE on adipocyte differentiation

34 Effect of the GLE in HFD-Induced Obese Mice Wefurther elucidated the antiadipogenic effects of the GLE byperforming an in vivo experiment with HFD-induced obesemice As shown in Figure 4(a) the body weights of micein the HFD and HFD + 1 GLE groups were significantlyhigher than those of mice in the control and HFD + 5GLE groups after 6 weeks of treatment (119901 lt 005) At theend of the experiment mice in the HFD + 5 GLE groupexhibited a drastic reduction in body weight gain comparedto that reported for the HFD group mice (82 plusmn 34 versus173 plusmn 26 g) However the antiadipogenic effect in the HFD +1 GLE group was not as pronounced as that in the HFD +5 GLE group The feed efficiency ratio (FER) of the HFD +5 GLE group was significantly lower than that of the HFDand HFD + 1 GLE groups (Figure 4(b)) (119901 lt 005) Thefat weight which comprises the abdominal perirenal andepididymal fat pad weights of mice in the HFD + 5 GLEgroup (82 plusmn 03 g) was approximately 50 lower than that ofmice in the HFD (163 plusmn 03 g) and HFD + 1 GLE (158 plusmn02 g) groups The fat weight per 100 g body weight of micein the HFD + 5 GLE group (277 plusmn 10 g) was significantlylower than that of mice in the HFD (427 plusmn 08 g) and HFD +1 GLE (403 plusmn 05 g) groups (Figure 4(c)) (119901 lt 005)

It is well-known that an imbalance between energy intakeand energy expenditure leads to body fat storage owing toincreased lipogenesis and adipogenesis [18] However thisstudy showed that supplementing the diet with 5 GLEeffectively inhibited the body fat accumulation in HFD-induced obesemice comparedwith that in the untreatedHFD


0 50

100 200 400

GLE (gmL)

GLE (gmL)

(a)

Lipi

d co

nten

t (

cont

rol)

0 50 100 200 4000

20

40

60

80

100

120

A AB

C

D

GLE (gmL)

(b)

Figure 3 Effect of the GLE on 3T3-L1 adipocyte differentiation (a) Oil red O staining showing the differentiation of induced 3T3-L1preadipocytes Black color indicates stained cytoplasmic lipids (b) Quantification of lipid accumulation in differentiated 3T3-L1 cells basedon the absorbance at 520 nm of destained oil red O extracted from the adipocytes Lipid content in untreated control cells is set to 100Values are expressed as mean plusmn SD (119899 = 3) Means with different superscript letters are significantly different by Duncanrsquos multiple range test(119901 lt 005) GLE Glehnia littoralis root extract

groupTherefore the GLE could be useful for treating obesityby reducing body fat accumulation

35 Effects of the GLE on Critical Adipogenic Gene andProtein Expression in HFD-Induced Obese Mice In orderto investigate the molecular mechanisms underlying theantiadipogenic effect of the GLE in HFD-induced obesemice we analyzed the gene and protein expression of varioustranscription factors associated with preadipocyte differenti-ation and fat accumulation via RT-PCR and western blottingrespectively The GLE treatment markedly decreased theexpression of adipogenic markers such as PPAR120574 CEBP120572and SREBP-1c and lipidmetabolism genes such as aP2 leptinand FAS (Figure 5)ThemRNA levels of PPAR120574 CEBP120572 andSREBP-1c in the GLE-treated groups were significantly lowerthan those in the HFD group (119901 lt 005) with the levels in theHFD+ 5GLE group being reduced by 595 1183 and 413respectively compared to those in the HFD group (Figures5(b)ndash5(d))

Preadipocyte differentiation is regulated by transcrip-tional activators including members of the CEBP andPPAR120574 families [19ndash21] Currently CEBP120572 and PPAR120574 areconsidered the primary mediators of adipogenesis Thesetranscription factors have been shown to activate adipocyte-specific genes and are also involved in the growth arrestrequired for preadipocyte differentiation [22] The complexprocess of adipogenesis commences with PPAR120574 productionwhich is controlled and activated by CEBP120572 and SREBP-1c[17] CEBP120572 also activates the promoters of the adipocytegenes leptin and aP2 [23] while both PPAR120574 and CEBP120572coordinate the expression of genes involved in generating andmaintaining aP2 and leptin levels The expression of aP2 andFAS mRNA in the HFD group was 1341 plusmn 46 and 1924 plusmn

46 while that in the 5GLE-treated groupwas 897 plusmn 39and 807 plusmn 25 respectively compared to the expression inthe control group (100) (Figures 5(e) and 5(g)) The mRNAexpression of leptin which serves as a major adipostat bysuppressing the urge to eat and promoting energy expendi-ture [24] decreased by 19 and 1077 in a dose-dependentmanner compared with that in the HFD group followingthe treatment with 1 and 5 GLE respectively (Figure 5(f))Interestingly the 5 GLE treatment significantly decreasedthe expression of aP2 leptin and FAS mRNA compared tothe expression in the control group (119901 lt 005) In particularthe leptin mRNA expression in the HFD + 5 GLE groupdecreased by 446 plusmn 27TheGLE treatment also suppressedthe expression of SREBP-1c and FAS SREBP-1c acceleratesadipogenesis by inducing the expression of FAS Leptinwhich is one of the best-known hormonemarkers for obesitywas also downregulated following the ingestion of an HFDwith 5 GLE These findings also indicate that GLE mightcontain FAS or leptin inhibitors and present its efficiencyagainst fat accumulation through this pathway in addition toadipogenesis inhibition It has been reported that caffeic acidphenethyl ester suppresses the production of leptin duringdifferentiation of 3T3-L1 preadipocytes [25] Therefore oneof components of GLE such as caffeic acidmay be responsibleinhibitor for both FAS and leptin

PPAR120574 and CEBP120572 are major regulators of thepreadipocyte differentiation process and CEBP120572 mediatesthe transactivation of leptin transcription [26] CEBP120572which is expressed rather late in the adipogenesis processhas been widely reported to be both necessary and sufficientfor the differentiation of 3T3-L1 preadipocytes to adipocytes[23 27 28] and appears to promote the differentiation inconjunction with PPAR120574 by cross-regulation [29] SREBP-1c


(Weeks)

Body

wei

ght (

g)

0 2 4 6 820

24

28

32

36

40

CHFD

HFD + 1 GLEHFD + 5 GLE

(a)

C

A

B

C

00

02

04

06

08

10

CHFD


Feed

effici

ency

ratio

(b)

B

AA

B

0

10

20

30

40

50

CHFD


Fat p

ad w

eigh

t (g10

0Ａ

BW)

(c)

Figure 4 Effect of the GLE on the growth of and fat accumulation in HFD-induced obese mice (a) Body weight of the mice that were fedexperimental diets (b) Feed efficiency ratio (FER) calculated as the total weight gaintotal food intake (c) Fat weight per 100 g body weightFat weight includes the abdominal renal and epididymal fat pad weights of mice that were fed experimental diets Values are presented asmeanplusmn SD (119899 = 7) Each barwith different superscript letters is significantly different byDuncanrsquosmultiple range test (119901 lt 005) Experimentalgroups Control fed basic diet HFD fed high-fat diet HFD + 1 GLE fed HFD containing 1 GLE HFD + 5 GLE fed HFD containing5 GLE GLE Glehnia littoralis root extract HFD high-fat diet

regulates the lipogenic gene expression associated withfatty acid synthesis which promotes increased triglyceridesynthesis and the expression of PPAR120574 ligands [30] Theresults of our study suggest that the GLE downregulatesthe expression of SREBP-1c leading to decreased PPAR120574expression SREBP-1c also reportedly binds to the promoterregion of FAS to activate its transcription [31]The expressionof aP2 and FAS genes which are involved in lipidmetabolismwas significantly downregulated in the GLE-treated HFDmice aP2 which is expressed in adipocytes and is also knownas the fatty acid binding protein 4 (FABP4) has profoundeffects on insulin sensitivity and glucose metabolism and

plays an important role in adipocyte differentiation [32]Additionally aP2 is activated by PPAR120574 CEBP120572 andSREPB-1c [32] Furthermore the protein levels of theadipogenic transcription factors and lipid metabolism genesnamely PPAR120574 CEBP120572 SREPB-1c aP2 leptin and FAS inthe epididymal fat of the GLE-treated HFD mice followedthe same trend as their respective mRNA levels (Figures6(a)ndash6(g)) Thus the expression of the critical adipogenicproteins PPAR120574 and CEBP120572 decreased following thetreatment with 1 and 5 GLE (Figures 6(b) and 6(c)) Inconnection with the discussion before it has been suggestedthat GLE might suppressed the secretion of adipocytokines


-actin

PPAR

CEBP

SREBP-1c

aP2

Leptin

FAS

C HFD

HFD

+ 1

G

LE

HFD

+ 5

G

LE

(a)PP

AR

()

0

50

100

150

200

250

D

A

B

C

CHFDHFD + 1 GLEHFD + 5 GLE

(b)

D

A

B

C

CEB

P (

)

0

100

200

300

400


(c)

C

A B

C

SREB

P-1c

()

0

50

100

150

200


(d)

B

A

B

C

aP2

()

0

50

100

150


(e)

C

AB

D

Lept

in (

)

0

50

100

150

200


(f)

C

A

B

D

FAS

()

0

50

100

150

200

250


(g)

Figure 5 Effect of the GLE on the mRNA expression of major adipogenic transcription factors in HFD-induced obese mice (a) A representativeimage of the RT-PCR results mRNA levels of (b) PPAR120574 (c) CEBP120572 (d) SREBP-1c (e) aP2 (f) Leptin and (g) FAS as determined by RT-PCR Values are presented as a percentage of the levels in controls Data are expressed as mean plusmn SD (119899 = 7) Bars with different superscriptletters are significantly different by Duncanrsquos multiple range test (119901 lt 005) Experimental groups Control fed basic diet HFD fed high-fatdiet HFD + 1 GLE fed HFD containing 1 GLE HFD + 5 GLE fed HFD containing 5 GLE PPAR peroxisome proliferator-activatedreceptor CEBP CCAATenhancer-binding protein FAS fatty acid synthase aP2 adipose fatty acid binding protein SREBP sterol regulatoryelement binding protein RT-PCR reverse transcription-polymerase chain reaction GLE Glehnia littoralis root extract HFD high-fat diet

such as leptin through the suppression of PPAR120574 expression[25]

Obesity is related to adipocyte differentiation and excessfat accumulation [18] In our study GLE administrationreduced fat accumulation in 3T3-L1 adipocytes and HFD-induced obese mice by suppressing the expression of keytranscription factors and genes at both the mRNA andprotein level SREBP-1c is known to accelerate adipogenesisby inducing the expression of FAS which is an adipogenicenzyme [33] Additionally triglyceride accumulation in thelivers of SREBP-1c-deficient obob mice has been reported todecrease by approximately 50 compared with that in obobmice livers [34]

Our results showed that the abdominal perirenal andepididymal fat weight of 5 GLE-treated mice was less thanhalf of that of the untreated HFD-induced obese mice whichmay have been due to the GLE-mediated inhibition of themRNA and protein expression of SREBP-1c and FAS Wealso demonstrated that the antiobesity effects of the GLE onvarious genes involved in adipogenesis which is a differenti-ation pathway are mediated via the downregulation of majortranscription factors including PPAR120574 CEBP120572 and SREBP-1c The consequent downregulation of lipid metabolizingmediators such as aP2 leptin and FAS which are involvedin the transport uptake and synthesis of lipids resulted inthe reduced fat accumulation in adipocytes


C HFD

HFD

+ 1

G

LE

HFD

+ 5

G

LE

-actin

PPAR

CEBP

SREBP-1c

aP2

Leptin

FAS

(a)

0

50

100

150

200

B

A

B

C

PPA

R (

)


(b)

D

A

B

C

0

100

200

300

CEB

P (

)


(c)

C

AB

C

0

50

100

150

200

250

SREB

P-1c

()


(d)

B

A

BC

0

50

100

150

200

aP2

()


(e)

C

A

B B

0

50

100

150

200Le

ptin

()


(f)

C

A

B

C

0

50

100

150

200

FAS

()


(g)

Figure 6 Effect of the GLE on the protein expression of major adipogenic transcription factors in HFD-induced obese mice (a) A representativeimage of the western blotting results Protein levels of (b) PPAR120574 (c) CEBP120572 (d) SREBP-1c (e) aP2 (f) Leptin and (g) FAS as determinedby western blotting Values are presented as a percentage of the levels in controls Data are expressed as mean plusmn SD (119899 = 7) Bars with differentsuperscript letters are significantly different by Duncanrsquos multiple range test (119901 lt 005) Experimental groups Control fed basic diet HFDfed high-fat diet HFD+ 1GLE fedHFD containing 1GLE HFD+ 5GLE fedHFD containing 5GLE PPAR peroxisome proliferator-activated receptor CEBP CCAATenhancer-binding protein FAS fatty acid synthase aP2 adipose fatty acid binding protein SREBP sterolregulatory element binding protein GLE Glehnia littoralis root extract HFD high-fat diet

4 Conclusion

In conclusion the GLE strongly inhibited adipogenesis byreducing the expression of adipogenesis-related transcrip-tion factors Therefore the GLE may act as an effectivenutraceutical for the treatment of obesity by suppressingeither adipocyte differentiation or lipid accumulation

Abbreviations

GLE Glehnia littoralis root extractHFD High-fat dietPPAR120574 Peroxisome proliferator-activated receptor 120574

CEBP120572 CCAATenhancer-binding protein 120572FAS Fatty acid synthaseaP2 Adipose fatty acid binding proteinSREBP-1c Sterol regulatory element binding

protein-1c


The authors declare that they have no conflicts interest

Acknowledgments

This work was supported by Business for Cooperative RampDbetween Industry Academy and Research Institute funded


by Korea Small andMediumBusiness Administration in 2015(Grant no C0296657)

References

[1] U Pagotto D Vanuzzo V Vicennati and R Pasquali ldquoPharma-cological therapy of obesityrdquo Giornale Italiano Di Cardiologiavol 9 Supplement 1 pp 83sndash93s 2008

[2] C Couillard PMauriege P Imbeault et al ldquoHyperleptinemia ismore closely associated with adipose cell hypertrophy thanwithadipose tissue hyperplasiardquo International Journal of Obesity vol24 no 6 pp 782ndash788 2000

[3] J-Y Yang M A Della-Fera S Rayalam et al ldquoEnhancedinhibition of adipogenesis and induction of apoptosis in 3T3-L1 adipocytes with combinations of resveratrol and quercetinrdquoLife Sciences vol 82 no 19-20 pp 1032ndash1039 2008

[4] S-S Yoon Y-H Rhee H-J Lee et al ldquoUncoupled protein 3and p38 signal pathways are involved in anti-obesity activity ofSolanum tuberosum L cv Bora Valleyrdquo Journal of Ethnophar-macology vol 118 no 3 pp 396ndash404 2008

[5] A C Zacour M E Silva P R Cecon E A Bambirra andE C Vieira ldquoEffect of dietary chitin on cholesterol absorptionand metabolism in ratsrdquo Journal of Nutritional Science andVitaminology vol 38 no 6 pp 609ndash613 1992

[6] L M Kaplan ldquoPharmacological therapies for obesityrdquo Gas-troenterology Clinics of North America vol 34 no 1 pp 91ndash1042005

[7] J Lin M A Della-Fera and C A Baile ldquoGreen tea polyphe-nol epigallocatechin gallate inhibits adipogenesis and inducesapoptosis in 3T3-L1 adipocytesrdquo Obesity Research vol 13 no 6pp 982ndash990 2005

[8] J-Y Yang M A Della-Fera D L Hartzell C Nelson-DooleyD B Hausman and C A Baile ldquoEsculetin induces apoptosisand inhibits adipogenesis in 3T3-L1 cellsrdquo Obesity vol 14 no10 pp 1691ndash1699 2006

[9] J Rozema P Bijwaard G Prast and R Broekman ldquoEcophysi-ological adaptations of coastal halophytes from foredunes andsalt marshesrdquo Plant Ecology vol 62 no 1-3 pp 499ndash521 1985

[10] T Yoon D Y Lee A Y Lee G Choi B K Choo andH K KimldquoAnti-inflammatory effects of Glehnia littoralis extract in acuteand chronic cutaneous inflammationrdquo Immunopharmacologyand Immunotoxicology vol 32 no 4 pp 663ndash670 2010

[11] Z Yuan Y Tezuka W Fan S Kadota and X Li ldquoConstituentsof the underground parts of Glehnia littoralisrdquo Chemical ampPharmaceutical Bulletin vol 50 no 1 pp 73ndash77 2002

[12] C-S Kong Y R Um J I Lee Y A Kim S S Yea andY Seo ldquoConstituents isolated from Glehnia littoralis suppressproliferations of human cancer cells and MMP expression inHT1080 cellsrdquo Food Chemistry vol 120 no 2 pp 385ndash394 2010

[13] Y R Um C-S Kong J I Lee Y A Kim T J Nam and Y SeoldquoEvaluation of chemical constituents from Glehnia littoralis forantiproliferative activity against HT-29 human colon cancercellsrdquo Process Biochemistry vol 45 no 1 pp 114ndash119 2010

[14] Y Nakano H Matsunaga T Saita M Mori M Katanoand H Okabe ldquoAntiproliferative Constituents in UmbelliferaePlants IL1) Screening for Polyacetylenes in Some UmbelliferaePlants and Isolation of Panaxynol and Falcarindiol from theRoot ofHeracleummoellendorffiirdquoBiologicalampPharmaceuticalBulletin vol 21 no 3 pp 257ndash261 1998

[15] T B Ng F Liu and H X Wang ldquoThe antioxidant effects ofaqueous and organic extracts of Panax quinquefolium Panax

notoginseng Codonopsis pilosula Pseudostellaria heterophyllaand Glehnia littoralisrdquo Journal of Ethnopharmacology vol 93no 2-3 pp 285ndash288 2004

[16] R Buettner J Scholmerich and L C Bollheimer ldquoHigh-fatdiets modeling the metabolic disorders of human obesity inrodentsrdquo Obesity vol 15 no 4 pp 798ndash808 2007

[17] A T Ali W E Hochfeld R Myburgh and M S PepperldquoAdipocyte and adipogenesisrdquo European Journal of Cell Biologyvol 92 no 6-7 pp 229ndash236 2013

[18] B M Spiegelman and J S Flier ldquoObesity and the regulation ofenergy balancerdquo Cell vol 104 no 4 pp 531ndash543 2001

[19] S R Farmer ldquoTranscriptional control of adipocyte formationrdquoCell Metabolism vol 4 no 4 pp 263ndash273 2006

[20] F M Gregoire C M Smas and H S Sul ldquoUnderstandingadipocyte differentiationrdquo Physiological Reviews vol 78 no 3pp 783ndash809 1998

[21] Z Wu E D Rosen R Brun et al ldquoCross-regulation ofCEBP120572 and PPAR120574 controls the transcriptional pathway ofadipogenesis and insulin sensitivityrdquo Molecular Cell vol 3 no2 pp 151ndash158 1999

[22] U A White and J M Stephens ldquoTranscriptional factors thatpromote formation of white adipose tissuerdquo Molecular andCellular Endocrinology vol 318 no 1-2 pp 10ndash14 2010

[23] O A MacDougald andM D Lane ldquoTranscriptional regulationof gene expression during adipocyte differentiationrdquo AnnualReview of Biochemistry vol 64 pp 345ndash371 1995

[24] C D Wrann and E D Rosen ldquoNew insights into adipocyte-specific leptin gene expressionrdquo Adipocyte vol 1 no 3 pp 168ndash172 2014

[25] S Juman N Yasui H Okuda et al ldquoCaffeic acid phenethyl estersuppresses the production of adipocytokines leptin tumornecrosis factor -alpha and resistin during differentiation toadipocytes in 3T3-L1 cellsrdquo Biological amp Pharmaceutical Bul-letin vol 34 no 4 pp 490ndash494 2011

[26] F Krempler D Breban H Oberkofler et al ldquoLeptin Peroxi-some Proliferator-Activated Receptor- and CCAATEnhancerBinding Protein- mRNA Expression in Adipose Tissue ofHumans and Their Relation to Cardiovascular Risk FactorsrdquoArteriosclerosis Thrombosis and Vascular Biology vol 20 no2 pp 443ndash449 2000

[27] F-T Lin and M D Lane ldquoAntisense CCAATenhancer-binding protein RNA suppresses coordinate gene expressionand triglyceride accumulation during differentiation of 3T3-L1preadipocytesrdquoGenes ampDevelopment vol 6 no 4 pp 533ndash5441992

[28] F-T Lin and M D Lane ldquoCCAATenhancer binding protein120572 is sufficient to initiate the 3T3-L1 adipocyte differentiationprogramrdquo Proceedings of the National Acadamy of Sciences of theUnited States of America vol 91 no 19 pp 8757ndash8761 1994

[29] T Jeon S G Hwang S Hirai et al ldquoRed yeast rice extractssuppress adipogenesis by down-regulating adipogenic tran-scription factors and gene expression in 3T3-L1 cellsrdquo LifeSciences vol 75 no 26 pp 3195ndash3203 2004

[30] J B Kim and B M Spiegelman ldquoADD1SREBP1 promotesadipocyte differentiation and gene expression linked to fattyacidmetabolismrdquoGenesampDevelopment vol 10 no 9 pp 1096ndash1107 1996

[31] M M Magana and T F Osborne ldquoTwo tandem binding sitesfor sterol regulatory element binding proteins are required forsterol regulation of fatty-acid synthase promoterrdquoThe Journal ofBiological Chemistry vol 271 no 51 pp 32689ndash32694 1996


[32] B Huang H D Yuan D Y Kim H Y Quan and S HChung ldquoCinnamaldehyde prevents adipocyte differentiationand adipogenesis via regulation of peroxisome proliferator-activated receptor-120574 (PPAR120574) and AMP-activated proteinkinase (AMPK) pathwaysrdquo Journal of Agricultural and FoodChemistry vol 59 no 8 pp 3666ndash3673 2011

[33] H-Y Jung Y-H Kim I-B Kim et al ldquoThe Korean mistletoe(Viscum album coloratum) extract has an antiobesity effectand protects against hepatic steatosis in mice with high-fat diet-induced obesityrdquo Evidence-Based Complementary andAlternative Medicine vol 2013 Article ID 168207 9 pages 2013

[34] N Yahagi H Shimano A H Hasty et al ldquoAbsence of sterolregulatory element-binding protein-1 (SREBP-1) amelioratesfatty livers but not obesity or insulin resistance in LepobLepobmicerdquo The Journal of Biological Chemistry vol 277 no 22 pp19353ndash19357 2002

Research ArticleTreatment of Urolithiasis with Medicinal PlantSalvia miltiorrhiza A Nationwide Cohort Study

Wen-Chi Chen12 San-YuanWu 34 Po-Chi Liao5 Tzu-Yang Chou6

Huey-Yi Chen12 Jen-Huai Chiang12 Yuan-Chih Su12 Kee-Ming Man27

Ming-Yen Tsai 18 and Yung-Hsiang Chen 129

1Graduate Institute of Integrated Medicine Chinese Medicine Research Center Research Center for Chinese Medicine amp AcupunctureCollege of Medicine China Medical University Taichung Taiwan2Departments of Urology Obstetrics and Gynecology Medical Research and AnesthesiologyManagement Office for Health Data China Medical University Hospital Taichung Taiwan3Center for General Education Feng Chia University Taichung Taiwan4Center for General Education Chaoyang University of Technology Taichung Taiwan5Department of Urology Taichung Veterans General Hospital Taichung Taiwan6Department of Chinese Medicine Kaohsiung Municipal Gangshan Hospital Kaohsiung Taiwan7Department of Medicinal Botanicals and Health Applications Da-Yeh University Changhua Taiwan8Department of Chinese Medicine Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of MedicineKaohsiung Taiwan9Department of Psychology College of Medical and Health Science Asia University Taichung Taiwan

Correspondence should be addressed to Yung-Hsiang Chen yhchenmailcmuedutw

Received 20 November 2017 Revised 9 February 2018 Accepted 1 March 2018 Published 11 April 2018


Copyright copy 2018 Wen-Chi Chen et alThis is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Salvia miltiorrhiza Bunge (Danshen) a common medicinal plant in traditional Chinese medicine has been tested effectively toprevent urolithiasis in animals nevertheless the clinical application for urolithiasis remains unclear We thus investigated theclinical effect of Danshen by analyzing the database from the Taiwan National Institute of Health The cohort ldquoDanshen-usersrdquowas prescribed Chinese herb medicine Danshen after the initial diagnosis of calculus The control group (non-Danshen-users)was not given Danshen after the initial diagnosis of calculus The date of first using Danshen after new diagnosis date of calculuswas considered as index date The outcome variables were categorized into two categories the first category included calculussurgical treatment including extracorporeal shock wave lithotripsy ureteroscopy percutaneous nephrostomy with fragmentationand ureterolithotomy the second category included any bleeding disorders including gastrointestinal bleeding intracranialhemorrhage and blood transfusions The incidence of calculus surgical treatment in the Danshen-users was less than that inthe non-Danshen-users 1071 in 1000 person-years (200 people followed up for 5 years) and 3142 in 1000 person-yearsrespectively The adjusted hazard ratio for calculus surgical treatment in the Danshen-users was 034 (95 confidence intervals031ndash038) as compared to the non-Danshen-usersWhen stratified by sex the incidence of calculus surgical treatment in Danshen-users was 0685 in 1000 person-years and 1575 in 1000 person-years for women and men respectively which was lowerthan that in non-Danshen-users Danshen decreased the ratio of subsequent stone treatment after the first treatment in the studypopulation there was no increased bleeding risk due to long-term Danshen use

1 Introduction

Urolithiasis is a common urological disorder with anannual incidence of 7ndash13 in North America 1ndash5 inAsia [1 2] and 64 in Taiwan [3] Urolithiasis is also

a disease with high recurrence Over 50 of the patientswith stone experience stone episode recurrence after 5years of their first treatment [4] Therefore seeking drugsfor the prevention of stone recurrence is an importantissue



SalviamiltiorrhizaBunge (Danshen) is a commonmedic-inal plant in traditional Chinese medicine (TCM) withits roots (dried) possessing pharmacological properties [5]Danshen is a classical HuoxueHuayu herb (a TCM term usedfor activating blood circulation relieving pain activatingblood to promote menstruation clearing heart fire tranquil-izing and treating blood stasis) that has been prescribedclinically for one thousand years [6] In modern medicineDanshen is used for the treatment of cardiovascular diseases[7 8] osteoporosis [9] anticancer [5] and hepatoprotectiveeffect [9] Danshen is one of the tested effective TCM herbsfor prevention of stone disease in our previous study [10 11]We chose Danshen (as an herb to be tested) because of itseffectiveness in the treatment of blood disorders AccordingtoTCM blood stasis is one of themajor pathogeneses of stonedisease and hematuria is frequently observed in patients withstones

We used the database from the National Institutes ofHealth (NIH) Taiwan to study the clinical effect of thepotential TCM herb on urolithiasis Although Danshenhas been tested effectively for the prevention of urolithi-asis in animal models [11] the clinical application in theprevention of urolithiasis is still under investigation [12]The objective of the present study was to investigate thepreventive effect of Danshen clinically by analyzing the NIHdatabase The surrogate outcome will be a decrease in thenumber of stone surgeries in a cohort We have also studiedthe possible effects of increased bleeding tendency due tothe antiplatelet effect of Danshen used for treating bloodstasis


21 Database For this retrospective cohort study ourdata source was from National Health Insurance ResearchDatabase (NHIRD) in Taiwan Taiwanrsquos National HealthInsurance (NHI) program is a compulsory insurance that hasbeen providing comprehensive coverage to 99 of 23 millionindividuals since 1996 The NHIRD included information ofsex birthday outpatient care inpatients care western andtraditional Chinese medicine (TCM) prescription medicalinstitutions and registration files with scrambled identifica-tions We used the LHID 2000 (Longitudinal Health Insur-ance Database 2000) which contains medicine informationbetween 1996 and 2013 of 1 million beneficiaries randomlysampled from the registry of all beneficiaries in 2000 Thesampled patients exhibit no significant difference in agesex birth year or average insured payroll-related amountfrom the general populationThe International Classificationof Diseases Ninth Revision Clinical Modification (ICD-9-CM) codes were used for diagnoses Because the NHIRDcontains identified secondary data for research the presentstudywaswaived from informed consent A disease diagnosiswithout valid supporting clinical findings may be considereda medical fraud by NHI with a penalty of 100 times ofthe payment claimed by the treating physician or hospi-tal This study was approved by the Institutional ReviewBoard of China Medical University (CMUH104-REC2-115)

22 Study Population All cases diagnosed with calculus(ICD-9-CM 5920 5921 and 5929) from January 2000 toDecember 2010 and aged ge18 years were the study cohortpopulation The case cohort population was defined aspatients whowere orally given (either single or formula form)herbal medicine powder Danshen after initial diagnosis ofcalculus Patients did not use Danshen after initial diagnosisdate of calculus as compared to cohort group The date offirst using Danshen after new diagnosis date of calculus wasconsidered as index date

23 Covariate Assessment Sociodemographic factors includ-ed age and sex Agewas divided into 3 groups 18ndash39 years old40ndash64 years old and ge65 years old Baseline comorbiditieswere considered if ICD-9-CM codes appeared at least once inoutpatients or inpatients before initial fibromyalgia diagnosisincluding diabetes mellitus (ICD-9-CM 250) hypertension(ICD-9-CM 401ndash405) urinary tract infection (ICD-9-CM5990) chronic kidney disease (ICD-9-CM 585) and gout(ICD-9-CM 2749)

24 Primary Outcome The outcome variables were two onewas calculus surgical treatment including extracorporealshock wave lithotripsy (ESWL) ureteroscopy percutaneousnephrostomy with fragmentation (PCNL) and ureterolitho-tomy and the other was any bleeding disorders includinggastrointestinal bleeding (ICD-9-CM 5780 5781 5789)intracranial hemorrhage (ICH ICD-9-CM 4320 4329) andblood transfusions (OP code 990) Each individual wasassessed from the index date to 31 December 2013 (end ofthe study) until the time of diagnosis of calculus surgicaltreatment or any bleeding disorders or until the patients werecensored for withdrawal from insurance or lost to follow-up(which one first occurs)

25 Statistical Analyses Studentrsquos 119905-tests for continuous vari-ables and Chi-square test for categorical variables were usedto compare the two study groups We estimated hazardratios (HRs) and 95 confidence intervals (CI) of calculussurgical treatment and bleeding disorder for the cohortusing Danshen compared to the cohort not using Danshenby Cox proportional hazard model Statistical analysis wasperformed and figures were created using SAS 94 (SASInstitute Cary NC) and R software 119875 lt 005 in two-tailedtests indicated statistical significance

3 Results

Our study included a total of 8568 patients using Danshen(Danshen-users) and 56502 patients not using Danshen(non-Danshen-users) suffering from calculus disease [afterfrequency matching (1 1) through sex age (per 5 years)initial diagnosis year of calculus and index year] Therewere 8536 Danshen-users and non-Danshen-users in eachcohort Table 1 shows the characteristics of both groupsThe mean age (standard deviation SD) for Danshen-usersand non-Danshen-users was 4640 (1429) years and 4642(1430) years respectively After frequency matching thedistribution of sex and age was not significantly different (119875 =


Table 1 Characteristics of calculus patients according to use or no use of Danshen

VariableUsing Danshen in calculus patients

119875 valuelowastNo (119899 = 8536) Yes (119899 = 8536)119899 119899

Sex 099Female 4723 5533 4723 5533Male 3813 4467 3813 4467

Age group years 09918ndash39 3018 3536 3018 353640ndash64 4508 5281 4508 5281ge65 1010 1183 1010 1183Mean plusmn SD (years) 4642 (1430) 4640 (1429) 09157a

Baseline comorbiditiesDiabetes mellitus 2992 3505 3339 3912 lt00001Urinary tract infection 4897 5737 5241 614 lt00001Hypertension 4402 5157 4561 5343 00148Chronic kidney disease 657 77 753 882 00076Gout 1608 1884 1811 2122 00001

Duration between diagnosis date of calculus and index days (mean median) 1120 (923) 1130 (921) 04553alowastChi-square test a푡-test Themean (median) of follow-up period was 627 (598) years and 509 (486) years for cohort group using Danshen and cohort groupnot using Danshen separately

099 for both) between Danshen-users and non-Danshen-users The proportion of baseline comorbidities in Danshen-users was higher than that in non-Danshen-users (119875 lt 005for all) The mean (median) follow-up period for Danshen-users and non-Danshen-users was 627 (598) years and 509(486) years respectively

The incidence of calculus surgical treatment in theDanshen-users was less than that in the non-Danshen-users1071 in 1000 person-years (200 people followed up for 5years) and 3142 in 1000 person-years respectively Theadjusted hazard ratio (HR) for calculus surgical treatment inthe Danshen-users was 034 (95 CI 031ndash038) as comparedto the non-Danshen-users When stratifying by sex theincidence of calculus surgical treatment in theDanshen-userswas 0685 in 1000 person-years and 1575 in 1000 person-years for women andmen respectively which was lower thanthat in the non-Danshen-users (2454 in 1000 person-yearsand 4070 in 1000 person-years for women andmen resp)

When stratifying by age the incidence of calculus surgicaltreatment in Danshen-users was 1087 in 1000 person-years 1137 in 1000 person-years and 0690 in 1000person-years for 18ndash39 years age group 40ndash64 years agegroup and above 65 years age group respectively whichwas lower than that in non-Danshen-users (2675 in 1000person-years 3514 in 1000 person-years and 2989 in1000 person-years for 18ndash39 years age group 40ndash64 yearsage group and above 65 years age group resp) The adjustedHRs revealed a significantly lower risk of calculus surgicaltreatment in the Danshen-users as compared to the non-Danshen-users in all the categories women men age groupof 18ndash39 years age group of 40ndash64 years and age group above65 years population (Table 2) The estimated cumulativeincidence of calculus surgical treatment in theDanshen-users

Without DanshenWith Danshen

000

005

010

015

020

025

030

Cum

ulat

ive i

ncid

ence

of c

alcu

lus s

urgi

cal t

reat

men

t

2 4 6 8 10 120Time (years)

Log-rank test P lt 00001

Figure 1 The estimated cumulative incidence of calculus surgicaltreatment in the Danshen-users was lower than that in the non-Danshen-users by Kaplan-Meier analysis

was lower than that in the non-Danshen-users (119875 lt 00001log-rank test) (Figure 1)

The incidence of any bleeding disorder in the Danshen-users was less than that in the non-Danshen-users (1708 in1000 person-years and 2577 in 1000 person-years resp)


Table 2 Incidence rates hazard ratio and confidence intervals of calculus surgical treatment and any bleeding disorder for calculus patientsusing and not using Danshen in the stratification of sex and age

Variables

Using Danshen in calculus patientsCrude HR Adjusted HRdaggerNo Yes

(119899 = 8536) (119899 = 8536)Event Person-years IR Event Person-years IR (95 CI) (95 CI)

Outcome calculus surgical treatmentTotal 1370 43605 3142 574 53589 1071 036 (033ndash04)lowastlowastlowast 034 (031ndash038)lowastlowastlowast

SexFemale 615 25057 2454 208 30354 685 03 (026ndash035)lowastlowastlowast 029 (024ndash034)lowastlowastlowast

Male 755 18548 4070 366 23235 1575 041 (036ndash047)lowastlowastlowast 039 (034ndash044)lowastlowastlowast

Age group years18ndash39 449 16784 2675 215 19782 1087 043 (036ndash05)lowastlowastlowast 04 (034ndash047)lowastlowastlowast

40ndash64 799 22739 3514 320 28151 1137 035 (03ndash039)lowastlowastlowast 033 (029ndash038)lowastlowastlowast

ge65 122 4082 2989 39 5656 690 026 (018ndash037)lowastlowastlowast 025 (017ndash035)lowastlowastlowast

Outcome any bleeding disordersTotal 1138 44166 2577 917 53678 1708 066 (061ndash072)lowastlowastlowast 061 (056ndash067)lowastlowastlowast






IR incidence rates per 1000 person-years HR hazard ratio CI confidence interval Adjusted HRdagger represented adjusted hazard ratio mutually adjusted forDanshen drug used sex age diabetes mellitus urinary tract infection hypertension chronic kidney disease and gout in Cox proportional hazard regressionlowastlowastlowast푃 lt 0001

The adjusted HR for calculus surgical treatment in Danshen-users was 061 (95 CI 056ndash067) as compared to the non-Danshen-users When stratifying by sex the incidence of anybleeding disorder in the Danshen-users was 1524 in 1000person-years and 1949 in 1000 person-years for womenand men respectively which was lower than that in the non-Danshen-users (2557 in person-years and 3007 in 1000person-years for women and men resp)

When stratifying by age the incidence of calculus surgicaltreatment in Danshen-users was 0819 in 1000 person-years 1827 in 1000 person-years and 4228 in 1000person-years for 18ndash39 years age group 40ndash64 years agegroup and above 65 years age group respectively which waslower than that in the non-Danshen-users (1198 in 1000person-years 2723 in 1000 person-years and 7307 in1000 person-years for 18ndash39 years age group 40ndash64 years agegroup and above 65 years group resp) The adjusted HRsrevealed a significantly lower risk of any bleeding disorder intheDanshen-users as compared to the non-Danshen-users inall the categories females males age group of 18ndash39 yearsage group of 40ndash64 years and above 65 years age grouppopulation (Table 2) The estimated cumulative incidence ofany bleeding disorder in the Danshen-users was lower thanthat in the non-Danshen-users (119875 lt 00001 log-rank test)(Figure 2)TheHRs and 95CI of calculus surgical treatmentand any bleeding disorder associated with cumulative doseper year of Danshen among calculus patients with Danshen-users were shown in Table 3

4 Discussion

We observed that Danshen significantly reduces the subse-quent surgical treatment after the first stone episode with ahazard ratio of 034 This effect was consistent in both sexesand among all age groups Danshenmay prove to be clinicallyeffective for those having stone disease and seeking ameasureto prevent their further surgical treatment Danshen posesa concern regarding the increased bleeding tendency due toits enhanced blood stasis effect However we did not findany incidence involving hemorrhage or any transfusion eventin this cohort This result suggests that long-term use ofDanshen may prove to be safe without any bleeding disorder

The idea of using Danshen in the present study originatedfrom our previous data [11] Danshen revealed its preventiveresults for the crystal formation in a fruit fly (as observed inan animal study) Salvia miltiorrhiza appeared in the classicherbal book named ldquoShennong Ben Cao Jingrdquo more than2000 years ago (about 200 and 250 AD) [13] It was describedas a noble and nontoxic herb It is often used to treat cardio-vascular diseases [14 15] hypertension and ischemic strokedue to its efficacy on blood circulation [16 17] Till date morethan thirty pharmaceutical preparations for the treatmentof cardiovascular diseases have been developed in clinicalpractice [18] Cardiac and renal dysfunctions often occursimultaneously due to the shared causes and pathogenesis[19] Furthermore oxidative stress is considered as the mostimportant determinant of the common cause [20]


Table 3 Hazard ratios and 95 confidence intervals of calculus surgical treatment and any bleeding disorder associated with cumulativedose per year of Danshen among calculus patients using Danshen

Used Danshen dose (g) per year 119899 Number of events Hazard ratio (95 CI)Crude Adjusteddagger

Event calculus surgical treatmentLess than 417 g per year 2813 203 1 (reference) 1 (reference)417ndash1096 g per year 3025 179 075 (062ndash092)lowastlowast 076 (062ndash093)lowastlowast

More than 1096 g per year 2698 192 092 (075ndash112) 094 (077ndash114)Event any bleeding disorders

Less than 417 g per year 2813 306 1 (reference) 1 (reference)417ndash1096 g per year 3025 308 084 (071ndash098)lowast 083 (071ndash097)lowast

More than 1096 g per year 2698 303 094 (080ndash110) 095 (081ndash111)Adjusted HRdagger represented adjusted hazard ratio mutually adjusted for sex age diabetes mellitus urinary tract infection hypertension chronic kidney diseaseand gout in Cox proportional hazard regression lowast푃 lt 005 lowastlowast푃 lt 001 tertiles are two cut points that will divide a dataset into three equal-sized groups 417 gwas 33rd percentage point and 1096 g was 66th percentage

Time (years)0 2 4 6 8 10 12


00

01

02

03

04

Cum

ulat

ive i

ncid

ence

of c

alcu

lus s

urgi

cal t

reat

men

t


Figure 2 The estimated cumulative incidence of any bleedingdisorder in the Danshen-users was lower than that in the non-Danshen-users by Kaplan-Meier analysis

The hypertensive patients have a greater risk of kidneystones than those with normal blood pressure The patientswith kidney stones are more likely to suffer from hyper-tension than those without urolithiasis Thus there exists apositive correlation between hypertension and renal stones[21] According to a recent study Danshen is the mostfrequently prescribed single herb drug for hypertension [22]In addition previous animal studies revealed that overpro-duction of reactive oxygen species causes kidney damage andSalvia miltiorrhiza helps to improve the renal function andprevent oxidative stress in the renal tissues thereby treatingthe renal damage [23ndash26]

Our previous study conducted with an emerging trans-lational model to screen antilithic herbal drugs revealedthe inhibitory effect of Danshen on the formation of CaO119909crystals in theMalpighian tubules ofDrosophila [11] Accord-ing to the epidemiological studies urolithiasis is associatedwith many chronic diseases including obesity metabolicsyndrome diabetes hypertension chronic kidney diseaseand coronary artery disease [27ndash32]The correlation betweenthese chronic diseases and renal stones is most likely theresult of a common pathophysiological mechanism Reactiveoxygen species (ROS) and oxidative stress are the commonfeatures between kidney stones and venereal diseases [33]Further evidences showed that ROS is also produced inidiopathic CaO119909 kidney stones A kidney stone is not onlya physical-chemical event but also a metabolic disorderThe chronic diseases associated with oxidative stress arerelated to each other Oxidative stress is usually causedby one disorder which in turn contributes to the devel-opment of another disorder particularly hypertension anddiabetes Both these effects may lead to oxidative stresskidney damage and inflammation along with the changesin the urinary environment which promote crystallization[21] Therefore the treatment of urinary tract stones shouldnot be overlooked and the original source must be curedcompletely Furthermore TCM focuses on the reconstructionof the homeostasis prior to the formation of stones alongwith acting as a treatment of urolithiasis after kidney diseaseand stone formation [34] Therefore Danshen may play animportant role in the prevention of urolithiasis

The limitations of this study include limited patientnumber a surrogate outcome instead of recurrence andunknown stone site and number In addition calculus surgi-cal treatment option depends on stone size However LHID2000 does not provide the information of stone size

5 Conclusions

Danshen decreased the ratio of subsequent stone treatmentafter the first treatment in a population study from Taiwanrsquosdatabase Long-term use of Danshen may prove to be safe


with a reduced risk of a bleeding eventTherefore Danshen isa safe herb having a potential for the prevention of calculus



Acknowledgments

This work was supported in part by the Ministry of Healthand Welfare Taiwan (MOHW107-TDU-B-212-123004)China Medical University Hospital Academia Sinica StrokeBiosignature Project (BM10701010021) MOST Clinical TrialConsortium for Stroke (MOST106-2321-B-039-005) Tseng-Lien Lin Foundation Taichung Taiwan Katsuzo and KiyoAoshima Memorial Funds Japan China Medical University(CMU106-S-22 and CMU106-S-32) CMU under the Aimfor Top University Plan of the Taiwan Ministry of Educationand Taiwan Ministry of Science and Technology (MOST104-2320-B039-016-MY3 and MOST106-2813-C-039-108-B)

References

[1] M Ilhan B Ergene I Suntar et al ldquoPreclinical evaluation ofantiurolithiatic activity of Viburnum opulus L on sodiumoxalate-induced urolithiasis rat modelrdquo Evidence-Based Com-plementary and Alternative Medicine vol 2014 Article ID578103 pp 1ndash10 2014

[2] A Premgamone P Sriboonlue S Maskasem W Ditsataporn-charoen and B Jindawong ldquoOrthosiphon versus placebo innephrolithiasis withmultiple chronic complaints a randomizedcontrol trialrdquo Evidence-Based Complementary and AlternativeMedicine vol 6 no 4 pp 495ndash501 2009

[3] W-Y Huang Y-F Chen S Carter H-C Chang C-F Lanand K-H Huang ldquoEpidemiology of upper urinary tract stonedisease in a Taiwanese population a nationwide populationbased studyrdquo The Journal of Urology vol 189 no 6 pp 2158ndash2163 2013

[4] K K Stamatelou M E Francis C A Jones L M NybergJr and G C Curhan ldquoTime trends in reported prevalenceof kidney stones in the United States 1976ndash1994rdquo KidneyInternational vol 63 no 5 pp 1817ndash1823 2003

[5] X Chen J Guo J Bao J Lu and Y Wang ldquoThe anticancerproperties of Salvia miltiorrhiza Bunge (Danshen) a systematicreviewrdquoMedicinal Research Reviews vol 34 no 4 pp 768ndash7942014

[6] Y Guo Y Li L Xue et al ldquoSalvia miltiorrhiza an ancientChinese herbal medicine as a source for anti-osteoporoticdrugsrdquo Journal of Ethnopharmacology vol 155 no 3 pp 1401ndash1416 2014

[7] Y-H Chen S-J Lin H-H Ku et al ldquoSalvianolic acid B atten-uates VCAM-1 and ICAM-1 expression in TNF-120572-treatedhuman aortic endothelial cellsrdquo Journal of Cellular Biochemistryvol 82 no 3 pp 512ndash521 2001

[8] T-L Yang F-Y Lin Y-H Chen et al ldquoSalvianolic acid Binhibits low-density lipoprotein oxidation and neointimalhyperplasia in endothelium-denuded hypercholesterolaemicrabbitsrdquo Journal of the Science of Food and Agriculture vol 91no 1 pp 134ndash141 2011

[9] Y Yuan Q Wu J-S Shi and X-P Chen ldquoAdvance in studieson hepatoprotective effect of Salvia miltiorrhiza and its main

componentsrdquo China Journal of Chinese Materia Medica vol 40no 4 pp 588ndash593 2015

[10] Y ChenH LiuH Chen et al ldquoEthylene glycol induces calciumoxalate crystal deposition in Malpighian tubules a Drosophilamodel for nephrolithiasisurolithiasisrdquo Kidney Internationalvol 80 no 4 pp 369ndash377 2011

[11] S YWu J L Shen KMMan et al ldquoAn emerging translationalmodel to screen potential medicinal plants for nephrolithi-asis an independent risk factor for chronic kidney diseaserdquoEvidence-Based Complementary and Alternative Medicine vol2014 Article ID 972958 pp 1ndash7 2014

[12] C Pan H Huang M Chen et al ldquoLower risk of end stage renaldisease in diabetic nurserdquo Biomedicine vol 7 no 4 article 252017

[13] Z Shang ldquoDiscassion on the date of appearance of the title Shennong ben caojing (ShennongrsquosHerbal Classic)rdquoZhonghuaYi ShiZa Zhi vol 29 no 3 pp 135ndash138 1999

[14] M Asokan Shibu W Kuo C Kuo et al ldquoPotential phyto-estrogen alternatives exert cardio-protective mechanismsrdquoBiomedicine vol 7 no 2 article 11 2017

[15] J Yang C Lu S Kuo et al ldquoAutophagy and its link to type IIdiabetes mellitusrdquo Biomedicine vol 7 no 2 article 8 2017

[16] K Wang D Zhang J Wu S Liu X Zhang and B Zhang ldquoAcomparative study ofDanhong injection and Salviamiltiorrhizainjection in the treatment of cerebral infarctionrdquoMedicine vol96 no 22 Article ID e7079 2017

[17] L Zhou Z Zuo and M S S Chow ldquoDanshen an overviewof its chemistry pharmacology pharmacokinetics and clinicaluserdquo Clinical Pharmacology andTherapeutics vol 45 no 12 pp1345ndash1359 2005

[18] X Li Y Luo L Wang et al ldquoAcute and subacute toxicity ofethanol extracts from Salvia przewalskii Maxim in rodentsrdquoJournal of Ethnopharmacology vol 131 no 1 pp 110ndash115 2010

[19] J Coresh B C Astor T Greene G Eknoyan and A S LeveyldquoPrevalence of chronic kidney disease and decreased kidneyfunction in the adult US population third national healthand nutrition examination surveyrdquo American Journal of KidneyDiseases vol 41 no 1 pp 1ndash12 2003

[20] E Ritz ldquoHeart and kidney fatal twinsrdquo American Journal ofMedicine vol 119 no 5 2006

[21] S R Khan ldquoIs oxidative stress a link between nephrolithiasisand obesity hypertension diabetes chronic kidney diseasemetabolic syndromerdquo Urolithiasis vol 40 no 2 pp 95ndash1122012

[22] P-R Yang W-T Shih Y-H Chu P-C Chen and C-YWu ldquoFrequency and co-prescription pattern of Chinese herbalproducts for hypertension in Taiwan a cohort studyrdquo BMCComplementary and Alternative Medicine vol 15 article 1632015

[23] Z You Y Xin Y Liu et al ldquoProtective effect of Salvia Miltior-rhizae injection on N(G)-nitro-d-arginine induced nitric oxidedeficient and oxidative damage in rat kidneyrdquo Experimental andToxicologic Pathology vol 64 no 5 pp 453ndash458 2012

[24] HHYNgaiW-H Sit and JM FWan ldquoThenephroprotectiveeffects of the herbal medicine preparation WH30+ on thechemical-induced acute and chronic renal failure in ratsrdquoAmerican Journal of Chinese Medicine vol 33 no 3 pp 491ndash500 2005

[25] X Lu Y Jin L Ma and L Du ldquoDanshen (Radix SalviaeMiltiorrhizae) reverses renal injury induced by myocardialinfarctionrdquo Journal of Traditional Chinese Medicine vol 35 no3 pp 306ndash311 2015


[26] L Li Y Zhang JMa et al ldquoSalviamiltiorrhiza injection amelio-rates renal damage induced by lead exposure in micerdquo TheScientific World Journal vol 2014 Article ID 572697 pp 1ndash92014

[27] S H Obligado and D S Goldfarb ldquoThe association of nephro-lithiasis with hypertension and obesity a reviewrdquo AmericanJournal of Hypertension vol 21 no 3 pp 257ndash264 2008

[28] I G Jeong T Kang J K Bang et al ldquoAssociation betweenmetabolic syndrome and the presence of kidney stones in ascreened populationrdquo American Journal of Kidney Diseases vol58 no 3 pp 383ndash388 2011

[29] J C Lieske L S P de la Vega M T Gettman et al ldquoDiabetesmellitus and the risk of urinary tract stones a population-basedcase-control studyrdquo American Journal of Kidney Diseases vol48 no 6 pp 897ndash904 2006

[30] N A Saucier M K Sinha K V Liang et al ldquoRisk factorsfor CKD in persons with kidney stones a case-control studyin Olmsted County Minnesotardquo American Journal of KidneyDiseases vol 55 no 1 pp 61ndash68 2010

[31] M Daudon and P Jungers ldquoDiabetes and nephrolithiasisrdquo Cur-rent Diabetes Reports vol 7 no 6 pp 443ndash448 2007

[32] A D Rule V L Roger L J Melton III et al ldquoKidney stonesassociate with increased risk for myocardial infarctionrdquo Journalof the American Society of Nephrology vol 21 no 10 pp 1641ndash1644 2010

[33] S-J Lin T-H Yang Y-H Chen et al ldquoEffects of Ginkgo bilobaextract on the proliferation of vascular smooth muscle cells invitro and on intimal thickening and interleukin-1 120573 expressionafter balloon injury in cholesterol-fed rabbits in vivordquo Journal ofCellular Biochemistry vol 85 no 3 pp 572ndash582 2002

[34] M D I Gohel and S P Wong ldquoChinese herbal medicines andtheir efficacy in treating renal stonesrdquoUrolithiasis vol 34 no 6pp 365ndash372 2006

Research ArticleEffect of Resveratrol Dry Suspension on ImmuneFunction of Piglets

Qiuting Fu1 Qiankun Cui1 Yi Yang1 Xinghong Zhao1 Xu Song1

Guangxi Wang1 Lu Bai1 Shufan Chen1 Ye Tian1 Yuanfeng Zou1 Lixia Li1

Guizhou Yue2 Renyong Jia 3 and Zhongqiong Yin 1

1Natural Medicine Research Center College of Veterinary Medicine Sichuan Agricultural University Chengdu 611130 China2College of Science Sichuan Agricultural University Yarsquoan 625014 China3College of Veterinary Medicine Sichuan Agricultural University Chengdu 611130 China

Correspondence should be addressed to Zhongqiong Yin yinzhongq163com

Received 20 September 2017 Accepted 10 January 2018 Published 1 February 2018

Academic Editor Randhir Singh Dahiya

Copyright copy 2018 Qiuting Fu et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Resveratrol a polyphenolic plant antitoxin has a wide range of pharmacological activities In this study we systematically evaluatedthe effects of resveratrol dry suspension (RDS) on immune function in piglets that were treated with different doses of RDS for 2weeksThe results showed that the RDS has significant effects on the development maturation proliferation and transformation ofT lymphocytes RDS could regulate humoral immune responses by upregulating the release of IFN-120574 and downregulating the releaseof TNF-120572 After piglets were vaccinated against classical swine fever virus and foot-and-mouth disease virus the antibody titerswere significantly increased RDS treatment showed an excellent resistance to enhance T-SOD activity Values of blood routine andblood biochemistry showed no toxicity These results suggested that RDS could be considered as an adjuvant to enhance immuneresponses to vaccines as well as dietary additives for animals to enhance humoral and cellular immunity

1 Introduction

The immune system is a vital barrier against the invasionof microorganisms and it assumes enormous importancein fight against diseases and malignant abnormal cells [1]Modern medical research has brought natural products intopeoplersquos vision to enhance or restore the immune system It isshown that some phytochemicals are beneficial to the healthof the body by promoting the immune function reducinginflammation and activating enzymes [2] As a result naturalplants with pharmacological activities are recommended asdietary supplements or therapeutic agents to effectively carefor the organism

Resveratrol (trans-345-trihydroxystilbene) a naturalpolyphenolic compound extracted from Polygonum cuspida-tum was first found in red wine because of the beneficialeffect on the heart [3] It has been exposed to a variety ofbiological activities including anticancer antioxidative anti-inflammatory antimicrobial and estrogenic activities [4] By

interacting with multiple molecular targets resveratrol couldregulate innate and adaptive immunity [5] It has attractedincreasing attention due to the rich biological activities andhas been recognized for its benefits to human health and usedas a healthcare product in some peoplersquos diet [6]

Resveratrol supplementation in rat diets showed anincrease in IgM concentration and splenocyte proliferationand a decrease in the triglyceride level [7] In chickens resver-atrol could promote growth and inhibit antigen-inducedapoptosis [8] In ducklings infected with virulent duckenteritis virus resveratrol supplementation could increasethe survival rate relieve tissue lesions and reduce viral loadin blood [9]

Although the function of resveratrol to regulate theimmune response has been demonstrated in various animalmodels it has been rarely reported in piglets Pigs can be usedas animal models for human diseases because of the greatsimilarity between pigs and humans in lipid metabolismcardiovascular physiology [10] and digestive system [11]



In our previous research resveratrol was prepared into adry suspension with the presence of suitable excipients tosolve the trouble of poor water solubility in our laboratoryTherefore in this study the piglets were given resveratrol drysuspension (RDS) and the immune-regulating function wasdetermined for the purpose of development of a new additivefor piglets


21 Chemicals The resveratrol dry suspension (RDS) wasprepared in Natural Medicine Research Center of SichuanAgricultural University (Chengdu China) and the contentof resveratrol was 3 Resveratrol was purchased from SigmaCo Ltd (USA) Echinacea purpurea powder was purchasedfrom Qilu Animal Health products Co Ltd (Jinan China)

22 Animals Animal experiments were conducted underthe principles of proper laboratory animal care and wereapproved by the ethical committee of the LaboratoryAnimalsCare and Use of Sichuan Agriculture University (ChengduChina license number SCXK (Sichuan) 2014-187) 40 cross-bred weaned piglets (Duroc times Landrace times Big White) at 28days of age were randomly divided into five groups of 8animals each group (4 females and 4 males) The 5 groupswere as follows saline control group (Group I) low doseof RDS-treated group (01 gkgd Group II) middle doseof RDS-treated group (033 gkgd Group III) high dose ofRDS-treated group (10 gkgd Group IV) and Echinaceapurpurea-treated group (005 gkgd Group V) respectivelyThe RDS and Echinacea purpurea (positive control) weresuspended in water and fed to animals at 9 am everymorning for 14 days The standard diet of animals wasformulated based on the NRC (2012) recommendation forthe nutrient requirements of 7ndash11 kg pigs [12] The pigletswere bred at a stationary temperature of 20ndash25∘C a stablerelative humidity of 50 plusmn 10 and illumination of 12 hper day in accordance with the International Committeeon Laboratory Animals The animals were domesticatedfor 4 days before experiments It is assured that all ani-mals are treated humanely in the laboratory and that thefewest numbers of animals are used to achieve the desiredobjectives

23 Growth Performance and Visceral Index Assay Duringtreatment period piglets were weighed under limosis Thestates of the animals were observed and recorded every dayThe average daily feed intake (ADFI) average daily gain(ADG) and ratio of feed to gain (F G) were measured

Within 24 hours of the last administration piglets weresacrificed and the organswereweighed including heart lungliver kidney spleen and inguinal lymph nodes The indexeswere calculated according to the following formula index(mgg) = (the weight of organ)the body weight

24 Vaccine Treatment and Detection of Serum AntibodyLevel Each piglet was inoculated with classical swine fevervaccine (CSFV) in the first day of the trial reference to therecommended immunization program [13] A week later the

piglets were inoculated with foot-and-mouth disease vaccine(FMDV) again The delay of second vaccination time was toeliminate or mitigate the stress response of piglets to FMDV[14]

Blood samples from anterior vein were collected todetermine the serum antibody level at 0 d 7 d and 14 dduring the trial respectively The antibody levels of CSFVand FMDV in serum were analyzed by ELISA kits (Shenzhenfinder Biotech Co Ltd China) in accordance with themanufacturerrsquos instructions

25 T Lymphocyte Subsets Assay Within 24 hours of thelast administration 2ml of blood sample of each piglet fromanterior vein was collected and dealt with EDTA The lym-phocytes were separated by lymphocyte separation medium(Beijing Solarbio China)Then the cells were incubated withCD3e-FITC CD4120572-PRE and CD8120572-SPRDmonoclonal anti-bodies (BDBiosciencesUSA) at temperature 37∘C for 05 h inthe darkness followed by centrifugation and resuspending inPBS T lymphocyte subsets were analyzed by flow cytometry(BD Biosciences USA)

26 Proliferative Activity of Peripheral Blood Lymphocyte andSpleen Lymphocytes Within 24 hours of the last adminis-tration blood sample of each piglet from anterior vein wascollected with anticoagulation Then 3ml of blood samplewas slowly injected into 6ml of porcine peripheral bloodlymphocyte separation solution (Beijing Solarbio China) andcentrifuged to obtain the intermediate white cell layer Thecells were washed and centrifuged by PBS three times andthen suspended in RPMI-1640 medium (Beijing SolarbioChina) at the concentration of 2 times 106 cellsL Blastogenicresponse of lymphocytes to the mitogen of ConA (BeijingSolarbio China) was assessed by CCK-8 (Dojindo Labora-tories Japan) Lymphocyte suspension was incubated withConA (10 120583gmL) in 150 120583L RPMI 1640 medium containing10 fetal bovine serum (FBS Gibco Company USA) at 37∘Cwith 5 CO2 After incubation for 48 h 10 120583L CCK-8 wasadded to each well After incubation for 2 h the absorbanceat 450 nm was measured by a microplate reader (Bio-RadUSA)

Within 24 hours of the last administration 3 pigletsfrom each group were sacrificed and the spleen was isolatedin a sterile environment Spleen tissue with the weight of5 g was disrupted and spleen cell suspensions were passedthrough sterile nylon mesh Red blood cells were lysed byErythrocyte Lysate (Beijing Solarbio China)The spleen cellswere suspended in RPMI-1640 medium and the methods ofculture and detectionwere identical to those described above

27 Determination of Serum Immunoglobulin Levels Theblood of piglets was collected from the anterior vein at theend of the trialThe serumwas isolated by centrifugationTheserum concentrations of IgG IgA and IgMweremeasured byELISA kits (Shanghai MLBIO China)

28 The Antioxidant Capacity of Serum The serum to-tal antioxidant capacity (T-AOC) malondialdehyde level(MDA) and superoxide dismutase (T-SOD) in serum were


Table 1 Growth performance and visceral index

Items Group I Group II Group III Group IV Group VInitial body weight (kg) 652 plusmn 007 652 plusmn 018 675 plusmn 041 657 plusmn 038 661 plusmn 016Final body weight (kg) 782 plusmn 037 765 plusmn 031 85 plusmn 04 813 plusmn 075 841 plusmn 013Average daily feed intake (g) 24286 plusmn 2326 19333 plusmn 1203 24807 plusmn 426 18334 plusmn 3335 12809 plusmn 392Average daily gain (g) 9333 plusmn 2965 8095 plusmn 971 14905 plusmn 2764 1119 plusmn 2792 22645 plusmn 2695Ratio of feed to gain 325 plusmn 104 242 plusmn 016 167 plusmn 003 168 plusmn 017 178 plusmn 024Heart coefficient 537 plusmn 034 499 plusmn 024 545 plusmn 027 518 plusmn 011 551 plusmn 039Lung coefficient 2732 plusmn 252 265 plusmn 192 2428 plusmn 205 2447 plusmn 173 2067 plusmn 125Liver coefficient 2732 plusmn 252 265 plusmn 192 2428 plusmn 205 2447 plusmn 173 2067 plusmn 125Kidney coefficient 594 plusmn 049 605 plusmn 018 63 plusmn 054 562 plusmn 022 611 plusmn 034Spleen coefficient 194 plusmn 014 152 plusmn 018 168 plusmn 004 152 plusmn 016 201 plusmn 019Lymph nodes coefficient 145 plusmn 013 184 plusmn 026 176 plusmn 022 144 plusmn 015 163 plusmn 016Group I saline control Group II RDS 01 gkg treated group Group III RDS 033 gkg treated group Group IV RDS 10 gkg treated group GroupV Echinaceapurpurea powder 005 gkg treated group Data are represented as means plusmn SE 119899 = 6 comparison was made with the model group one-way ANOVA followedby Duncan test

Table 2 T lymphocyte subsets

Items Group I Group II Group III Group IV Group VCD3+ () 65 plusmn 471 6343 plusmn 502 7117 plusmn 089 6157 plusmn 487 621 plusmn 475CD3+CD4+ () 2797 plusmn 389 359 plusmn 571 433 plusmn 456 358 plusmn 339 2937 plusmn 259CD3+CD8+ () 2367 plusmn 388 2223 plusmn 263 2423 plusmn 15 207 plusmn 201 181 plusmn 201CD3+CD4+CD3+CD8+ 125 plusmn 029 16 plusmn 007 178 plusmn 009 174 plusmn 01 145 plusmn 017Group I saline control Group II RDS 01 gkg treated group Group III RDS 033 gkg treated group Group IV RDS 10 gkg treated group GroupV Echinaceapurpurea powder 005 gkg treated group Data are represented as means plusmn SE 119899 = 6 comparison was made with the model group one-way ANOVA followedby Duncan test

determined by ELISA kits (Nanjing Jiancheng Bioengineer-ing Institute China)

29 Determination of Serum Cytokine Levels The serumcytokine levels of interleukin interferon and tumor necrosisfactor were determined by ELISA kits (Shanghai MLBIOChina)

210 Hematologic Examination and Serum Biochemical Ex-amination Theblood samples obtained at the end of the trialwere collected into a precalibrated tube containing sodiumcitrate The hematological parameters included white bloodcell count (WBC) red blood cell count (RBC) hemoglobinconcentration (HGB) hematocrit (HCT) mean corpuscu-lar volume (MCV) mean corpuscular hemoglobin (MCH)MCH concentration (MCHC) platelet count (PLT) andleukocyte differential count (lymphocytes neutrophils andmonocytes) [15]

Serum biochemical indicators were detected includingalbumin (ALB) total protein (TP) alanine aminotrans-ferase (ALT) aspartate aminotransferase (AST) alkalinephosphatase (ALP) urea nitrogen (BUN) creatinine (CRE)glucose (GLU) calcium (Ca) phosphorus (P) total bilirubin(TBIL) and total cholesterol (CHO)

3 Results

31 Growth Performance and Visceral Coefficients Thegrowth performance and visceral index of piglets were shown

in Table 1 Animals were randomly grouped and showed nodifference in initial body weight While the animals gainedweight during experiment the average daily feed intake andaverage daily gain of all drug treatments did not significantlydiffer in comparison to the saline control group (119901 gt 005)The RDS and Echinacea purpurea treatment had no effect oncoefficients of organs when compared to the saline controlgroup (119901 gt 005)

32 Percentage and Ratio of T Lymphocyte Subsets Thepercentage of T lymphocytes in the peripheral blood of pigletswas shown in Table 2 as well as the percentage of CD3+CD4+and CD3+CD8+ labeled T cells and the ratio of the two Thepercentages of T lymphocyte including CD3+ CD3+CD4+and CD3+CD8+ and the ratio of CD3+CD4+CD3+CD8+did not show any difference (119901 gt 005) among all the groupsIn RDS treatment these T lymphocyte subsets were slightlyhigher than positive control (119901 gt 005)

33 Proliferative Activity of Peripheral Blood Lymphocyte andSpleen Lymphocytes The proliferation of peripheral bloodlymphocytes and splenic lymphocytes under the stimulationof ConA was shown in Figure 1 Compared with salinecontrol group RDS treatment (033 gkg) significantly (119901 lt001) stimulated the proliferation of peripheral blood lym-phocytes while the other treatment groups did not showany differences In splenic lymphocytes all RDS treatmentssignificantly increased (119901 lt 005) lymphocyte proliferation


lowastlowast

0

1

2

3O

D 4

50

Group II Group III Group IV Group VGroup IPeripheral blood lymphocyte

(a)

lowastlowast

lowastlowast

Group II Group III Group IV Group VGroup ISplenic lymphocytes

0

1

2

3

OD

450

(b)

Figure 1 Proliferative activity of peripheral blood lymphocyte and spleen lymphocytes under the stimulation of ConA (a) Proliferation ofperipheral blood lymphocytes (b) proliferation of splenic lymphocytes Group I saline control Group II RDS 01 gkg treated group GroupIII RDS 033 gkg treated group Group IV RDS 10 gkg treated group Group V Echinacea purpurea powder 005 gkg treated group Dataare represented as means plusmn SE 119899 = 6 comparison was made with the saline control group one-way ANOVA followed by Duncan test Thesymbols represent statistical significance at lowast119901 lt 005 and lowastlowast119901 lt 001

7 d14 d

lowastlowastlowastlowast

lowastlowast

lowast lowast

Group II Group III Group IV Group VGroup IInoculation with CSFV

00

02

04

06

08

Ant

ibod

y le

vel

(a)

7 d

lowast

lowastlowast lowast

00

02

04

06

08

Ant

ibod

y le

vel

Group II Group III Group IV Group VGroup IInoculation with FMDV

(b)

Figure 2 Antibody levels in serum (a) The antibody level of CSFV (b) the antibody level of FMDV Group I saline control Group II RDS01 gkg treated group Group III RDS 033 gkg treated group Group IV RDS 10 gkg treated group Group V Echinacea purpurea powder005 gkg treated group RDS resveratrol dry suspension CSFV classical swine fever vaccine FMDV foot-and-mouth disease vaccine Dataare represented as means plusmn SE 119899 = 6 comparison was made with the saline control group one-way ANOVA followed by Duncan test Thesymbols represent statistical significance at lowast119901 lt 005 and lowastlowast119901 lt 001

which showed RDS possessed potent effect on lymphocyteactivity

34 Antibody Levels in Serum The detection of antibodylevels in piglets was shown in Figure 2 The levels of CSFVantibody produced after 7 days of inoculation in piglets weresignificantly increased (119901 lt 001) inRDS treatment (033 gkgand 10 gkg) compared to the saline control group whilethe antibody level in Echinacea purpurea powder-treatmentwas also remarkably higher (119901 lt 005) than that of salinecontrol group After 14 days of inoculation CSFV only RDStreatment (033 gkg and 10 gkg) differed significantly in thesaline control group (119901 lt 001 or 119901 lt 005) Detection resultsafter a week of vaccination with FMDV showed that all drugtreatments significantly (119901 lt 005) improved the antibody

levels in piglets These data demonstrated the positive effectsof RDS on the secretion of antibodies

35 Immunoglobulin Levels in Serum The immunoglobulinslevels of serum in piglets were measured in the first andsecond weeks of the trial respectively and the results wereshown in Figure 3 At 7 d of the trial all RDS treatmentssignificantly increased (119901 lt 005 or 119901 lt 001) the levelsof IgG and IgM in the serum while the RDS treatment(033 gkg) and Echinacea purpurea powder treatment signif-icantly increased (119901 lt 001) the content of IgA At 14 d theRDS treatment (033 gkg) significantly promoted (119901 lt 001)the secretion of IgA in serum yet the other drug-treatmentgroups had no effect on the changes of immunoglobulincontent compared with the saline control group


7 d14 d

Group II Group III Group IV Group VGroup I

lowastlowast lowastlowast

lowast

0

50

100

150

200

250(

gm

l)

(a)

7 d14 d



lowast

0

20

40

60

80

100

(g

ml)

(b)

7 d14 d



lowastlowast

0

20

40

60

80

100

(g

ml)

(c)

Figure 3 Immunoglobulin levels in serum (a) Immunoglobulin G levels (b) immunoglobulinM levels (c) immunoglobulin A levels GroupI saline control Group II RDS 01 gkg treated group Group III RDS 033 gkg treated group Group IV RDS 10 gkg treated group GroupV Echinacea purpurea powder 005 gkg treated group Data are represented as means plusmn SE 119899 = 6 comparison was made with the salinecontrol group one-way ANOVA followed by Duncan test The symbols represent statistical significance at lowast119901 lt 005 and lowastlowast119901 lt 001

36 Antioxidant Capacity of Serum The result (Figure 4)showed that at 7 d of the trial RDS treatment (033 gkgand 10 gkg) and Echinacea purpurea powder treatmentsignificantly improved (119901 lt 001) the total antioxidantcapacity of serum Similarly the RDS treatment (033 gkg)and the Echinacea purpurea treatment significantly increasedthe total antioxidant capacity at 14 d while the other groupswere not significantly different compared with the salinecontrol group All the drug treatments had no effect onMDAproduction RDS-treatment groups (033 gkg and 10 gkg)and positive control group significantly improved the activityof serum T-SOD after 7 d (119901 lt 001 or 119901 lt 005) and onlythe RDS-treatment (033 gkg) and positive control groupsignificantly improved the activity of serum T-SOD after14 d The results confirmed that RDS had a good antioxidantcapacity at the dose of 033 gkg

37 Cytokine Levels in Serum The result (Figure 5) showedthat all RDS treatments and Echinacea purpurea treatmentreduced the release of TNF-120572 (119901 lt 001 or 119901 lt 005) at7 d while the RDS treatment (01 gkg and 033 gkg) alsoreduced the release of IL-12 (119901 lt 005) In the second week

all RDS-treatment and Echinacea purpurea-treatment groupsincreased the release of IFN-120574 (119901 lt 005) and the RDStreatment (10 gkg) increased the release of IL-2 (119901 lt 001)

38 Hematologic Examination and Serum Biochemical Exam-ination Tables 3 and 4 show the effects of RDS on bloodand serumbiochemicalmarkers respectively RDS-treatmentgroups (033 gkg and 10 gkg) and positive control groupsignificantly increased the number of white blood cells(WBC) neutrophils (NEUT) lymphocytes (LY) and mono-cytes (MONO)The creatinine (CRE) levels were significantlyhigher in the RDS medium and high dose groups than thatof saline group (119901 lt 005) The urea nitrogen (BUN) andtriglyceride (TG) levels were increased in the RDS-treatment(01 gkg) group (119901 lt 001) Alanine aminotransferase (ALT)levels were increased in the median dose group meanwhileblood sugar (GLU) levels were lower in the RDS-treatment(033 gkg) group (119901 lt 001)

4 Discussion

Our study systematically evaluated the effect of RDS on theimmune function of piglets through various parameters We


7 d14 d


lowastlowast


lowastlowast

lowastlowast

0

5

10

15(U

ml)

(a)

7 d14 d

Group II Group III Group IV Group VGroup I0

2

4

6

8

(nm

olm

l)

(b)

7 d14 d


lowastlowastlowastlowastlowast

lowastlowast

0

20

40

60

80

100

(Um

l)

(c)

Figure 4 Serum total antioxidant capacity (a) Serum T-AOC activity (b) serum MDA activity (c) serum T-SOD activity Group I salinecontrol Group II RDS 01 gkg treated group Group III RDS 033 gkg treated group Group IV RDS 10 gkg treated group Group VEchinacea purpurea powder 005 gkg treated group Data are represented as means plusmn SE 119899 = 6 comparison was made with the salinecontrol group one-way ANOVA followed by Duncan test The symbols represent statistical significance at lowast119901 lt 005 and lowastlowast119901 lt 001

Table 3 Blood routine examination

Items Group I Group II Group III Group IV Group VWBC (10and9L) 1327 plusmn 071 1304 plusmn 123 2154 plusmn 329lowastlowast 2109 plusmn 096lowastlowast 187 plusmn 118lowast

NEUT (10and9L) 502 plusmn 025 416 plusmn 077 112 plusmn 169lowastlowast 765 plusmn 011lowast 78 plusmn 069lowast

LY (10and9L) 787 plusmn 055 843 plusmn 048 943 plusmn 161lowast 1321 plusmn 075lowastlowast 1026 plusmn 051lowast

MONO (10and9L) 031 plusmn 004 027 plusmn 001 086 plusmn 015lowastlowast 063 plusmn 008lowast 061 plusmn 009lowast

HB (gL) 111 plusmn 132 11367 plusmn 351 11533 plusmn 664 11067 plusmn 056 11333 plusmn 319PLT (10and9L) 52433 plusmn 5585 44867 plusmn 7048 48233 plusmn 5238 430 plusmn 6948 48133 plusmn 5259RBC (10and12L) 69 plusmn 008 695 plusmn 014 661 plusmn 064 701 plusmn 009 678 plusmn 036Group I saline control Group II RDS 01 gkg treated group Group III RDS 033 gkg treated group Group IV RDS 10 gkg treated group GroupV Echinaceapurpurea powder 005 gkg treated group Data are represented as means plusmn SE 119899 = 6 comparison was made with the model group one-way ANOVA followedby Duncan test The symbols represent statistical significance at lowast119901 lt 005 and lowastlowast119901 lt 001

found that RDS was the effective preparation of resveratroland could significantly enhance immune function of pigletsEchinacea purpurea was shown to elicit an immune responseby increasing the phagocytosis of granulocytes and thenumber of lymphocytes in fattening pigs as a feed additive[16] Therefore it was selected as a positive control drugto assess the effect on immune function of resveratrol The

results showed that RDS had a better immune-enhancingactivity suggesting that RDS had the potential to be used asan immunopotentiator

In this study RDS had no effect on the growth perfor-mance and organ coefficient of the piglets which was similarto the previous study [17] It was reported that standard dietsupplementedwith 300 or 600mg resveratrolkg significantly


7 d14 d


lowastlowast

lowast

lowast

0

1000

2000

3000

4000

5000IF

N-

(pg

ml)

(a)

7 d14 d


lowastlowast

lowastlowastlowast

0

20

40

60

80

TNF-

(p

gm

l)

(b)

7 d14 d


lowastlowast

0

100

200

300

400

IL-2

(pg

ml)

(c)

0

10

20

30

40

50

IL-4

(pg

ml)

7 d14 d


(d)

lowast

0

50

100

150

IL-1

0 (p

gm

l)

7 d14 d


(e)

lowastlowast

0

50

100

150

IL-1

2 (p

gm

l)

7 d14 d


(f)

Figure 5 Cytokines levels in serum (a) IFN-120574 levels (b) TNF-120572 levels (c) IL-2 levels (d) IL-4 levels (e) IL-10 levels (f) IL-12 levels Group Isaline control Group II RDS 01 gkg treated group Group III RDS 033 gkg treated group Group IV RDS 10 gkg treated group Group VEchinacea purpurea powder 005 gkg treated group Data are represented as means plusmn SE 119899 = 6 comparison was made with the saline controlgroup one-way ANOVA followed by Duncan test The symbols represent statistical significance at lowast119901 lt 005 and lowastlowast119901 lt 001

reduced the pigrsquos liver coefficient being probable due to thedecrease of the visceral adipose tissue weight [18]

CD3+CD4+ cell as a T helperinducing cell secretesa variety of lymphokines which can regulate other cellsinvolved in the immune response while CD3+CD8+ cell asa cytotoxic T cell can secrete IFN-120574 and kill the target cells

carrying the antigen when it was activated [19] The effect ofresveratrol increasing the ratio of CD3+CD4+CD3+CD8+was confirmed in the obese model of C57BL6 mice [20]The reduction in CD3+CD4+CD3+CD8+ ratio was usuallyassociated with malignancies or the attack of the virus suchas HIV infection [21] and the reduction also existed in the


Table 4 Serum biochemical indexes

Items Group I Group II Group III Group IV Group VTP (gL) 5187 plusmn 027 533 plusmn 152 522 plusmn 22 4943 plusmn 129 5348 plusmn 079ALB (gL) 3607 plusmn 142 4007 plusmn 224 3643 plusmn 159 341 plusmn 112 3872 plusmn 033TBIL (120583molL) 137 plusmn 013 157 plusmn 018 26 plusmn 052 157 plusmn 006 147 plusmn 012ALT (IUL) 3067 plusmn 205 262 plusmn 145 3793 plusmn 676lowastlowast 297 plusmn 256 2907 plusmn 103AST (IL) 4277 plusmn 138 5023 plusmn 754 851 plusmn 1079 591 plusmn 276 5995 plusmn 248ALP (IUL) 24937 plusmn 1159 25067 plusmn 1904 2359 plusmn 3028 26513 plusmn 1811 24751 plusmn 578120574-GT (UL) 4747 plusmn 255 4453 plusmn 17 499 plusmn 276 562 plusmn 272 5462 plusmn 191BUN (mmolL) 334 plusmn 045 473 plusmn 015lowastlowast 379 plusmn 044 367 plusmn 019 383 plusmn 014CRE (120583molL) 7567 plusmn 394 76 plusmn 063 8667 plusmn 542lowast 8567 plusmn 076lowast 8314 plusmn 243GLU (mmolL) 544 plusmn 026 549 plusmn 019 469 plusmn 013lowastlowast 545 plusmn 011 534 plusmn 017TC (mmolL) 166 plusmn 02 192 plusmn 003 19 plusmn 015 156 plusmn 002 195 plusmn 007TG (mmolL) 036 plusmn 007 061 plusmn 009lowastlowast 048 plusmn 002 045 plusmn 002 048 plusmn 001CK (IUL) 949 plusmn 33045 81633 plusmn 12621 249333 plusmn 106158 1596 plusmn 36001 74333 plusmn 6097K (mmolL) 495 plusmn 018 479 plusmn 007 462 plusmn 04 527 plusmn 009 484 plusmn 015Na (mmolL) 13653 plusmn 221 1321 plusmn 066 137 plusmn 218 13647 plusmn 053 13618 plusmn 121Cl (mmolL) 967 plusmn 216 9313 plusmn 148 9833 plusmn 175 9737 plusmn 014 9847 plusmn 088Ca (mmolL) 292 plusmn 007 307 plusmn 013 28 plusmn 012 283 plusmn 005 292 plusmn 01Group I saline control Group II RDS 01 gkg treated group Group III RDS 033 gkg treated group Group IV RDS 10 gkg treated group GroupV Echinaceapurpurea powder 005 gkg treated group Data are represented as means plusmn SE 119899 = 6 comparison was made with the model group one-way ANOVA followedby Duncan test The symbols represent statistical significance at lowast119901 lt 005 and lowastlowast119901 lt 001

mouse model of systemic lupus erythematosus [22] In ourstudy there was no significant difference between the normaland treated groups When referring to the normal humanrange of 11ndash2 [23] the ratio of piglets was considered to havea normal fluctuation

T lymphocytes can be transformed into lymphoblasts forcell division and proliferation in vitro culture under the stim-ulation of mitogen such as concanavalin (ConA) Antigenstimulation changed from steady state of small lymphocytesinto large lymphocytes accompanied by increased cell vol-ume and lighter nuclear staining nucleolus and cytoplasmicribosome Then lymphocyte division and proliferation ofeffector cells took place [24] Lymphocyte proliferation testsare often used to assess cellular immune function It isreported that there was a trend for increased proliferationfor cells treated with resveratrol [25] Compared to theimmunosuppressive mice spleen lymphocyte proliferationwas enhanced with resveratrol-treatment [26] In our studyall RDS-treatment groups showed a positive effect on theactivation and proliferation of T lymphocytes in spleen andin peripheral blood Our study also demonstrated that RDSwas effective in activating the function of T lymphocytesstimulated by antigens

Natural products have been shown to serve as adjuvantsthat can enhance animal antibody levels under the stimula-tion of vaccines Astragalus polysaccharide and oxymatrinehave been reported to possess synergistical immunoenhance-ment in enhancing the immune efficacy of Newcastle diseasevaccine [27] The antibody titer against infectious bursaldisease virus in broilers with treatment of Echinacea purpureaextract (01ndash1 gkg) was significantly higher than that incontrol group [28] Adding 05 Echinacea into diet hadan enhancing effect on response of influenza vaccine [29]

Swine fever and swine foot-and-mouth disease are acute andinfectious diseases which happened worldwide and broughthuge losses to mankind [30] In the present study both RDStreatment (033 gkg and 10 gkg) and Echinacea treatmentsignificantly improved the antibody titers against CSFV andFMDV and the activity of RDS treatment was superior toEchinacea treatment A recent study evaluated the effectsof resveratrol on inflammatory response and antibody pro-duction against Philasterides dicentrarchi induced in turbotthe results showed a good regulatory effect of resveratrol onthe inflammatory response the vaccine induced [31] Theseresults suggested that resveratrol could be considered as anadjuvant to enhance the immune response of vaccine inanimals

Immunoglobulins are formed in spleen and lymph nodesand secreted by mature plasma cells They exist in the serumbody fluids and tissues and can be directly involved inhumoral immunity Resveratrol supplementation remarkablypromoted the production of immunoglobulin G in rats [32]Similar studies also reported that dietary supplementationof 02 resveratrol improved the serum IgG levels in piglets[17] In the first week of our trial the levels of IgG IgMand IgA in serum were increased in varying degrees withdifferent dose of RDS supplementation while these effectscould not be observed at the end of the second weekWe speculate that this may be due to the improvement ofthe immune system in the growth process of piglets andthe impact of drug treatment on its immune response hasdiminished These results suggested that RDS may be moreeffective in immunocompromised animals in regulating andparticipating in immune responses

Recently the antioxidant activity of resveratrol has beenfully confirmed by various experiments It has been shown


that resveratrol can exhibit prooxidant properties leadingto oxidative breakage of cellular DNA in the presence oftransition metal ions such as copper which hinted theanticancer and chemopreventive properties of resveratrol[33] Resveratrol may protect against oxidant injury due toits capacity to inhibit COX-2-derived PGE 2 synthesis [34]A study in rats showed that resveratrol significantly anddose-dependently decreased brain MDA level and increasedbrain SOD catalase and peroxidase activities [35] RDS hasbeen proven to enhance the activities of T-AOC and SODin our experiment while it did not affect the level of MDAin the serum These studies showed that RDS enhanced theability to scavenge oxygen free radicals and improved the totalantioxidant capacity

Resveratrol can regulate the secretion of cytokines bymediating and activating immune cells It was reported thatTNG-120572 levels in diabetic rats treated with resveratrol (5 gkg)have decreased significantly [36] and this trend was also bedemonstrated in our study The mechanism may be due tothe downregulation of JAK-STAT pathway and decreasingthe levels of activated STAT1 in the nucleus [37] Besidesresveratrol could reduce the release of proinflammatorycytokines on human periodontal ligament cells such as IL-12stimulated by LPS [38] In our study RDS was involved in theregulation of humoral immune responses by upregulating therelease of IFN-120574 and downregulating the release of TNF-120572

Blood routine and biochemical tests are often used toassist in the diagnosis of diseases and to observe the toxicityof drugs In our study the increase in WBC NEUT LYand MONO suggested that a slight inflammation may havetaken place in the RDS-treatment groups (033 gkg and10 gkg) and Echinacea purpurea-treatment group Resvera-trol suppressed oxidative and inflammatory stress responseto a high-fat high-carbohydrate meal [39] In the presentstudy the blood glucose (GLU) levels in the RDS-treatment(033 gkg) group were also reduced which was similar to thereport RDS had no significant effect on liver function renalfunction and electrolyte and other biochemical indexes incomparison with blank control A small number of indicators(rise or fall) were still within the normal range of fluctuationswhich can be accepted when referring to normal levels [40]These tests suggested that RDS was lowly toxic or nontoxic topiglets

5 Conclusion

In summary RDS significantly affects the developmentmaturation proliferation and transformation of T lympho-cytes and is involved in the regulation of humoral immuneresponses by upregulating the release of IFN-120574 and down-regulating the release of TNF-120572 It significantly increased theantibody titers of the piglets under the stimulation of CSFVand FMDV when immunized against the vaccine It showedan excellent resistance to oxidation and enhanced the T-SODactivity and it has low toxicityThese positive effects hint thatRDS could be considered as an adjuvant to enhance the bodyrsquosimmune response to vaccines as well as dietary additives foranimals to enhance humoral and cellular immunity and toplay antioxidant and antiaging effects




Qiuting Fu Qiankun Cui and Yi Yang contributed equally tothis work

Acknowledgments

This research was financially supported by National Nat-ural Science Foundation of China (Grant no 31372477)the Sichuan Strategic Research and Development Projectfor Emerging Products (2015GZX0010) the Sichuan Sci-ence and Technology Plan Project (2015NZ0077) and theChengdu Agricultural Technology Research and Develop-ment ProjectFunctional Feed Additive (2015-NY02-00266-NC)The authors are also grateful to the colleagues in the labfor their assistance during the experiment

References

[1] V Varona ldquoImmunity healthrdquo Macrobiotics Today vol 46 no2 Article no 5 2006

[2] S R Naik V N Thakare and F P Joshi ldquoFunctional foodsand herbs as potential immunoadjuvants and medicines inmaintaining healthy immune system A commentaryrdquo Journalof Complementary and Integrative Medicine vol 7 no 1 articleno 46 pp 3ndash19 2010

[3] ldquoRed Wine Joe Weiders Muscle amp Fitness 2008rdquo[4] H PiotrowskaMKucinska andMMurias ldquoBiological activity

of piceatannol leaving the shadow of resveratrolrdquo MutationResearch - Reviews in Mutation Research vol 750 no 1 pp 60ndash82 2012

[5] U Svajger and M Jeras ldquoAnti-inflammatory effects of resver-atrol and its potential use in therapy of immune-mediateddiseasesrdquo International Reviews of Immunology vol 31 no 3 pp202ndash222 2012

[6] Y-Z Mei R-X Liu D-P Wang X Wang and C-C DaildquoBiocatalysis and biotransformation of resveratrol in microor-ganismsrdquo Biotechnology Letters vol 37 no 1 pp 9ndash18 2015

[7] K O Kim H Park and H-S Kim ldquoEffects of high-protein dietandor resveratrol supplementation on the immune response ofirradiated ratsrdquo Preventive Nutrition and Food Science vol 19no 3 pp 156ndash163 2014

[8] C Zhang Y Tian F Yan et al ldquoModulation of growthand immunity by dietary supplementation with resveratrol inyoung chickens receiving conventional vaccinationsrdquoAmericanJournal of Veterinary Research vol 75 no 8 pp 752ndash759 2014

[9] X Zhao J Xu X Song et al ldquoAntiviral effect of resveratrol inducklings infected with virulent duck enteritis virusrdquo AntiviralResearch vol 130 pp 93ndash100 2016

[10] J Wei H Ouyang Y Wang et al ldquoCharacterization of ahypertriglyceridemic transgenic miniature pig model express-ing human apolipoprotein CIIIrdquo FEBS Journal vol 279 no 1pp 91ndash99 2012

[11] Q ZhangGWidmer and S Tzipori ldquoApigmodel of the humangastrointestinal tractrdquo Gut Microbes vol 4 no 3 pp 193ndash2002013


[12] L Berg ldquoldquoNutrient requirements of swinerdquo releasedrdquo NationalHog Farmer Expert Blog vol 11 no 1 2012

[13] Y Luo B Wu Li ZH et al ldquoHe QG Survey of classical swinefever immunization status in pigs in large-scale pig farms andoptimization of primary vaccination in pigletsrdquo Chinese Journalof Veterinary Medicine vol 37 no 8 pp 3819ndash3825 2010

[14] W P Huang and X Cheng ldquoThe establishment on immuniza-tion program of piglets aftosa in large-scale pig farmrdquo SichuanAnimal amp Veterinary Sciences vol 10 no 2-9 2012

[15] X Liu Drug evaluation vol 2 Chemical Industry PublishingHouse 2006

[16] B M Bohmer H Salisch B R Paulicks and F X RothldquoEchinacea purpurea as a potential immunostimulatory feedadditive in laying hens and fattening pigs by intermittentapplicationrdquo Livestock Science vol 122 no 1 pp 81ndash85 2009

[17] S T Ahmed M E Hossain G M Kim J A Hwang HJi and C J Yang ldquoEffects of resveratrol and essential oils ongrowth performance immunity digestibility and fecal micro-bial shedding in challenged pigletsrdquo Asian-Australasian Journalof Animal Sciences vol 26 no 5 pp 683ndash690 2013

[18] C Zhang J Luo B Yu J Chen and D Chen ldquoEffects ofresveratrol on lipid metabolism in muscle and adipose tissuesA reevaluation in a pig modelrdquo Journal of Functional Foods vol14 pp 590ndash595 2015

[19] Y Yang and Z He ldquoDiagnosis of clinical liver diseaserdquo ChinaPress of Traditional Chinese Medicine vol 12 pp 98ndash102 2007

[20] B Wang J Sun L Li J Zheng Y Shi and G Le ldquoRegulatoryeffects of resveratrol on glucose metabolism and T-lymphocytesubsets in the development of high-fat diet-induced obesity inC57BL6 micerdquo Food amp Function vol 5 no 7 pp 1452ndash14632014

[21] P Bostik F Villinger A A Ansari and T M Folks ldquoPre-infection CD4+CD8+ ratio and HIV infectionrdquo Trends inImmunology vol 18 no 11 pp 555-556 1997

[22] Y Ding W Liao X-J He and W Xiang ldquoEffects of125(OH)2D3 and vitamin D receptor on peripheral CD4+CD8+ double-positive T lymphocytes in a mouse model of sys-temic lupus erythematosusrdquo Journal of Cellular and MolecularMedicine vol 21 no 5 pp 975ndash985 2017

[23] W Yin-wei W Jian-fang and L Min ldquoInvestigat ion of normalvalue in absolute count of peripheral blood T lymphocytesubsets in healthy Chinese adultsrdquo Clinical Focus vol 19 no 4pp 187-188 2004

[24] J Lastrsquoovicka M Rataj and J Bartunkova ldquoAssessment oflymphocyte proliferation for diagnostic purpose Comparisonof CFSE staining Ki-67 expression and 3H-thymidine incorpo-rationrdquoHuman Immunology vol 77 no 12 pp 1215ndash1222 2016

[25] S J Zunino and D H Storms ldquoResveratrol alters proliferativeresponses and apoptosis in human activated B lymphocytes invitrordquo Journal of Nutrition vol 139 no 8 pp 1603ndash1608 2009

[26] X Lai Q Pei X Song et al ldquoThe enhancement of immunefunction and activation of NF-120581B by resveratrol-treatment inimmunosuppressive micerdquo International Immunopharmacol-ogy vol 33 pp 42ndash47 2016

[27] Y Chen D Wang Y Hu et al ldquoAstragalus polysaccharide andoxymatrine can synergistically improve the immune efficacy ofNewcastle disease vaccine in chickenrdquo International Journal ofBiological Macromolecules vol 46 no 4 pp 425ndash428 2010

[28] A Ma W Shi X Niu M Wang and X Zhong ldquoEffects ofEchinacea purpurea extract on the immunological responseto infectious bursal disease vaccine in broilersrdquo Frontiers ofAgriculture in China vol 3 no 4 pp 452ndash456 2009

[29] H Najafzadeh M Ghorbanpour M Mayahi and H GavzanldquoEffect of Echinacea purpurea on antibody production againstfowl influenza vaccinerdquo Journal of Applied Animal Research vol39 no 2 pp 139ndash141 2011

[30] S Edwards A Fukusho P-C Lefevre et al ldquoClassical swinefeverThe global situationrdquoVeterinary Microbiology vol 73 no2-3 pp 103ndash119 2000

[31] B Domınguez M Noia J Leiro and J Lamas ldquoRegulationby resveratrol of turbot inflammatory response induced byvaccinesrdquo Fish and Shellfish Immunology vol 34 no 6 pp 1704-1704 2013

[32] C-C Wu Y-S Huang J-S Chen et al ldquoResveratrol amelio-rates renal damage Increases expression of heme oxygenase-1and has anti-Complement Anti-Oxidative and Anti-Apoptoticeffects in a murine model of membranous nephropathyrdquo PLoSONE vol 10 no 5 Article ID e0125726 2015

[33] C A De La Lastra and I Villegas ldquoResveratrol as an antioxidantand pro-oxidant agent mechanisms and clinical implicationsrdquoBiochemical Society Transactions vol 35 no 5 pp 1156ndash11602007

[34] M Dave M Attur G Palmer et al ldquoThe antioxidant resver-atrol protects against chondrocyte apoptosis via effects onmitochondrial polarization and ATP productionrdquo Arthritis ampRheumatology vol 58 no 9 pp 2786ndash2797 2008

[35] M Mokni S Elkahoui F Limam M Amri and E AouanildquoEffect of resveratrol on antioxidant enzyme activities in thebrain of healthy ratrdquo Neurochemical Research vol 32 no 6 pp981ndash987 2007

[36] P Palsamy and S Subramanian ldquoAmeliorative potentialof resveratrol on proinflammatory cytokines hyperglycemiamediated oxidative stress and pancreatic 120573-cell dysfunction instreptozotocin-nicotinamide-induced diabetic ratsrdquo Journal ofCellular Physiology vol 224 no 2 pp 423ndash432 2010

[37] D Sagheri J Mcloughlin and J J Clarkson ldquoResveratrol mod-ulates cytokine-induced JakSTAT activation more efficientlythan 5-aminosalicylic acid an in vitro approachrdquo Plos One vol9 no 10 Article ID e109048 2014

[38] A Rizzo N Bevilacqua L Guida M Annunziata C RomanoCarratelli and R Paolillo ldquoEffect of resveratrol andmodulationof cytokine production on human periodontal ligament cellsrdquoCytokine vol 60 no 1 pp 197ndash204 2012

[39] H Ghanim C L Sia K Korzeniewski et al ldquoA resveratrol andpolyphenol preparation suppresses oxidative and inflammatorystress response to a high-fat high-carbohydrate mealrdquo TheJournal of Clinical Endocrinology amp Metabolism vol 96 no 5pp 1409ndash1414 2011

[40] X F Kong H J Liu F G Yin Y L Yin and B O Mei-JuanldquoEffects of acanthopanacis senticosi extract as dietary additiveon routine blood and antioxidant parameters inweaned pigletsrdquoNatural Product Research amp Development vol 21 no 3 Article404 2009







Editorial Board










Contents












































1 Introduction

























(3)









times 100(4)














(5)

3 Results


























Aminoacid

Aminoacidatom








2000 4000 6000 8000 100000Time (ps)

0

005

01

015

02

025

03

RMSD

(nm

)



0

01

02

03

04

05

RMSF

(nm

)

1000 2000 3000 4000 5000 6000 7000 80000Number of atoms




Pote

ntia

l energ

y

Time (ps)


(kJ

mol

)







Gly436

Thr310

Arg145

Ile132 Cys437

Arg115

Asp309

Met374

Met375

Phe134









Aminoacid

Aminoacid atom






Gly218Ile219 Gly220





2000 4000 6000 8000 100000Time (ps)

005

115

225

335

445

Num

ber



0

2

4

6

8

10

12

Num

ber

2000 4000 6000 8000 100000Time (ps)


4 Discussion






2000 4000 6000 8000 100000Time (ps)

0

005

01

015

02

025

RMSD

(nm

)


1000 2000 3000 4000 5000 60000Number of atoms

0

005

01

015

02

025

RMSF

(nm

)



0 2000 4000 6000 8000 10000

Time (ps)

minus533000

minus543000

minus553000

minus563000

Pote

ntia

l energ

y (k

Jm

ol)







Lys120

Gln262

Ser216

Asp181

Arg221

Gln226

Cys215

Arg221




Data Availability






Acknowledgments





0

05

1

15

2

25

3

35

Num

ber

2000 4000 6000 8000 100000Time (ps)




0

2

4

6

8

10

12

Num

ber

2000 4000 6000 8000 100000Time (ps)




minus100minus120

Bind

ing

energy

(kJ

mol

)

0 2000 4000 6000 8000 10000

Time (ps)



0 2000 4000 6000 8000 10000

Time (ps)0


minus100

Bind

ing

energy

(kJ

mol

)



References






















































































1 Introduction



















































3 Results











(min) Sample



Flavonoid 336 Pulp


Endocarp



PeelPulp







(mgL)Reduction ()



05 1 2 4 80

20

40

60

80

100

(mgmL)

lowast

lowast lowastlowast

lowast

lowast

lowast

lowast lowast

lowast

lowast

lowast

lowastlowast

lowast

PulpPeel

EndocarpTrolox

lowastD

PPH

inhi

bitio

n (

)

(a)

PulpPeel

EndocarpTrolox

05 1 2 4 80

20

40

60

80

100

(mgmL)

lowastlowast lowast

lowast

lowast

lowastlowastlowast

lowastlowast

lowast

lowastlowast

lowastlowast

lowast

inhi

bitio

n (

)A

BTS+

(b)

PulpPeel

EndocarpTrolox

05 1 2 4 80

1

2

3

(mgmL)

lowast lowast

lowast lowastlowast

lowastlowast

lowastlowast

lowast

lowast lowast

lowast

lowast

lowastlowast

(absorbance)

Redu

cing

pot

entia

l(Fe

+F

e+)

(c)

PulpPeel

EndocarpTrolox

05 1 2 4 80

20

40

60

80

100

lowast

lowast

lowast

lowast

lowast

lowast

lowast

lowast

lowast

lowast

lowast

lowastlowast

lowast lowast

(mgmL)

lowast

TBA

RS in

hibi

tion

()

(d)

PulpPeel

EndocarpTrolox

05 1 2 4 80

20

40

60

80

100

(mgmL)

lowastlowast

lowastlowast

lowast

lowast

lowast


lowastlowast

lowast

lowastlowast

lowast

Nitr

ite co

nten

t inh

ibiti

on (

)

(e)
























05 1 2 4 8(mgmL)

lowast

lowastlowast

lowast

lowast

lowast

lowast lowast

lowast

lowastlowast

lowast

lowast

lowastlowast

lowast

TroloxPulpPeel

Endocarp

0

20

40

60

80

Inhi

bitio

n of

oxi

dativ

ehe

mol

ysis

()




4 Discussion



















5 Conclusions



Data Availability




Acknowledgments


References
















































































1 Introduction





























(a) (b)


supplement (b)



3 Results


50)


50values of








(a) (b) (c)

(d) (e) (f)



4 Discussion




















5 Conclusion


Data Availability




Acknowledgments


References






















































1 Introduction


































3 Results








Age (years)lt40 30 536ge40 26 464


Yes 19 731b

No 7 269b


0 7 269b

1 4 154b

2 3 115b

ge3 12 462b





























4 Discussion































2 1




















Item



Potential harms



4 3 5 2 5 2 6 3


5 2 4 3 4 3 4 2

Potential benefits






















5 Conclusion








References






































































1 Introduction





























300

200

100

21 40 60 80 100 120 140 160 180

Time (min)

Abso

rban

ce (m

AU)

minus20

1 2








Cell

pro

lifer

atio

n (

)

0 50 100 200 4000

50

100

150

B B B A A

GLE (gmL)






0 50

100 200 400

GLE (gmL)

GLE (gmL)

(a)

Lipi

d co

nten

t (

cont

rol)

0 50 100 200 4000

20

40

60

80

100

120

A AB

C

D

GLE (gmL)

(b)








(Weeks)

Body

wei

ght (

g)

0 2 4 6 820

24

28

32

36

40

CHFD


(a)

C

A

B

C

00

02

04

06

08

10

CHFD


Feed

effici

ency

ratio

(b)

B

AA

B

0

10

20

30

40

50

CHFD


Fat p

ad w

eigh

t (g10

0Ａ

BW)

(c)





-actin

PPAR

CEBP

SREBP-1c

aP2

Leptin

FAS

C HFD

HFD

+ 1

G

LE

HFD

+ 5

G

LE

(a)PP

AR

()

0

50

100

150

200

250

D

A

B

C


(b)

D

A

B

C

CEB

P (

)

0

100

200

300

400


(c)

C

A B

C

SREB

P-1c

()

0

50

100

150

200


(d)

B

A

B

C

aP2

()

0

50

100

150


(e)

C

AB

D

Lept

in (

)

0

50

100

150

200


(f)

C

A

B

D

FAS

()

0

50

100

150

200

250


(g)






C HFD

HFD

+ 1

G

LE

HFD

+ 5

G

LE

-actin

PPAR

CEBP

SREBP-1c

aP2

Leptin

FAS

(a)

0

50

100

150

200

B

A

B

C

PPA

R (

)


(b)

D

A

B

C

0

100

200

300

CEB

P (

)


(c)

C

AB

C

0

50

100

150

200

250

SREB

P-1c

()


(d)

B

A

BC

0

50

100

150

200

aP2

()


(e)

C

A

B B

0

50

100

150

200Le

ptin

()


(f)

C

A

B

C

0

50

100

150

200

FAS

()


(g)


4 Conclusion


Abbreviations



protein-1c



Acknowledgments




References















































1 Introduction













3 Results






Sex 099Female 4723 5533 4723 5533Male 3813 4467 3813 4467








000

005

010

015

020

025

030

Cum

ulat

ive i

ncid

ence

of c

alcu

lus s

urgi

cal t

reat

men

t

2 4 6 8 10 120Time (years)







Variables


















4 Discussion










Time (years)0 2 4 6 8 10 12


00

01

02

03

04

Cum

ulat

ive i

ncid

ence

of c

alcu

lus s

urgi

cal t

reat

men

t






5 Conclusions






Acknowledgments


References















































1 Introduction































3 Results






lowastlowast

0

1

2

3O

D 4

50


(a)

lowastlowast

lowastlowast


0

1

2

3

OD

450

(b)


7 d14 d


lowastlowast

lowast lowast


00

02

04

06

08

Ant

ibod

y le

vel

(a)

7 d

lowast

lowastlowast lowast

00

02

04

06

08

Ant

ibod

y le

vel


(b)







7 d14 d



lowast

0

50

100

150

200

250(

gm

l)

(a)

7 d14 d



lowast

0

20

40

60

80

100

(g

ml)

(b)

7 d14 d



lowastlowast

0

20

40

60

80

100

(g

ml)

(c)






4 Discussion



7 d14 d


lowastlowast


lowastlowast

lowastlowast

0

5

10

15(U

ml)

(a)

7 d14 d


2

4

6

8

(nm

olm

l)

(b)

7 d14 d



lowastlowast

0

20

40

60

80

100

(Um

l)

(c)












7 d14 d


lowastlowast

lowast

lowast

0

1000

2000

3000

4000

5000IF

N-

(pg

ml)

(a)

7 d14 d


lowastlowast

lowastlowastlowast

0

20

40

60

80

TNF-

(p

gm

l)

(b)

7 d14 d


lowastlowast

0

100

200

300

400

IL-2

(pg

ml)

(c)

0

10

20

30

40

50

IL-4

(pg

ml)

7 d14 d


(d)

lowast

0

50

100

150

IL-1

0 (p

gm

l)

7 d14 d


(e)

lowastlowast

0

50

100

150

IL-1

2 (p

gm

l)

7 d14 d


(f)


















5 Conclusion






Acknowledgments


References
















































Contents












































1 Introduction

























(3)









times 100(4)














(5)

3 Results


























Aminoacid

Aminoacidatom








2000 4000 6000 8000 100000Time (ps)

0

005

01

015

02

025

03

RMSD

(nm

)



0

01

02

03

04

05

RMSF

(nm

)

1000 2000 3000 4000 5000 6000 7000 80000Number of atoms




Pote

ntia

l energ

y

Time (ps)


(kJ

mol

)







Gly436

Thr310

Arg145

Ile132 Cys437

Arg115

Asp309

Met374

Met375

Phe134









Aminoacid

Aminoacid atom






Gly218Ile219 Gly220





2000 4000 6000 8000 100000Time (ps)

005

115

225

335

445

Num

ber



0

2

4

6

8

10

12

Num

ber

2000 4000 6000 8000 100000Time (ps)


4 Discussion






2000 4000 6000 8000 100000Time (ps)

0

005

01

015

02

025

RMSD

(nm

)


1000 2000 3000 4000 5000 60000Number of atoms

0

005

01

015

02

025

RMSF

(nm

)



0 2000 4000 6000 8000 10000

Time (ps)

minus533000

minus543000

minus553000

minus563000

Pote

ntia

l energ

y (k

Jm

ol)







Lys120

Gln262

Ser216

Asp181

Arg221

Gln226

Cys215

Arg221




Data Availability






Acknowledgments





0

05

1

15

2

25

3

35

Num

ber

2000 4000 6000 8000 100000Time (ps)




0

2

4

6

8

10

12

Num

ber

2000 4000 6000 8000 100000Time (ps)




minus100minus120

Bind

ing

energy

(kJ

mol

)

0 2000 4000 6000 8000 10000

Time (ps)



0 2000 4000 6000 8000 10000

Time (ps)0


minus100

Bind

ing

energy

(kJ

mol

)



References






















































































1 Introduction



















































3 Results











(min) Sample



Flavonoid 336 Pulp


Endocarp



PeelPulp







(mgL)Reduction ()



05 1 2 4 80

20

40

60

80

100

(mgmL)

lowast

lowast lowastlowast

lowast

lowast

lowast

lowast lowast

lowast

lowast

lowast

lowastlowast

lowast

PulpPeel

EndocarpTrolox

lowastD

PPH

inhi

bitio

n (

)

(a)

PulpPeel

EndocarpTrolox

05 1 2 4 80

20

40

60

80

100

(mgmL)

lowastlowast lowast

lowast

lowast

lowastlowastlowast

lowastlowast

lowast

lowastlowast

lowastlowast

lowast

inhi

bitio

n (

)A

BTS+

(b)

PulpPeel

EndocarpTrolox

05 1 2 4 80

1

2

3

(mgmL)

lowast lowast

lowast lowastlowast

lowastlowast

lowastlowast

lowast

lowast lowast

lowast

lowast

lowastlowast

(absorbance)

Redu

cing

pot

entia

l(Fe

+F

e+)

(c)

PulpPeel

EndocarpTrolox

05 1 2 4 80

20

40

60

80

100

lowast

lowast

lowast

lowast

lowast

lowast

lowast

lowast

lowast

lowast

lowast

lowastlowast

lowast lowast

(mgmL)

lowast

TBA

RS in

hibi

tion

()

(d)

PulpPeel

EndocarpTrolox

05 1 2 4 80

20

40

60

80

100

(mgmL)

lowastlowast

lowastlowast

lowast

lowast

lowast


lowastlowast

lowast

lowastlowast

lowast

Nitr

ite co

nten

t inh

ibiti

on (

)

(e)
























05 1 2 4 8(mgmL)

lowast

lowastlowast

lowast

lowast

lowast

lowast lowast

lowast

lowastlowast

lowast

lowast

lowastlowast

lowast

TroloxPulpPeel

Endocarp

0

20

40

60

80

Inhi

bitio

n of

oxi

dativ

ehe

mol

ysis

()




4 Discussion



















5 Conclusions



Data Availability




Acknowledgments


References
















































































1 Introduction





























(a) (b)


supplement (b)



3 Results


50)


50values of








(a) (b) (c)

(d) (e) (f)



4 Discussion




















5 Conclusion


Data Availability




Acknowledgments


References






















































1 Introduction


































3 Results








Age (years)lt40 30 536ge40 26 464


Yes 19 731b

No 7 269b


0 7 269b

1 4 154b

2 3 115b

ge3 12 462b





























4 Discussion































2 1




















Item



Potential harms



4 3 5 2 5 2 6 3


5 2 4 3 4 3 4 2

Potential benefits






















5 Conclusion








References






































































1 Introduction





























300

200

100

21 40 60 80 100 120 140 160 180

Time (min)

Abso

rban

ce (m

AU)

minus20

1 2








Cell

pro

lifer

atio

n (

)

0 50 100 200 4000

50

100

150

B B B A A

GLE (gmL)






0 50

100 200 400

GLE (gmL)

GLE (gmL)

(a)

Lipi

d co

nten

t (

cont

rol)

0 50 100 200 4000

20

40

60

80

100

120

A AB

C

D

GLE (gmL)

(b)








(Weeks)

Body

wei

ght (

g)

0 2 4 6 820

24

28

32

36

40

CHFD


(a)

C

A

B

C

00

02

04

06

08

10

CHFD


Feed

effici

ency

ratio

(b)

B

AA

B

0

10

20

30

40

50

CHFD


Fat p

ad w

eigh

t (g10

0Ａ

BW)

(c)





-actin

PPAR

CEBP

SREBP-1c

aP2

Leptin

FAS

C HFD

HFD

+ 1

G

LE

HFD

+ 5

G

LE

(a)PP

AR

()

0

50

100

150

200

250

D

A

B

C


(b)

D

A

B

C

CEB

P (

)

0

100

200

300

400


(c)

C

A B

C

SREB

P-1c

()

0

50

100

150

200


(d)

B

A

B

C

aP2

()

0

50

100

150


(e)

C

AB

D

Lept

in (

)

0

50

100

150

200


(f)

C

A

B

D

FAS

()

0

50

100

150

200

250


(g)






C HFD

HFD

+ 1

G

LE

HFD

+ 5

G

LE

-actin

PPAR

CEBP

SREBP-1c

aP2

Leptin

FAS

(a)

0

50

100

150

200

B

A

B

C

PPA

R (

)


(b)

D

A

B

C

0

100

200

300

CEB

P (

)


(c)

C

AB

C

0

50

100

150

200

250

SREB

P-1c

()


(d)

B

A

BC

0

50

100

150

200

aP2

()


(e)

C

A

B B

0

50

100

150

200Le

ptin

()


(f)

C

A

B

C

0

50

100

150

200

FAS

()


(g)


4 Conclusion


Abbreviations



protein-1c



Acknowledgments




References















































1 Introduction













3 Results






Sex 099Female 4723 5533 4723 5533Male 3813 4467 3813 4467








000

005

010

015

020

025

030

Cum

ulat

ive i

ncid

ence

of c

alcu

lus s

urgi

cal t

reat

men

t

2 4 6 8 10 120Time (years)







Variables


















4 Discussion










Time (years)0 2 4 6 8 10 12


00

01

02

03

04

Cum

ulat

ive i

ncid

ence

of c

alcu

lus s

urgi

cal t

reat

men

t






5 Conclusions






Acknowledgments


References















































1 Introduction































3 Results






lowastlowast

0

1

2

3O

D 4

50


(a)

lowastlowast

lowastlowast


0

1

2

3

OD

450

(b)


7 d14 d


lowastlowast

lowast lowast


00

02

04

06

08

Ant

ibod

y le

vel

(a)

7 d

lowast

lowastlowast lowast

00

02

04

06

08

Ant

ibod

y le

vel


(b)







7 d14 d



lowast

0

50

100

150

200

250(

gm

l)

(a)

7 d14 d



lowast

0

20

40

60

80

100

(g

ml)

(b)

7 d14 d



lowastlowast

0

20

40

60

80

100

(g

ml)

(c)






4 Discussion



7 d14 d


lowastlowast


lowastlowast

lowastlowast

0

5

10

15(U

ml)

(a)

7 d14 d


2

4

6

8

(nm

olm

l)

(b)

7 d14 d



lowastlowast

0

20

40

60

80

100

(Um

l)

(c)












7 d14 d


lowastlowast

lowast

lowast

0

1000

2000

3000

4000

5000IF

N-

(pg

ml)

(a)

7 d14 d


lowastlowast

lowastlowastlowast

0

20

40

60

80

TNF-

(p

gm

l)

(b)

7 d14 d


lowastlowast

0

100

200

300

400

IL-2

(pg

ml)

(c)

0

10

20

30

40

50

IL-4

(pg

ml)

7 d14 d


(d)

lowast

0

50

100

150

IL-1

0 (p

gm

l)

7 d14 d


(e)

lowastlowast

0

50

100

150

IL-1

2 (p

gm

l)

7 d14 d


(f)


















5 Conclusion






Acknowledgments


References










































natural foods from plant sources in preventing

Documents