neoz cordless lighting. - important bagatelles€¦ · hehe hilhitontot - mancheestes banyan treee...
TRANSCRIPT
N Wally YacYacYacYachtshts TTTTTT Thhehehehehehe FFFFFoFFour Sr Sease onso HoHoteltel - EgyEgyEgyEgygygygyyptptpttptpt ptpt p VViVirVViVirVirVirVirVir iigingingingingin AAtAt At Atlanananlanlananllannticticticicicicticcct ClClClCl ClClCl Cl CClC ubhubuubuuuububu ousouse -e - Ho HoHoHoHooHoong ngngnn Kong Conrrrn an’an’ananananaa s Is Iconco ic c ResRResRR taut rant - Tokyoky Royal Albert Ht all - LonLondondonondondonon AAArtAArtArtArt G GaG lleery of NNNN
oSheeratratratratatononononon on FijFijFijFijFijFiji Ri RRi Ri Ri Resoort t AAAAAA AAmmamamanmmananmannyyaryaryarya a Ra Ra Ra Resoesoeesortrtrt rt tt - T- Turkurkkkssss &s &ss Ca Caicocos Is Islasland nd MGMGM GrGrGr G andndndddannanddd MMMMaMaMa MaMaMMMa Ma Ma MaMMMaMaMa M M caucaucauauccccaccacaac Ja Jazz zz zzz on on onooooooo LinLLininnnnncolcolcolcolcolccoocolnnn Cn Cnn enter - New York k HHHHHHH Huvuvauvauvauvauvauvauvafffenfenfenfeefen Fu Fu Fu FuFuuF shshishis Resort -t - Ma MaaaMaaaldldldldiddldildid ves Ha Haymayman In Islasland nd ResRessooooo
WMaMandandaandanddaarinrinrinnrinrinrin OOrOrOrOr Oriiienieniienent - B- erlrlinin B BB BBBBocaoca Ra RaRaRaaaaattontonton ReResorsort & Club - Florida One & OnOnOnOnlylylylylyly ly ly PPalPallPPPalP lmilmilmillalla la - M- MMexiex co co TheTTTT Peninninnnnnnnsulss a Ha Ha Ha aa oteotel -l HoHoHooHooooonngngngng nnnn KonK g g G GGGGGGrrarararanra d Resort Laggonionississi - - AthAthensensnsss The W
hehe HilHilHilHilHilHi tontott - Mancheestes Banyan TreTreee Re Re esoesoses rt t P- PPhukhukhukkkhukkkeetet e LLLa La LL ResR erve - GeGeneva TTTThehehehehhehe he PlaPlaPlaPlaPlaPlaPlaPlazzza HotHotel l - N- New ew YorYorYorYorYororrrkkkkkkkk SkSkSkSkSk SSkS Sketcetcetctcetcetcetctcetcee ch Rh RRh Rh Rh Rh Rh Rh hhhh esesteste auaurantnt - --- -- LonLonLononLL doonnnn B Bulgagariri HotHoteel elelel llel ee && RResoesooosoortrttrrtrt t - B- B- B- B- B Balialialialiaalialiaali AAAm Am Amankankora Resort - Bhutan
Interterconcontintinententntntttalalalal alal GrGrananndndndann Hy Hyyatatatattattatatttat - TokTokyo yo TheTheTheTheTheTheTheThehhh RRiiRiRiRRiRiR Ritz HotHotel el - L- Londonddndndnddononononononon on Penfold’s Magilll El Estastaatetete tetete te - AAdelelaidaidddeee e eee e ee ee RRaffl ffl es HoHoteltel - - SinSingapg oreore Juumeimeiemeirahrahhrahrarahahh BeBeBeBBeBe Be BeB achachachachachachaachac HoH tel - DubDubDubububububbaiaiai CroCroCroCroCroCroowwnwnewnewnewne
DoDorchrchrchrchhesteste er HotHotel el W Wynnynnnnnnynnnnnn LaLaLaLaaLa LaaLas Vs Vs Vegagas Hs Hoteotel al aaandndndndnd nnd ndd CCaCaCasCasCasCCasiinon CrCrysty al Cruises BBBurjurjurjrururjrjurju j AlAlAlAAlA AlAl AAAAr ArArAAAA abab - D- Dubaubai i BMW W WelWellt -t -t -t -t -t -t -t Mu MM MM nicich h Sanandy dy LaLanLanLanananane He Hoteotelllll - Barbados Banyan TTreereee ReReReRe ReReesorsorsorosorsorsorttttttt
‘Ic‘Ice Squaquauaauarererere rerre 1001011 ’ specifi fied ed forfor Le Les Os Os OOOOOOs Ombrmmbmmm es ResResResesRessesResesestautautauauautautautautautauranranrarant, t, QuaQuai B Branranranly lyly yyyy MusMusMusMusMusMuMusMusususM eumeueumeumeumeueumeumeumm PPPPaP Paris by by by arca hithitectect Je Jean an Nouvelv of Francance, e, P iPri ktzker ArcArchithitittectectectectectctctttureureureureureureureureure PPPPrPrPPrPrPr Priiizeize Laureate 2008
Phooto by byy JacJacJacJJacacJacacacckiekiekiekiekiekiekieiee Ch Ch CC an
NEOZ Cordless Lighting.Be seen in the best Light.
Designed and assembled in Sydney Australia for the World’s Best Hotels & Restaurants
‘Creating the fi nest ambience for the Worlds Best Hotels and Restaurants’
Ice Square 100 at Les Ombres RestaurantQuai Branly Museum Paris, architect Jean Nouvel
Page 2 Page 3
FrFrFFFrommmmmmmmm ‘‘‘‘ ThThThhT e eee RiRiRitztztz HH Hotototooo elelel’ ’ innnin L Loondon to ‘‘HuHuvafefeeennn nn FFuFuuF shshi’’’ inininin thhhheeeehe M MMMMalalalalddid vees,s, NNeoeoz zz CoCordlel ss Ligghth inng gg enennsusussusures syoyoyoyoyoyoyourururrurr e eeestststttabababablishmementnt is s seen in the e bestt l lligighthtthtt.
CrCrCrCrCrrCC eaeaeeaeaeateteteteteedd dd dd bybybb o our LLigghtth ining g DeDeDeD sisisigngngng erers,s,s,, N Neooeoz z CoCoorddrddlellesssssssss LLiLiiLiLiLighghghghghghg titititititingngnggngn iiiis s rer chhc arrgegeabablele, didiidimmmmmmmabababableleee, sasaaafefefefe, and dprprprprp ovovovvidididdddeeseses u uuuup p p tototo twewentn y y titimemes thhhe eee brbrbrrigigighththth nenenenesssssss o oooffff aa cacacacacandndndndndlelelelele uuu sisisingngggg a a HHala ogogo enen b bululb b - - ththe ee sususupepepeririir ororooo l ligightththt sossosos ururu cecece wwititth h peeppp rfrfecect t cocololourur r renendedeeriringngggg fffororor dddefiefiefi n nininng g sksskininin t tononnes, foooddd c cololouourss a aandndndd tt texexextutuurereres;s; o oor rr ththe e LELED DDbubulblb optp ion n fof r mam ximum mmm lililighghhtt titimememe a a andndn e effi ffi c cieencncn y.y
ToTo g guauarranteeee performance nightht aaaftftereree nnigiggighthththt, yeyearar aaffter year Neoz Cordless LaLaampmpmpm s ss ususususe e e ononononlylyylyy t t tthehehehe hihighhest quuala ity coompmpmpponononenenentstststs ww wwitititithhhh upupupu t ttto o o ththththrereee e e yeyeyeearararrs sswawawarranntytyty i i incncncnclululul dididingngngn tt tthehehehe w wwworororo ldldldd’s’s b bbesese t t LiLiththt iuiuum-m-m iionon rechargeeeabbleele bbbbatatatatteteteteriririeseseses...
AAlAlAlsososoo d ddd esesesesigiggignenened d d fofoforr r thththe ee hohohoh mememme u uuseseer r theeessese ppporororrrrtatataaablbblble elululumimiinananaairirrireseses a a allllllowowoww c c comomomompllplp etete freeeee ddoom mm aanandd fl flflflexeeexexe ibibbbilililitti yy y – ththheyeyeyey c cc ananan b b bbe e e usususedededed tt to o ilililluluu iiminaaaanatete aaan n oououtdtdoooooooo r r sesseseetttttiniingfofofofor r r upupup t t to oo 26262660 0 0 0 hohohooururururu s*s*s*s* a aa c ccchahhargrgggeee orrrororor aaaaa asss sss cocccococ rdrddrdr ededededded ll lamamamamaampsppsp tooto cc c cononononseseservrvrve ee bababattttttttererery y y y enenenenererergygygygy wwwwheheheh n n nen ara a poweerere sosoouruurcececece...
FeFeFeatataturururu inining gg g dididimmmmmmmmininiing gg g asasasa w w welelell ll asss ttheheh canandllldle momoddeded , , aall atata t thehee t ttououo chchch oo off f a a a bubububuutttttttononn,, thththe e NENENEEOZOZZ C CCorordldlesesss lalaampmpleleetststs y yyyouou c ccrerereatatate e e ananna inntntimimata e e atatmomom spphehererere i iin nn yoyoy uur hohohoh memememe, , inininsissidedede a aaandnddn outtut.
LiLighghg titingngg D DDesese igiggnenersrsrss s ssinini ceceec 1 1989883,3,33, a aandndd p pioiooneneerers soffof C Corordldld esess s LiLL ghghtititinggngg s s sinininncecee 1 19999995,5, NN NNNeoeoeoz zzz hahas srererecececeivivivededede ssevevereralal A AAususu trralaliaiaiaan nn DeDeDeesisisiigngnggn A A Awawawaardrds s annnannd dththhe e ininteteernrnatata ioioonanal ‘rredded ddototo ddd deseesesiggiggn awawawararrd’d’d’d’ f fforororror t t t hhhihis s ououutststatanddn inining gg prprododo ucuct t t rarangngn e.e.e
* * hohoururs s babasesed d onono L Lowow ssetettitingng ( (PrPrroo babattttere y)y) w witith h LELED D bubulblb
Quality Assurance Made from the world’s best quality materials & components, under warranty for up to 3 years.
True Colour Rendering Beautiful light diff usion with halogen light bulb, the best light source for true colour rendering of skin tones, food colours and textures.
Remarkable Performance High capacity, long life, Li-ion rechargeable batteries combined with the LED bulb option gives up to 260 hours of light time on a single charge.
Easy Charging and Operation Unique charging on a dedicated base station with red and green charge status indicator, showing when the lamps are fully charged.
Fuel Gauge Base of each lamp shows battery charge level.
Eco Friendly All parts designed to be replaceable, serviceable and recyclable. ‘Green’ Li-ion battery & RoHS Compliant.
Cost and Energy Saving 1 Lamp = over 1000 Candles per yearAround 2 cents per day of electrical energy to charge and eliminates hardwiring costs.
Brighter Refl ected light 20 times brighter than a candle to read menus clearly.
Dimmable 3 dimming levels for a beautiful light ambience
Candle Eff ect A safer option without fl ame, smoke or odour that will not blow out in windy conditions.
Page 4 Page 5
Cordless Lighting Features and Benefi ts‘Ritz’ - The Ritz, Piccadilly London
Photo by Jackie Chan
Page 6 Page 7
Cordless Lighting Glass Series
Egg
Rechargeable battery table lamp with hand blown frosted glass diff user providing soft ambient light.
Margarita
Rechargeable battery table lamp with hand blown assymetric frosted glass diff user on stainless steel base providing soft ambient light.
Egg Fritted
Rechargeable battery table lamp with hand blown fritted glass diff user providing soft ambient light.
Little Margarita
Rechargeable battery table lamp with hand blown assymetric frosted glass diff user providing soft ambient light.
Saffron
Red
Aqua
Opal
‘Egg’ - Restaurant Vinkeles, The Dylan AmsterdamPhoto by Roel Ruijs
Page 8 Page 9
Cordless Lighting Glass Series
Ice Square 100
Rechargeable battery table lamp with pressed frosted glass diff user providing soft ambient light.
Ice Round 100
Rechargeable battery table lamp with pressed frosted glass diff user providing soft ambient light.
Ice Square 85
Rechargeable battery table lamp with pressed frosted glass diff user providing soft ambient light.
Ice Round 85
Rechargeable battery table lamp with pressed frosted glass diff user providing soft ambient light.
‘Ice Round 100’ - Universal Restaurant, SydneyPhoto courtesy of Universal
Page 10 Page 11
Cordless Lighting Polymer Series
Collins
Rechargeable battery table lamp with brushed stainless steel base and top with opal diff user providing soft ambient light.
Gem Square
Rechargeable battery table lamp with injection molded Plexiglas® diff user provides soft ambient light
Little Collins
Rechargeable battery table lamp with brushed stainless steel top with opal acrylic diff usor providing soft ambient side and downlight.
Gem Round
Rechargeable battery table lamp with injection molded Plexiglas® diff user provides soft ambient light
Amber
Ruby
Sapphire
Opal
Amber
Ruby
Sapphire
Opal
‘Gem Square Ruby’ - Fairmont Beijing, ChinaPhoto courtesy of Fairmont Hotels
Page 12 Page 13
Cordless Lighting Metal Series
Owl 1
Rechargeable battery table lamp with dome refl ector giving maximum direct downlight without glare. Ideal for table lighting rooms with views through glass as there is minimum refl ection.
Owl 3
Rechargeable battery table lamp with internally ribbed conical diff user providing soft ambient light.
Owl 2
Rechargeable battery table lamp cylindrical opal diff user and top plate providing soft ambient side and downlight.
Owl 1 Tall
Rechargeable battery table lamp with dome refl ector giving maximum direct downlight without glare. Increased height provides wider surface illumination. Ideal for table lighting rooms with views through glass as there is minimum refl ection.
S/Steel
Brass
Copper
Black
White
Antique Bronze
S/Steel
Brass
Copper
Black
White
Antique Bronze
S/Steel
Brass
Copper
Black
White
Antique Bronze
S/Steel
Brass
Copper
Black
White
Antique Bronze
Owl 2 Tall
Rechargeable battery table lamp cylindrical opal diff user and top plate providing soft ambient side and downlight. Increased height provides wider direct surface illumination.
Magill
Rechargeable battery table lamp with brush body with part frosted acrylic providing direct downlight and soft ambient side light.
Owl 3 Tall
Rechargeable battery table lamp with internally ribbed conical diff user providing soft ambient light. Increased height provides wider direct surface illumination.
Ritz
Rechargeable battery table lamp with solid brass traditional base and shade providing direct downlight and soft diff used sidelight.
S/Steel
Brass
Copper
Black
White
Antique Bronze
S/Steel
Brass
Copper
Black
White
Antique Bronze
Brass
Nickel
Page 14 Page 15
Cordless Lighting Handmade Resin Series
Gem 1 Resin
Rechargeable battery table lamp with hand-made solid resin diff user provides soft ambient light.
Medusa
Rechargeable battery table lamp with solid resin form encapsulating the refl ector providing glare free soft table lighting.
Gem 2 Resin
Rechargeable battery table lamp with hand-made solid resin diff user provides soft ambient light.
Amber
Ruby
Sapphire
Opal
Amber
Ruby
Sapphire
Opal
‘Medusa’ - Amanyara Resort, Turks & Caicos IslandPhoto by Lloyd Inwards
Page 16 Page 17
Cordless Lighting Specifi cations - Pro and Eco Comparison
5W halogen frosted - standard (4000+ hour life)10W halogen frosted - optional (4000+ hour life)
1.1W LED - optional (50000+ hour life)
Sanyo 2600mAhLi-ion Rechargeable Battery
1000+ full charge cycles & replaceable
4.5 hours
5W halogen frosted - standard (4000+ hour life)10W halogen frosted - optional (4000+ hour life)
1.1W LED - optional (50000+ hour life)
Sanyo 5200mAhLi-ion Rechargeable Battery
1000+ full charge cycles & replaceable
8.5 hours
Charger
Special Light Eff ects
Approvals & Standards
Intellectual Property
Warranty
5W Halogen
11 hours17 hours33 hours
10W Halogen
6 hours9 hours
17 hours
1.1W LED
56 hours104 hours260 hours
FullMediumLow
5W Halogen
-8 hours
14 hours
10W Halogen
---
1.1W LED
28 hours52 hours
130 hours
FullMediumLow
100 - 240V Switch-Mode Electronic Power Supply15W SMPU for max. 1 Lamp, 50W SMPU for max. 5 Lamps, 120W SMPU for max. 12 Lamps
Approved for worldwide usage supplied with appropriate mains electric plug type
Dimmable with 3 brightness levels, Candle mode with 2 brightness levels
CE, CSA, C-Tick, FCC, RoHS Compliant
Neoz V4 Cordless Lamps are covered by Design Registration,Software Copyright, Patents and Patents Pending
NEOZ warrants the V4 range for 36 months from the date of purchase.Please refer to our website for further information - http://www.neoz.com.au/warranty
Light Source
Power Source
Light Time
Charge Time
Cordless Lighting Specifi cations - Lamp Range
175mm x 110mm(7”) x (4½”)
160mm x 85mm(6¼”) x (3½”)
1.64 kg / 3.6 lb
1.24 kg / 2.7 lb
1.04 kg / 2.3 lb
Hand Blown Glass
Hand Blown Glass
Hand Blown glass + Stainless Steel
Hand Blown Glass
1.00 kg / 2.2 lb
1.00 kg / 2.2 lb Aqua, Opal, Saff ron, Red
Clear / Sand Blasted
Clear / Sand Blasted
1.22 kg / 2.7 lb
1.11 kg / 2.5 lb
Injection Moulded Plexiglas
Injection Moulded Plexiglas
1.20 kg / 2.6 lb Amber, Opal, Sapphire, Ruby
Amber, Opal, Sapphire, Ruby
Stainless Steel + Acrylic
Stainless Steel + Acrylic
0.73 kg / 1.6 lb Opal / Brushed Stainless Steel
Polyester Resin1.32 kg / 2.9 lb Amber, Opal, Sapphire, Ruby
1.04 kg / 2.3 lb
Polyester Resin1.48 kg / 3.3 lb Amber, Opal, Sapphire, Ruby
0.63 kg / 1.4 lb Opal / Brushed Stainless Steel
0.55 kg / 1.2 lb
0.55 kg / 1.2 lb
0.60 kg / 1.4 lb
0.60 kg / 1.4 lb
Polished metal orBaked enamel colour
Polished metal orBaked enamel colour
Polished metal orBaked enamel colour
Polished metal orBaked enamel colour
Polished metal orBaked enamel colour
Polished metal orBaked enamel colour
0.58 kg / 1.3 lb
0.58 kg / 1.3 lb
Stainless Steel + Acrylic0.85 kg / 1.9 lb Clear Lens / Brushed Stainless Steel
Polished Brass / Satin Nickel2.0 kg / 4.4 lbBrass - cast,
machined + polished Parchment shade
Stainless Steel /Brass / Copper /
Aluminium (Colour)
Stainless Steel /Brass / Copper /
Aluminium (Colour)
Stainless Steel /Brass / Copper /
Aluminium (Colour)
Stainless Steel /Brass / Copper /
Aluminium (Colour)
Stainless Steel /Brass / Copper /
Aluminium (Colour)
Stainless Steel /Brass / Copper /
Aluminium (Colour)
Polyester Resin1.42 kg / 3.2 lb Clear
175mm x 110mm(7”) x (4½”)
160mm x 85mm(6¼”) x (3½”)
180mm x 120mm(7½”) x (4¾”)
180mm x 120mm(7½”) x (4¾”)
205mm x 100mm(8”) x (4”)
180mm x 100mm(7”) x (4”)
200mm x 95mm(8”) x (3½”)
210mm x 78mm(8¼”) x (3”)
210mm x 90mm(8¼”) x (3½”)
220mm x 95mm(8½”) x (3½”)
175mm x 115mm(7”) x (4½”)
175mm x 110mm(7”) x (4½”)
195mm x 100mm(8”) x (4”)
145mm x 100mm(5¾”) x (4”)
190mm x 78mm(7½”) x (3”)
190mm x 90mm(7½”) x (3½”)
200mm x 100mm(8”) x (4”)
275mm x 125mm x 125mm(11”) x (5”) x (5”)
170mm x 110mm(6¾”) x (4½”)
170mm x 110mm(6¾”) x (4½”)
195mm x 140mm x 120mm(7¾”) x (5½”) x (4¾”)
Press Glass
Press Glass
Press Glass
Press Glass
1.81 kg / 4.0 lb Clear / Sand Blasted
Clear / Sand Blasted
Clear / Sand Blasted
Clear / Sand Blasted
Clear / Sand Blasted
Ice Square 100
Ice Square 85
Ice Round 100
Ice Round 85
Egg Fritted
Gem Square
Little Collins
Owl 3
Owl 3 Tall
Ritz
Gem 2 Resin
Egg
Little Margarita
Collins
Owl 2
Owl 2 Tall
Margarita
Gem Round
Owl 1
Owl 1 Tall
Magill
Gem 1 Resin
Medusa
PRO ECO Dimensions Material Colour / Surface FinishWeight(Based on PRO Battery)
Page 18 Page 19
Charging Options for Home Users
Base Station
The standard single Lamp charging solution for NEOZ Cordless Lamps.Equipped with LED charge indication and Base Station switching, simply rotate Lamp half a turn for diff erent brightness levels (patented). Lamps illuminate using mains power when on Base Station.
Charging Bar
Storage + charging platform for up to 5 Lamps.Five Base Stations fi tted into Bar pre-assembled with fi ve way distributor and one lead to one 50W 100-240V Switch-Mode Electronic Power Supply unit. Two sizes accomodate the full Lamp range.
Simply rotate Lamp half a turn for diff erent brightness levels (patented).Lamps illuminate using mains power when on Base Station.
Page 20 Page 21
Charging Options for Commercial Users
Bar short/long
Storage + charging platform for up to 5 Lamps using one 50W electronic power supply. Crafted with birch plywood, two sizes accomodate the full Lamp range.
Base Station
Standard equipment for single lamp user. Base Station charging with full LED charge indicator. Lamp can be illuminated using mains power when on Base station.
5 way power distributor
Flexible 5 way DC distributor. Charge 5 lamps from one power outlet (50W charger electronic power supply).
Small Recharging Trolley
Recharging and storage platform for up to 24 Lamps with two 120Wcharger electronic power supply’s fully assembled with one power plugfor mains connection. Durable polycarbonate moulding provides a stable platform with 24 docking points each with LED charge indication.
Large Recharging Trolley
Recharging and storage platform for up to 48 Lamps with four 120Wcharger electronic power supply’s fully assembled with one power plugfor mains connection. Durable polycarbonate moulding provides a stable platform with 48 docking points each with LED charge indication.
Recharging Tray
Recharging Tray for up to 12 Cordless Lamps complete with one 120Wcharger electronic power supply. Durable polycarbonate moulding provides a stable platform with 12 docking points each with LED charge indication.
‘Large Recharging Trolley’ with Owl 1 - BMW Welt, GermanyPhoto by Jonathan Knight
Page 22 Page 23
Charging Systems for Home & Commercial Users
* Note:Higher Lamp capacity per Recharging Tray + Trolley available on Owl Series, Ice Square 85 and Ice Round 85 Lamp models.Contact sales for more details.
Charging Capacity *
Lamp illuminates on
Charging Dock
Weight
Dimensions
Material
Power Supply
Approvals &
Standards
5 lamps
No
Short: 1.18 kg / 2.6 lbLong: 1.54 kg / 4.4 lb
Short565 x 110 x 39 mm(22”) x (5”) x (1½”)
Long810 x 120 x 39 mm(32”) x (5”) x (1½”)
Birch Plywood
5 lamps
No
1.06 kg / 2.3 lb
N/A(Flexible)
Polycarbonate
1 lamp
Yes
0.5 kg / 1.1 lb
Ø100mm x 25mm(Ø4” ) x (1”)
Polycarbonate
100 - 240V Switch-Mode Electronic Power Supply15W SMPU for max. 1 Lamp, 50W SMPU for max. 5 Lamps, 120W SMPU for max. 12 Lamps
Approved for worldwide usage supplied with appropriate mains electric plug type
All charging bars, trays and trolleys are supplied fully assembled and Cordless Lamps fully charged recharged ready to operate with main plug for country of use.
CE, CSA, C-Tick, FCC, RoHS Compliant
12 lamps
No
3 kg / 7 lb
595 x 440 x 26 mm(24”) x (18”) x (1”)
Polycarbonate
24 lamps
No
19 kg / 42 lb
610 x 450 x 900 mm(24”) x (18”) x (36”)
PolycarbonatePlated Steel Frame
48 lamps
No
33 kg / 73 lb
910 x 610 x 900 mm(36”) x (24”) x (36”)
PolycarbonatePlated Steel Frame
Large
Recharging Trolley
Small
Recharging Trolley
Recharging
Tray
Charging Bar
(Short or Long)
5-Way Distributor
with Base Stations
Base Station
Page 24 Page 25
Cordless Illuminated Furniture
Aura cordless
In collaboration with designer Henrietta Gothe-Ellis of 2DESIGN, the award winning Aura illuminated modular seat utilizes NEOZ V4 Cordless technology to provide a soft ambient glow. When the charger is connected the light will operate from mains power and simultaneously charge the battery.
Rombi Lit cordless
In collaboration with furniture designer Paul Morris of join, The illuminated modular seat uses the award winning NEOZ V4 Cordless technology to provide a soft ambient glow.
* In addition to the Cordless solution we also off er mains powered corded versions.
Aura Mini cordless
A mini version of the Aura, an award winning illuminated modular seat,using NEOZ V4 Cordless technology to provide a soft ambient glow. Whenthe charger is connected the light will operate from mains power andsimultaneously charge the battery.
‘Aura’ and ‘Ice Round 85’ - Hotel Paracas, PeruPhoto courtesy of Starwood Hotels
Page 26 Page 27
Charging Options for Illuminated Furniture
15W Power Supply
Plug in directly to base of lamp to charge and/or operate simultaneously. Charger comes with 4 interchangeable international mains plugs.
50W Power Supply with 5-Way Power Distributor (Long)
Charges up to 5 lamps simultaneously from one power supply. Each fl exible cable is 1.5 meters long and plugs directly into the lamp control socket.
Type A
Type G
5-Way Power Distributor (Long)
50W Power Supply
+
Type C
Type I
www.NEOZ.com
Neoz Cordless Lighting
20 Tepko Road Terrey Hills 2084 NSW Sydney Australia Tel +61 2 9810 5520 Fax +61 2 9555 1054
Email [email protected]
Updated August 2011