neurobiology of disease - university of delhidu.ac.in › du › uploads › research › best...

Neurobiology of Disease 63 (2014) 48–61

Contents lists available at ScienceDirect

Neurobiology of Disease

j ourna l homepage: www.e lsev ie r .com/ locate /ynbd i

Drosophila Myc, a novel modifier suppresses the poly(Q) toxicity bymodulating the level of CREB binding protein and histone acetylation

M. Dhruba Singh, Kritika Raj, Surajit Sarkar ⁎Department of Genetics, University of Delhi, South Campus, Benito Juarez Road, New Delhi 110 021, India

⁎ Corresponding author. Fax: +91 11 2411 2761.E-mail address: [email protected] (S. Sarkar).

Available online on ScienceDirect (www.sciencedirect.c

0969-9961/$ – see front matter © 2013 Elsevier Inc. All rihttp://dx.doi.org/10.1016/j.nbd.2013.11.015

a b s t r a c t
a r t i c l e i n f o
Article history:Received 7 August 2013Revised 6 November 2013Accepted 19 November 2013Available online 27 November 2013

Keywords:Polyglutamine [poly(Q)] disordersNeurodegenerationInclusion bodiesDrosophilaMycCBPHistone acetylation

Polyglutamine or poly(Q) disorders are dominantly inherited neurodegenerative diseases characterised byprogressive loss of neurons in cerebellum, basal ganglia and cortex in adult human brain. Overexpression ofhuman form of mutant SCA3 protein with 78 poly(Q) repeats leads to the formation of inclusion bodies andincreases the cellular toxicity in Drosophila eye. The present study was directed to identify a genetic modifierof poly(Q) diseases that could be utilised as a potential drug target. The initial screening process was influencedby the fact of lower prevalence of cancer among patients suffering with poly(Q) disorders which appears to berelated to the intrinsic biological factors. We investigated if Drosophila Myc (a homologue of human cMycproto-oncogene) harbours intrinsic property of suppressing cellular toxicity induced by an abnormally longstretch of poly(Q). We show for the first time that targeted overexpression of Drosophila Myc (dMyc) mitigatesthe poly(Q) toxicity in eye and nervous systems. Upregulation of dMyc results in a significant reduction inaccumulation of inclusion bodies with residual poly(Q) aggregates localising into cytoplasm. We demonstratethat dMyc mediated suppression of poly(Q) toxicity is achieved by alleviating the cellular level of CBP andimproved histone acetylation, resulting restoration of transcriptional machinery which are otherwise abbreviat-ed due to poly(Q) disease conditions. Moreover, our study also provides a rational justification of the enigma ofpoly(Q) patients showing resistance to the predisposition of cancer.

© 2013 Elsevier Inc. All rights reserved.

Introduction

The poly(Q) repeat disorders are used to describe abnormal expan-sion of poly(CAG) tracts in a gene that leads to the expression of thepathogenic protein with unusually long extended poly(Q) stretch,which in turn could dramatically modify the functional characteristicsof the protein. This condition is associated with several human heredi-tary neurodegenerative disorders such as Huntington's disease (HD), 6different forms of Spinocerebellar ataxias (1, 2, 3, 6, 7 and 17), Spinaland bulbar muscular atrophy (Kennedy's disease) and Dentatorubral-pallildoluysian atrophy (Everett and Wood, 2004). A remarkable andintriguing feature of poly(Q) disorders include their selective patternof neuronal degeneration in different forms of the diseases (Landesand Bates, 2004). For instance, in HD the cortical and basal ganglia arehighly affected whereas in Spinocerebellar ataxia type 3, Purkinje cellsin cerebellum are mostly affected (Landes and Bates, 2004; Paulson,2012). Interestingly, most of these disorders are dominantly inheritedand exhibit a set of overlapping phenotypes: late adult onset, formationof protein aggregates and progressive degeneration of vulnerablesubsets of neurons.

om).

ghts reserved.

Among different forms of poly(Q) diseases, Spinocerebellar ataxiarepresents a subgroup and Spinocerebellar ataxia type 3 (SCA3) orMachado Joseph disease (MJD) being the most common form. Inpolyglutamine disorders the poly(Q) repeats within the coding regionof protein elicit accumulation of mutant polypeptides in the form ofinsoluble aggregates (nuclear inclusions or inclusion bodies) in nucleiof affected neurons causing toxic gain of function (DiFiglia et al., 1997;Landes and Bates, 2004). Subsequently, the nuclear inclusion bodies se-quester endogenous proteins involved in proteosomal system, proteinfolding machinery and key transcription factors, which ultimately leadto neuronal dysfunction and activation of initiator and effector caspasescausing apoptosis (Chen et al., 2000; Lin et al., 2000; Saudou et al., 1998;Tsoi et al., 2012). One of the striking features of poly(Q) diseases in-cludes impaired cellular transcription machinery as several key tran-scription factors such as TATA binding protein (TBP), CREB bindingprotein (CBP), TBP-associated factor (TAFII130) and Specificity factor(SP1) are sequestered by poly(Q) aggregates (Dunah et al., 2002;McCampbell et al., 2000; Nucifora et al., 2001; Perez et al., 1998;Shimohata et al., 2000; Taylor et al., 2003). Sequestration of histone ace-tyltransferases by inclusion bodies has been implicated as one of theleading factors for neurodegeneration and cellular toxicity in poly(Q)mediated diseases (McCampbell et al., 2000; Nucifora et al., 2001;Taylor et al., 2003). Subsequently, cell–cell communications and strin-gency of signalling pathways are also severely impaired due to

http://crossmark.crossref.org/dialog/?doi=10.1016/j.nbd.2013.11.015&domain=pdf

http://dx.doi.org/10.1016/j.nbd.2013.11.015

mailto:[email protected]


http://www.sciencedirect.com/science/journal/09699961

49M.D. Singh et al. / Neurobiology of Disease 63 (2014) 48–61

increasing load of misfolded proteins in axonal compartments(Gunawardena and Goldstein, 2001; Seidel et al., 2010).

In order to decipher the disease pathogenicity and to design remedi-al strategies, the cellular and molecular mechanism(s) operating theneuronal degeneration have been extensively investigated. Althoughthe precise role of poly(Q) aggregates in disease pathogenesis is stillenigmatic, it is increasingly clear now that the pathogenic effect ofpoly(Q) aggregates could be altered in vivo in model systems such asC. elegans, Drosophila and mouse. Modelling of human neurodegenera-tive disorders in model organisms not only provided an opportunityto study the mechanistic details of the disease progression but alsofacilitated in identification of several genetic modifiers which coulddominantly mitigate the toxic effects of poly(Q) aggregates (Lu andVogel, 2009). Heat shock factor (Hsf), Myocyte enhancer factor 2(Mef2), TBP-associated Factor 10 (Taf10), Debra (dbr), Drosophila mye-loid leukaemia factor 1 (dmlf), CREB Binding Protein (CBP), Histonedeacetylase 6 (HDAC6), SUMO (smt3), Heat shock protein 70 (Hsp70),DIAP1 (thread), and p53 are some of the examples of genetic modifiersof poly(Q) toxicity (Reviewed by Mallik and Lakhotia, 2010a). Interest-ingly, majority of the genetic modifiers of poly(Q) disorders could beclassified in subgroups such as components of protein folding and deg-radation machinery, gene expression and programmed cell death etc.(Bonini, 1999; Branco et al., 2008; Chan et al., 2002; Ghosh and Feany,2004; Warrick et al., 1999). In this context, it is important to note thatmammalian model systems are relatively challenging to be utilised formodifier screening due to their complex genetic background andenvironment.

The present study was directed to identify novel genetic modifiersthat suppress the poly(Q) induced cellular toxicity and could providea potential target for designing and testing therapeutic strategies. Thepreliminary screening was influenced by the fact of lower prevalenceof cancer among patients suffering with neurodegenerative disorderswhich appears to be related to intrinsic biological factors (Ji et al.,2012; Sorensen et al., 1999). We identified dMyc (a homologue ofhuman c-Myc, a proto-oncogene) as a novel genetic modifier of SCA3induced toxicity in Drosophila. Our findings suggest for the first timethat targeted overexpression of dMyc can significantly ameliorate pro-gression of poly(Q) induced neurodegeneration and reduces formationof inclusion bodies. We further report that enhanced expression ofdMyc increases cellular abundance of CBP and acetylated form of his-tone which collectively may induce chromatin remodelling and modu-late global gene expression. Our studies suggest that protooncogenicproperty of dMyc may harbour inherent capability of suppressingneuro-degeneration caused by poly(Q) repeat disorder.

Material and methods

Drosophila stocks

The Drosophila stocks used in the experiments were reared incornmeal/agar/yeast media at 24 ± 1 °C. The wild type used in theexperiment was Oregon R+. The transgenic lines UAS-SCA3trQ78(S)(Bonini, 1999), UAS-SCA3trQ78(W) (Warrick et al., 1999), GMR-Gal4(Hay et al., 1994), UAS-DIAP1 (Bloomington Stock Centre, Indiana,USA), Elav-Gal4 (Lin and Goodman, 1994), 201YGal4 (Yang et al.,1995), UAS-dMyc (two lines with independent insertion on secondand third chromosome) (Johnston et al., 1999), UAS-eGFP-HttQ138-mRFP (Weiss et al., 2012), UAS-CBP RNAi (Ludlam et al., 2002), UAS-CBPFLAD (Kumar et al., 2004), and UAS-dMyc RNAi (Bloomington stock no.25784) were either procured from Bloomington Drosophila stock centre,Indiana, USA, or obtained from various laboratories as referred above.

Examination of adult eye

The images of adult eyeswere captured by CanonG10digital cameraattached with Zeiss Stemi 200-C stereo zoom binocular microscope. For

the evaluation of fluorescence of eGFP in adult eyes, heads from desiredgenotypes were decapitated and mounted on glass slide and observedimmediately under an Olympus BX51 florescence microscope at equalexposures.

Phototaxis and survival assay

Groups of nearly 20 flies were put into Y-Maze design to study thephototaxis activity (Quinn et al., 1974). One side of Y-Maze was dark-ened by covering with thick black paper, while the other arm wasuncovered. A beam of light was allowed to shine over the transparentside. After 20 s the flies in each armwere counted and scored for visibil-ity. Phototaxis indices are calculated on the basis that 100% wild typeflies choose transparent arm of the Y-maze whereas the disease flywill choose between dark and transparent side depending upon its vis-ibility. About 100–200 flies were observed for each genotype to scorevisibility. For the survivability test, the progenies of desired genotypesat third instar larval stage were collected in milk bottles and allowedto pupate. Total number of flies eclosing from the pupal case wererecorded and statistical analysis was performed. More than 500 pupaewere examined for each genotype.

Scanning electron microscopy (SEM)

Adult heads of desired genotype were decapitated in 1XPBS. Thetissues were fixed in 2.5% glutaraldehyde and 2% paraformaldehydeat 4 °C for overnight. The tissues were dehydrated in acetone andcritically-dried. The heads were mounted on studs under stereo zoombinocular microscope and coated with gold. Images were capturedusing a Zeiss EVO40 scanning electron microscope.

Pseudopupil analysis

Pseudopupil analysis allows observation of photoreceptors arrange-ment of Drosophila eye (Franceschini, 1972). Each ommatidia show 7photoreceptors clustered towards the centre of each ommatidia.The adult heads of desired genotype were decapitated and mountedon glass slide and observed under bright field 60× oil objective of anOlympus BX51 microscope.

Histology and immunohistochemistry

For Drosophila adult eye sectioning, two days old heads were decap-itated and fixed in 4% paraformaldehyde for 20 min. The tissues weredehydrated in alcohol and then in xylene. Xylene was completely re-moved by frequently changing the solution by molten wax. The tissueswere poured into moulds and the orientation of eyes was manipulatedwith the help of a dissecting needle. The sections were cut at 15 μmthickness using semi-automatic microtome (Thermo Scientific, USA).Tissues were stained in 0.01% Toluidine blue solution (in 1XPBS) for5 min. andmounted in DPX and observed under brightfieldmicroscope(Olympus BX51).

For immunochemistry, the eye disc of third instar larvae or 55 h oldpupal eye disc or two days old adult brain was dissected in 1XPBS. Thetissues were fixed in 4% paraformaldehyde (15812-7, Sigma, USA) for20 min. The tissues were washed with 1XPBST and incubated inblocking solution for 2 h at room temperature. Later tissues were incu-bated in desired primary antibody or TRITC-Phalloidin (dilution 1:200in 1XPBS, SigmaAldrich, USA) overnight at 4 °C. The primary antibodieswere anti-HA (1:1000; Y11, Santa Cruz Biotechnology, USA), anti-dMyc(1:1000; P4C4 B10) (Prober and Edgar, 2000), anti-Fasciclin ΙΙ (1: 100;ID4, DSHB, USA), anti-cleaved-caspase-3 (1:1000; D175, Cell SignallingTechnology, USA), anti-HSP70 (1:500; 7Fb) (Chai et al., 1999), and anti-dCBP (1:600) (Lilja et al., 2003), anti-ace-H3K9 (1:1000; AH3-H20,Abcam, USA), anti-Elav (1:400; 9F8A9, DSHB, USA), anti-disc large(1:500; 4 F3, DSHB, USA) and anti-armadillo (1:400; N27A1, DSHB,

Fig. 1.GMR-Gal4 driven coexpression of dMyc suppresses poly(Q) induced neurodegener-ation in Drosophila eye. (A–D) Picture of external surface of adult eye. (A) Wild type.(B) Degeneration of eye surface and black necrotic patches is evident in UAS-SCA3trQ78(S)/GMR-Gal4. (C) Coexpression of dMyc restores the cellular degenerationand roughening of eye surface. (D) RNAimediated reduced expression of dMyc further en-hances the severity of poly(Q) phenotypes and large necrotic patches are evident.

50 M.D. Singh et al. / Neurobiology of Disease 63 (2014) 48–61

USA). Following day, tissues were washed 3 times in 1XPBST for 20 mineach and incubated in appropriate secondary antibody (1:200 dilution;Molecular Probes, USA). The secondary probes were; Cy3 Goat anti-mouse (A10521), Cy3 goat anti-Rabbit (A10520), Alexa 488 goat anti-mouse (A10001), Alexa-488 goat anti-rabbit (A11008) and Alexa-488goat anti-guinea pig (A11073). In some cases tissues were counter-stained with DAPI (5 μg/ml, Roche Diagnostics, GmbH, Germany) andmounted in prolong gold antifade mounting reagent (P36934, Molecu-lar probes, USA). The images were captured either by Olympus BX51 orBX53 fluorescencemicroscope using appropriate filters or Leica TCS SP5II confocal microscope. Equal numbers of confocal optical section im-ages were taken while constructing comparative merge images withLeica application suite advanced fluorescence software. The pictureswere assembled using Adobe Photoshop CS5 software.

Bromouridine staining

Drosophila third instar eye discs were dissected in 1XPBS. Theeye discs were incubated in 10 μM BrdU (Sigma, USA) in Schneider'smedium (Sigma, USA) at room temperature for one hour. Subsequently,tissues were fixed in 4% paraformaldehyde and treated with 2 N HCl atroom temperature to denature the DNA. Tissues were then neutralisedusing 100 mM borax solution and incubated in anti-BrdU antibody(1:600; G3G4, DSHB, USA) for overnight at 4 °C. Tissues were thenincubated for two hours in appropriate secondary antibody (1:200).The images were captured by Olympus BX51 or BX53 fluorescence mi-croscope using appropriate filters.

Western blot

30 heads of 1 day old flies of desired genotypes were decapitatedand homogenised in RIPA buffer (50 mM Tris-Cl, 1% TritonX-100, 0.1%SDS, 0.5% sodium deoxycholate, 150 mM NaCl, 10% Glycerol) supple-mented with protease inhibitor cocktail to the final concentration of1% (Sigma, USA). Concentration of protein was estimated by Bradfordmethod and 30 μg of total protein from each genotype wasmixed with equal volume of 2× Laemni buffer (120 mM Tris-Cl, 10%β-Mercaptoethanol, 4% SDS, 20% Glycerol, 1 mM PMSF and 0.02%bromophenol blue) and loaded into polyacrylamide gel (12% resolvingand 4% stacking gel). The protein samples were transferred to nitrocel-lulose membrane (Millipore, USA) bywet transfer apparatus at 40 V forovernight at 4 °C. Themembranewas blocked in blockingbuffer (cat no.37570; Thermo Pierce, USA) and incubated in desired primary antibodyfor overnight at 4 °C. Themembranewaswashed three times in 1XPBSTand incubated in appropriate secondary antibody for 2 h. The primaryantibody used was anti-HA (1:1000, Y-11, Santa Cruz Biotechnology,USA). For loading control anti-α tubulin was used (1:1000; CellSignalling, USA). The Secondary antibody was Horseradish peroxidaseconjugated secondary antibody (1:1000, Merck, India). The blot wasdeveloped using ECL detection kit (cat no. 32209, Thermo Pierce,USA). Images were acquired in a Fujifilm imaging system (FLS-4000).

Semi quantitative reverse transcription PCR and quantitative real time-PCR

Total RNA from desired genotypes were isolated from 50 heads ofone day old Drosophila by TRIZOL reagent using manufactures protocol(cat no. T9424, Sigma Aldrich, USA). cDNA was prepared from 3 μgof total RNA using Oligo d(T)18 (cat no. S1316S, New Englands Biolabs,UK) and 200 units of M-MuLV reverse transcriptase (cat no. M0253S,New England Biolab, UK). The gene specific primers used in theexperiments were: CBP forward 5′-GCTGCGGCAAATCTTTTCTC-3′; CBPreverse 5′-CCTGGATGGGCGCTAAACTA-3′ and control primers were,GAPDH2 forward 5′-CAAGTTCGATTCGACCCACG-3′ and GAPDH2reverse 5′ CCTTCAAGTGAGTGGATGCC 5′. The thermal programmeused for amplification of transcript includes initial denaturation stepof 95 °C for 5 min followed by 30 cycles of denaturation step at 94 °C

for 30 s, annealing step at 60 °C for 30 s and extension step at 72 °Cfor 45 s. Equal amount of PCR products were visualised on 1% agarosegel and the picture was acquired using Alpha imager HP.

In case of quantitative real time-PCR, amplification was performedon a cDNA amount equivalent to 25 ng of total RNA with 1 × SYBRGreen universal PCR master mix (Applied Biosystems, USA) containingdeoxyribonucleotide triphosphates, MgCl2, AmpliTaq Gold DNA poly-merase, and forward and reverse CBP primers as described above.Each reaction was performed in triplicate on Applied Biosystems7900HT fast real time sequence detection system (Applied Biosystems,USA), and experimental Ct values were normalised to RP49 forward5′-ATGCTAAGCTGTCGCACAA-3′ and reverse 5′- TTGTGCACCAGGAACTTCTT-3′ primers. The data was subjected to ΔΔCt statistical analysisand presented as mean ± standard deviation.

Results

Enhanced expression of dMyc suppresses poly(Q) toxicity in eye

To investigate the role of dMyc in poly(Q) disease, we utilised aDrosophila model of human SCA3 in which a truncated form of ataxia-3 protein containing 78 CAG repeatswith HA tag [SCA3tr78Q(S)] clonedafter yeast upstream activator system (UAS), and tissue specific expres-sion of the transgene could be achieved by regulating the availability ofthe Gal4 transcription factor in selective tissues (Bonini, 1999; Brandand Perrimon, 1993; Chan et al., 2002; Warrick et al., 1999). Targetedexpression of SCA3tr78Q(S) [referred as UAS-78Q(S) in figures] inDrosophila eye using GMR-Gal4 (Hay et al., 1994) (hereinafter referredas UAS-SCA3trQ78(S)/GMR-Gal4) resulted in severe degeneration(Bonini, 1999; Chan et al., 2002; Warrick et al., 1999). Compared towild type (Fig. 1A) orGMR-Gal4/+ (not shown)which gives normal ap-pearance of eye, the degeneration in UAS-SCA3trQ78(S)/GMR-Gal4 flies


was prominent even on the 1st day of adult life (Fig. 1B). The affectedeyes exhibited loss of pigmentation, disrupted ommatidial arrange-ment, collapsed cellular architecture and irregular bristles lattice(Fig. 1B). Inmany of the adult eyes, severely degenerated tissues formedblack necrotic lesions over the surface of the eyes (Fig. 1B). In agreementwith earlier reports (Warrick et al., 1999), retinal expression ofSCAtrQ27 did not develop any of the above phenotypes (not shown),demonstrating that poly(Q) induced degeneration is length-dependent.

To investigate if targeted expression of Drosophila Myc (dMyc,also known as dimunitive) can mitigate the poly(Q) induced toxicity,we crossed UAS-SCA3trQ78(S)/GMR-Gal4 with UAS-dMyc in whichwild type dMyc expresses under UAS control. Earlier reports suggestthat targeted overexpression of dMyc results in 33% enlargement insize of adult eye ommatidium in Drosophila (Secombe et al., 2007),however, when a single copy of UAS-dMyc transgene was coexpressedin Drosophila eye along with UAS-SCA3trQ78(S) (hereinafterreferred as UAS-SCA3trQ78(S)/GMR-Gal4/ UAS-dMyc), the external eyearchitecture and bristle arrangements were significantly restored(Fig. 1C). Intriguingly, relative measurement of adult ommatidiumin UAS-SCA3trQ78(S)/GMR-Gal4/ UAS-dMyc flies showed only 7%(N = 236 ommatidium) enlargement in size, compared to 33% enlarge-ment as discussed earlier (Secombe et al., 2007). The pigments werespread uniformly throughout the ommatidia which indicate lesserpathogenicity (Fig. 1C). In addition, the necrotic patches whichwere otherwise common in UAS-SCA3trQ78(S)/GMR-Gal4 genotype,were rarely formed in UAS-SCA3trQ78(S)/GMR-Gal4/ UAS-dMyc flies(N ≥ 500). Coexpression of UAS-GFP transgene with UAS-SCA3trQ78(S)/GMR-Gal4 did not result in any phenotypic change (Fig. S1A; N = 86)which excludes any possibility of the effect of two UAS transgene ondisease phenotype.

We further wanted to study the effect of the reduced expression ofdMyc in SCA3 trQ78(S) background; and intriguingly, an aggravatedlevel of degeneration was evident when cellular abundance of dMycwas depleted by expressing a copy of UAS-dMyc RNAi in UAS-SCA3trQ78(S)/GMR-Gal4 flies (Fig. 1D). Large necrotic patches were ev-ident on the eye surface in all such eclosing flies (N = 246) with com-plete loss of inner cellular mass and ommatidial structure onsubsequent days. We validated the UAS-dMyc driven poly(Q) rescueevent with two independent lines of UAS-dMyc transgenic on chromo-some 2 and 3 respectively (Johnston et al., 1999). Both of the lines ex-hibited similar rescue proficiency when coexpressed independentlywith UAS-SCA3trQ78(S). Surprisingly, coexpression of two copies ofUAS-dMyc resulted in somewhat similar or slightly improved morphol-ogy than the single dose of UAS-dMyc (not shown). We also wanted toinvestigate if the modifier potency of dMyc is comparable with anyestablished modifier of poly(Q) disorder such as Drosophila inhibitorof apoptosis (DIAP1) (Branco et al., 2008; Ghosh and Feany, 2004).The selection of DIAP1 was influenced by its well-established universalrole in inhibition of apoptotic events inDrosophila (Hay et al., 1995).Wefound that DIAP1 mediated modulation (single copy) of UAS-SCA3trQ78(S)/GMR-Gal4 toxicity resulted in lesser extent of rescuethan that of dMyc (single copy), indicating possibility of dMyc as a stron-ger suppresser of poly(Q) than DIAP1 (Fig. S1B).

The scanning electron microscopy of external eye surface revealedthat compared to thewild type adult eye which shows regular arrange-ment of ommatidia (Fig. 2A), external eye structure ofUAS-SCA3trQ78(S)/GMR-Gal4 was severely deformed and ommatidia are collapsed intothe brain as underlying structures were absent (Fig. 2B). Subsequently,upregulation of dMyc showed significant improvement in externaleye morphology with distinct ommatidia and bristle arrangement(Fig. 2C). To investigate the internal morphology of adult eyes, 15 μmthick horizontal sections were prepared and stainedwith 0.01% Toluidineblue stain. In agreement with earlier reports, compared to the wild type(Fig. 2D) expression of SCA3trQ78(S) showed degeneration of internalstructure and the retinal portion was devoid of any tissue mass(Fig. 2E). In contrast, coexpression of dMycwas found to suppress retinal

degeneration and improved internal structure of eyes (Fig. 2F) in 83% ofthe cases (N = 200). Notably, improvement in internal eye structure re-mains evident through the Drosophila life span.

As reported earlier, poly(Q) mediated defects do not manifest inthird instar larval eye disc although aggregation of IB could be detected(Bonini, 1999). It has been demonstrated that threshold level ofpoly(Q) aggregates is achieved by the time of pupation, and progressivedisruption of cellular processes and degeneration takes place during thepupal development (Bonini, 1999). Therefore, to understand the role ofdMyc in the modulation of the poly(Q) toxicity, morphological studieswere performed on developing pupal eyes. Drosophila eye is composedof intricate structures containing around 600 ommatidia. Each omma-tidium comprises twenty cells; 1 corneal cell, 2 primary cells, 3 second-ary cells, 3 tertiary cells, 3 bristles and 8 rhabdomeres each havingphotoreceptors towards the centre of ommatidia. The 8th rhabdomerelies just below the 7th so it is not visible at the same focal planewith other photoreceptors. To demonstrate whether upregulation ofdMyc reverses poly(Q) toxicity, 55 h old Drosophila pupal eyes wereexamined by staining with various cellular markers.

Phalloidin is a marker of F-actin which stains the cellular boundaryas well as photoreceptor pigments at the centre of the ommatidia. Inwild type, trapezoid arrangement of seven rhabdomeres was observedand individual ommatidia showed hexagonal structure (Fig. 2G). Ab-normal development of rhabdomeres was observed due to expressionof SCA3trQ78(S) and ommatidia were found to arrange irregularlywith spaces between them (Fig. 2H). Coexpression of dMyc significantlyimproved the ommatidial architecture and trapezoid arrangement ofrhabdomere was also restored (Fig. 2I). Subsequently, staining withElav demonstrated restoration of neuronal differentiation in rescuedflies [Compare Fig. S2A (wild type) and S2C] which was otherwisecollapsed in UAS-SCA3trQ78(S)/GMR-Gal4 flies (Fig. S2B). To furtherinvestigate if the phenotypic improvement has been extended toother areas of developing pupal eyes, staining with Disc large (Dlg; aseptate junction marker) and Armadillo (an adheran junction marker)was performed. Compare to wild type (Fig. S2D, G), staining withthese markers revealed cellular degeneration and gross morphologicaldefects in primary, secondary and tertiary cells, cone cells and abnormalbristle lattice in UAS-SCA3trQ78(S)/GMR-Gal4 flies (Fig. S2E, H). Thesedefects were almost completely suppressed following coexpression ofdMyc (Fig. S2F, I).

To ascertain that the overexpression of dMycwas indeed achieved inthe target tissues, eye discs of third instar larvae were stained with an-tibody specific to Drosophila Myc (Prober and Edgar, 2000). Stainingwith wild type (Fig. 2J) and UAS-SCA3trQ78(S)/GMR-Gal4 (Fig. 2K)exhibited basal level of expression throughout the disc area. Compara-tively, a robust expression of dMyc confined to the posterior region ofmorphogenetic furrow was evident in UAS-SCA3trQ78(S)/GMR-Gal4/UAS-dMyc larval eye disc (Fig. 2L). Above result clearly demonstratedthat a robust expression of dMyc was indeed achieved in eye fieldwhich might be driving the rescue event.

Functional rescue of poly(Q)-mediated toxicity by dMyc

The overexpression of SCA3 protein with expanded poly(Q) repeatsdestroys the ommatidial arrangement and impairs the visibility inDrosophila (Bonini, 1999; Chan et al., 2002; Warrick et al., 1999). Inspite of severity of the disease, dMyc restores the cellular architectureand externalmorphology of the eye. Although substantial level of rescuein external and internal eye architecture has been achieved due to over-expression of dMyc; as revealed by pseudopupil analysis, restoration ofphotoreceptors in adult eyes was partial and only three or four photore-ceptors were observed (data not shown). So we used a less toxic andweaker form of SCA3 transgene, UAS-SCA3trQ78(W) (Warrick et al.,1999) to substantiate our findings. Although GMR-Gal4 driven expres-sion of weak form of UAS-SCA3trQ78(W) transgene did not exhibit anyvisible external morphological defects immediately after eclosion,

Fig. 2. GMR-Gal4 driven coexpression of dMyc improves the external and internal cellular architectures in poly(Q) induced neurodegeneration inDrosophila eye. (A–C) SEM images takenat 2000X to observe the external eye surface. (A) Wild type. (B) Disorganised ommatidial structure in UAS-SCA3trQ78(S)/GMR-Gal4. (C) Coexpression of dMyc prevents deformity inexternal ommatidial arrangement restores bristle lattice. (D–F) Toluidine blue stained horizontal section of eye retina. (D) Wild type. (E) Retinal tissues are completely degenerated inUAS-SCA3trQ78(S)/GMR-Gal4. (F) Coexpression of dMyc suppresses the retinal degeneration and inner tissue masses are now visible. (G–I) Confocal images of 55 h old pupal eye discstained with TRITC-Phalloidin. (G) Wild type shows hexagonal arrangement of ommatidia. (H) Formation and arrangement of ommatidial rhabdomeres are abnormal in UAS-SCA3trQ78(S)/GMR-Gal4. (I) Coexpression of dMyc improves the morphology and arrangement of ommatidial subunits. (J–L) Confocal pictures of eye discs stained with anti-dMyc. (J,K) Basal level of dMyc expression is observed inwild type andUAS-SCA3trQ78(S)/GMR-Gal4. (L) Robust upregulation of dMyc is evident in eye disc by coexpression ofUAS-dMyc transgenein UAS-SCA3trQ78(S)/GMR-Gal4 background.


however, compare to wild type (Fig. S3A) or GMR-Gal4/+ (not shown),pseudopupil analysis during subsequent days revealed exponential lossof pigment and roughening of eye surface (Fig. S3B). Subsequently, incontrast to the wild type of similar age (Fig. S3D), intact ommatidiawith 7 photoreceptors were rarely visible in 5 days old UAS-SCA3trQ78(W)/GMR-Gal4 flies and degenerating cellular masses werewitnessed with some ommatidia showing one or two rhabdomeres(Fig. S3E). Flies coexpressingUAS-SCA3trQ78(W) andUAS-dMyc showedrestoration of ommatidial architecture and increase in the number ofphotoreceptors (Fig. S3C, F; N = 100). The rescuewas evident through-out the life span.

To investigate whether improvement in the external morphology ofeye corresponds to the restoration of functional vision, phototaxis assaywas performed on 2 days old adult flies (Quinn et al., 1974). The ratio-nale behind the Y-maze phototaxis assay is that the flies with normalvision will choose the illuminated arm of Y-maze whereas flies withabnormal vision will choose randomly either the illuminated or thedark arm of the Y-maze. In wild type, 95% flies (Fig. 3A; N = 184)move towards illuminated chamber and only 5%move to dark chamber.Expression of SCA3trQ78(W) in eyes compromised the functional visionand flies moved randomly in light and dark chambers almost equally(Fig. 3A; N = 247). Increase in positive phototaxis behaviour was

observed by coexpression of dMyc as 86% (N = 219) of flies choosethe light chamber over the dark chamber (Fig. 3A). This study confirmedthat dMyc not only restored the internal and external morphology ofeyes but also improved the functional vision.

dMyc mediated reduction of poly(Q) toxicity in nervous system

Polyglutamine disorders primarily affect different parts of humanbrain tissues depending upon the type of disease. Although Drosophilaeye has been widely used as a model organ to study the poly(Q) patho-genicity and modifier screening, however, it is equally important to es-tablish themodifier capacity of selected candidates by expressing themin selective parts of nervous system and brain. Therefore, we askedwhether dMyc mediated suppression of SCA3 toxicity also extends torest of the nervous system and brain. We utilised two Gal4 drivers;Elav-Gal4 which expresses in central and peripheral nervous systempan neuronally, and 201Y-Gal4 which exclusively expresses in kenyoncells of the mushroom body of Drosophila brain (Lin and Goodman,1994; Yang et al., 1995). In agreement with the earlier report(Warrick et al., 1999), targeted expression of SCA3trQ78(S) using Elav-Gal4 caused 100% lethality as pupal pharates (Fig. 3B; N = 614).Coexpression of dMyc with SCA3trQ78(S) pan neuronally resulted in


partial but significant suppression of lethality. Following coexpressionof dMyc, 24% of flies (N = 563) eclosed as fully differentiated adultwith life span ranging between 20 and 30 days (Fig. 3B) with almostnormal behaviour during first 15 days and subsequently developedmild paralytic phenotype. Remaining 76% developed as fully differenti-ated pupae, but were unable to eclose or die during eclosion.

Drosophila mushroom body is an associative brain structure homol-ogous to hippocampus of the highermammals and is essential for olfac-tory memory, learning and courtship behavioural responses. It is apaired organ composed of kenyon cells and its axonal extensions name-ly 2α, 2β and 2γ lobes. We found that targeted expression ofSCA3trQ78(S) in neuronal subpopulation (kenyon cells) of mushroombody resulted in substantial lethality at pupal stage (Fig. 3B, C1). Only3.19% (N = 565) viable adult escapers eclosed and survived with themaximum life span of 7–8 days (Fig. 3B, C2). Intriguingly, coexpression

Fig. 3. Upregulation of dMyc improves vision and prevents poly(Q) mediated brain degenerahistograms represent mean value (±SD) of either positively or negatively phototaxis flies (B)in mushroom body is rescued by coexpression of dMyc. (C) Expression of SCA3trQ78(S) in m(3.19%) eclose and survives for 7–8 days (2). (D–F) Mushroom body of 2 days old flies stainesize is significantly reduced and γ lobe is degenerated in UAS-SCAtrQ78(S)/201Y-Gal4 flies. (F)visible following coexpression of dMyc. (G) Graph represents comparative size of mushroom b

of dMyc with SCA3trQ78(S) and 201Y-GAL4 increased the survival ratioto 97.5% (Fig. 3B; N = 483)with a life span of 30–35 days showing nor-mal behaviour. To examine the protective role of dMyc on poly(Q) tox-icity, the morphology of the mushroom body in adult brains wasobserved by staining with Fas II antibody. Compared to the size ofwild type mushroom body (Fig. 3D, G; average size = 405.33 ±0.75 μm; N = 12), expression of SCA3trQ78(S) resulted in a significantreduction in the size ofα and β neuropiles ofmushroombody in surviv-ing SCA3trQ78(S)/201Y-Gal4 adults (Fig. 3E, G; average size = 284.00±2.74 μm;N = 12). Moreover, overall intensity of Fas II stainingwas alsolow compared to the wild type (compare Fig. 3D and E). The neuropileof γ-lobe was poorly stained perhaps due to selective loss of neuronalcounterpart in the kenyon cells. Our staining experiments clearly dem-onstrated that the overall size of the mushroom body along with α andβ lobes were substantially restored by coexpression of dMyc (Fig. 2F, G;

tion: (A) poly(Q) induced impaired vision is alleviated by coexpression of dMyc. Bars inPupal lethality mediated by expression of SCA3trQ78(S) either in pan neuronal tissues orushroom body causes lethality at fully differentiated pupal stage (1) and a few escapersd by anti-Fas ΙΙ. (D) Wild type showing α, β and γ lobes of mushroom body. (E) OverallSize of mushroom body is restored and γ lobe is rescued from degeneration and clearlyodies dissected from adult brains of different genotypes.


average size = 392.67±1.73 μm;N = 13).Moreover, degeneration ofγ-lobe was also copiously prevented (Fig. 3F). The Fas II staining exper-iment was also performed with brain dissected out from 55 h old pupaand similar results were obtained (not shown). This finding clearlydemonstrates that the potential of dMyc to modulate poly(Q) toxicityis extensively prevalent in different organs and neuronal tissues.

Enhanced level of dMyc reduces poly(Q) mediated cell death andcellular stress

Apoptosis or programmed cell death is a cell intrinsic mechanism ofremoving or killing of cells which are injured or whose survival is com-promised for maintenance of cellular homeostasis (Cashio et al., 2005).In poly(Q) disease, formation of highly toxic inclusion bodies inducesapoptosis in selective regions of brain (Chen et al., 2000; Saudou et al.,1998). Inclusion bodies accumulate dynamically in different regions ofbrain and induce activation of highly specific caspase proteins, whichin normal cells are masked by binding with inhibitor of apoptosis suchas IAP1 (Chen et al., 2000; Chew et al., 2004; Fan and Bergmann,2010; Meier et al., 2000; Saudou et al., 1998). To examine the poly(Q)induced apoptotic activity, third instar larval eye discs were stainedwith anti-cleaved caspase-3 antibody. The activation of caspase wasnot evident in wild type eye disc cells (Fig. 4A). Following the expres-sion of SCA3trQ78(S), a substantial amount of caspase-3 stainingindicate its highly activated statewhichwould subsequently lead exten-sive cell death in targeted region (Fig. 4B). On the contrary, a low level ofcaspase-3 staining confined to only fewer cells in posterior region of eyedisc in UAS-SCA3trQ78(S)/GMR-Gal4/ UAS-dMyc genotype (Fig. 4C). Acomparable pattern of caspase-3 staining was evident in developingeyes dissected out from the pupal stage (not shown). Moreover, acri-dine orange staining of third instar larval imaginal discs (Fig. S4) andpupal eyes (not shown) was also revealed substantially less prevalenceof cell death in UAS-SCA3trQ78(S)/GMR-Gal4/ UAS-dMyc genotype incomparison to UAS-SCA3trQ78(S)/GMR-Gal4.

The expression of SCA3trQ78(S) causes formation of toxic nuclearinclusions which induces expression of stress inducible form of HSP70as cell intrinsic mechanism to refold the abnormally folded poly(Q)disease proteins (Chai et al., 1999; Chan et al., 2002; Mallik andLakhotia, 2009;Warrick et al., 1999). In order to examine the protectiveactivity of dMyc on poly(Q) toxicity, the level of cellular stress waschecked by assessing the expression of stress inducible form of HSP70(Velazquez et al., 1983) which was otherwise not expressed in wildtype flies raised in unstressed condition (Fig. 4D). However, GMR-Gal4driven expression of SCA3trQ78(S) resulted in significant upregulationin the expression of stress inducible HSP70 which was evident in theform of small aggregates being restricted to the posterior of morphoge-netic furrow in the eye disc (Fig. 4E). Coexpression of dMyc in thepoly(Q) background significantly repressed the stress induced expres-sion of HSP70 and only a little amount of stainingwas visible at the pos-terior end of the disc (Fig. 4F). Above experiments clearly demonstratedthat enhanced level of dMyc in SCA3 background provides a protectiverole and dominantly helps in reducing the cellular toxicity and celldeath.

Upregulation of dMyc inhibits poly(Q) protein aggregation

The formation of nuclear inclusions have been postulated as thepathological feature in all the cases of poly(Q) diseases and the sizeand number of inclusions could be directly correlated with diseaseseverity in model organisms (Bonini, 1999; Chan et al., 2002; Warricket al., 1999). Since cellular apoptosis and level of HSP70 were signifi-cantly altered due to coexpression of dMyc, we postulated that dMycmay alsomodulate the subcellular level and distribution dynamics of in-clusion bodies. To substantiate our hypothesis, GMR-Gal4 driven,SCA3trQ78(S) expressing third instar larval eye discs were stainedwith anti-HA antibody (Bonini, 1999; Chan et al., 2002; Warrick et al.,

1999). Robust accumulation of poly(Q) aggregates covering more thanhalf of the eye field was detected in such imaginal discs (Fig. 4G). Mag-nified images revealed subcellular abundance of inclusions bodies ofvarious sizes present in nuclear as well as cytoplasmic compartments(Fig. 4I). Coexpression of Drosophila Myc with UAS-SCA3trQ78(S)/GMR-Gal4 prevented the formation of nuclear inclusions and also al-tered the subcellular localisation dynamics of residual inclusion bodieswhich mostly now appear in the cytoplasmic domain (Fig. 4H). Subse-quent analysis revealed significantly reduced level of poly(Q) proteinswith occasional presence of small size inclusion bodies and their inter-action with nucleus was hardly evident (Fig. 4J). Similar study withthe weak form of SCA3trQ78(W) also showed substantially reducedlevel of poly(Q) proteins (Fig. S3 compare G and H). However, as re-vealed by confocal optical sectioning and co-localization studies, nophysical association could be established between dMyc and inclusionbodies (not shown). To further understand the rescue potential ofdMyc, the level of inclusion bodies in adult flies were examined bywestern blot using anti-HA antibody. In agreement with the earlierreports (Chan et al., 2002), in UAS-SCA3trQ78(S)/GMR-Gal4 the inclu-sion bodies were found as highly insoluble protein complexes whichwere difficult to resolve and mostly remain trapped in the stacking gel(Fig. 4K, lane 1). Following coexpression of dMyc, the abundance ofSDS-insoluble protein aggregates was significantly reduced, however,themonomeric form of poly(Q) proteinwas difficult to observe perhapsdue to their high mobility rate (Fig. 4K, lane 2). Above findings clearlyillustrate that dMyc potentially suppress the poly(Q) mediated toxicityby altering the subcellular level and distribution pattern of the nuclearinclusions.

Further investigation was performed to check whether dMyc canalso modulate the toxicity in other form of poly(Q) disease line andwe selected a Huntington line, UAS-eGFP-HttQ138-mRFP tagged withboth the eGFP andmRFP upstreamand downstream of coding sequencein first exon 1 (Weiss et al., 2012). The UAS-eGFP-HttQ138-mRFP trans-genic line allows in vivo imaging of huntingtin expression and studyof aggregation dynamic in live animals (Weiss et al., 2012). GMR-Gal4driven expression of UAS- eGFP-HttQ138-mRFP exhibited abundantexpression of huntingtin protein in the form of cytoplasmic aggregatesin third instar larval eye discs as detected by in vivo imaging and infixed tissues (Fig. 4L). Consequently, such adult flies exhibited roughen-ing and degeneration of eyes which increased with aging (Fig. 4N) andsubsequent pseudopupil analysis showed drastic loss of photoreceptors(see inset in Fig. 4N). Invariably, coexpression of dMyc showed constantrescue efficacy as found earlier and normal looking eye was re-established in UAS-eGFP-HttQ138-mRFP/GMR-Gal4/ UAS-dMyc flies(Fig. 4O) with considerable improvement in the photoreceptors(Fig. 4O inset). Moreover, coexpression of dMyc also resulted in signifi-cant reduction in the expression of huntingtin protein as recorded by in-vivo imaging (Fig. 4M). The difference in eGFP-HttQ138-mRFP aggrega-tion level was further established in seven days old adult fly head bydirectly observing the decapitated head under fluorescent microscope.Expression of eGFP-HttQ138-mRFP in adult head produced large andbrightly fluorescing aggregates distributed widely around the eye re-gion (Fig. 4P). Coexpression of dMyc resulted in substantial reductionin accumulation of eGFP-HttQ138-mRFP aggregates in seven days oldadult eyes and only a few ommatidia showed fluorescence (Fig. 4Q).Taken together, above studies clearly suggest that overexpression ofdMyc could potentially suppress the toxic effects of the multiple formsof the poly(Q) aggregates by altering their expression and subcellulardistribution dynamics.

Mitigation of poly(Q) toxicity by dMyc is not a consequence of inducedcell proliferation

Human form of Myc has been reported to play an important rolein cellular proliferation by inducing cells to enter into S-phase(Leone et al., 2001; Robinson et al., 2009). Moreover, aberrant

Fig. 4. Coexpression of dMyc reduces cellular apoptosis, toxicity and suppresses the formation of inclusion bodies. (A–C) Apoptotic signal is examined by staining with anti-cleavedcaspase-3. (A) No staining observed in wild type. (B) Robust caspase-3 activity is evident in UAS-SCA3trQ78(S)/GMR-Gal4. (C) Caspase-3 staining is reduced due to coexpressionof dMyc. (D–F) Cellular toxicity examined by staining with stress induced anti-HSP70. (D) Abundance of HSP70 is not detectable in wild type (E) GMR-Gal4 driven expression ofSCA3trQ78(S) resulted in significant expression of HSP70 in eye filed. (F) Expression of HSP70 is minimal and aggregate formation is also prevented by induced expression of dMyc inSCA3trQ78(S) background. (G–H) Localisation of poly(Q) proteins examined by staining with anti-HA. (G) Expression SCA3trQ78(S) forms inclusion bodies covering more than half ofeye field. (H) Coexpression of dMyc prevents formation of inclusion bodies. (I–J) Staining with anti-HA (green) and DAPI (red) to study the relative localization of poly(Q) aggregates.(I) Robust accumulation of poly(Q) aggregates (green) is evident inmagnified image. A substantial amount of poly(Q) aggregates colocalize with nucleus (red) and large inclusion bodiesare frequently visible. (J) Coexpression of dMyc prevents the formation of protein aggregates and residual amount poly(Q) proteins are localised in cytoplasm. (K)Western blot of proteinhomogenates from1 day old fly showing increased SDS solubility of poly(Q) aggregates following coexpression of dMyc.Most of the SDS insoluble protein aggregates are trapped in stack-ing gel following expression of SCA3trQ78(S). A significant reduction in the amount of trapped protein in stacking gel could be seen following expression of dMyc. α-tubulin was used asloading control. (L–M) GMR-Gal4 driven in-vivo expression dynamic of eGFP-HttQ138-mRFP aggregates. Expression of GFP has been shown in panels. (L) Expression of eGFP-HttQ138-mRFP shows high level of entangled huntingtin protein in eye field. (M) Coexpression of dMyc reduces the level of huntingtin protein. (N–O) Bright field images of adult eye surface(N) Expression of eGFP-HttQ138 causes roughening of eye surface and degeneration of photoreceptors (inset). (O) Coexpression of dMyc suppresses the roughening of eye surface andreduces degeneration of photoreceptors (inset). (P–Q) In vivo imaging of 7 days old adult heads showing comparative level of poly(Q) aggregates. (P) Bright expression of eGFP-HttQ138 is an indicative of robust accumulation of poly(Q) aggregate in adult eye. (Q) Coexpression of dMyc significantly reduces the accumulation of poly(Q) aggregates in adult eyes.


expression ofMyc has been found to be associatedwith several forms ofcancer (Lutz et al., 2002). In Drosophila, overexpression of dMyc resultsin increase in growth rates and cell size, however, its direct involvementin cellular proliferation has not been reported yet (Johnston et al., 1999;

Secombe et al., 2007). Therefore, in view of the possibility we askedwhether dMyc mediated suppression of poly(Q) toxicity was indeedachieved by re-entry in cell cycle and subsequent replacement ofdegenerating neuronal cells. To address this question, the level of


BrdU incorporation efficiency in third instar larval eye discs was exam-ined. In agreementwith the earlier reports, wild type eye disc (N = 26)exhibited maximum incorporation of BrdU in second mitotic wave re-gion (SMW), a region posterior to morphogenetic furrow where cellsundergo S-phase followed by wave of mitotic division (Escudero andFreeman, 2007; Yamaguchi et al., 1999) (Fig. 5A). Eye discs dissectedfrom UAS-SCA3trQ78(S)/GMR-Gal4 larvae (N = 28) showed inconsis-tency (74% discs exhibited reduced BrdU incorporation than wildtype) in the rate of BrdU incorporation (Fig. 5B) which could be due tothe toxic effect of poly(Q) aggregates and impaired transcriptionalefficiency (Cohen-Carmon and Meshorer, 2012). On the other hand,although coexpression of dMyc in poly(Q) background resulted inimproved BrdU incorporation in SMW region (N = 34), however, thelevel of incorporation was always found to be maintained as the wildtype or occasionally marginally less than that (compare Fig. 5A and C).The BrdU incorporation efficiency was not affected in other parts ofeye field in above genotypes. This study clearly demonstrated that themodulation in poly(Q) toxicity was not due to cell cycle re-entry andsubsequent replacement of degenerated neurons, rather some otherintrinsic properties of dMyc appeared to be responsible for improvedsurvivability of neuronal cells.

dMyc mediated suppression of poly(Q) toxicity is achieved by modulatingthe cellular abundance of CBP and improved histone acetylation

Sequestration of c-AMP response element binding protein (CBP) hasbeen implicated as a major factor responsible for poly(Q) inducedrepression of cellular transcriptional activity (McCampbell et al., 2000;Nucifora et al., 2001; Taylor et al., 2003). Moreover, reports suggestthat poly(Q) induced neurodegeneration makes a negative impact ontranscriptional efficiency of CBP (Taylor et al., 2003). dMyc has beenreported as a global transcriptional regulator and an interacting partnerof CBP, and together they bind to the E-box containing promoter regionof the genes to modulate gene expression (Vervoorts et al., 2003;Gallant, 2009). Therefore, we asked if expression of dMyc havemade any impact on the expression level and cellular distributionpattern of CBP.

We checked the level of CBP transcripts by semi quantitative reversetranscription-PCR (Fig. 5D1) and quantitative real time-PCR (Fig. 5D2),using total RNA isolated from one day old adult Drosophila heads(Taylor et al., 2003) using gene specific primers. In agreementwith ear-lier reports, level of CBP transcripts inUAS-SCA3trQ78(S)/GMR-Gal4wasfound to be critically reduced (Taylor et al., 2003) as compared to wildtype (Fig. 5D1, compare lane i-ii; also see D2). Coexpression of dMycwith UAS-SCA3trQ78(S)/GMRGal4 normalised the level of CBPtranscripts almost as the wild type (Fig. 5D1, lane iii; D2). Thereupon,we also asked whether overexpression of dMyc has any effect on thetranscriptional efficiency of CBP during normal homeostasis. Remark-ably, we observed an increase in the level of CBP transcripts followingoverexpression of dMyc in normal condition (Fig. 5D1, lane iv; D2).Subsequently, overexpression of SCA3trQ78(W) was also found todeplete CBP transcripts level which was normalised by coexpressionof dMyc (data not shown). Based on these investigationswehypothesisedthat the protective activity of dMyc on poly(Q) induced neurodegener-ation could be the operating by normalising the cellular abundance ofCBP.

The hypothesis was further validated by genetic interaction studiesusing UAS-CBP RNAi and UAS-CBP FLAD transgenic lines (Kumar et al.,2004; Ludlam et al., 2002). CBP-FLAD harbours a dominant negativemutation in acetyl transferase domain of CBP (Kumar et al., 2004).Although as reported earlier, downregulation of CBP using UAS-CBPRNAi or altering the CBP histone acetyltransferase activity using UAS-CBP FLAD under SCA3trQ78(S) background exacerbates the poly(Q)toxicity (Mallik and Lakhotia, 2010b), but we did not observe anygross phenotypic difference in such cases (not shown). We furtherobserved that downregulation or loss of CBP acetyltransferase activity

byUAS-CBP RNAi (N = 258) and/orUAS-CBP FLAD (N = 186) respective-ly, in UAS-SCA3trQ78(S)/GMR-GAL4/ UAS-dMyc background reduced theinability of dMyc to suppress the poly(Q) toxicity (Fig. 5E1-2). Theinability of dMyc to suppress the poly(Q) induced neurodegeneration inabove cases arise due to the fact that additional increase in CBP level iseither destroyed by CBP RNAi or by rendered non-functional by CBPFLAD. Therefore, the genetic interaction studies clearly indicated thatdMyc mediated rescue was indeed being channelized by increasedcellular level of CBP.

As overexpression of dMyc restores the level of CBP, the cellulardistribution and level of CBP protein were further examined by immu-nostaining to the eye disc with anti-CBP antibody (Lilja et al., 2003). Inwild type (N = 18), uniformly distributed basal level expression ofCBP was evident in the entire disc area (Fig. 5F). Consistent with ourRT-PCR data,GMR-Gal4 driven expression of SCA3trQ78(S) resulted in re-duced level of CBP in the entire eye field (N = 23; compare Figs. 5F-G).Subsequently, coexpression of dMyc increased the cellular abundance ofCBP to the near normal level (N = 25; compare Figs. 5F-H). The compar-ative distribution dynamics of CBP and poly(Q) were also performed byco-staining the imaginal discs with anti- CBP and anti-HA antibodies.Studies at higher magnification revealed bright and diffuse distributiondynamics of CBP in wild type cells (N = 15; Fig. 5I) whereas accumula-tion of poly(Q) aggregates in UAS-SCA3trQ78(S)/GMR-Gal4 resulted inrelatively reduced and abnormal staining pattern (N = 23; Fig. 5J). In-triguingly, some of the poly(Q) bearing cells exhibited complete loss ofCBP expression (inset in Fig. 5J, arrowhead). It was also observed thatCBP depleted cells exhibit propensity of early nuclear fragmentationand possibly degenerate early compare to the cells showing residualabundance of CBP. In this context it is important to note that earlierreports have also demonstrated similar kind of phenomenon in whichneuronal cells with poly(Q) aggregates were found to sequester endog-enous CBP and several of such cells were marked by complete loss ofCBP expression (Jiang et al., 2003; McCampbell et al., 2000; Nuciforaet al., 2001). In agreement with our earlier results, coexpression ofdMyc in SCA3trQ78(S) background normalised the cellular abundanceof CBP and wild type distribution pattern was restored (N = 26,compare Fig. 5I-K). Moreover, the interaction between CBP andpoly(Q) aggregates was also minimised in such cases as the level ofpoly(Q) proteins was significantly reduced and confined to the cytoplas-mic compartment.

Sequestration of CBP by poly(Q) aggregatesmakes a negative impacton the process of histone acetylation and reduces global transcriptionalactivities (McCampbell et al., 2000; Nucifora et al., 2001; Taylor et al.,2003). Earlier reports have confirmed that dMyc recruits histone acetyl-transferase to target chromatin and locally promotes hyper-activationof multiple lysine residues of H3 and H4 (Knoepfler et al., 2006;Martinato et al., 2008). Therefore, we checked the abundance ofacetylated histone in wild type, following accumulation of poly(Q)aggregates and after overexpressing dMyc in disease background.

The level of acetylated histone H3was analyzed in third instar larvaleye disc by staining with anti-acetylated histone H3 (ace-H3K9). Thewild type eye disc (N = 19) showed moderate level of stainingconfined to the nuclear compartments (Fig. 5L). In contrast, GMR-Gal4driven expression of SCA3trQ78(S) resulted in significant reduction inthe abundance of acetylated histoneH3 (N = 23, Fig. 5M). Interestinglycoexpression of dMyc in SCA3 background restored the level of histoneacetylation (N = 25, Fig. 5N). Moreover, majority of the SCA3trQ78(S)/GMR-Gal4/ UAS-dMyc discs even exhibited enhanced level of stainingcompared to wild type (compare Fig. 5L and N). Therefore, in view ofseveral reports, the higher level of histone acetylation could be directlyattributed with enhanced transcriptional efficiency (Knoepfler et al.,2006; Martinato et al., 2008; Taylor et al., 2003). Taken together,the above studies confirmed that dMyc mediated suppression ofpoly(Q) toxicity was actually accomplished by improving the cellulartranscriptional efficiency via restoring the level of CBP and histoneacetylation.

Fig. 5. dMyc does notmodulate poly(Q) toxicity by increasing the cellular proliferation; rather increase in the expression of CBP drives the rescuemechanism. (A–C) Cell division assessedby BrdU incorporation and subsequent staining with anti-BrdU. (A) Wild type shows incorporation of BrdU in secondmitotic wave (SMW) region (B) Expression of SCA3trQ78(S) causesinconsistent incorporation of BrdU in SMW region. (C) Coexpression of dMyc does not induce cellular proliferation but improves poly(Q) mediated defect of BrdU incorporation in SMWregion. (D) Relative level of CBPmRNAwas examined by semi-quantitative reverse transcription-PCR (1) and quantitative real time-PCR (2). (D1) lanes: i. wild type ii. UAS-78Q(S)/GMR-Gal4 iii. UAS-78Q(S)/GMR-Gal4/UAS-dMyc iv. UAS-dMyc/GMR-Gal4. (D2) Compare to wild type (1.0 ± 0.047), expression of SCA3trQ78(S) results in reduction of CBP mRNA to0.68 ± 0.036, which is almost normalized (0.98 ± 0.083) by coexpression of dMyc (bars in histograms represent mean value ± SD). Overexpression of dMyc in wild type backgroundresults in (1.47 ± 0.11) fold increase in CBP expression. (E) dMycmediated suppression of poly(Q) disorder is averted by downregulation of CBP using UAS-CBP-RNAi (1) or by suppress-ing CBP function by using dominant negative form of acetyl transferase domain of CBP using UAS-CBP-FLAD (2). (F–H) Anti-CBP staining in third instar larval imaginal discs (arrow in F–Hindicates eye field) (F) Wild type eyes show normal pattern of CBP expression. (G) Expression of SCA3trQ78(S) depletes the level of CBP in entire eye field. (H) Coexpression of dMyc re-stores the level of CBP throughout the eye field. (I–K) Co-stainingwith anti-CBP (green) and anti-HA (red) observed at highermagnification. (I) CBP is distributed diffusely in thewild typecells. (J) Expression of SCA3trQ78(S) sequesters the CBP protein. Complete loss of CBP staining could be noted in selective rhabdomeres of a given ommatidia (arrowheads in inset). (K)Coexpression of dMyc prevents sequestration of CBP and enhances its cellular abundance. (L–N) Staining with anti-acetylated form of histone H3 (ace-H3K9). (L)Wild type. (M) Expres-sion of SCA3trQ78(S) reduces the level of ace-H3K9. (N) Coexpression of dMyc enhances the level of ace-H3K9.


Discussion

Present study was focused on to identification of a novel geneticmodifier of poly(Q) diseases which could be utilised as a potentialdrug target. Our initial screening was largely influenced by some popu-lation studies in which significantly lower prevalence of cancer was

reported in patients with poly(Q) diseases than in the general popula-tion, and a common mechanism was suggested which may providesuch protection against the development of cancer (Ji et al., 2012;Sorensen et al., 1999). However, the cellular and molecular factorswhich cultivate this negative correlation between the poly(Q) diseasesand risk of developing cancer are largely enigmatic (Ji et al., 2012;


Sorensen et al., 1999). Based on above demographic findings, wehypothesised if the intrinsic properties of some proto-oncogenescould be exploited to dominantly suppress the progression of poly(Q)induced neurodegeneration. Consistent with the hypothesis, for thefirst timewe report that targeted overexpression of dMyc (a homologueof human c-Myc, a proto-oncogene) could potentially suppress the SCA3induced neurodegeneration inDrosophila. It is also interesting in view ofthe fact that accumulation of protein inclusion bodies and cellular de-generation was substantially reduced following overexpression ofdMyc in target tissues. In contrast, reduced expression of dMyc furtheraggravates the poly(Q) induced cellular toxicity and degeneration.Moreover, dMyc mediated mitigation of SCA3 phenotype was equallyeffective in suppressing the toxicity in both, the Drosophila eye andneurons of the central and peripheral nervous system(s).

The myc proto-oncogene family (c-myc, N-myc, and L-myc) isamongst one of the most studied genes in biology (Bellosta andGallant, 2010; Gallant, 2009; Meyer and Penn, 2008). Functioning as aproto-oncogene, Myc is often found to be overexpressed in variousforms of tumour (Lutz et al., 2002). It has been implicated in severalimportant biological functions such as transcriptional control, cellcycle progression, apoptosis, cell migration, cell adhesion, mi-RNA bio-genesis, stem cell behaviour etc. (Bellosta and Gallant, 2010; Lovénet al., 2012; Meyer and Penn, 2008; Takashashi and Yamanaka, 2006).The N-terminal transcription regulatory domain of Myc contains highlyconserved “Myc boxes” 1, 2 and 3 (MB, MB2 and MB3), and C-terminalposes basic region-helix-loop-helix-leucine zipper (BHLHZ) domain,which facilitates formation of heterodimer with another BHLHZ-domain protein, Max (“Myc-associated protein X”). As transcriptionalregulator, Myc:Max heterodimers recognise relatively less conservedsequence motif “E-boxes” (CACGTG) and activate the expression ofneighbouring genes (Amati et al., 1992; Gallant, 2009; Lovén et al.,2012). CBP has also been implicated as one the positive co-factors ofMyc which facilitates binding of the heterodimer with target DNAsequence (Vervoorts et al., 2003). Interestingly, Myc:Max dimers havealso been reported to repress a distinct set of target genes by interactingwith several transcription factors. Moreover, in a recent study Myc wasidentified as one of the factors required to induce stem cell characteris-tics in the fibroblast cells (Takashashi and Yamanaka, 2006). Interest-ingly, in spite of availability of a large amount of data it is difficult topropose a working model of c-Myc, since it modulates the expressionof a large number of assorted genes at a given developmental timepoint.

Drosophila genomeposes single homolog of human c-Myc, known asdMyc or diminutive (dm), performing diverse biological functions asnoted earlier (Bellosta and Gallant, 2010; Gallant, 2009). Enhancedlevel c-Myc in both mammalian and Drosophila cells stimulates rDNAtranscription as an integral feature of the augmented cell growth re-sponse toMyc (Grewal et al., 2005). Upregulation of dMyc in Drosophilaresults in enlargement of cell size and increased cellular transcription(Prober and Edgar, 2000; Secombe et al., 2007). Subsequently, targetedoverexpression of dMyc in Drosophila eye resulted in ommatidialenlargement and roughening of the eye surface (Prober and Edgar,2000). However, such eyes did not display any noticeable defect inneuronal differentiations. It was postulated that enlarged cell sizewhich was primarily achieved due to enhanced growth resultedin disorganised ommatidial arrangement that finally lead to the rough-ening of the eye surface (Prober and Edgar, 2000). Intriguingly, asdiscussed earlier, targeted overexpression of dMyc in poly(Q) back-ground not only resulted in reduction of cellular toxicity but the omma-tidial sizes also appeared reasonably normal (7% enlarged size), whichwas otherwise 33% larger (Secombe et al., 2007). It appears that dueto poly(Q) toxicity and subsequent reduction in transcriptional efficien-cy, dMycmediated increase in cell sizewas compromised in SCA3 back-ground and the rescue flies (UAS-SCA3trQ78(S)/GMR-Gal4; UAS-dMyc)achieved rather normal cellular size. Perhaps the functional dynamicsof dMyc in the presence of poly(Q) aggregates is somewhat different

than that in wild type. In this context it is also important to note thatwhen two dosages of dMyc were co-expressed with SCA3trQ78(S), theeyeswere similarly preserved aswith a single copy. Perhaps, expressionof Myc beyond a threshold level is not supported by the cells.

The cellular stress mediated by abnormal poly(Q) proteins inducesthe expression of inducible form of HSP70 which associate themselveswith the inclusion bodies (Chan et al., 2002; Warrick et al., 1999) andsubsequently trigger the apoptotic activity due to activation ofcysteine caspases, and lead to loss of selective neurons (Chen et al.,2000; Saudou et al., 1998). Overexpression of dMyc resulted in a signif-icant reduction of cellular poly(Q) aggregates with residual inclusionbodies mostly being restricted in the cytoplasmic compartments,which are reported to be relatively less deleterious compared to theirnuclear accumulation (Warrick et al., 1999). Though, we did not findany explicit in-situ colocalization or physical interaction betweendMyc and inclusion bodies. In Drosophila, role of dMyc in apoptosis issomewhat vague as contrasting evidences have been proposed(Montero et al., 2008; Secombe et al., 2007). In present case, dMycmediated reduction in cell death appeared to be a consequence of thesequestration or degradation of cellular inclusion bodies, increasedsolubility of poly(Q) aggregates and reduced toxicity burdens; whichmight have been achieved by inducing the expression of various surviv-al factors. Therefore, a substantial reduction in the abundance of nuclearinclusions bodies and their altered distribution dynamic could be theprimary responsible factor driving the subsequent rescue events.

While working upon themechanistic details we first postulated thatsince induction of c-Myc is known to induce S-phase entry and cellularproliferation in mammalian cells (Leone et al., 2001; Robinson et al.,2009); the rescue phenotype in present case might have been achievedby inducing cell cycle re-entry and subsequently by replacement ofdegenerating cells with newly dividing cells. However, as revealed bycomparative BrdU incorporation efficiency, coexpression of dMyc withSCA3trQ78(S) only stabilised the rate of cell division to the level ofwild type, and did not make any noticeable impact. Therefore, ourstudy clearly demonstrate that dMyc mediated mitigation of poly(Q)toxicity is not accomplished by increasing the rate of cell division,rather, some intrinsic properties of dMyc is commencing the rescuephenomenon.

Sequestration of potent transcriptional regulators by poly(Q) pro-teins have been suggested to be a key factor causing cellular toxicityand neuronal dysfunction (Dunah et al., 2002; McCampbell et al.,2000; Nucifora et al., 2001; Perez et al., 1998; Taylor et al., 2003; Tsoiet al., 2012). Many of the transcription factors comprise poly(Q)or glutamine rich domains, and in such cases, the poly(Q) tract them-selves serves as transcriptional activator (Gerber et al., 1994). Severaltranscriptional regulators comprising poly(Q) tracts such as Myocyteenhancer factor 2 (Mef2), C-terminal binding protein (dCtBP), Sin3A,Debra (dbr), Heat etc. get sequestered in inclusion bodies resultingin impairment of transcriptional machinery in disease condition (Bilenand Bonini, 2007; Bolger et al., 2007; Fernendez-Funez et al., 2000;Fujikake et al., 2008). In addition, sequestration of other essentialcellular proteins, e.g. chaperone proteins (Chan et al., 2002;Cummings et al., 1998; Waelter et al., 2001) and proteasome subunits(Cummings et al., 1998; DiFiglia et al., 1997; Waelter et al., 2001), etc.further exacerbates the transcriptional impairment. Therefore, in viewof a well-established role of c-Myc as a global transcriptional regulator(Eilers and Eisenman, 2008; Lovén et al., 2012), we hypothesised ifdMycmediatedpoly(Q) suppression is being accomplished bymodulat-ing the cellular transcriptional efficiency. Moreover, in view of the factthat CBP is a positive cofactor of c-Myc which binds to the carboxy-terminal region of the protein for subsequent regulation of gene expres-sion, we postulated that enhanced level of dMyc could positivelymodulate the expression of CBP which could then mitigate the toxiceffects of poly(Q) aggregates.

CBP is a transcriptional coactivator which is also essential to coordi-nate cellular responses to intracellular signals (Chan and La Thangue,

Fig. 6. Accumulation of poly(Q) proteins is associated with neuronal toxicity, cellulardysfunction and death. Our studies suggest that upregulation of dMyc modulates thecellular abundance of CBP. Enhanced level of CBP could inhibit the accumulation ofpoly(Q) aggregate by functioning directly as blocking peptide, and/or indirectly byimproving the status of histone acetylation which subsequently results in increasedtranscriptional activity. As suggested earlier, increased transcriptional activity negativelyregulate the aggregate formation, accelerate the process of poly(Q) degradation andprovide pro-survival ability.


2001). CBP has a repeat of 18 glutamines near its carboxy terminalwhich was reported to interact with the expanded poly(Q) repeats ofthe mutated proteins (McCampbell et al., 2000, 2001). This interactionnegatively affects the transcriptional activity of CBP, which has beensuggested as a major source of cellular toxicity (Jiang et al., 2006;McCampbell et al., 2000; Nucifora et al., 2001; Taylor et al., 2003). In ad-dition, CBP has also been attributed to be associatedwithmodulation ofpoly(Q) repeat instability in Drosophila disease model (Jung and Bonini,2007). In agreement with the earlier findings (Jiang et al., 2003, 2006;McCampbell et al., 2000; Nucifora et al., 2001), we also noted a signifi-cant reduction in the CBP expression following expression of SCA3 pro-tein in Drosophila. Moreover, some cells in a given ommatidia showedcomplete loss of CBP staining and propensity of early degeneration.

Regulated overexpression of CBP or enhancement of its activity hasbeen demonstrated to mitigate poly(Q) induced neurodegeneration(Taylor et al., 2003). Moreover, microarray analysis have demonstratedthat overexpression of CBP enables the cells to recuperate the standardlevel of gene expression which was otherwise compromised in poly(Q)disease condition (Taylor et al., 2003). We found that enhanced level ofdMyc induces the expression of CBP in SCA3 as well as in wild typebackground. Although upregulation in CBP expression was not robustin poly(Q) disease condition and the resulting level was relatively com-parable with that of wild type. On the other hand, dMycmediated over-expression of CBP was somewhat greater in case of wild type. At thispoint we do not know the exact underlying mechanism regulating thetranscriptional activation of CBP, however, dMyc mediated chromatinremodelling (Eilers and Eisenman, 2008) could be one of the leadingfactors whichmight be operating the above phenomenon. Subsequent-ly, our studies further demonstrated that apart from the expressionlevel, in-situ distribution pattern of CBP was also normalized followingexpression of dMyc. Therefore, it appeared that dMyc induced suppres-sion of poly(Q) toxicity was indeed being accomplished by regulatingthe cellular abundance of CBP. Genetic interaction studies furtherdemonstrated that downregulating the expression of CBP by UAS-CBPRNAiorUAS-CBP FLAD in poly(Q) background restricts the dMyc's abilityto mitigate the toxicity, which is only possible in the event of a directfunctional association between the cellular level of dMyc and CBP. Asfar as we are aware, this is the first report demonstrating a positivecorrection between the expression level of dMyc and CBP.

Interestingly, dMyc mediated suppression of poly(Q) toxicityshowed a striking contrast with some of the earlier known modifierssuch as Tpr2 and Mlf (Kazemi-Esfarjani, and Benzer, 2000a,b), inwhich overexpression of modifier gene did not make any significantimpact on the accumulation of inclusion bodies; whereas dMyc overex-pression was found to be directly associated with the reduced level ofprotein aggregates. In this context it is important to note that CBPmediated suppression of poly(Q) toxicity was also demonstrated to beassociated with the reduced level of inclusion bodies (Taylor et al.,2003). Above similarities further indicate that dMyc driven rescue ofpoly(Q) suppression might be actually operating by modulating theexpression of CBP.

CBP has also been demonstrated to harbour intrinsic acetyltransfer-ase activities which function in combination with various transcriptionfactors to finally regulate the expression of target genes by acetylatingthe histone components of chromatin core particles (Ogrysko et al.,1996). Process of histone acetylation alters the chromatin structure insuch a way that the DNA becomes more accessible to the transcriptionfactors. The ultimate status of nuclear histone acetylation is the outcomeof the relative activities of two opposing classes of proteins: the histoneacetyltransferase and the histone deacetylase, and a fine balancebetween the levels of two above proteins are essential to attain thedesired level of gene expression.

CBP functions as a potent poly(Q) modifier by modulating thestatus of histone acetylation and sequestration of CBP by poly(Q) pro-teins has been correlated with compromised acetyl transferase activity,which subsequently results in global transcriptional dysregulation

(McCampbell et al., 2000; Nucifora et al., 2001; Taylor et al., 2003). Inagreement with the noted function of CBP, it has been found that rever-sal of histone acetylation either by overexpression of CBP or by treatingwith histone deacetylase inhibitor drugs such as Suberoylanilidehydroxamic acid (SAHA), Trichostatin A (TSA) and sodium butyrateequally reduces the poly(Q) induced neurodegeneration (McCampbellet al., 2001; Steffan et al., 2001). In this context it is also important tonote that dMyc itself has been implicated in maintaining the acetylatedstate of histone proteins by functioning as a member of Myc/Max/Madbasic helix-loop-helix-zipper transcription factor (Knoepfler et al.,2006; Martinato et al., 2008). Therefore, dMyc's own intrinsic capabilityof modifying chromatin structure along with its ability to restore CBPlevel as found in present study prompted us to examine the level ofacetylated form of histone H3 (ace-H3K9).

In agreement with the earlier reports, accumulation of poly(Q)protein aggregates resulted in a significant reduction in the level ofH3-histone acetylation (Cohen-Carmon and Meshorer, 2012; Pennutoet al., 2009), which was restored following coexpression of dMyc. Infact, the level of histone acetylation was relatively higher in rescueflies than inwild type, which could be an additive effect of the increasedexpression of dMyc and CBP. However, any isolated role of dMyc inhistone acetylation seems to be minimal in the present case since in ab-sence of the desired level of CBP, dMyc mediated poly(Q) suppressionwas predominantly compromised. Thus, we believe that dMyc mediat-ed improved level of histone acetylation was essentially accomplishedby modulating the level of CBP.

In summary, we report dMyc as a novel modifier of poly(Q) diseasesin Drosophila. Although, earlier studies have identified oncogenicproteins such as dMlf1 (Drosophila myeloid leukaemia factor 1) andSrc42A as poly(Q) modifiers in Drosophila, but mechanistic detailshave not been worked out (Kaltenbach et al., 2007; Kazemi-Esfarjani,and Benzer, 2000b).We propose that dMycmitigates the poly(Q) toxic-ity by inducing the expression of CBPwhich in turn restores the status ofhistone acetylation (ace-H3k9), thereby increasing the transcriptionalactivities of the genes which either inhibit the formation of poly(Q) ag-gregate or accelerate the degradation pathway to remove the inclusionbodies (Fig. 6). In addition, CBP itself, by functioning as a polyglutaminepeptide, may directly prevent the interaction of polyglutamine mono-mers to form larger inclusion bodies (Kazantsev et al., 2002).

At this point we do not know if themodifier capacity of dMyc is alsoapplicable with other forms of neurodegenerative disorders since we


restricted our study to the Drosophila models of poly(Q) diseases. Ourstudy reveals a brighter side ofMycwhich is otherwise implicated in de-veloping various kinds of cancers. Moreover, in view of the increasingevidences that a single proto-oncogenic mutation may not be enoughto develop majority of cancer types; enriching the transcriptional activ-ity by finding a mean (such as activating drugs) to alter the expressionof Myc in poly(Q) disease conditions could be a novel therapeuticapproach to suppress the toxic effects of inclusion bodies. Moreover,our study also attempts to provide a possible explanation of the enigmaof poly(Q) patients showing resistance to the predisposition of cancer.It appears that reduced cellular abundance of CBP and subsequentcompromised activity of Myc in patients with poly(Q) disordersprovides an inherent immunity against cancer.

Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.nbd.2013.11.015.

Acknowledgment

We are thankful to Peter Gallant (University of Zurich, Switzerland),Justin P. Kumar (Indiana University, Bloomington, USA), J. Troy Littleton(Massachusetts Institute of Technology, USA) and the BloomingtonStock Center for providing different fly stocks used in this study. Wegratefully thank Bob Eisenman (Fred Hutchinson Cancer ResearchCenter, USA) for anti-dMyc and T. Lilja (Stockholm University, USA)for anti-CBP antibodies. This work was supported by research grant(Ref. no. BT/PR4937/MED/30/727/2012) from the Department ofBiotechnology (DBT), Government of India, New Delhi, to S.S. MDS issupported by the Senior Research Fellowship (SRF) from the Councilof Scientific and Industrial Research (CSIR), New Delhi. We also thankDelhi University for financial support under R&D scheme and CentralInstrumentation Facility (CIF) at South Campus for confocal microscopy.We are grateful to Nabanita Sarkar, Renu Yadav and Soram IdiyasanChanu for technical help.

References

Amati, B., Dalton, S., Brooks, M.W., Littlewood, T.D., Evan, G.I., Land, H., 1992. Transcrip-tional activation by the human c-Myc oncoprotein in yeast requires interactionwith Max. Nature 359, 423–426.

Bellosta, P., Gallant, P., 2010. Myc function in Drosophila. Genes Cancer 1, 542–546.Bilen, J., Bonini, N.M., 2007. Genome-wide screen for modifiers of ataxin-3

neurodgeneration in Drosophila. PLoS Genet. 3, 1950–1964.Bolger, T.A., Zhao, X., Cohen, T.J., Tsai, C.C., Yao, T.P., 2007. The neurodegenerative disease

protein ataxin-1 antagonizes the neuronal survival function of myocyte enhancerfactor-2. J. Biol. Chem. 282, 29186–29192.

Bonini, N.M., 1999. A genetic model for human polyglutamine-repeat disease in Drosoph-ila melanogaster. Philos. Trans. R. Soc. Lond. B Biol. Sci. 354, 1057–1060.

Branco, J., Al-Rahmani, I., Ukani, L., Perez, A.M., Fernandez-Funez, P., Rincon-Limas, D.,Botas, J., 2008. Comparative analysis of genetic modifiers in Drosophila points to com-mon and distinct mechanisms of pathogenesis among polyglutamine diseases. Hum.Mol. Genet. 17, 376–390.

Brand, A.H., Perrimon, N., 1993. Targeted gene expression as a means of altering cell fatesand generating dominant phenotypes. Development 118, 401–415.

Cashio, P., Lee, T.V., Bergmann, A., 2005. Genetic control of programmed cell death in Dro-sophila melanogaster. Semin. Cell Biol. 16, 225–235.

Chai, Y., Koppenhafer, S.L., Bonini, N.M., Paulson, H.L., 1999. Analysis of the role of heatshock proteins (Hsp) molecular chaperones in polyglutamine disease. J. Neurosci.19, 10338–10347.

Chan, H.M., La Thangue, N.B., 2001. p300/CBP proteins: HATs for transcriptional bridgesand scaffolds. J. Cell Sci. 114, 2363–2373.

Chan, H.Y., Warrick, J.M., Andriola, I., Merry, D., Bonini, N.M., 2002. Genetic modulation ofpolyglutamine toxicity by protein conjugation pathways in Drosophila. Hum. Mol.Genet. 11, 2895–2904.

Chen, M., Ona, V.O., Li, M., Ferrante, R.J., Fink, K.B., Zhu, S., Bian, J., Guo, L., Farrell, L.A.,Hersch, S.M., et al., 2000. Minocycline inhibits caspase-1 and caspase-3 expressionand delays mortality in transgenic mouse model of Huntington's disease. Nat. Med.6, 797–801.

Chew, S.K., Akdemir, F., Chen, P., Lu, W.J., Mills, K., Daish, T., Kumar, S., Rodriquez, A.,Abrams, J.M., 2004. The apical caspase dronc governs programmed cell death in Dro-sophila. Dev. Cell 7, 897–907.

Cohen-Carmon, D., Meshorer, E., 2012. Polyglutamine (polyQ) disorders: the chromatinconnection. Nucleus 3, 433–441.

Cummings, C.J., Mancini, M.A., Antalffy, B., DeFranco, D.B., Orr, H.T., Zoghbi, H.Y., 1998.Chaperone suppression of aggregation and altered subcellular proteasome localiza-tion imply protein misfolding in SCA1. Nat. Genet. 19, 148–154.

DiFiglia, M., Sapp, E., Chase, K.O., Davies, S.W., Bates, G.P., Vonsattel, J.P., Aronin, N., 1997.Aggregation of huntingtin in neuronal intranuclear inclusions and dystrophicneurites in brain. Science 277, 1990–1993.

Dunah, A.W., Jeong, H., Griffin, A., Kim, Y.M., Standaert, D.G., Hersch, S.M., Mouradian,M.M., Young, A.B., Tanese, N., Krainc, D., 2002. Sp1 and TAFII130 transcriptional activ-ity disrupted in early Huntington's disease. Science 296, 2238–2243.

Eilers, M., Eisenman, R.N., 2008. Myc's broad reach. Genes Dev. 22, 2755–2766.Escudero, M., Freeman, M., 2007. Mechanism of GI arrest in the Drosophila eye imaginal

disc. BMC Dev. Biol. 7, 13.Everett, C.M., Wood, N.W., 2004. Trinucleotide repeats and neurodegenerative disease.

Brain 127, 2385–2405.Fan, Y., Bergmann, A., 2010. The cleaved-Caspase-3 antibody is a marker of Caspase-9-like

DRONC activity in Drosophila. Cell Death Differ. 17, 534–539.Fernendez-Funez, P., Nino-Rosales, M.L., de Gouyon, B., She, W.C., Luchak, J.M., Martinez,

P., Turiegano, E., Benito, J., Capovilla, M., Skinner, P.J., et al., 2000. Identification ofgenes that modify ataxin-1 induced neurodegeneration. Nature 408, 101–106.

Franceschini, N., 1972. Pupil and Pseudopupil in the Compound Eye of Drosophila. In:Wehner, R. (Ed.), Information processing in the visual system of anthropods. SpringerVerlag, Berlin, pp. 75–82.

Fujikake, N., Nagai, Y., Popiel, H.A., Okamato, Y., Yamaguchi, M., Toda, T., 2008. Heat shocktranscription factor 1-activating compounds suppress polyglutamine-induced neuro-degeneration through induction of multiple molecular chaperones. J. Biol. Chem. 283,26188–26197.

Gallant, P., 2009. Drosophila Myc. Adv. Cancer Res. 103, 111–144.Gerber, H.P., Seipel, K., Georgiev, O., Hofferer, M., Hug, M., Rusconi, S., Schaffner, W., 1994.

Transcription activation modulated by homopolymeric glutamine and prolinestretches. Science 263, 808–811.

Ghosh, S., Feany, M.B., 2004. Comparison of pathways controlling toxicity in the eye andbrain in Drosophila models of human neurodegenerative diseases. Hum. Mol. Genet.13, 2011–2018.

Grewal, S.S., Li, L., Orian, A., Eisenman, R.N., Edgar, B.A., 2005. Myc-dependent regulationof ribosomal RNA synthesis during Drosophila development. Nat. Cell Biol. 7,295–302.

Gunawardena, S., Goldstein, L.S., 2001. Disruption of axonal transport and neuronal viabil-ity by amyloid precursor protein mutation in Drosophila. Neuron 32, 389–401.

Hay, B.A., Wolff, T., Rubin, G.M., 1994. Expression of baculovirus P35 prevents cell death inDrosophila. Development 120, 2121–2129.

Hay, B.A., Wassarman, D.A., Rubin, G.M., 1995. Drosophila homologs of baculovirus inhib-itor of apoptosis proteins function to block cell death. Cell 63, 1253–1262.

Ji, J., Sundquist, K., Sundquist, J., 2012. Cancer incidence in patients with polyglutaminediseases: a population-based study in Sweden. Lancet Oncol. 6, 642–648.

Jiang, H., Nucifora Jr., F.C., Ross, C.A., DeFranco, D.B., 2003. Cell death triggered bypolyglutamine-expanded Huntingtin in a neuronal cell line is associated with degra-dation of CREB-binding protein. Hum. Mol. Genet. 12, 1–12.

Jiang, H., Poirier, M.A., Liang, Y., Pei, Z., Weiskittel, C.E., Smith, W.W., DeFranco, D.B., Ross,C.A., 2006. Depletion of CBP is directly linked with cellular toxicity caused by mutanthuntingtin. Neurobiol. Dis. 23, 543–551.

Johnston, L.A., Prober, D.A., Edgar, B.A., Eisenman, R.N., Gallant, P., 1999. Drosophila Mycregulates cellular growth during development. Cell 98, 779–790.

Jung, J., Bonini, N., 2007. CREB-binding proteinmodulates repeat instability in aDrosophilamodel for the polyQ disease. Science 315, 1857–1859.

Kaltenbach, L.S., Romero, E., Becklin, R.R., Chettier, R., et al., 2007. Huntingtin interactingproteins are genetic modifiers of neurodegeneration. PLoS Genet. 3, e82.

Kazantsev, A., Walker, H.A., Slepko, N., Bear, J.E., Preisinger, E., Steffan, J.S., Zhu, Y.Z.,Gertler, F.B., Houseman, D.E., Marsh, J.L., et al., 2002. A bivalent Huntingtin bindingpeptide suppresses polyglutamine aggregation and pathogenesis in Drosophila. Nat.Genet. 30, 367–376.

Kazemi-Esfarjani, P., Benzer, S., 2000a. Genetic suppression of polyglutamine toxicity inDrosophila. Science 287, 1837–1840.

Kazemi-Esfarjani, P., Benzer, S., 2000b. Suppression of polyglutamine toxicity by a Dro-sophila homolog of myeloid leukemia factor 1. Hum. Mol. Genet. 11, 2657–2672.

Knoepfler, P.S., Zhang, X.Y., Cheng, P.F., Gafken, P.R., McMahon, S.B., Eisenman, R.N., 2006.Myc influences global chromatin structure. EMBO J. 25, 2723–2734.

Kumar, J.P., Jamal, T., Doetsch, A., Turner, F.R., Duffy, J.B., 2004. CREB binding protein func-tions during successive stages of eye development in Drosophila. Genetics 168,877–893.

Landes, C., Bates, G.P., 2004. Huntingtin and the molecular pathogenesis of Huntington'sdisease. Fourth in molecular medicine review series. EMBO Rep. 10, 958–963.

Leone, G., Sears, R., Huang, E., Rempel, E., Nuckolls, F., Park, C.H., Giangrande, P., Wu, L.,Saavedra, H.I., Field, S.J., et al., 2001. Myc requires the distinct E2F activities to induceS phase and apoptosis. Mol. Cell 8, 105–113.

Lilja, T., Qi, D., Stabell, M., Mannervik, M., 2003. The CBP coactivator functions both up-stream and downstream of Dpp/Screw signaling in the early Drosophila embryo.Dev. Biol. 262, 294–302.

Lin, D.M., Goodman, C.S., 1994. Ectopic and increased expression of Fasciclin ΙΙ alters mo-toneuron growth cone guidance. Neuron 13, 507–523.

Lin, X., Antalffy, B., Kang, D., Orr, H.T., Zoghbi, H.Y., 2000. Polyglutamine expansion down-regulates specific neuronal genes before pathologic changes in SCA1 Nat. Neurosci. 3,157–163.

Lovén, J., Orlando, D.A., Sigova, A.A., Lin, C.Y., Rahl, P.B., Burge, C.B., Levens, D.L., Lee, T.I.,Young, R.A., 2012. Revisiting global gene expression analysis. Cell 151, 476–482.

Lu, B., Vogel, H., 2009. Drosophila models of neurodegenerative diseases. Annu. Rev.Pathol. Mech. Dis. 4, 315–342.

Ludlam, W.H., Taylor, M.H., Tanner, K.G., Denu, J.M., Goodman, R.H., Smolik, S.M., 2002.The acetyltransferase activity of CBP is required for the wingless activation and H4acetylation in Drosophila melanogaster. Mol. Cell. Biol. 22, 3832–3841.



http://refhub.elsevier.com/S0969-9961(13)00328-8/rf0005
















































































































Lutz, W., Leon, J., Eilers, M., 2002. Contribution of Myc to tumorigenesis. Biochim. Biophys.Acta 1602, 61–71.

Mallik, M., Lakhotia, S.C., 2009. RNAi of the large non-coding hsromega transcripts sup-presses polyglutamine pathogenesis in Drosophila models. RNA Biol. 6, 464–478.

Mallik, M., Lakhotia, S.C., 2010a. Modifiers andmechanisms of multi-system polyglutamineneurodegenerative disorders: lessons from fly models. J. Genet. 89, 497–526.

Mallik, M., Lakhotia, S.C., 2010b. Improved activities of CREB binding protein, heteroge-neous nuclear ribonucleoproteins and proteasome following downregulation of non-coding hsromega transcripts help suppress poly(Q) pathogenesis in fly models.Genetics 184, 927–945.

Martinato, F., Cesaroni, M., Amati, B., Guccione, E., 2008. Analysis of Myc-induced histonemodification on target chromatin. PLoS ONE 3, e3650.

McCampbell, A., Taylor, J.P., Taye, A.A., Robitschek, J., Li, M., Merry, D., Chai, Y., Paulson, H.,Sobue, G., Fischbeck, K.H., 2000. CREB-Binding protein sequestration by expandedpolyglutamine. Hum. Mol. Genet. 9, 2197–2202.

McCampbell, A., Taye, A.A., Whitty, L., Penney, E., Steffen, J.S., Fischbeck, K.H., 2001. His-tone deacetylase inhibitors reduce polyglutamine toxicity. Proc. Natl. Acad. Sci. U. S.A. 98, 15179–15184.

Meier, P., Silke, J., Leevers, S.J., Evan, G.I., 2000. The Drosophila caspase DRONC is regulatedby DIAP1. EMBO J. 19, 598–611.

Meyer, N., Penn, L.Z., 2008. Reflecting on 25 years of Myc. Nat. Rev. Cancer 8, 976–990.Montero, L., Muller, N., Gallant, P., 2008. Induction of apoptosis by Drosophila Myc. Gene-

sis 46, 104–111.Nucifora Jr., F.C., Sasaki, M., Peters, M.F., Huang, H., Copper, J.K., Yamada, M., Takashashi,

H., Tsuji, S., Troncosco, J., Dawson, V.L., et al., 2001. Interference by Huntington andatrophin-1 with cbp-mediated transcription leading to cellular toxicity. Science291, 2423–2428.

Ogrysko, W., Schiltz, R.L., Russanova, V., Howard, B.H., Nakatani, Y., 1996. The transcrip-tional coactivators p300 and CBP are histone acetyltransferases. Cell 87, 953–959.

Paulson, H., 2012. Machado-Joseph disease/spinocerebellar ataxia type 3. Handb. Clin.Neurol. 103, 437–449.

Pennuto, M., Palazzolo, I., Poletti, A., 2009. Post-translational modifications of expandedpolyglutamine proteins: impact on neurotoxicity. Hum. Mol. Genet. 18, R40–R47.

Perez, M.K., Paulson, H.L., Pendse, S.J., Saionz, S.J., Bonini, N.M., Pitman, R.N., 1998. Recruit-ment and role of nuclear localization in polyglutamine-mediated aggregation. J. CellBiol. 143, 1457–1470.

Prober, D.A., Edgar, B.A., 2000. Ras1 promotes cellular growth in the Drosophilawing. Cell100, 435–446.

Quinn, W.G., Harris, W.A., Benzer, S., 1974. Conditioned behaviour in Drosophila eyes.Proc. Natl. Acad. Sci. U. S. A. 71, 708–712.

Robinson, K., Asawachaicharn, N., Galloway, D.A., Grandori, C., 2009. c-Myc accelerates S-phase and requires WRN to avoid replication stress. PLoS ONE 4, e5951.

Saudou, F., Finkbeiner, S., Devys, D., Greenberg, M.E., 1998. Huntingtin acts in the nucleusto induce apoptosis but death does not correlate with the formation of intracellularinclusions. Cell 95, 55–66.

Secombe, J., Li, L., Carlos, L., Eisenman, R.N., 2007. The Trithorax group protein Lid is atrimethyl histone H3K4 demethylase required for dMyc-induced cell growth. GenesDev. 21, 537–551.

Seidel, K., den Dunnen, W.F., Schultz, C., Paulson, H., Frank, S., de Vos, R.A., Brunt, E.R.,Deller, T., Kamipinga, H.H., Rub, U., 2010. Axonal inclusions in spinocerebellar ataxiatype 3. Acta Neuropathol. 120, 449–460.

Shimohata, T., Nakajima, T., Yamada, M., Uchida, C., Onodera, O., Naruse, S., Kimura,T., Koide, R., Nozaki, K., Sano, Y., et al., 2000. Expanded polyglutamine stretchesinteract with TAFΙΙ130, interfering with CREB-dependent transcription. Nat.Genet. 26, 29–36.

Sorensen, S.A., Fenger, K., Olsen, J.H., 1999. Significantly lower incidence of cancer amongpatients with Huntington disease: an apoptotic effect of an expanded polyglutaminetract? Cancer 86, 1342–1346.

Steffan, J.S., Bodai, L., Pallos, J., Poelman, M., McCampbell, A., Apostol, B.L., Kazantsev, A.,Schmidt, E., Zhu, Y.Z., Greenwald,M., et al., 2001. Histone deacetylase inhibitors arrestpolyglutamine-dependent neurodegeneration in Drosophila. Nature 413, 739–743.

Takashashi, K., Yamanaka, S., 2006. Induction of pluripotent stem cells from mouse em-bryonic and stem fibroblast cultures by defined factors. Cell 126, 663–676.

Taylor, J.P., Taye, A.A., Campbell, C., Kazemi- Esfarjani, P., Fischbeck, K.H., Min, K.T., 2003.Aberrant histone acetylation, altered transcription, and retinal degeneration in a Dro-sophila model of polyglutamine disease are rescued by CREB-binding protein. GenesDev. 17, 1463–1468.

Tsoi, H., Lau, T.C., Tsang, S.Y., Lau, K.F., Chan, H.Y., 2012. CAG expansion induces nucleolarstress in polyglutamine disease. Proc. Natl. Acad. Sci. U. S. A. 109, 13428–13433.

Velazquez, J.M., Sonoda, S., Bugaisky, G., Lindquist, S., 1983. Is the major Drosophila heatshock protein present in cells that have not been heat shocked? J. Cell Biol. 96,286–290.

Vervoorts, J., Luscher-Firzlaff, J.M., Rottmann, S., Lilischkis, R., Walsemann, G., Dohmann,K., Austen, M., Luscher, B., 2003. Stimulation of c-Myc transcription activity and acet-ylation by recruitment of the cofactor CBP. EMBO Rep. 4, 484–490.

Waelter, S., Boeddrich, A., Lurz, R., Scherzinger, E., Lueder, G., Lehrach, H., Wanker, E.E.,2001. Accumulation of mutant huntingtin fragments in aggresome-like inclusionbodies as a result of insufficient protein degradation. Mol. Biol. Cell 12, 1393–1407.

Warrick, J.M., Chan, H.Y., Gray-Board, G.L., Chai, Y., Paulson, H.L., Bonini, N.M., 1999. Sup-pression of polyglutamine-mediated neurodegeneration in Drosophila by molecularchaperone HSP70. Nat. Genet. 23, 425–428.

Weiss, K.R., Kimura, Y., Lee, W.C., Littleton, J.T., 2012. Huntingtin aggregation kinetics andtheir pathological role in Drosophila Huntington's disease model. Genetics 190,581–600.

Yamaguchi, M., Hirose, F., Inoue, Y.H., Shiraki, M., Hayashi, Y., Nishi, Y., Matsukage, A.,1999. Ectopic expression of human p53 inhibits entry into S phase and induces apo-ptosis in the Drosophila eye imaginal disc. Oncogene 18, 6767–6775.

Yang, M.Y., Armstrong, J.D., Vilinsky, I., Strausfeld, N.J., Kaiser, K., 1995. Subdivision of theDrosophila mushroom bodies by enhancer-trap expression patterns. Neuron 15,45–54.



















































































Supplementary data

Fig. S1.

Fig. S1. (A) Coexpression of UAS-GFP with SCA3trQ78(S) does not make any phenotypic difference. (B) Coexpression of DIAP1 improves the poly(Q) phenotype, though at lower magnitude compared to dMyc (compare with Fig. 1 C).

Fig. S2.

Fig. S2. Coexpression of dMyc suppresses the poly(Q) induced defects in 55 h old pupal eye disc. (A–C) Immunoataining with anti-Elav, (A) Wild type shows floral arrangement of photoreceptor cells. (B) Expression of SCA3trQ78(S) disturbs the normal development of photoreceptor cells. (C) Coexpression of dMyc restores the normal pattern of photoreceptor cells. (D–F) Immunostaining with anti-Dlg (D) Wild type eye showing normal arrangement of ommatidial cells and bristles. (E) Expression of SCA3Q78(S) affects the development of various ommatidial cells including primary, secondary, tertiary and cone cells. The ommatidial bristles also show abnormal arrangement. (F) Coexpression of dMyc suppresses overall defects in ommatidial arrays. (G–I) Immunostaining with anti-armadillo (G) Wild type shows normal ommatidial lattice and photoreceptors. (H) Expression of SCA3trQ78(S) adversely affects the ommatidial lattice, cellular architecture and development of photoreceptors. (I) Coexpression of dMyc suppresses the defects in ommatidial lattice and prevents degeneration of photoreceptors.

Fig. S3.

Fig. S3. Coexpression of dMyc with SCA3trQ78(W) rescues degeneration of photoreceptors and reduces the expression of poly(Q) protein. (A–C) External morphology of 15 days old adult Drospophila eye. (A) Wild type. (B) Expression of SCA3trQ78(W) causes partial depigmentation of eye with slight roughening. (C) External eye surface is completely rescued by coexpression of dMyc. (D–F) Pseudopupil image of 5 days old adult eye. (D) 7 photoreceptors are observed in wild type. (E) Absence of photoreceptors due to expression of SCA3trQ78(W). (F) Coexpression of dMyc suppresses degeneration of photoreceptors and 5–7 photoreceptors are found in each ommatidia. (G–H) Immunostaining with anti-HA. (G) poly(Q) protein is distributed abundantly in cytoplasm due to expression of SCA3trQ78(W) and inclusion bodies are formed in few rows in the posterior region of eye field. (H) Coexpression of dMyc reduces the total poly(Q) protein and abundance of inclusion bodies.

Fig. S4.

Fig. S4. dMyc suppresses the poly(Q) mediated cell death. (A–C) Acridine orange staining of larval eye discs. (A) No staining could be observed in wild type. (B) Large number of cells shows positive acridine orange staining due to expression of SCA3trQ78(S). (C) Coexpression of dMyc reduces abundance of acridine orange positive cells.

neurobiology of disease - university of delhidu.ac.in › du › uploads › research › best...

Documents