neuronal activity after cocaine self-administration. an ... dissertation.pdf · chapter 4...

Chapter 1

1

Neuronal activity after cocaine self-administration.

An anatomical study of prefrontal cortex-basal

ganglia circuits in rats

Ping Gao

Chapter 1

2

Neuronal activity after cocaine self-administration. An anatomical study of prefrontal

cortex-basal ganglia circuits in rats.

Amsterdam UMC, Vrije Universiteit Amsterdam, Department of Anatomy and Neurosciences,

Amsterdam Neuroscience, Amsterdam, The Netherlands

The research conducted in this thesis was carried out at the department of Anatomy and

Neurosciences at Vrije Universiteit Amsterdam, Amsterdam Neuroscience and the

department of Translational Neuroscience, Brain Center Rudolf Magnus at University

Medical Center Utrecht.

The research was financially supported by the Netherlands Organisation for Health Research

and Development (ZonMw) Grant 9120700.

Cover design: Ping Gao

Printed by: GVO drukkers & vormgevers B.V.

ISBN: 978-94-6332-529-5

Chapter 1

3

VRIJE UNIVERSITEIT

NEURONAL ACTIVITY AFTER COCAINE SELF-ADMINISTRATION

AN ANATOMICAL STUDY OF PREFRONTAL CORTEX-BASAL GANGLIA

CIRCUITS IN RATS

ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad Doctor aan

de Vrije Universiteit Amsterdam,

op gezag van de rector magnificus

prof.dr. V. Subramaniam,

in het openbaar te verdedigen

ten overstaan van de promotiecommissie

van de Faculteit der Geneeskunde

op dinsdag 15 oktober 2019 om 13.45 uur

in de aula van de universiteit,

De Boelelaan 1105

door

Ping Gao

geboren te Xinjiang, China

Chapter 1

4

promotoren: prof.dr. H.J. Groenewegen

prof.dr. L.J.M.J. Vanderschuren

copromotor: dr. P. Voorn

Chapter 1

5

水调歌头

苏轼【宋】

丙辰中秋，欢饮达旦，大醉，作此篇。兼怀子由。

明月几时有，把酒问青天。

不知天上宫厥，今夕是何年？

我欲乘风归去，又恐琼楼玉宇，

高处不胜寒。

起舞弄清影，何似在人间！

转朱阁，低绮户，照无眠。

不应有恨，何事长向别时圆？

人有悲欢离合，月有阴晴圆缺，

此事古难全。

但愿人长久，千里共婵娟。

Chapter 1

6

Chapter 1

7

Water Melody

Mid-Autumn of the Bing Chen year.

Having been drinking happily overnight, I am drunk.

I write this poem for my brother, Zi You.

When will the moon be clear and bright?

With a cup of wine in my hand, I ask the sky.

In the heavens on this night, I wonder what season it would be?

Riding the wind, there I would fly.

Yet I fear the crystal and jade mansions are much too high and cold for me.

Dancing with my moonlit shadow,

It does not seem like the human world.

The moon rounds the red mansion, stoops to silk-pad doors,

Shines upon the sleeplessness.

Bearing no grudge, why does the moon tend to be full when people are apart?

People experience sorrow, joy, separation and reunion.

The moon may be dim or bright, round or crescent shaped.

This imperfection has been going on since the olden days.

May we all be blessed with longevity.

Though thousands of miles apart,

We are still able to share the beauty of the moon together.

Su Shi [Song dynasty (1076)]

Reference for the English translation: Wikisource | Shuidiao Getou

Chapter 1

8

Chapter 1

9

CONTENTS

Chapter 1 General introduction 11

Chapter 2 Stable immediate early gene expression patters in 43

medial prefrontal cortex and striatum after long-term

cocaine self-administration

Chapter 3 A neuronal activation correlation in striatum and prefrontal 77

cortex of prolonged cocaine intake

Chapter 4 Heterogeneous neuronal activity in the lateral habenula 125

after short- and long-term cocaine self-administration in rats

Chapter 5 General discussion 153

Summary 171

Acknowledgements 175

About the author 179

Publications 181

Chapter 1

10

Chapter 1

11

Chapter 1

General introduction

Chapter 1

12

Theories of addiction - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 14

Positive reinforcement theory - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 14

Negative reinforcement theory - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 15 7

Incentive sensitization theory - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 16

Instrumental learning theory - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 17

Structures and circuits involved in drug addiction - - - - - - - - - - - - - - - - - - - - - - - - - - - 18

Prefrontal cortex - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 20

Striatum - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 22

Habenula - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 24

Mapping neuronal activity using immediate early gene expression - - - - - - - - - - - - - - - 26

Immediate early gene-based neural activity mapping - - - - - - - - - - - - - - - - - - - 26

Immediate early genes in cocaine addiction - - - - - - - - - - - - - - - - - - - - - - - - - - 27

The aim and structure of the present thesis - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 29

References - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 31

Chapter 1

13

Drug addiction is a chronic, relapsing brain disorder that is characterized by compulsive drug

seeking and taking in spite of negative consequences (Leshner, 1997; Volkow et al., 2016).

In the most recent Diagnostic and Statistical Manual of Mental Disorders (DSM-5) drug

addiction falls under the category ‘substance use disorder’ (SUD; DSM-5, American

Psychiatric Association [APA], 2013) in which compulsive drug use features prominently. In

the clinical diagnostic criteria, a series of behavioral symptoms and pharmacological

indicators are described including tolerance (i.e., markedly increased amounts of the

substance are needed for the same effect, or a markedly diminished effect with continued

use of the same amount of the substance), withdrawal, larger amounts or longer periods of

substance taking than intended, unsuccessful efforts to issue control over substance use, a

great deal of time or effort is spent in activities necessary to obtain the substance, important

social, occupational or recreational activities are given up or reduced because of substance

use, substance use is continued despite knowledge of having persistent physical or

psychological problems. Substance use disorder affects a sizable part of the population. It

has been established that 76 million people worldwide are addicted to alcohol (World Health

Organization, 2004), 29 million people are addicted to illicit drugs, such as opiates,

psychostimulants and cannabis (United Nations Office on Drugs and Crime, 2016) and 1.1

billion people smoke tobacco (World Health Organization, 2015), a substantial proportion of

which can be considered addicted. These large numbers and the personal and social

problems that are associated with drug addiction warrant research into the neurobiological

basis of drug addiction. In this thesis, we focus on addiction to cocaine.

Cocaine is a powerfully addictive stimulant drug. Its name comes from “coca” and the

alkaloid suffix “-ine”; the chemical name of cocaine is benzoylmethylecgonine. It is an

alkaloid ester that is extracted from the leaves of the coca plant. The three parts of its

chemical structure – the hydrophilic methyl ester moiety, the lipophilic benzoyl ester moiety,

and the carboxylic acid and hydroxyl groups of ecgonine – allow for rapid absorption through

nasal membranes and passage through the blood-brain barrier (Cocaine, PubChem, Open

Chemistry Database). Although cocaine also binds to noradrenaline and serotonin

transporters, its ability to bind to dopamine transporter (DAT) is important to the rewarding

effects of cocaine (Kuhar et al., 1991, Volkow et al., 1997). The DAT blockade prevents

dopamine from being transported back into the neuron from whence it was released. This

thereby leads to an accumulation of the neurotransmitter in the synaptic cleft and,

consequently, to amplification of dopaminergic signaling to the post-synaptic neurons

(Volkow et al., 1997). High concentrations of dopamine in the nucleus accumbens (NAc) are

critically implicated in mediating the rewarding effects of cocaine (Wise, 2004; Pierce and

Kumaresan, 2006; Veeneman et al., 2012). Likewise, dopamine in the dorsal part of striatum

is involved in the reinforcement of cocaine self-administration (Veeneman et al., 2012). In

Chapter 1

14

addition, in primates it has been shown that the density of DAT binding sites in both the

dorsal and ventral striatum are affected by cocaine in a dose- and exposure time-dependent

manner (Letchworth et al., 2001; Porrino et al., 2004).

As hinted upon above, cocaine has negative effects on multiple aspects of users'

lives, such as impaired brain development and function, reduced lifetime achievement,

increased risk of mental illness and multifaceted psychosocial harm (Volkow et al., 2012;

Volkow et al., 2014). Understanding the mechanisms through which intake of the drug leads

to substance use disorder will be important to find solutions for those problems. Therefore, in

the current thesis we focus on the neurobiological mechanisms of cocaine addiction, more

specifically on the functional alterations of several brain areas known to be involved in

addiction, i.e., the prefrontal cortex, striatum, and lateral habenula. In order to analyse the

changes that take place at the cellular level, we used a well-established rat model of cocaine

self-administration, focusing on changes that take place during the transition from initial to

prolonged intake of cocaine. In this introduction, we will first briefly outline four relevant

contemporary theories about the development of addiction. Subsequently, we will introduce

the various brain circuitries and regions that are thought to be involved in drug addiction.

Following a section about neural plasticity that forms the neural basis for behavioral

adaptations in these circuits, the specific aims of the thesis are formulated.

Theories of addiction

Over the years, several different theories about the development of addiction have been

proposed (Hyman et al., 2006; Edwards, 2016). Here, we will discuss four main

contemporary theories that focus on the neurobiological and psychological mechanisms

underlying addictive behavior. These theories emphasize the role of the basal ganglia and

related structures in drug addiction. In general, these theories play a crucial role in leading to

our hypothesis in this thesis.

Positive reinforcement theory

The positive reinforcement theory has been one of the most popular theories in analyzing the

mechanisms that possibly lead to drug addictive behavior (Wise, 1988; Wise and Koob,

2014). The term reinforcement is used to describe the relationship between behavior and its

consequences. For instance, positive reinforcement is subjectively linked to pleasure,

including drug-induced euphoria (Wise, 2008). In general terms, reinforcement is an event

that increases the probability of an instrumental or operant response upon which it is

Chapter 1

15

contingent. As Volkow et al., (2017) described recently, the motivation for drugs and drug

taking behavior is influenced by previous experience with the reinforcing stimuli (i.e. drugs)

that increase the probability and/or strength of a behavioral response (i.e. drug taking). Most

drugs that are self-administered by humans and animals act as positive reinforcers. Thus, it

has been hypothesized that drug self-administration is maintained because of the state (such

as euphoria) the drugs induce rather than the alleviation of unpleasant withdrawal symptoms

that they bring (Wise, 1988). Similarly, researchers argued that compulsive drug use is

maintained by the positive affective states that are repetitively generated (McAuliffe and

Gordon, 1974; Stewart et al., 1984). In recent years, Wise has modified his theory of

addiction by stating that addiction begins with the formation of habits through positive

reinforcement and emphasizing that positive reinforcement is crucial for establishing drug

seeking habits and reinstatement of drug seeking (Wise and Koob, 2014). In his opinion,

addiction starts when drug taking becomes regular, predictable and uninterrupted (Wise and

Koob, 2014).

Wise and colleagues agree with others that addictive drugs or drug experiences may

lead to changes in brain structures and functions, which can be expressed at the molecular

cellular level or on aspects of functional adaptation in neural circuits (Berke and Hyman,

2000; Lüscher and Malenka, 2011; Wise and Koob, 2014). In the studies of Berke and

Hyman, they described that addictive drugs may produce neuronal adaptation and/or

synaptic plasticity in brain. In their opinions, neuronal adaptation is mostly homeostatic

adaptation to drug administration, and it seems unlikely that homeostatic adaptations can

explain the nature of compulsive drug use or the persistence of relapse. In contrast, synaptic

plasticity can establish the association between the drug-related stimuli and specific

behaviors (such as drug seeking/taking behavior). The persistent changes in drug-induced

behavior is associated with the persistent alteration in synaptic connectivity (Berke and

Hyman, 2000). In addition, drug-induced persistence in plasticity is thought to influence

normal memory formation (Berke and Hyman, 2000). So, they argued that synaptic plasticity

plays important roles in the development of compulsive drug use. Holding a similar opinion,

Wise believes that development of memory traces for drug experiences in multiple memory

systems plays a key role in causing drug craving and compulsive drug seeking (Wise and

Koob, 2014).

Negative reinforcement theory

Negative reinforcement, like positive reinforcement, causes behavior to be repeated, but in

this case the action invokes avoidance behavior. The negative reinforcement theory refers to

a process by which the removal of an aversive stimulus, viz the psychological withdrawal

Chapter 1

16

symptoms, increases the probability of a response (Koob and Le Moal, 1997; Koob, 2013;

Koob et al., 2014). Koob emphasizes the predominance of negative reinforcement in driving

a pathological state of compulsion in his studies (Koob et al., 1989; Wise and Koob, 2014).

Considering that both positive and negative reinforcement play a role in addiction, Koob

argued that drug addiction is a process that progresses from a source of positive

reinforcement involving elements of impulsivity to sensitization of the brain stress and anti-

reward systems that involves elements of compulsivity (Wise and Koob, 2014). In this view,

the defining property of drug addiction is the implication of sensitization of anti-reward

systems. After chronic drug use, long-term and persistent dysregulation of neural circuits

develop via decreased function of brain reward system and recruitment of brain stress (anti-

reward) systems (Koob and Le Moal, 2008).

The process of drug addiction has been characterized as a cycle that consists of

three stages: 1) binge-intoxication stage, 2) withdrawal-negative effect stage, and 3)

preoccupation-anticipation stage. (see e.g. Koob and Le Moal, 1997, for review). The Binge-

intoxication stage can be conceptualized as measurements of acute drug reward that is

considered as positive reinforcer such as pleasure. The withdrawal-negative effect stage can

be defined as the presence of negative emotional signs of withdrawal that is driven by the

recruitment of anti-reward systems. The preoccupation-anticipation stage is associated with

“craving” and has been hypothesized to be a key factor of relapse (Koob and Le Moal, 2008).

Each of the three stages is associated with neurobiological changes in specific

neurocircuitries. Thus, changes in dopamine and opioid peptides in the basal ganglia are

associated with the binge-intoxication stage. Decreases in dopaminergic function in the

reward system and the recruitment of brain stress neurotransmitters in the extended

amygdala occur in the withdrawal-negative affect stage. Dysregulations of key projections

from the frontal cortex and allocortex to the basal ganglia and extended amygdala are found

in the preoccupation-anticipation stage (Koob and Volkow, 2016). These three stages

influence each other and become more and more intense, which eventually leads to

addictive behavior (Koob and Le Moal, 1997; Shen and Kalivas, 2013; Wise and Koob,

2014).

Incentive sensitization theory

The incentive sensitization theory was first proposed by Robinson and Berridge in 1993

(Robinson and Berridge, 1993). Its central thesis is that repeated exposure to addictive drugs

can persistently change brain cells and circuits that normally regulate the attribution of

incentive salience to stimuli (Robinson and Berridge, 2008). As described by Robinson and

Berridge, this theory addresses four main points: (1) potentially addictive drugs share the

Chapter 1

17

ability to alter brain organization; (2) brain systems that are changed during drug exposure

are normally involved in reward and incentive motivation; (3) the critical neuroadaptation for

addiction renders the brain reward systems hypersensitive to drugs or drug-associated

stimuli; (4) the sensitized neural systems mediate incentive salience (drug “wanting”) but not

the pleasurable or euphoric effects of drugs (drug “liking”) (Robinson and Berridge, 2000).

The reason for this dissociation is that brain “liking” mechanisms are separable from

“wanting” mechanisms, even for the same reward (Berridge and Robinson, 1998). In their

discussion of psychomotor sensitization and the neurobiology of such sensitization,

Robinson and Berridge argue that behavioral sensitization is associated with

neuroadaptations in the dopamine and nucleus accumbens-related circuitries (Berridge and

Robinson, 1998; Robinson and Berridge, 2001).

The main issues that fostered the incentive - sensitization theory included: (1) why do

some susceptible individuals undergo a transition from casual to compulsive drug use? (2)

why do addicted drug users compulsively seek drugs and find it so difficult to stop drug use?

In the view of Robinson and Berridge, reward-related psychological processes - the

development of incentive motivation - consists of two separate components: “liking”

representing subjective pleasure and “wanting” representing incentive salience attribution

(Robinson and Berridge, 2001, 2003). The severity of drug seeking behavior may not in all

cases be positively related to the severity of physical symptoms upon withdrawal, and drug

seeking behavior may continue even when physical withdrawal symptoms disappear

(Robinson and Berridge, 2008). For example, methamphetamine and cocaine, both of which

are highly addictive, may show different strength of physical withdrawal symptoms after

stopping drug use, when compared to heroin and alcohol. It suggests that drug-induced

sensitization of brain systems mediates incentive salience - a specific incentive-motivational

function – that causes drug use to become compulsive and enduringly “wanted”.

Instrumental learning theory

The instrumental learning theory of drug addiction was explicitly formulated by Trevor

Robbins and Barry Everitt in 1999 (Robbins and Everitt, 1999; Everitt et al., 2001; Everitt and

Robbins, 2005). The underlying basis of this theory is closely related to studies on drug-

associated conditioned stimuli (CSs). Presentation of CSs suggests drug availability and

evokes memories of the effects of previous drug use, which eventually lead to drug seeking

and taking behavior (Stewart et al., 1984; O'Brien et al., 1998; Childress et al., 1999;

Robbins and Everitt, 2002). The psychological process that may underlie the development of

drug addiction can be described in a number of sequential steps (Everitt, 2014), which

include in subsequent order initial voluntary drug seeking and taking, acquisition of drug self-

Chapter 1

18

administration, controlled drug use, habit formation, binges of drug seeking and taking,

compulsive drug use and relapse. In this process, drug seeking becomes more and more

under the control of drug-associated stimuli, it subsequently develops into a maladaptive

stimulus-response habit, and eventually becomes compulsive (Everitt and Robbins, 2016;

Everitt, 2018).

Relating the addictive behavior to striatal functions, Everitt and colleagues put forward

the hypothesis that the transition from voluntary to habitual drug seeking parallels the

transition of the involvement of ventromedial towards dorsolateral striatal systems (Everitt et

al., 2008). Furthermore, a progressive decrease in inhibitory control by the prefrontal cortex

over drug seeking behavior has also been hypothesized to be an important factor

contributing to the occurrence of compulsivity (Everitt and Robbins, 2005). Related to the

above-described theories, ‘drug taking’ and ‘drug seeking’ behavior have also been

distinguished by Everitt and co-workers, emphasizing that drug taking mostly involves the

reinforcement of simple lever presses while drug-seeking is significantly influenced by drug-

associated CSs (e.g. Everitt, 2014; Everitt and Robbins, 2016).

A general agreement has been reached that (mal)adaptations take place as a

consequence of drug exposure in diverse neural systems, concerning the development of

drug addiction, i.e. a controlled process of voluntary substance taking evolving into

compulsive drug seeking and taking. Theories of drug addiction have stressed the

importance of different “driving forces”, such as positive or negative reinforcement. Perhaps

the instrumental learning theory is most advanced in the sense that it predicts changes in the

functional involvement of particular networks, which are responsible for the behavioral

characteristics that define the subsequent stages in the development of addiction. In the

present thesis, our primary aim was to identify whether the functional control of striatum will

change from ventral to dorsal when cocaine self-administration progresses from a short-term

to a long-term period. We also aimed to explore the neurobiological and functional alterations

in prefrontal cortex in these two different periods.

Structures and circuits involved in drug addiction

As is clear from the account above, several brain structures are implicated in the

development and maintenance of drug addiction. In particular in the case of a

psychostimulant drug like cocaine, there is a central role for dopamine and the reward

circuitry in which this neurotransmitter plays a crucial role. This circuitry includes the

mesolimbic dopamine system arising in the VTA and targeting the ventral striatum,

prominently including the nucleus accumbens, and the prefrontal cortex. However, as implied

Chapter 1

19

by the work of Everitt and colleagues, the dorsal part of the striatum and the amygdala are

also involved in drug addiction (Everitt and Robbins, 2005; Murray et al., 2015; Everitt, 2016).

The latter structures are intimately interconnected in various basal ganglia-thalamocortical

circuits that are all modulated by the dopaminergic system. Several loop systems involve

different parts of the prefrontal cortex, the striatum, downstream basal ganglia structures and

different thalamic (sub)nuclei that close these loops via projections back to the prefrontal

cortex (Fig. 1). Such cortical-subcortical loops are involved in different brain functions and,

on the one hand, have all their own outputs leading to various behavioral actions but, on the

other hand, appear to be interconnected at several neuronal levels in order to produce

coherent behavior (for recent reviews, see: Pennartz et al., 2009; Balleine and O’Doherty,

2010; Groenewegen et al., 2016). The cortical-subcortical loops that involve the ventral part

of the medial prefrontal cortex and the ventral or dorsomedial striatum, are involved in

stimulus-reward, goal-directed behaviors (Schultz, 2002; Kelly, 2004; Voorn et al., 2004; Yin

et al., 2005; Hart et al., 2014). Loops involving the dorsal part of the medial prefrontal cortex

and the dorsolateral striatum are implicated in stimulus-response and habitual behaviors

(Voorn et al., 2004; Yin et al., 2004; Yin and Knowlton, 2006). According to Everitt and

colleagues, the ventral and dorsal loops are involved in the early and late phases

respectively of the development of drug addiction (Everitt and Robbins, 2005). In the course

of cocaine self-administration, from short- to long-term exposure, plastic brain changes take

place that change the functional role of different areas of the prefrontal cortex and

subregions of the striatum. These changes are of particular interest in the present study and

they are studied in detail in the different parts of our study.

In the reward circuitry, the role of dopamine is undisputed (Schultz., 2002; Wise.,

2002, 2004). Rewarding signals or signals predicting reward that reach the dopamine

neurons have been shown to arise from various sources, among others the amygdala and

superior colliculus (Schultz and Dickinson, 2000; Schultz W, 2002; Redgrave and Gurney,

2006). The role of the lateral habenula in mediating aversive stimuli that have an inhibitory

influence on the dopaminergic neurons has more recently been recognized through the work

of Hikosaka and colleagues (Ellison, 2002; Bromberg-Martin et al., 2010; Hikosaka, 2010). In

the context of the brain changes that take place with long-term use of addictive drugs such

as cocaine, aversive stimuli may also play a role. Therefore, in order to study plastic changes

that take place during long-term self-administration of cocaine, three brain regions were

thought to be a specific interest: the prefrontal cortex, the striatum and the lateral habenula.

In the following paragraphs we will discuss in some more detail the functional anatomy of

these brain areas as well as their presumed role in drug addiction, in particular related to

cocaine abuse.

Chapter 1

20

Fig. 1. Schematic diagram of brain structures and circuits implicated in drug addiction. Cortical

subregions secondary frontal area (FR2), anterior cingulate cortex (AC) and prelimbic cortex /

infralimbic cortex (PL/IL) send parallel glutamatergic projections (red) to dorsolateral parts of

caudate and putamen nuclei (CPdl), ventromedial part of caudate and putamen nuclei (CPvm) and

nucleus accumbens (Acb). These areas are further topographically connected with ventral anterior

thalamic nucleus (VA), globus pallidus (GP) and ventral pallidum (VP) respectively and modulate

gamma-aminobutyric acid (GABA)ergic transmission (Blue) in the basal ganglia. Glutamatergic

projections from lateral habenula (LHb) innervate the ventral tegmental area (VTA) dopamine

neurons directly or indirectly via GABAergic transmission in the rostromedial tegmental nucleus

(RMTg). VTA projects dopaminergic fibers (Green) back to the medial prefrontal cortex (AC, PL and

IL) and the ventral and dorsal part of striatum (Acb and CP).

Prefrontal cortex

The prefrontal cortex (PFC) in rats occupies a relatively extensive region of the rostral part of

the hemisphere, in particular at its medial, ventral and orbital sides. In general, the rat

prefrontal cortex is divided into medial, orbitofrontal and lateral areas (Uylings et al., 2003).

All three areas can be further subdivided into histologically and connectionally distinct

subareas. For example, the medial PFC (mPFC) consists of the dorsal and ventral anterior

cingulate, the prelimbic and the infralimbic areas. In view of the inputs from the amygdala,

Chapter 1

21

the prominent dopaminergic input from the ventral mesencephalon and the projections to the

ventral and medial striatum, the mPFC is of most interest for the present study.

Nevertheless, the orbitofrontal region will also receive some attention in subsequent

chapters. The latter prefrontal region can also be subdivided into different subareas with their

own unique input and output relations and distinct contributions to prefrontal functioning.

The results of a variety of studies have implicated the function of mPFC in controlling

drug-related behaviors (Goldstein and Volkow, 2002; Kalivas and Volkow, 2005; Goldstein

and Volkow, 2011). Pharmacological studies revealed the different contribution of the dorsal

and the ventral part of mPFC in the regulation of drug seeking. Whereas the dorsal part of

mPFC (the anterior cingulate and the dorsal part of the prelimbic area) is thought to drive a

drug seeking response, the ventral part of mPFC (the ventral part of the prelimbic area and

the infralimbic area) could either promote or inhibit drug seeking responses (Capriles et al.,

2003; McLaughlin and See, 2003; Riga et al., 2014; Moorman et al., 2015). For instance,

Mihindou et al. (2013) reported that in rats the flexibility and the strength of the ability to

inhibit cocaine seeking behavior is selectively dependent on the increased neuronal activity

in the prelimbic area. Microinjection of GABA agonist into the dorsal part of mPFC reduced

cocaine reinstatement (McFarland and Kalivas, 2001) or reduced conditioned suppression of

cocaine seeking behavior (Limpens et al., 2015). Administration of a dopamine receptor

antagonist in prelimbic cortical areas or inactivation of this area could block the cocaine-

induced reinstatement (McFarland and Kalivas, 2001; Capriles et al., 2003; Stefanik et al.,

2013). Studies revealed that activation of the infralimbic cortex by microinjection of a positive

modulator of AMPA receptor suppressed cue-induced reinstatement of drug seeking

behavior (LaLumuere et al., 2012). Infralimbic inactivation via GABA agonists after extinction

training increased drug seeking behavior or evoked expression of the original cocaine

seeking response (Peters et al., 2008; LaLumuere et al., 2010). Taken together, these data

implicate the medial PFC as a crucial mediator of conditioned drug seeking behavior.

Chronic drug use may induce malfunction of the prefrontal cortex, that could lead to the

failure of cognitive inhibitory control over drug use, such as the impaired ability to inhibit

conditioned drug seeking (Jentsch and Taylor., 1999; Bechara, 2005; Goldstein and Volkow.,

2011).

Besides the medial prefrontal cortex, the orbitofrontal cortex (OFC) is also thought to

be crucial for the development of substance abuse, because of its role in mediating

compulsive drive, decision-making and expectancy (Schoenbaum and Shaham, 2008). In

previous studies, specific orbitofrontal subareas have been associated with certain

behavioral functions. For instance, the posterior portion of the orbitofrontal cortex is thought

to be related to emotional and autonomic aspects of compulsive behavior such as drug

craving (London et al., 2000; Bolla et al., 2003). During craving, associated activation of

Chapter 1

22

orbitofrontal cortex has been found to depend on the intensity of craving in addicted users

(Volkow and Fowler, 2000; Adinoff et al., 2001). When cocaine addicts obtained placebo or

remained in withdrawal, bilateral OFC hypo-activation could be observed (Volkow et al.,

1993; Adinoff et al., 2001). In addition, drug self-administration has been shown to affect the

structure, activity and function of OFC. Chronic exposure to cocaine or amphetamine

increased the dendritic length and spine density and changed cellular activity of OFC as

evidenced by accumulation of transcription factor deltaFosB (Crombag et al., 2005;

Winstanley et al., 2007). Lucantonio et al (2014) showed that after cocaine self-

administration deficits in insight and learning behavior in rats were associated with reduced

synaptic efficacy in OFC (which could be restored after optogenetic activation of OFC).

Moreover, not only the drugs themselves but also the presentation of drug-associated cues

could induce activation of OFC, which may be critical for mediating drug seeking behavior

(Childress et al., 1999; Volkow and Fowler, 2000). Together, these data suggest that OFC is

an important neural substrate in responding to cocaine exposure and that cocaine-induced

changes in OFC function are involved in the maladaptive behavior that is relevant to

addiction (Jentsch and Taylor, 1999; Porrino and Lyons, 2000; Lucantonio et al., 2012).

Striatum

The striatum forms the largest nucleus of the basal ganglia, situated just underneath the

cerebral cortex. In animals with a strongly developed internal capsule, among which

primates, there is a clear distinction within the striatum between the caudate nucleus medial

and the putamen lateral to the internal capsule. In addition, in the most rostroventral part of

the striatum, around the rostral tip of the lateral ventricle, the nucleus accumbens can be

delineated from the head of the caudate nucleus and the rostroventral part of the putamen.

However, the borders between these three striatal structures cannot be sharply defined. In

rats, in which we performed our experiments, the internal capsule is represented by an array

of fiber bundles that ‘perforate’ the striatum, making a clear distinction between the caudate

nucleus and putamen impossible. It is therefore indicated as the caudate-putamen complex.

The nucleus accumbens can be divided in an outer shell that medially, ventrally and laterally

encloses that centrally located core of the nucleus (Groenewegen et al., 1987; Zahm, 1999;

Voorn et al., 2004; Groenewegen et al., 2016).

A functional anatomical subdivision of the striatum is based on the patterns and

combinations of striatal inputs and outputs. There is a main distinction between the dorsal

and ventral striatum. The latter includes the nucleus accumbens, striatal elements of the

olfactory tubercle and ventromedial parts of the caudate-putamen complex; the dorsal

striatum consists of the remaining dorsal parts of the caudate-putamen (Heimer and Wilson,

Chapter 1

23

1975; Groenewegen et al., 2016). However, according to the patterns of inputs from

functionally different cortical and thalamic areas there appear to exist ‘slabs’ of striatal tissue,

oriented from ventrolateral to dorsomedial that combine unique sets of inputs and represent

functionally distinct striatal zones. The most ventromedial zone, located in the medial shell of

the nucleus accumbens, receives input from the infralimbic area and the paraventricular

thalamic nucleus and is, in addition, innervated by the hippocampus and amygdala.

Successively more dorsally and laterally located zones of the striatum receive inputs from

progressively more dorsally located medial prefrontal areas and from different nuclei in the

midline and intralaminar thalamus. The most dorsolateral striatal zone is innervated by the

sensorimotor cortex and the parafascicular thalamus and can therefore be characterized as

the sensorimotor striatum. In contrast, the ventromedial striatum represents its limbic part,

while striatal regions between these two extremes represent a gradient from limbic, via

associative/cognitive, to sensorimotor. The dopaminergic inputs also form a gradient such

that the ventral tegmental area in the medial part of the ventral mesencephalon (mesolimbic

system) projects primarily to ventromedial striatal regions while progressively more laterally

located dopaminergic neurons, located in the substantia nigra compacta, project to

progressively more dorsal and lateral striatal areas (nigrostriatal system). Dopamine, via

dopamine D1, D2 and D3 receptors, strongly modulates the transfer of information from

cortical regions to the output of the striatum. Cytoarchitectonically, GABAergic medium-sized

spiny neurons constitute 95% of the striatal neuronal population and they constitute the

output neurons of the striatum. The remaining 5% neurons consists of a variety of

interneurons that expresses different neurotransmitters and neuropeptides. Among these are

the larger cholinergic and GABAergic interneurons (Gerfen et al., 1990; Kawaguchi et al.,

1995). Cortical, thalamic as well as dopaminergic inputs strongly converge and interact at the

level of the medium-size spiny projection neurons. In the present thesis, we primarily focus

on the medium-size spiny neurons with respect to the plastic changes that take place under

the influence of cocaine.

There is a large body of evidence indicating a role for the ventral striatum in mediating

the (initial) reinforcing effects of cocaine (Carelli, 2004; Wise, 2004; Everitt and Robbins,

2005; Hyman et al., 2006; Pierce and Kumaresan, 2006). Indeed, dopamine release in the

striatum has been linked with the euphoric effects of the drug. Furthermore, cocaine seeking

behavior seems to be closely associated with changes in extracellular dopamine levels in the

nucleus accumbens in animals that self-administered cocaine (Caine and Koob, 1994;

Ikemoto, 2003; Di Ciano and Everitt, 2004; Bari and Pierce., 2005). It is important to note that

the nucleus accumbens core and shell are thought to control cocaine seeking differently (Ito

et al., 2004). The shell appears to mediate the primary rewarding effects of the drug while the

core mediates the incentive value of cocaine-conditioned stimuli (Pierce and Vanderschuren,

Chapter 1

24

2010). In response to drug or drug-related stimuli, increases of dopamine release in the

nucleus accumbens may result in goal-directed behavior that contributes to the reward

seeking behaviors in drug abuse (Willuhn et al., 2010). In contrast, changes in dopamine

levels in the dorsal striatum appear to be associated with drug seeking behavior when drug-

associated cues are presented (Ito et al., 2002). Bilateral infusions of a dopamine receptor

antagonist into the dorsolateral striatum selectively reduced cue-controlled cocaine seeking

habits in rats (Vanderschuren and Everitt, 2005). Together, these data suggest that the

ventral striatum regulates goal-directed behavior associated with the drug of abuse and that

the dorsolateral striatum plays a role in aspects of habitual stimulus-response-associated

drug seeking.

While it is at present generally accepted that both the ventral and dorsal striatum are

involved in cocaine addiction, Everitt and colleagues have postulated that these two striatal

regions play a role in different stages, i.e. from the initial phase of drug use up to the phase

of compulsive drug intake. Thus, while the ventral striatum seems to be primarily involved in

the early phase of drug intake, the later phase of habitual and compulsive intake appears to

depend on dorsal striatal regions.(Belin and Everitt, 2008). The progression from voluntary

compulsive drug use is associated with a shift of striatal control from the ventral to more

dorsal domains (Everitt and Robbins, 2005, 2013, 2016). In line with this theory, Porrino et

al., (2004) showed that in primates, five sessions of cocaine self-administration reduced the

glucose utilization in the ventral striatum and restricted areas of the dorsal striatum. If training

was extended to 100 days, the alteration of glucose utilization spread to the most

dorsolateral parts of the striatum.

Habenula

The habenula consists of a pair of small, and evolutionarily conserved structures, located in

the dorsomedial edge of the thalamus. Together with the epiphysis the habenula forms the

epithalamus. The habenula is composed of two subnuclei, i.e. the medial (MHb) and lateral

habenula (LHb) – in each hemisphere. It acts as a functional-anatomical node between the

forebrain and midbrain regions (Hikosaka et al., 2008). Whereas the MHb receives inputs

from the septum and projects mainly to the interpeduncular nucleus, the LHb receives limbic

and motor signals directly or indirectly from forebrain regions and projects mainly to neurons

in midbrain areas including the dopaminergic neurons in VTA and substantia nigra pars

compacta and to the serotoninergic neurons in raphe nuclei (Herkenham and Nauta, 1977,

1979; Araki et al., 1988; Geisler and Trimble, 2008; Hikosaka et al., 2008). The LHb is further

divided into lateral (LHbL) and medial (LHbM) subnuclei (Herkenham and Nauta, 1979). It

has been reported that the LHbL is mainly innervated by the basal ganglia, in particular the

Chapter 1

25

globus pallidus, while the LHbM receives inputs preferentially from the diagonal band

nucleus and the hypothalamus (Herkenham and Nauta, 1977; Aizawa et al., 2013).

The projections from the LHb to the ventral mesencephalon, in particular the

dopaminergic cell groups, deserve some special attention in the context of the present

thesis. Until quite recently the habenular projections were thought to directly influence the

dopaminergic neurons. However, it has now been shown that the LHb more strongly projects

to a GABAergic intermediary nucleus, the so-called rostromedial tegmental nucleus (RMTg)

which is located in the caudal region of the ventral tegmental area (Jhou et al., 2009; Balcita-

Pedicino et al., 2011). This nucleus in turn innervates the dopaminergic neurons of the VTA

(Jhou et al., 2009; Balcita-Pedicino et al., 2011; Barrot et al., 2012; Bourdy and Barrot,

2012). Since the LHb output neurons for the most part are glutamatergic, the final habenular

influence on the dopaminergic system seems to be largely inhibitory.

Administration or self-administration of cocaine has been shown to increase

neuronal activity in the habenula (Zahm et al., 2010; Jhou et al., 2013). Such activation can

also be elicited in LHb neurons through dopaminergic activation (Kowski et al., 2009).

Following administration of cocaine, other changes were reported in LHb neurons such as

enhanced membrane excitability (Neumann et al., 2014), increased glutamate release after

activation of D1 and D2 receptors (Zuo et al., 2013), decreased intensity of GABA

immunolabeling (Meshul et al., 1998), and postsynaptic accumulation of AMPA receptors

and other phenomena related to long-term potentiation (Maroteaux and Mameli, 2012).

Cocaine has both rewarding and aversive effects (Ettenberg, 2004) and activation of the LHb

after cocaine exposure has been thought to be induced by the aversive effects of the drug

(Jhou et al., 2013). It has been demonstrated that neurons in LHb respond to unexpected

rewards and aversive stimuli by showing either inhibition or excitation. They also respond to

cues that predict aversive outcomes (Lecca et al., 2014; Proulx et al., 2014). When cues

predicting no drug-availability were delivered to animals that previously self-administered

cocaine, stronger neuronal activation was found in both the LHb and RMTg (Mahler and

Aston-Jones, 2012). Mahler and Aston-Jones (2012) also showed that the activated

habenula neurons were LHb afferents to the VTA. In addition, in vivo manipulations of the

habenula were shown to have effects on drug-related behaviors. For instance, lesions of the

LHb increased delayed cocaine seeking behavior, and deep-brain-stimulation that mimics

glutamate transmission to the LHb, reduced cocaine seeking behavior (Friedman et al.,

2010). Zapata et al., (2017) further reported that inhibition of LHb activity could increase

cocaine seeking behavior when the cue predicting no drug availability was present. These

studies indicate an important role of LHb in modulating drug seeking behavior.

Chapter 1

26

Mapping neuronal activity using immediate early gene expression

Exposure to drugs or to cues that are associated with drug taking is accompanied by

activation of different regions in the corticostriatal system (Adinoff, 2001; Porrino et al.,

2007). Knowledge of changes in neuronal activation in specific brain areas in the course of

the development of addiction contributes to identifying its neurobiological correlate. In this

thesis, mapping of the expression levels of several genes as a reflection of neuronal activity

has been employed to evaluate the possible involvement of the prefrontal cortex, striatum

and lateral habenula in the development of cocaine-addiction. We were especially interested

in identifying changes in expression profiles between short-term and long-term self-

administration of cocaine in an attempt to further our understanding of the neuronal

processes that underlie the progressive changes from casual to compulsive drug use.

Immediate early gene-based neural activity mapping

The term ‘immediate early gene’ (IEG) refers to a subset of genes that respond fast and

transiently to external signals without requirement of prior protein synthesis (Terleph and

Tremere, 2006). More than three decades ago it was discovered that sensory stimulation,

seizures, and physiologically relevant stimuli can initiate rapid and transient induction of

immediate early genes in neurons in vivo (Hunt et al., 1987; Morgan et al., 1987; Graybiel et

al., 1990; Herdegen and Leah 1998). Since then, much effort has been directed at

understanding the biological functions of these genes. IEGs encode for a diverse range of

proteins including transcriptional factors, signal transduction proteins, structural and

scaffolding proteins, growth factors, and enzymes (Robertson, 1992; Dragunow, 1996,

Lanahan and Worley, 1998). Functionally, IEGs may be categorized into two classes: 1.

transcription factor IEGs, and 2. effector IEGs. Regulatory transcription factors may control

transcription of other “downstream” genes; while effector IEGs may encode proteins that

directly influence cellular functions, such as cellular growth, intracellular signaling and

synaptic modifications (Lanahan and Worley, 1998; Clayton, 2000; Guzowski, 2002; Moga et

al., 2004). The induction of IEGs is generally relevant to complex changes in cellular and

molecular signaling pathways, which are fundamental to neuroplastic changes in various

neural systems (Hyman and Malenka, 2001; Robison and Nestler, 2011). For instance,

repeated exposure to drugs can evoke changes from the molecular level in synapses to, at a

larger scale, activities in entire neuronal circuitries. Such changes can be summarized under

the term neuroplasticity and, in the context of drug addiction, may eventually be responsible

for the development of compulsive drug seeking and drug taking behavior.

Chapter 1

27

It has been clearly demonstrated that for most IEGs their mRNA products can be

induced quickly, which is then followed by protein synthesis in about 30 to 90 minutes (Hu et

al., 1994). In general, the mRNA‘s of most IEGs have a short half-life of generally less than

30 minutes, while this is about 2 hours for their proteins (Berke et al., 1998). Therefore, in the

experimental setting the selection of a restricted time window following a stimulus plays an

important role in detecting changes in IEG expression levels. Measurement of neuronal

activity through detection of IEGs has been widely employed to evaluate the engagement of

specific brain structures in a large variety of behaviors, among which cocaine addiction

(Guzowski et al., 2005; Terleph and Tremere, 2006; Nakamura et al., 2010).

Immediate early genes in cocaine addiction

Acute or chronic administration of cocaine induces striking increases in the expression of

various IEGs (Fumagalli et al., 2006; Larson et al., 2010; Besson et al., 2013; Li and Wolf,

2015), and the responses of IEGs have been found in various cells and brain structures

(Larson et al., 2010; Zahm et al., 2010; Jhou et al., 2013). In the present thesis, we

investigated the expression of a panel of 17 IEGs in several reward-related brain regions.

These IEGs, i.e., c-fos, FosB/delta FosB, Jun, Egr1, Egr2, Egr3, Egr4, Mkp1, Arc, Bdnf, Trkb,

Homer1, Sgk1, Dclk1, Ccnl1, fra-1, and Rgs2 have been demonstrated to be affected directly

or indirectly by psychostimulant exposure, among which cocaine (Burchett et al., 1999;

Ghasemzadeh et al., 2009; Luca et al., 2009; Havik et al., 2012; Jia et al., 2013). In the

following paragraphs, we will discuss these IEGs, a number of which are commonly studied

in cocaine addiction research. Owing to their sensitivity to cocaine they may act as suitable

biomarkers to distinguish the neurobiological differences between short-term and long-term

cocaine self-administration.

C-fos is one of the earliest discovered IEGs and it has been successfully applied for

identifying neuronal activity changes by measuring mRNA or protein product levels

(Greenberg and Ziff, 1984; Nishikura and Murray, 1987; Hoffman and Lyo, 2002). As an

inducible IEG encoding a transcription factor, c-fos is involved in stimulus-transcription

coupling and contributes to long-term cellular responses (Morgan and Curran, 1995). Studies

in early years showed that a single injection of cocaine induced a significant increase of c-fos

in striatum (Graybiel et al., 1990; Young et al., 1991). Subsequent work showed that c-fos

increased after single or repeated cocaine administration in multiple brain regions including

the cerebral cortex, striatum, and habenula (Larson et al., 2010; Zahm et al., 2010; James et

al., 2011; Jhou et al., 2013). Like the Fos family, the Egr (early growth response gene) family

belongs to the category of transcription factors. Members of this family encode four zinc-

Chapter 1

28

finger transcription factors that are designated Egr1, Egr2, Egr3, and Egr4. They contain

similar DNA binding domains and can transactivate gene expression of target genes

(Swirnoff and Milbrandt, 1995; O'Donovan et al., 1999). Egr1 has been used to examine

neuronal activity in drug abuse or other pathological conditions in multiple brain regions such

as the cerebral cortex, striatum, hippocampus, and habenula (Cotterly et al., 2007; Rakhade

et al., 2007; Besson et al., 2013; Ichijo et al., 2015; Ziółkowska et al., 2015). It appears to

play a crucial role in regulating neuroplastic responses, since a strong correlation has been

demonstrated between Egr1 expression and stabilization of LTP in response to synaptic

activity (Abraham et al., 1991; Worley et al., 1993; Jones et al., 2001). Others also revealed

a critical role of Egr1 in the late-phase LTP persistence of hippocampus-dependent long-term

memory formation as well as memory reconsolidation (Bozon et al., 2002; Lee et al., 2004).

Arc (activity-regulated cytoskeletal-associated protein) and BDNF (brain-derived

neurotrophic factor) are two widely used effector IEGs, which are involved in cocaine

addiction. Fumagalli and colleagues showed that a single session of cocaine self-

administration significantly increased the mRNA level of Arc in the medial prefrontal cortex

and striatum (Fumagalli et al., 2009). Whereas the increase in Arc expression disappeared

quickly following a single cocaine injection, after repeated exposure to cocaine a long-lasting

up-regulation of the expression was observed in the corticostriatal system (Fumagalli et al.,

2006). A unique characteristic of Arc is that its mRNA and protein are restricted to dendritic

compartments of neurons (Lyford et al., 1995; Moga et al., 2004). It has been reported that

synaptic plasticity, synaptic transmission, as well as long-term memory consolidation are all

regulated by the expression and localization of Arc and Arc-dependent AMPA receptor

endocytosis (Chowdhury et al., 2006).

BDNF is a member of the neurotrophin polypeptide family and is abundantly

expressed in the nervous system (Thoenen, 1995). Cocaine exposure changes BDNF levels

in multiple reward-related brain regions, such as the prefrontal cortex, nucleus accumbens,

ventral tegmental area and amygdala (Grimm et al., 2003; McGinty et al., 2010; Li and Wolf,

2015). BDNF also plays a role in regulating cortical pathways that may exert an influence on

drug seeking behavior. For instance, a single infusion of BDNF into the medial prefrontal

cortex can markedly attenuate cocaine seeking behavior after experiencing 10 days of

cocaine self-administration (Berglind et al., 2007). Such BDNF-induced suppression effects

can also be observed after a few days of abstinence, extinction, or a cocaine challenge

injection (Berglind et al., 2007). It suggests suppressive effects of BDNF in the medial

prefrontal cortex on drug seeking behavior.

Chapter 1

29

The aim and structure of the present thesis

Drug addiction negatively impacts our lives and public health and leads to multiple societal

problems. For many years, doctors and scientists have tried to understand how drug use can

become compulsive and to find effective treatments. A tremendous research effort had

advanced our knowledge of this “biopsychosocial” phenomenon, but still many questions

remain to be answered. The overall aim of the present thesis is to aid the elucidation of the

neurobiology underlying the development of cocaine addiction by focusing on functional

alterations in the prefrontal cortex, striatum and lateral habenula after cocaine self-

administration in rats. A core issue is to examine the molecular and cellular changes that

take place in these brain areas when cocaine self-administration is extended from short- to

long-term. The experimental approaches in this thesis included behavioral, molecular-

biological and (immuno) histological techniques.

Our focus on the prefrontal cortex and striatum is particularly related to the

reinforcement aspect of cocaine intake and the close functional-anatomical relationships

between the prefrontal cortex to striatum. Our interest in the lateral habenula is mainly based

on its possible role in mediating the aversive effects of cocaine through dopamine regulation.

Previous studies indicate that cocaine self-administration behavior stabilizes after about 10

sessions (De Vries et al. 1998; Deroche-Gamonet et al. 2002; Veeneman et al. 2012). When

access to drugs is extended, the drug seeking behavior may become compulsive in

laboratory animals. Such compulsive behavior was found to occur after approximately 50

self-administration sessions, and animals will keep searching or self-administering large

quantities of drugs even in the face of adverse consequences such as electric foot shocks

(Deroche-Gamonet et al., 2004; Vanderschuren and Everitt, 2004; Jonkman et al., 2012;

Vanderschuren et al. 2014; Limpens et al. 2015). With this in mind, we have selected periods

of 10 and 60 days of cocaine self-administration as two time points to assess the expression

of IEGs. Sucrose self-administration was included to allow us to examine the effects of short-

and long-term sucrose self-administration in the same brain regions, and to compare the

effects of a drug of abuse to those of a natural reward.

The current thesis comprises of five chapters. Chapter 1 introduces the basic theories

of addiction, basal ganglia circuits, and how the structures in the basal ganglia circuits are

involved in drug addiction. Chapter 2 focuses on effects of short- and long-term cocaine self-

administration on the expression of IEGs in the medial prefrontal cortex and striatum. This

chapter provides an overview of the expression profiles of a panel of 17 IEGs in the medial

prefrontal cortex and the dorsal and ventral striatum as established using RT-PCR. Our

results demonstrate that six IEGs are significantly increased in both the medial prefrontal

Chapter 1

30

cortex and the dorsal and ventral striatum in both the 10 days and 60 days experiments,

while in medial prefrontal cortex another group of 10 IEGs increased only after long-term (i.e.

60 days of) cocaine self-administration. On basis of the results from Chapter 2, we focused

our attention in Chapter 3 on the detailed neuronal reactivity patterns in multiple subregions

of the prefrontal cortex and striatum, using the expression of Mkp1 as a marker. Data from

this experiment was analyzed by two methods, first by means of conventional cell counting

and, second, through statistical parametric mapping analysis to visualize neuronal reactivity

patterns in prefrontal cortex and striatum. Our results showed that 10 days of cocaine self-

administration activated most prefrontal cortical areas and a specific longitudinal region

extending from the lateral part of the ventral striatum to the medial part of the dorsal striatum.

After 60 days of cocaine exposure, neuronal activation appeared less intense, with activated

areas presenting more dorsally in the entire striatum. In the prefrontal cortex, significant

changes were seen in most subregions after 10 days of self-administration, but the activation

pattern was limited to the posterior parts of prefrontal cortex after 60 days of cocaine self-

administration. In Chapter 4, we addressed the effects of short- and long-term cocaine self-

administration in the lateral habenula and RMTg, structures thought to be involved in the

aversive aspects of drug intake. Cocaine-induced neuronal reactivity was increased

heterogeneously in the lateral habenula after both 10 days and 60 days of cocaine exposure.

In the 10 days experiment, both the density and the cellular labelling intensity of c-fos-

positive cells were increased in the lateral part of lateral habenula. In the 60 days experiment,

the density of labelled cells was increased in both the lateral and medial part of lateral

habenula. In RMTg, increased expression of glutamic acid decarboxylase (GAD) was

observed after 10 days but not 60 days of cocaine self-administration. Together, these data

reflect the complexity of cocaine effects on the lateral habenula-RMTg circuitry and might

also indicate a decline of inhibition of habenula on dopamine system. Finally, in Chapter 5 we

summarize the main results of the current thesis and discuss the functional neuroanatomical

changes following cocaine self-administration and relate these to the current understanding

of the neurobiology of drug addiction.

Chapter 1

31

References

⬧ Abraham WC, Dragunow M, Tate WP (1991) The role of immediate early genes in the stabilization

of long-term potentiation. Mol Neurobiol 5:297-314.

⬧ Adinoff B, Devous MD, Sr., Best SM, George MS, Alexander D, Payne K (2001) Limbic

responsiveness to procaine in cocaine-addicted subjects. Am J Psychiatry 158:390-398.

⬧ Ahmed SH, Kenny PJ, Koob GF, Markou A (2002) Neurobiological evidence for hedonic allostasis

associated with escalating cocaine use. Nat Neurosci 5: 625-626.

⬧ Aizawa H, Cui W, Tanaka K, Okamoto H (2013) Hyperactivation of habenula as a link between

depression and sleep disturbance. Front Hum Neurosci. 7:826.

⬧ American Psychiatric Association (2013) American Psychiatric Association. DSM-IV-R Diagnostic

and Statistical Manual of Mental Disorders. American Psychiatric Association, Washington, DC,

USA.

⬧ Araki M, McGeer PL, Kimura H (1988) The efferent projections of the rat lateral habenular nucleus

revealed by the PHA-L anterograde tracing method. Brain Res 441:319-330.

⬧ Balcita-Pedicino JJ, Omelchenko N, Bell R, Sesack SR (2011) The inhibitory influence of the lateral

habenula on midbrain dopamine cells: ultrastructural evidence for indirect mediation via the

rostromedial mesopontine tegmental nucleus. J Comp Neurol 519:1143-1164.

⬧ Balleine BW, O'Doherty JP (2010) Human and rodent homologies in action control: corticostriatal

determinants of goal-directed and habitual action. Neuropsychopharmacology. 35(1):48-69.

⬧ Bari AA, Pierce RC (2005) D1-like and D2 dopamine receptor antagonists administered into the

shell subregion of the rat nucleus accumbens decrease cocaine, but not food, reinforcement.

Neuroscience 135:959-968.

⬧ Barrot M, Sesack SR, Georges F, Pistis M, Hong S, Jhou TC (2012) Braking dopamine systems: a

new GABA master structure for mesolimbic and nigrostriatal functions. J Neurosci 32:14094-14101.

⬧ Bechara A (2005) Decision making, impulse control and loss of willpower to resist drugs: a

neurocognitive perspective. Nat Neurosci 8:1458-1463.

⬧ Belin D, Everitt BJ (2008) Cocaine seeking habits depend upon dopamine-dependent serial

connectivity linking the ventral with the dorsal striatum. Neuron 57:432-441.

⬧ Berglind WJ, See RE, Fuchs RA, Ghee SM, Whitfield TW, Jr., Miller SW, McGinty JF (2007) A

BDNF infusion into the medial prefrontal cortex suppresses cocaine seeking in rats. Eur J Neurosci

26:757-766.

⬧ Berke JD, Hyman SE (2000) Addiction, dopamine, and the molecular mechanisms of memory.

Neuron 25(3):515-532.

⬧ Berke JD, Paletzki RF, Aronson GJ, Hyman SE, Gerfen CR (1998) A complex program of striatal

gene expression induced by dopaminergic stimulation. J Neurosci 18:5301-5310.

⬧ Berridge KC, Robinson TE (1998) What is the role of dopamine in reward: hedonic impact, reward

learning, or incentive salience? Brain Res Brain Res Rev 28:309-369.

Chapter 1

32

⬧ Besson M, Pelloux Y, Dilleen R, Theobald DE, Lyon A, Belin-Rauscent A, Robbins TW, Dalley JW,

Everitt BJ, Belin D (2013) Cocaine modulation of frontostriatal expression of Zif268, D2, and 5-HT2c

receptors in high and low impulsive rats. Neuropsychopharmacology 38:1963-1973.

⬧ Bolla KI, Eldreth DA, London ED, Kiehl KA, Mouratidis M, Contoreggi C, Matochik JA, Kurian V,

Cadet JL, Kimes AS, Funderburk FR, Ernst M (2003) Orbitofrontal cortex dysfunction in abstinent

cocaine abusers performing a decision-making task. Neuroimage 19:1085-1094.

⬧ Bourdy R, Barrot M (2012) A new control center for dopaminergic systems: pulling the VTA by the

tail. Trends Neurosci 35:681-690.

⬧ Bozon B, Davis S, Laroche S (2002) Regulated transcription of the immediate-early gene Zif268:

mechanisms and gene dosage-dependent function in synaptic plasticity and memory formation.

Hippocampus 12:570-577.

⬧ Bromberg-Martin ES, hikosaka O (2011) Lateral habenula neurons signal errors in the prediction of

reward information. Nat Neurosci. 14(9):1209-1216.

⬧ Burchett SA, Bannon MJ, Granneman JG (1999). RGS mRNA expression in rat striatum:

modulation by dopamine receptors and effects of repeated amphetamine administration. J

Neurochem 72(4): 1529-1533.

⬧ Caine SB, Koob GF (1994) Effects of mesolimbic dopamine depletion on responding maintained by

cocaine and food. J Exp Anal Behav 61:213-221.

⬧ Capriles N, Rodaros D, Sorge RE, Stewart J (2003) A role for the prefrontal cortex in stress- and

cocaine-induced reinstatement of cocaine seeking in rats. Psychopharmacology (Berl) 168:66-74.

⬧ Carelli RM (2004) Nucleus accumbens cell firing and rapid dopamine signaling during goal-directed

behaviors in rats. Neuropharmacology. 47 1:180-189.

⬧ Childress AR, Mozley PD, McElgin W, Fitzgerald J, Reivich M, O'Brien CP (1999) Limbic activation

during cue-induced cocaine craving. Am J Psychiatry 156:11-18.

⬧ Chowdhury S, Shepherd JD, Okuno H, Lyford G, Petralia RS, Plath N, Kuhl D, Huganir RL, Worley

PF (2006) Arc/Arg3.1 interacts with the endocytic machinery to regulate AMPA receptor trafficking.

Neuron 52(3):445-459.

⬧ Clayton DF (2000) The genomic action potential. Neurobiol Learn Mem. 74(3):185-216.

⬧ Cotterly L, Beverley JA, Yano M, Steiner H (2007) Dysregulation of gene induction in corticostriatal

circuits after repeated methylphenidate treatment in adolescent rats: differential effects on zif 268

and homer 1a. Eur J Neurosci 25:3617-3628.

⬧ Crombag HS, Gorny G, Li Y, Kolb B, Robinson TE (2005) Opposite effects of amphetamine self-

administration experience on dendritic spines in the medial and orbital cortex. Cereb Cortex

15(3):341-348.

⬧ Compound Summary for CID 446220, Cocaine, PubChem, National Institutes of Health.

https://pubchem.ncbi.nlm.nih.gov/compound/cocaine.

⬧ Deroche-Gamonet V, Piazza PV (2014) Psychobiology of cocaine addiction: Contribution of a multi-

symptomatic animal model of loss of control. Neuropharmacology 76 Pt B:437-449.

Chapter 1

33

⬧ De Vries TJ, Schoffelmeer AN, Binnekade R, Mulder AH, Vanderschuren LJ (1998) Drug-induced

reinstatement of heroin- and cocaine-seeking behavior following long-term extinction is associated

with expression of behavioral sensitization. Eur J Neurosci. 10(11):3565-3571.

⬧ Di Ciano P, Everitt BJ (2004) Direct interactions between the basolateral amygdala and nucleus

accumbens core underlie cocaine-seeking behavior by rats. J Neurosci. 24:7167–7173.

⬧ Dragunow M (1996) A role for immediate-early transcription factors in learning and memory. Behav

Genet 26:293-299.

⬧ Edwards S (2016) Reinforcement principles for addiction medicine; from recreational drug use to

psychiatric disorder. Prog Brain Res. 223:63-76.

⬧ Ellison G (2002) Neural degeneration following chronic stimulant abuse reveals a weak link in brain,

fasciculus retroflexus, implying the loss of forebrain control circuitry. Eur Neuropsychopharmacol.

12(4):287-297.

⬧ Ettenberg A (2004) Opponent process properties of self-administered cocaine. Neurosci Biobehav

Rev. 27(8):721-728.

⬧ European Drug Report (2016) European Drug Report 2016: Trends and Developments.

http://www.emcdda.europa.eu/edr2016.

⬧ Everitt BJ (2014) Neural and psychological mechanisms underlying compulsive drug seeking habits

and drug memories--indications for novel treatments of addiction. Eur J Neurosci 40:2163-2182.

⬧ Everitt BJ, Belin D, Economidou D, Pelloux Y, Dalley JW, Robbins TW (2008) Review. Neural

mechanisms underlying the vulnerability to develop compulsive drug-seeking habits and addiction.

Philos Trans R Soc Lond B Biol Sci 363:3125-3135.

⬧ Everitt BJ, Dickinson A, Robbins TW (2001) The neuropsychological basis of addictive behaviour.

Brain Res Brain Res Rev 36:129-138.

⬧ Everitt BJ, Robbins TW (2005) Neural systems of reinforcement for drug addiction: from actions to

habits to compulsion. Nat Neurosci 8:1481-1489.

⬧ Everitt BJ, Robbins TW (2013) From the ventral to the dorsal striatum: devolving views of their roles

in drug addiction. Neurosci Biobehav Rev 37:1946-1954.

⬧ Everitt BJ, Robbins TW (2016) Drug addiction: updating to habits to compulsions ten years on. Annu

Rev Psychol. 67:23-50.

⬧ Everitt BJ (2018) Drug cues, conditioned reinforcement, and drug seeking: the sequelae of a

collaborative venture with athina markou. Biol Psychiatry. 83(11)924-931.

⬧ Friedman A, Lax E, Dikshtein Y, Abraham L, Flaumenhaft Y, Sudai E, Ben-Tzion M, Ami-Ad L, Yaka

R, Yadid G (2010) Electrical stimulation of the lateral habenula produces enduring inhibitory effect

on cocaine seeking behavior. Neuropharmacology 59:452-459.

⬧ Fumagalli F, Bedogni F, Frasca A, Di Pasquale L, Racagni G, Riva MA (2006) Corticostriatal up-

regulation of activity-regulated cytoskeletal-associated protein expression after repeated exposure

to cocaine. Mol Pharmacol 70:1726-1734.

⬧ Fumagalli F, Franchi C, Caffino L, Racagni G, Riva MA, Cervo L (2009) Single session of cocaine

intravenous self-administration shapes goal-oriented behaviours and up-regulates Arc mRNA levels

in rat medial prefrontal cortex. Int J Neuropsychopharmacol 12:423-429.

https://www.ncbi.nlm.nih.gov/pubmed/?term=Ellison%20G%5BAuthor%5D&cauthor=true&cauthor_uid=12126867

https://www.ncbi.nlm.nih.gov/pubmed/12126867

Chapter 1

34

⬧ Geisler S, Trimble M (2008) The lateral habenula: no longer neglected. CNS Spectr. 13(6):484-489.

⬧ Gerfen CR, Engber TM, Mahan LC, Susel Z, Chase TN, Monsma FJ, Sibley DR (1990) D1 and D2

dopamine receptor-regulated gene expression of striatonigral and striatopallidal neurons. Science.

250(4986):1429-1432.

⬧ Ghasemzadeh MB, Windham LK, Lake RW, Acker CJ, Kalivas PW (2009) Cocaine activates

Homer1 immediate early gene transcription in the mesocorticolimbic circuit: differential regulation by

dopamine and glutamate signaling. Synapse 63(1): 42-53.

⬧ World Health Organization (2004) Global status report on alcohol 2004. World Health Organization

Department of Mental Health and Substance Abuse. Geneva.

⬧ Goldstein RZ, Volkow ND (2002) Drug addiction and its underlying neurobiological basis:

neuroimaging evidence for the involvement of the frontal cortex. Am J Psychiatry 159:1642-1652.

⬧ Goldstein RZ, Volkow ND (2011) Dysfunction of the prefrontal cortex in addiction: neuroimaging

findings and clinical implications. Nat Rev Neurosci 12:652-669.

⬧ Graybiel AM, Moratalla R, Robertson HA (1990) Amphetamine and cocaine induce drug-specific

activation of the c-fos gene in striosome-matrix compartments and limbic subdivisions of the

striatum. Proc Natl Acad Sci U S A 87:6912-6916.

⬧ Greenberg ME, Ziff EB (1984) Stimulation of 3T3 cells induces transcription of the c-fos proto-

oncogene. Nature 311:433-438.

⬧ Grimm JW, Lu L, Hayashi T, Hope BT, Su TP, Shaham Y (2003) Time-dependent increases in

brain-derived neurotrophic factor protein levels within the mesolimbic dopamine system after

withdrawal from cocaine: implications for incubation of cocaine craving. J Neurosci 23:742-747.

⬧ Groenewegen HJ, Vermeulen-Van der Zee E, te Kortschot A, Witter MP (1987) Organization of the

projections from the subiculum to the ventral striatum in the rat. A study using anterograde transport

of Phaseolus vulgaris leucoagglutinin. Neuroscience. 23(1):103-120.

⬧ Groenewegen HJ, Voorn P, Scheel-Kruger J (2016) Limbic-basal ganglia circuits parallel and

integrative aspects. In: The basal Ganglia: Novel Perspectives on Motor and Cognitive Functions.

J.J. Soghomonian (ed). Springer.

⬧ Guzowski JF (2002) Insights into immediate-early gene function in hippocampal memory

consolidation using antisense oligonucleotide and fluorescent imaging approaches. Hippocampus

12(1):86-104.

⬧ Guzowski JF, Timlin JA, Roysam B, McNaughton BL, Worley PF, Barnes CA (2005) Mapping

behaviorally relevant neural circuits with immediate-early gene expression. Curr Opin Neurobiol

15:599-606.

⬧ Hart G, Leung BK, Balleine BW (2014) Dorsal and ventral streams: the distinct role of striatal

subregions in the acquisition and performance of goal-directed actions. Neurobiol Learn Mem.

108:104-118.

⬧ Havik B, Degenhardt FA, Johansson S, Fernandes CP, Hinney A, Scherag A, et al. (2012). DCLK1

variants are associated across schizophrenia and attention deficit/hyperactivity disorder. PLoS One

7: e35424.

Chapter 1

35

⬧ Heimer L, Wilson RD (1975) The subcortical projections of the allocortex: similarities in the neuronal

associations of the hippocampus, the pyriform cortex and the neocortex. In Goli Cenennial

Symposium: Perspectives in Neurobiology. M. Santini (ed), Raven Press, New York, pp.177-193.

⬧ Herdegen T, Leah JD (1998) Inducible and constitutive transcription factors in the mammalian

nervous system: control of gene expression b Jun, Fos and Krox, and CREB/ATF proteins. Brain

Res Rev. 28:370-490.

⬧ Herkenham M, Nauta WJ (1977) Afferent connections of the habenular nuclei in the rat. A

horseradish peroxidase study, with a note on the fiber-of-passage problem. J. Comp. Neurol. 173:

123-146.

⬧ Herkenham M, Nauta WJ (1979) Efferent connections of the habenular nuclei in the rat. J. Comp.

Neurol. 187: 19-47.

⬧ Hikosaka O (2010) The habenula: from stress evasion to value-based decision-making. Nat. Rev

Neurosci. 11(7):503-513.

⬧ Hikosaka O, Sesack SR, Lecourtier L, Shepard PD (2008) Habenula: crossroad between the basal

ganglia and the limbic system. J Neurosci 28:11825-11829.

⬧ Hoffman GE, Lyo D (2002) Anatomical markers of activity in neuroendocrine systems: are we all

'fos-ed out'? J Neuroendocrinol 14:259-268.

⬧ Hu E, Mueller E, Oliviero S, Papaioannou VE, Johnson R, Spiegelman BM (1994) Targeted

disruption of the c-fos gene demonstrates c-fos-dependent and -independent pathways for gene

expression stimulated by growth factors or oncogenes. EMBO J 13:3094-3103.

⬧ Hunt SP, Pini A, Evan G (1987) Induction of c-fos-like protein in spinal cord neurons following

sensory stimulation. Nature 328:632-634.

⬧ Hyman SE, Malenka RC (2001) Addiction and the brain: the neurobiology of compulsion and its

persistence. Nat Rev Neurosci. 2(10):695-703.

⬧ Hyman SE, Malenka RC, Nestler EJ (2006) Neural mechanisms of addiction: the role of reward-

related learning and memory. Annu Rev Neurosci 29:565-598.

⬧ Ichijo H, Hamada M, Takahashi S, Kobayashi M, Nagai T, Toyama T, Kawaguchi M (2015)

Lateralization, maturation, and anteroposterior topography in the lateral habenula revealed by

ZIF268/EGR1 immunoreactivity and labeling history of neuronal activity. Neurosci Res 95:27-37.

⬧ Ikemoto S (2003) Involvement of the olfactory tubercle in cocaine reward: intracranial self-

administration studies. J Neurosci 23:9305-9311.

⬧ Ito R, Dalley JW, Robbins TW, Everitt BJ (2002) Dopamine release in the dorsal striatum during

cocaine-seeking behavior under the control of a drug-associated cue. J Neurosci 22:6247-6253.

⬧ Ito R, Robbins TW, Everitt BJ. (2004) Differential control over cocaine-seeking behavior by nucleus

accumbens core and shell. Nat Neurosci. 7(4):389-397.

⬧ James MH, Charnley JL, Flynn JR, Smith DW, Dayas CV (2011) Propensity to 'relapse' following

exposure to cocaine cues is associated with the recruitment of specific thalamic and epithalamic

nuclei. Neuroscience 199:235-242.

https://www.ncbi.nlm.nih.gov/pubmed/?term=Ito%20R%5BAuthor%5D&cauthor=true&cauthor_uid=15034590

https://www.ncbi.nlm.nih.gov/pubmed/?term=Robbins%20TW%5BAuthor%5D&cauthor=true&cauthor_uid=15034590

https://www.ncbi.nlm.nih.gov/pubmed/?term=Everitt%20BJ%5BAuthor%5D&cauthor=true&cauthor_uid=15034590

https://www.ncbi.nlm.nih.gov/pubmed/?term=Ito+%2C+cocaine%2C++core%2C+shell%2C%2C+2004%2C

Chapter 1

36

⬧ Jentsch JD, Taylor JR (1999) Impulsivity resulting from frontostriatal dysfunction in drug abuse:

implications for the control of behavior by reward-related stimuli. Psychopharmacology (Berl)

146:373-390.

⬧ Jhou TC, Geisler S, Marinelli M, Degarmo BA, Zahm DS (2009) The mesopontine rostromedial

tegmental nucleus: A structure targeted by the lateral habenula that projects to the ventral tegmental

area of Tsai and substantia nigra compacta. J Comp Neurol 513:566-596.

⬧ Jhou TC, Good CH, Rowley CS, Xu SP, Wang H, Burnham NW, Hoffman AF, Lupica CR, Ikemoto S

(2013) Cocaine drives aversive conditioning via delayed activation of dopamine-responsive

habenular and midbrain pathways. J. Neurosci. 33: 7501-7512.

⬧ Jia W, Liu R, Shi J, Wu B, Dang W, Du Y, Zhou Q, Wang J, Zhang R (2013) Differential Regulation

of MAPK Phosphorylation in the Dorsal Hippocampus in Response to Prolonged Morphine

Withdrawal-Induced Depressive-Like Symptoms in Mice. PLoS One 8(6):e66111.

⬧ Jones MW, Errington ML, French PJ, Fine A, Bliss TV, Garel S, Charnay P, Bozon B, Laroche S,

Davis S (2001) A requirement for the immediate early gene Zif268 in the expression of late LTP and

long-term memories. Nat Neurosci 4:289-296.

⬧ Jonkman S, Pelloux Y, Everitt BJ (2012) Drug intake is sufficient, but conditioning is not necessary

for the emergence of compulsive cocaine seeking after extended self-administration.

Neuropsychopharmacology 37:1612-1619.

⬧ Kalivas PW, Volkow ND (2005) The neural basis of addiction: a pathology of motivation and choice.

Am J Psychiatry 162:1403-1413.

⬧ Kawaguchi Y, Wilson CJ, Augood SJ, Emson PC (1995) Striatal interneurones: chemical,

physiological and morphological characterization. Trends Neurosci. 18(12):527-535.

⬧ Kelly AE (2004) Ventral striatal control of appetitive motivation: role in ingestive behavior and

reward-related learning. Neurosci Biobehav Rev. 27(8):765-776.

⬧ Koob GF (2013) Negative reinforcement in drug addiction: the darkness within. Curr Opin Neurobiol

23:559-563.

⬧ Koob GF, Buck CL, Cohen A, Edwards S, Park PE, Schlosburg JE, Schmeichel B, Vendruscolo LF,

Wade CL, Whitfield TW, Jr., George O (2014) Addiction as a stress surfeit disorder.

Neuropharmacology 76 Pt B:370-382.

⬧ Koob GF, Le Moal M (1997) Drug abuse: hedonic homeostatic dysregulation. Science 278:52-58.

⬧ Koob GF, Le Moal M (2008) Addiction and the brain antireward system. Annu Rev Psychol 59:29-53.

⬧ Koob GF, Stinus L, Le Moal M, Bloom FE (1989) Opponent process theory of motivation:

neurobiological evidence from studies of opiate dependence. Neurosci Biobehav Rev 13:135-140.

⬧ Koob GF, Volkow ND (2016) Neurobiology of addiction: a neurocircuitry analysis. Lancet Psychiatry

3(8) 760-73.

⬧ Kowski AB, Veh RW, Weiss T (2009) Dopaminergic activation excites rat lateral habenular neurons

in vivo. Neuroscience. 161: 1154-1165.

⬧ Kuhar MJ, Ritz MC, Boja JW (1991) The dopamine hypothesis of the reinforcing properties of

cocaine. Trends Neurosci. 14(7):299-302.

Chapter 1

37

⬧ LaLumiere RT, Smith KC, Kalivas PW (2012) Neural circuit competition in cocaine-seeking: roles of

the infralimbic cortex and nucleus accumbens shell. Eur J Neurosci 35:614-622.

⬧ Lanahan A, Worley P (1998) Immediate-early genes and synaptic function. Neurobiol Learn Mem

70:37-43.

⬧ Larson EB, Akkentli F, Edwards S, Graham DL, Simmons DL, Alibhai IN, Nestler EJ, Self DW (2010)

Striatal regulation of ΔFosB, FosB, and cFos during cocaine self-administration and withdrawal. J

Neurochem.115(1):112-122.

⬧ Lecca S, Meye FJ, Mameli M (2014) The lateral habenula in addiction and depression: an

anatomical, synaptic and behavioral overview. Eur. J. Neurosci. 39: 1170-1178.

⬧ Lee JL, Everitt BJ, Thomas KL (2004) Independent cellular processes for hippocampal memory

consolidation and reconsolidation. Science 304:839-843.

⬧ Leshner AI (1997) Addiction is a brain disease, and it matters. Science 278(5335):45-47.

⬧ Letchworth SR, Nader MA, Smith HR, Friedman DP, Porrino LJ (2001) Progression of changes in

dopamine transporter binding site density as a result of cocaine self-administration in rhesus

monkeys. J Neurosci 21:2799-2807.

⬧ Li X, Wolf ME (2015) Multiple faces of BDNF in cocaine addiction. Behav Brain Res 279:240-254.

⬧ Limpens JH, Damsteegt R, Broekhoven MH, Voorn P, Vanderschuren LJ (2015) Pharmacological

inactivation of the prelimbic cortex emulates compulsive reward seeking in rats. Brain Res

1628:210-218.

⬧ London ED, Ernst M, Grant S, Bonson K, Weinstein A (2000) Orbitofrontal cortex and human drug

abuse: functional imaging. Cereb Cortex 10:334-342.

⬧ Luca F, Kashyap S, Southard C, Zou M, Witonsky D, Di Rienzo A, Conzen SD (2009). Adaptive

variation regulates the expression of the human SGK1 gene in response to stress. PLoS Genet 5:

e1000489.

⬧ Lucantonio F, Stalnaker TA, Shaham Y, Niv Y, Schoenbaum G (2012) The impact of orbitofrontal

dysfunction on cocaine addiction. Nat Neurosci. 15(3):358-366.

⬧ Lucantonio F, Takahashi YK, Hoffman AF, Chang CY, Bali-Chaudhary S, Shaham Y, Lupica CR,

Schoenbaum G (2014) Orbitofrontal activation restores insight lost after cocaine use. Nat Neurosci.

17(8):1092-1099.

⬧ Lüscher C, Malenka RC (2011) Drug-evoked synaptic plasticity in addiction: from molecular

changes to circuit remodeling. Neuron 69(4):650-663.

⬧ Lyford GL, Yamagata K, Kaufmann WE, Barnes CA, Sanders LK, Copeland NG, Gilbert DJ, Jenkins

NA, Lanahan AA, Worley PF. (1995) Arc, a growth factor and activity-regulated gene, encode a

novel cytoskeleton-associated protein that is enriched in neuronal dendrites. Neuron. 14:433-445.

⬧ Mahler SV, Aston-Jones GS (2012) Fos activation of selective afferents to ventral tegmental area

during cue-induced reinstatement of cocaine seeking in rats. J Neurosci 32:13309-13326.

⬧ Maroteaux M, Mameli M (2012) Cocaine evokes projection-specific synaptic plasticity of lateral

habenula neurons. J. Neurosci. 32:12641-12646.

⬧ McAuliffe WE, Gordon RA (1974) A test of Lindesmith's theory of addiction: the frequency of

euphoria among long-term addicts. AJS. 79:795-840.

https://www.ncbi.nlm.nih.gov/pubmed/?term=Larson%20EB%5BAuthor%5D&cauthor=true&cauthor_uid=20633205

https://www.ncbi.nlm.nih.gov/pubmed/?term=Akkentli%20F%5BAuthor%5D&cauthor=true&cauthor_uid=20633205

https://www.ncbi.nlm.nih.gov/pubmed/?term=Edwards%20S%5BAuthor%5D&cauthor=true&cauthor_uid=20633205

https://www.ncbi.nlm.nih.gov/pubmed/?term=Graham%20DL%5BAuthor%5D&cauthor=true&cauthor_uid=20633205

https://www.ncbi.nlm.nih.gov/pubmed/?term=Simmons%20DL%5BAuthor%5D&cauthor=true&cauthor_uid=20633205

https://www.ncbi.nlm.nih.gov/pubmed/?term=Alibhai%20IN%5BAuthor%5D&cauthor=true&cauthor_uid=20633205

https://www.ncbi.nlm.nih.gov/pubmed/?term=Nestler%20EJ%5BAuthor%5D&cauthor=true&cauthor_uid=20633205

https://www.ncbi.nlm.nih.gov/pubmed/?term=Self%20DW%5BAuthor%5D&cauthor=true&cauthor_uid=20633205

https://www.ncbi.nlm.nih.gov/pubmed/?term=Larson%2C+cocaine+%2C+striatum%2C++2010

https://www.ncbi.nlm.nih.gov/pubmed/?term=Larson%2C+cocaine+%2C+striatum%2C++2010


https://www.ncbi.nlm.nih.gov/pubmed/?term=L%C3%BCscher%20C%5BAuthor%5D&cauthor=true&cauthor_uid=21338877

https://www.ncbi.nlm.nih.gov/pubmed/?term=Malenka%20RC%5BAuthor%5D&cauthor=true&cauthor_uid=21338877

Chapter 1

38

⬧ McGinty JF, Whitfield TW Jr, Berglind WJ (2010) Brain-derived neurotrophic factor and cocaine

addiction. Brain Res 1314:183-193.

⬧ McFarland K, Kalivas PW (2001) The circuitry mediating cocaine-induced reinstatement of drug-

seeking behavior. J Neurosci. 21(21):8655-8663.

⬧ McLaughlin J, See RE (2003) Selective inactivation of the dorsomedial prefrontal cortex and the

basolateral amygdala attenuates conditioned-cued reinstatement of extinguished cocaine-seeking

behavior in rats. Psychopharmacology (Berl) 168:57-65.

⬧ Mihindou C, Guillem K, Navailles S, Vouillac C, Ahmed SH (2013) Discriminative inhibitory control of

cocaine seeking involves the prelimbic prefrontal cortex. Biol Psychiatry 73:271-279.

⬧ Meshul CK, Noguchi K, Emre N, Ellison G (1998) Cocaine-induced changes in glutamate and GABA

immunolabeling within rat habenula and nucleus accumbens. Synapse. 30: 211-220.

⬧ Moga DE, Calhoun ME, Chowdhury A, Worley P, Morrison JH, Shapiro ML (2004) Activity-regulated

cytoskeletal-associated protein is localized to recently activated excitatory synapses. Neuroscience

125(1):7-11.

⬧ Moorman DE, James MH, McGlinchey EM, Aston-Jones G (2015) Differential roles of medial

prefrontal subregions in the regulation of drug seeking. Brain Res. 1628(Pt A):130-146.

⬧ Morgan JI, Curran T (1995) Immediate-early genes: ten years on. Trends Neurosci. 18:66-67.

⬧ Morgan JI, Cohen DR, Hempstead JL, Curran T (1987) Mapping patterns of c-fos expression in the

central nervous system after seizure. Science 237: 192-197.

⬧ Murray JE, Belin-Rauscent A, Simon M, Giuliano C, Benoit-Marand M, Everitt BJ, Belin D (2015)

Basolateral and central amygdala differentially recruit and maintain dorsolateral striatum-dependent

cocaine-seeking habits. Nat Commun. 6:10088. doi: 10.1038/ncomms10088.

⬧ Nakamura NH, Fukunaga M, Akama KT, Soga T, Ogawa S, Pavlides C (2010) Hippocampal cells

encode places by forming small anatomical clusters. Neuroscience 166:994-1007.

⬧ Neumann PA, Ishikawa M, Otaka M, Huang YH, Schlüter OM, Dong Y (2014) Increased excitability

of lateral habenula neurons in adolescent rats following cocaine self-administration. Int. J.

Neuropsychopharmacol. 18:1-10.

⬧ Nishikura K, Murray JM (1987) Antisense RNA of proto-oncogene c-fos blocks renewed growth of

quiescent 3T3 cells. Mol Cell Biol 7:639-649.

⬧ O'Brien CP, Childress AR, Ehrman R, Robbins SJ (1998) Conditioning factors in drug abuse: can

they explain compulsion? J Psychopharmacol. 12(1):15-22.

⬧ O'Donovan KJ, Tourtellotte WG, Millbrandt J, Baraban JM (1999) The EGR family of transcription-

regulatory factors: progress at the interface of molecular and systems neuroscience. Trends

Neurosci 22:167-173.

⬧ Peters J, LaLumiere RT, Kalivas PW (2008) Infralimbic prefrontal cortex is responsible for inhibiting

cocaine seeking in extinguished rats. J Neurosci. 28(23): 6046–6053.

⬧ Pennartz CM, Berke JD, Graybiel AM, Ito R, Lansink CS, van der Meer M, Redish AD, Smith KS,

Voorn P (2009) Corticostriatal interactions during learning, memory processing, and decision

making. J Neurosci. 29(41):12831-12838

https://www.ncbi.nlm.nih.gov/pubmed/?term=Moorman%20DE%5BAuthor%5D&cauthor=true&cauthor_uid=25529632

https://www.ncbi.nlm.nih.gov/pubmed/?term=James%20MH%5BAuthor%5D&cauthor=true&cauthor_uid=25529632

https://www.ncbi.nlm.nih.gov/pubmed/?term=McGlinchey%20EM%5BAuthor%5D&cauthor=true&cauthor_uid=25529632

https://www.ncbi.nlm.nih.gov/pubmed/?term=Aston-Jones%20G%5BAuthor%5D&cauthor=true&cauthor_uid=25529632

https://www.ncbi.nlm.nih.gov/pubmed/?term=Differential+roles+of+medial+prefrontal+subregions+in+the+regulation+of+drug+seeking.

https://www.ncbi.nlm.nih.gov/pubmed/?term=Peters%20J%5BAuthor%5D&cauthor=true&cauthor_uid=18524910

https://www.ncbi.nlm.nih.gov/pubmed/?term=LaLumiere%20RT%5BAuthor%5D&cauthor=true&cauthor_uid=18524910

https://www.ncbi.nlm.nih.gov/pubmed/?term=Kalivas%20PW%5BAuthor%5D&cauthor=true&cauthor_uid=18524910

Chapter 1

39

⬧ Pierce RC, Kumaresan V (2006) The mesolimbic dopamine system: the final common pathway for

the reinforcing effect of drugs of abuse? Neurosci Biobehav Rev. 30(2):215-238.

⬧ Pierce RC, Vanderschuren LJ (2010) Kicking the habit: the neural basis of ingrained behaviors in

cocaine addiction. Neurosci Biobehav Rev 35:212-219.

⬧ Porrino LJ, Lyons D (2000) Orbital and medial prefrontal cortex and psychostimulant abuse: studies

in animal models. Cerebral Cortex. 10:326–333.

⬧ Porrino LJ, Lyons D, Smith HR, Daunais JB, Nader MA (2004) Cocaine self-administration produces

a progressive involvement of limbic, association, and sensorimotor striatal domains. J Neurosci

24:3554-3562.

⬧ Porrino LJ, Smith HR, Nader MA, Beveridge TJ (2007) The effects of cocaine: a shifting target over

the course of addiction. Prog Neuropsychopharmacol Biol Psychiatry. 31(8):1593-1600.

⬧ Proulx CD, Hikosaka O, Malinow R (2014) Reward processing by the lateral habenula in normal and

depressive behaviors. Nat. Neurosci. 17:1146-1152.

⬧ Rakhade SN, Shah AK, Agarwal R, Yao B, Asano E, Loeb JA (2007) Activity-dependent gene

expression correlates with interictal spiking in human neocortical epilepsy. Epilepsia 48 Suppl 5:86-

95.

⬧ Riga D, Matos MR, Glas A, Smit AB, Spijker S, Van den Oever MC (2014) Optogenetic dissection of

medial prefrontal cortex circuitry. Front Syst Neurosci 8:230.

⬧ Redgrave P, Gurney K (2006) The short-latency dopamine signal: a role in discovering novel

actions? Nat Rev Neurosci. 7(12):967-75.

⬧ Robbins TW, Everitt BJ (1999) Drug addiction: bad habits add up. Nature 398:567-570.

⬧ Robbins TW, Everitt BJ (2002) Limbic-striatal memory systems and drug addiction. Neurobiol Learn

Mem 78:625-636.

⬧ Robertson HA (1992) Immediate-early genes, neuronal plasticity, and memory. Biochem Cell Biol

70:729-737.

⬧ Robinson TE, Berridge KC (1993) The neural basis of drug craving: an incentive-sensitization theory

of addiction. Brain Res Brain Res Rev 18:247-291.

⬧ Robinson TE, Berridge KC (2001) Incentive-sensitization and addiction. Addiction 96:103-114.

⬧ Robinson TE, Berridge KC (2003) Addiction. Annu. Rev. Psychol 54:25-53.

⬧ Robinson TE, Berridge KC (2008) Review. The incentive sensitization theory of addiction: some

current issues. Philos Trans R Soc Lond Sci. 363(1507):3137-46.

⬧ Robison AJ, Nestler EJ (2011) Transcriptional and epigenetic mechanisms of addiction. Nat Rev

12(11):623-637.

⬧ Schoenbaum G, Shaham Y (2008) The role of orbitofrontal cortex in drug addiction: a review of

preclinical studies. Biol Psychiatry. 63(3): 256-262.

⬧ Schultz W (2002) Getting formal with dopamine and reward. Neuron 36:241-263.

⬧ Schultz W, Dickinson A (2000) Neuronal coding of prediction errors. Annu Rev Neurosci. 23:473-

500.

⬧ Shen H, Kalivas PW (2013) Reduced LTP and LTD in prefrontal cortex synapses in the nucleus

accumbens after heroin self-administration. Int J Neuropsychopharmacol 16:1165-1167.

https://www.ncbi.nlm.nih.gov/pubmed/?term=Pierce%20RC%5BAuthor%5D&cauthor=true&cauthor_uid=16099045

https://www.ncbi.nlm.nih.gov/pubmed/?term=Kumaresan%20V%5BAuthor%5D&cauthor=true&cauthor_uid=16099045


https://www.ncbi.nlm.nih.gov/pubmed/?term=Schoenbaum%20G%5BAuthor%5D&cauthor=true&cauthor_uid=17719014

https://www.ncbi.nlm.nih.gov/pubmed/?term=Shaham%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=17719014

https://www.ncbi.nlm.nih.gov/entrez/eutils/elink.fcgi?dbfrom=pubmed&retmode=ref&cmd=prlinks&id=17719014

Chapter 1

40

⬧ Stefanik MT, Moussawi K, Kupchik YM, Smith KC, Miller RL, Huff ML, Deisseroth K, Kalivas PW,

LaLumiere RT (2013) Optogenetic inhibition of cocaine seeking in rats. Addict Biol. 18(1):50-53.

⬧ Stewart J, de Wit H, Eikelboom R (1984) Role of unconditioned and conditioned drug effects in the

self-administration of opiates and stimulants. 91(2):251-268.

⬧ Swirnoff AH, Milbrandt J (1995) DNA-binding specificity of NGFI-A and related zinc finger

transcription factors. Mol Cell Biol 15:2275-2287.

⬧ Terleph TA, Tremere LA (2006) The use of immediate early genes as mapping tools for neuronal

activation: concepts and methods. In: Immediate Early Genes in Sensory Processing, Cognitive

Performance and Neurological Disorders. R. Pinaud, L.A. Tremere (ed). Springer Science &

Business Media.

⬧ Thoenen H (1995) Neurotrophins and neuronal plasticity. Science 270:593-598.

⬧ United Nation Office on Drugs and Crime (UNODC) (2016) World drug report 2016. Vienna: United

Nations publication

⬧ Uylings HB, Groenewegen HJ, Kolb B (2003) Do rats have a prefrontal cortex? Behav Brain Res.

146(1-2):3-17.

⬧ Vanderschuren LJMJ, Everitt BJ (2004) Drug seeking becomes compulsive after prolonged cocaine

self-administration. Science 305:1017-1019.

⬧ Vanderschuren LJMJ, Everitt BJ (2005) Behavioral and neural mechanisms of compulsive drug

seeking. Eur J Pharmacol 526:77-88.

⬧ Veeneman MM, Broekhoven MH, Damsteegt R, Vanderschuren LJMJ (2012) Distinct contributions

of dopamine in the dorsolateral striatum and nucleus accumbens shell to the reinforcing properties

of cocaine. Neuropsychopharmacology 37:487-498.

⬧ Volkow ND, Compton WM, Weiss SR (2014) Adverse health effects of marijuana use. N Engl J Med

371:879.

⬧ Volkow ND, Fowler JS (2000) Addiction, a disease of compulsion and drive: involvement of the

orbitofrontal cortex. Cereb Cortex 10:318-325.

⬧ Volkow ND, Fowler JS, Wang GJ, Hitzemann R, Logan J, Schlyer DJ, Dewey SL, Wolf AP (1993)

Decreased dopamine D2 receptor availability is associated with reduced frontal metablism in

cocaine abusers. Synapse 14(2):169-177.

⬧ Volkow ND, Koob GF, McLellan AT (2016) Neurobiologic advances from the brain disease model of

addiction. N Engl J Med. 374(4):363-371.

⬧ Volkow ND, Wang GJ, Fishman MW, Foltin RW, Fowler JS, Abumrad NN, Vitkun S, Logan J, Gatley

SJ, Pappas N, Hitzemann R, Shea CE. (1997) Relationship between subjective effects of cocaine

and dopamine transproter occupancy. nature 386:827-830.

⬧ Volkow ND, Wang GJ, Fowler JS, Tomasi D (2012) Addiction circuitry in the human brain. Anna Rev

Pharmacol Toxicol 52:321-336.

⬧ Volkow ND, Wise RA, Baler R (2017) the dopamine motive system: implications for drug and food

addiction. Nat Rev Neurosci.18:741-752.

⬧ Voorn P, Vanderschuren LJ, Groenewegen HJ, Robbens TW, Pennartz CM (2004) Putting a spin on

the dorsal-ventral divide of the striatum. Trends Neurosci. 27(8):468-474.

https://www.ncbi.nlm.nih.gov/pubmed/?term=Moussawi%20K%5BAuthor%5D&cauthor=true&cauthor_uid=22823160

https://www.ncbi.nlm.nih.gov/pubmed/?term=Kupchik%20YM%5BAuthor%5D&cauthor=true&cauthor_uid=22823160

https://www.ncbi.nlm.nih.gov/pubmed/?term=Smith%20KC%5BAuthor%5D&cauthor=true&cauthor_uid=22823160

https://www.ncbi.nlm.nih.gov/pubmed/?term=Miller%20RL%5BAuthor%5D&cauthor=true&cauthor_uid=22823160

https://www.ncbi.nlm.nih.gov/pubmed/?term=Huff%20ML%5BAuthor%5D&cauthor=true&cauthor_uid=22823160

https://www.ncbi.nlm.nih.gov/pubmed/?term=Deisseroth%20K%5BAuthor%5D&cauthor=true&cauthor_uid=22823160

https://www.ncbi.nlm.nih.gov/pubmed/?term=Kalivas%20PW%5BAuthor%5D&cauthor=true&cauthor_uid=22823160

https://www.ncbi.nlm.nih.gov/pubmed/?term=LaLumiere%20RT%5BAuthor%5D&cauthor=true&cauthor_uid=22823160


Chapter 1

41

⬧ World Health Organization (2015) WHO global report on trends in prevalence of tobacco smoking

2015. Geneva: world Health Organization.

⬧ Willuhn I, Wanat MJ, Clark JJ, Phillips PE (2010) Dopamine signaling in the nucleus accumbens of

animals self-administering drugs of abuse. Curr Top Behav Neurosci. 3:29-71.

⬧ Wise RA (1988) The neurobiology of craving: Implications for the understanding and treatment of

addiction. J Abnorm Psychol 97(2):118-132.

⬧ Wise RA (2002) Brain reward circuitry: insight from unsensed incentives. Neuron. 36(2):229-240.

⬧ Wise RA (2004) Dopamine, learning and motivation. Nat Rev Neurosci 5(6):483-494.

⬧ Wise RA (2008) Dopamine and reward: the anhedonia hypothesis 30 years on. Neurotox Res

14:169-183.

⬧ Wise RA, Koob GF (2014) The development and maintenance of drug addiction.


⬧ Winstanley CA, LaPlant Q, Theobald DE, Green TA, Bachtell RK, Perrotti LI, DiLeone RJ, Russo SJ,

Garth WJ, Self DW, Nestler EJ (2007) DeltaFosB induction in orbitofrontal cortex mediates

tolerance to cocaine-induced cognitive dysfunction. J Neurosci 27(39):10497-10507.

⬧ Worley PF, Bhat RV, Baraban JM, Erickson CA, McNaughton BL, Barnes CA (1993) Thresholds for

synaptic activation of transcription factors in hippocampus: correlation with long-term enhancement.

J. Neurosci 13(11):4776-4786.

⬧ Yin HH, Knowlton BJ (2006) The role of the basal ganglia in habit formation. Nat Rev Neurosci.

7(6):464-476.

⬧ Yin HH, Knowlton BJ, Balleine BW (2004) Lesions of dorsolateral striatum preserve outcome

expectancy but disrupt habit formation in instrumental learning. Eur J Neurosci. 19(1):181-189.

⬧ Yin HH, Ostlund SB, Knowlton BJ, Balleine BW (2005) The role of the dorsomedial striatum in

instrumental conditioning. Eur J Neurosci 22:513-523.

⬧ Young ST, Porrino LJ, Iadarola MJ (1991) Cocaine induces striatal c-fos-immunoreactive proteins

via dopaminergic D1 receptors. Proc Natl Acad Sci U S A 88:1291-1295.

⬧ Zahm DS (1999) Functional-anatomical implications of the nucleus accumbens core and shell

subterritories. Ann N Y Acad Sci. 877:113-128.

⬧ Zahm DS, Becker ML, Freiman AJ, Strauch S, Degarmo B, Geisler S, Meredith GE, Marinelli M

(2010) Fos after single and repeated self-administration of cocaine and saline in the rat: emphasis

on the Basal forebrain and recalibration of expression. Neuropsychopharmacology 35:445-463.

⬧ Zapata A, Hwang EK, Lupica CR (2017) Lateral Habenula Involvement in Impulsive Cocaine

Seeking. Neuropsychopharmacology. 42(5):1103-1112.

⬧ Ziółkowska B, Gieryk A, Solecki W, Przewlocki R (2015) Temporal and anatomic patterns of

immediate-early gene expression in the forebrain of C57BL/6 and DBA/2 mice after morphine

administration. Neuroscience 284:107-124.

⬧ Zuo W, Chen L, Wang L, Ye JH (2013) Cocaine facilitates glutamatergic transmission and activates

lateral habenular neurons. Neuropharmacology. 70:180-189.

https://www.ncbi.nlm.nih.gov/pubmed/?term=Willuhn%20I%5BAuthor%5D&cauthor=true&cauthor_uid=21161749

https://www.ncbi.nlm.nih.gov/pubmed/?term=Wanat%20MJ%5BAuthor%5D&cauthor=true&cauthor_uid=21161749

https://www.ncbi.nlm.nih.gov/pubmed/?term=Clark%20JJ%5BAuthor%5D&cauthor=true&cauthor_uid=21161749

https://www.ncbi.nlm.nih.gov/pubmed/?term=Phillips%20PE%5BAuthor%5D&cauthor=true&cauthor_uid=21161749

https://www.ncbi.nlm.nih.gov/pubmed/21161749/

https://www.ncbi.nlm.nih.gov/pubmed/?term=Zapata%20A%5BAuthor%5D&cauthor=true&cauthor_uid=28025973

https://www.ncbi.nlm.nih.gov/pubmed/?term=Hwang%20EK%5BAuthor%5D&cauthor=true&cauthor_uid=28025973

https://www.ncbi.nlm.nih.gov/pubmed/?term=Lupica%20CR%5BAuthor%5D&cauthor=true&cauthor_uid=28025973

Chapter 1

42

Chapter 2

43

Chapter 2

Stable immediate early gene expression patterns in

medial prefrontal cortex and striatum after long-term

cocaine self-administration

Ping Gao1,

Jules H. W. Limpens2,

Sabine Spijker3,

Louk J. M. J. Vanderschuren2,4,

Pieter Voorn1

1 Department of Anatomy and Neurosciences, Neuroscience Campus Amsterdam, VU University

Medical Center, Amsterdam, The Netherlands

2 Brain Center Rudolf Magnus, Department of Translational Neuroscience, University Medical Center

Utrecht, Utrecht, The Netherlands

3 Department of Molecular and cellular Neurobiology, Center for Neurogenomics & Cognitive

Research, Neuroscience Campus Amsterdam, VU University Amsterdam, Amsterdam, The

Netherlands

4 Department of Animals in Science and Society, Division of Behavioural Neuroscience, Faculty of

Veterinary Medicine, Utrecht University, Utrecht, The Netherlands

Addict Biol. 2017; 22(2):354-368.

Chapter 2

44

Abstract

The transition from casual to compulsive drug use is thought to occur as a consequence of

repeated drug taking leading to neuroadaptive changes in brain circuitry involved in emotion

and cognition. At the basis of such neuroadaptations lie changes in the expression of

immediate early genes (IEGs) implicated in transcriptional regulation, synaptic plasticity and

intracellular signaling. However, little is known about how IEG expression patterns change

during long-term drug self-administration. The present study, therefore, compares the effects

of 10 and 60 days self-administration of cocaine and sucrose on the expression of 17 IEGs in

brain regions implicated in addictive behavior, i.e. dorsal striatum, ventral striatum and

medial prefrontal cortex (mPFC). Increased expression after cocaine self-administration was

found for 6 IEGs in dorsal and ventral striatum (c-fos, Mkp1, Fosb/ΔFosb, Egr2, Egr4, Arc)

and 10 IEGs in mPFC (same 6 IEGs as in striatum, plus Bdnf, Homer1, Sgk1, and Rgs2).

Five of these 10 IEGs (Egr2, Fosb/ΔFosb, Bdnf, Homer1, and Jun) and Trkb in mPFC were

responsive to long-term sucrose self-administration. Importantly, no major differences were

found between IEG expression patterns after 10 or 60 days of cocaine self-administration,

except Fosb/ΔFosb in dorsal striatum and Egr2 in mPFC, whereas the amount of cocaine

obtained per session was comparable for short- and long-term self-administration. These

steady changes in IEG expression are, therefore, associated with stable self-administration

behavior rather than the total amount of cocaine consumed. Thus, sustained impulses to IEG

regulation during prolonged cocaine self-administration may evoke neuroplastic changes

underlying compulsive drug use.

Abbreviations

IEGs: immediate early genes

DS: dorsal striatum

VS: ventral striatum

mPFC: medial prefrontal cortex

RT-PCR: real-time PCR

ISH: in situ hybridization

Chapter 2

45

Introduction

The transition from casual to compulsive drug use is thought to be initiated by pathological

neuroadaptations in neural circuits that are involved in reward processing, habit formation

and cognitive control over behavior, including the ventral striatum (VS), dorsal striatum (DS)

and prefrontal cortex (PFC) (Jentsch and Taylor 1999; Koob and Volkow 2010; Pierce and

Vanderschuren 2010; Everitt 2014). That is, the reinforcing properties of psychostimulants

such as cocaine are widely assumed to be mediated by the mesolimbic dopaminergic system

that targets the VS (Pierce and Kumaresan 2006). The DS has been implicated in habit

formation (Yin and Knowlton 2006) and drug-induced maladaptive changes in this process

might play a major role in the development of inflexible cocaine use (Vanderschuren et al.

2005; Zapata et al. 2010; Jonkman et al. 2012a). Evidence suggests that a gradual shift in

striatal control over drug use takes place from VS to DS with a prolonged drug taking history,

as drug use devolves from casual to compulsive (Porrino et al. 2004b; Everitt and Robbins

2005; Pierce and Vanderschuren 2010). Concomitantly, drug-induced changes leading to

malfunction of medial PFC (mPFC) are thought to cause failure of cognitive control over drug

seeking (Jentsch and Taylor 1999; Goldstein and Volkow 2011; Chen et al. 2013).

Cocaine-induced neuroadaptations affecting striatal and PFC function have been

shown to involve complex molecular changes in transcriptional regulation and cellular

signaling pathways (Lüscher and Malenka 2011; Robison and Nestler 2011), in which

immediate early genes (IEGs) are key components. IEG expression profiles have been

widely studied to establish the effects of cocaine exposure, but few studies have looked at

IEG changes as a consequence of cocaine self-administration (Perrotti et al. 2008; Larson et

al. 2010; Zahm et al. 2010; Besson et al. 2013; Fumagalli et al. 2013). Importantly, studies in

rats and primates have shown that cocaine exposure-evoked changes in striatal metabolic

activity and dopamine function spread in extent and intensity as a function of self-

administration experience (Letchworth et al. 2001; Porrino et al. 2004a; Besson et al. 2013).

Moreover, prolonged cocaine self-administration has been demonstrated to engender

addiction-like behaviour, for example as insensitivity to punishment (Deroche-Gamonet et al.

2004; Vanderschuren and Everitt 2004; Pelloux et al. 2013; Vanderschuren and Ahmed 2013;

Limpens et al. 2014b). In the present study, we, therefore, measured the expression of a

panel of IEGs in VS, DS and mPFC of animals that had been self-administering cocaine for

either a limited (10 days) or a prolonged (60 days) time period, using quantitative real-time

PCR (RT-PCR). The panel of IEGs encompassed genes responsive to cocaine or

dopaminomimetic drugs that are involved in a broad range of functions ranging from

transcriptional regulation (Fos and Egr family) to synaptic plasticity (Arc, Bdnf, Homer1,

Chapter 2

46

Dclk1, Ccnl1), intracellular signaling (Bdnf, BDNF receptor Trkb, Rgs2), and cellular stress or

phosphorylation (Sgk1, Mkp1) (Hope et al. 1994; Berke et al. 1998; Burchett et al. 1999;

Thiriet et al. 2000; Berke et al. 2001; Takaki et al. 2001; Courtin et al. 2006; Corominas et al.

2007; McGinty et al. 2008; Fumagalli et al. 2009; Ghasemzadeh et al. 2009; Larson et al.

2010; Zahm et al. 2010; Guez-Barber et al. 2011; McCoy et al. 2011; Fumagalli et al. 2013;

Jia et al. 2013; Otis et al. 2014; Heller et al. 2015). IEG expression levels in the cocaine-

exposed animals were compared to those after self-administration of the natural reinforcer

sucrose and a self-administration control.

Our hypothesis was that after short-term cocaine exposure VS would display an

increase in the expression levels of particular IEGs, which would abate after extended

access to cocaine. For DS, we expected to find enhanced expression mainly after long-term

exposure to cocaine. With respect to mPFC, we expected to see increased IEGs expression

after short-term cocaine self-administration, followed by either further increases or decreases

after long-term cocaine exposure.

Methods

Animals

Male Wistar rats (Charles River, Sulzfeld, Germany) weighing 320 − 380 gram were housed

individually in Macrolon cages (L = 40 cm, W = 25 cm, H = 18 cm) under controlled

conditions (temperature = 20 – 21 °C, 55 ± 15% relative humidity) and a reversed 12h light -

dark cycle (lights on at 19:00). Each subject received 20 g laboratory chow (SDS Ltd, UK)

per day and free access to water, which was sufficient to maintain body weight and growth.

Self-administration sessions were carried out between 9 am and 6 pm, for 5 days a week. All

experiments were approved by the Animal Ethics Committee of Utrecht University and were

conducted in agreement with Dutch laws (Wet op de Dierproeven, 1996) and European

regulations (Guideline 86 / 609 / EEC).

Apparatus

Subjects were trained and tested in operant conditioning chambers (L = 29.5 cm, W =

32.5cm, H = 23.5cm; Med Associates, Georgia, VT, USA). The chambers were placed in

light - and sound-attenuating cubicles equipped with a ventilation fan. Each chamber was

equipped with two 4.8 cm wide retractable levers, placed 11.7 cm apart and 6.0 cm from the

grid floor. A cue light (28 V, 100 mA) was present above each active lever and a white house

Chapter 2

47

light (28 V, 100 mA) was located on the opposite wall. Sucrose pellets (45 mg, formula F,

Research Diets, New Brunswick, NJ, USA) were delivered at the wall opposite to the levers

via a dispenser. Cocaine infusions were controlled by an infusion pump placed on top of the

cubicles. During the cocaine self-administration sessions, polyethylene tubing ran from the

syringe placed in the infusion pump via a swivel to the cannula on the animals’ back. In the

operant chamber, tubing was shielded with a metal spring. Experimental events and data

recording were controlled by procedures written in MedState Notation using MED-PC for

Windows.

Surgery

Rats allocated to the cocaine self-administration group were anaesthetized with ketamine

hydrochloride (0.075 mg/kg, i.m) and medetomidine (0.40 mg/kg, s.c.) and supplemented

with ketamine as needed. A single catheter was implanted in the right jugular vein aimed at

the left vena cava. Catheters (Camcaths, Cambridge, UK) consisted of a 22 g cannula

attached to silastic tubing (0.012 ID) and fixed to nylon mesh. The mesh end of the catheter

was sutured subcutaneously (s.c.) on the dorsum. Carprofen (50 mg/kg, s.c.) was

administered once before and twice after surgery. Gentamycin (50 mg/kg, s.c.) was

administered before surgery and for 5 days post-surgery. Animals were allowed 10 days to

recover from surgery.

Cocaine and sucrose self-administration procedures

Rats were trained to self-administer cocaine under a fixed ratio-1 (FR-1) schedule of

reinforcement. During the self-administration sessions, two levers were present, an active

lever and an inactive lever. The left or right position of the active and inactive levers was

counterbalanced for individual animals. Pressing the active lever resulted in the infusion of

0.25 mg cocaine in 0.1 mL saline over 5.6 seconds, retraction of the levers and switching off

of the house light. During the infusion, a cue light above the lever was switched on, followed

by a 20 sec time-out period after which the levers were reintroduced and the house light

illuminated. The time-out period was changed to 3 minutes after 5 training sessions in order

to increase the session length. The session ended after 2 hours or if animals had obtained

40 cocaine infusions, whichever occurred first. Responding on the inactive lever had no

programmed consequences but was recorded to assess general levels of activity. After each

self-administration session, intravenous catheters were flushed with a gentamycin-heparin-

saline solution to maintain the patency of the catheters.

Chapter 2

48

The training procedure for the rats in the sucrose group was similar to that for cocaine

self-administration, with the exception that each response on the active lever resulted in

delivery of a sucrose pellet. Subjects in the control group were also exposed to the self-

administration box. Each response on the active lever resulted in illumination of the cue-light

for 5.6 seconds.

Rats were trained to self-administer cocaine or sucrose for either 10 days or 60 days,

and thereafter used for the quantitative RT-PCR experiments. In the 10 days experiment, 20

rats were used (control: n = 6, sucrose: n = 6, cocaine: n = 8), and in the 60 days experiment

the number of animals was 24 (control: n = 8, sucrose: n = 8, cocaine: n=8). To validate our

findings in the RT-PCR experiments for selected genes (i.e. c-fos and Bdnf) with a different

technique, separate rats were trained in the same procedures and used for in situ

hybridization (ISH). In the 10 days experiment, control: n = 8, sucrose: n = 8, cocaine: n = 8,

and in the 60 days experiments, control: n = 8, sucrose: n = 8, cocaine: n = 8.

Tissue dissection

After the last self-administration session, rats were moved back to their home cages, and

decapitated after 30 minutes. Brains were quickly removed and immediately frozen in cold

isopentane, then stored at −80 °C. For RT-PCR experiments, 200 µm coronal sections were

cut at −15 °C in a cryostat (Leica CM 1950). Three different brain regions including mPFC,

DS and VS were collected and stored separately. For ISH experiments, 14 µm thick coronal

sections were cut at −25 °C in the cryostat and mounted on SuperFrost® Plus glass slides

(Menzel-Gläser, Braunschweig, Germany)

RNA extraction and Quantitative real-time PCR

Total RNA was extracted by Guanidinium thiocyanate-phenol-chloroform extraction method

(Chomczynski and Sacchi 1987) and stored in RNase-free water (Ambion Inc., Austin, TX,

USA). A reverse transcription reaction was performed using TaqMan® reverse transcription

reagents (Applied Biosystems, Branchburg, NJ, USA) with the total reaction volume of 20 µL

(1 µg RNA template, 4 µL 5X iScript reaction Mix, 1 µL iScript reverse transcriptase, and

nuclease-free water) at the following conditions: 25 °C for 10 minutes, 37 °C for one hour

and stopped by heating at 85 °C for 5 minutes.

Primers for 17 IEGs were designed using Primer 3 software. Details of all primers are

given in Supplementary Table 1. A total of 10 µL reaction volume contained 1 µL of cDNA, 5

µL of 2x SYBR Green mix (Applied Biolosystems, USA), 1 µL RNase-free H2O and 3 µL

primer pair mix (1 pmoL/µL each). The temperature of the cycling protocol was 95 °C for 2

Chapter 2

49

minutes, followed by 40 reaction cycles of 95 °C for 15 seconds and 60 °C for 60 seconds,

using the Applied Biosystems® StepOnePlus™ real-time PCR system. For correcting results,

target IEGs transcripts were normalized to internal endogenous reference genes. IEGs Dclk1,

Ccnl1 and Homer1 were normalized using the mean of 2 reference genes (Gapdh and Actb),

and the other IEGs were normalized using the mean of 3 reference genes (Gapdh, Actb, and

Eno2). Analysis was performed according to the 2−ΔΔCT method (Livak and Schmittgen 2001).

Data from the cocaine and sucrose groups are presented as the n-fold change in gene

expression relative to the self-administration control group.

In situ hybridization

In situ hybridization for c-fos and Bdnf in striatum and mPFC after cocaine or sucrose self-

administration was performed as previously published (van Kerkhof et al. 2014). In brief,

DNA fragments for generating RNA probes were produced using Phusion® High-Fidelity

PCR Kit (Thermo, New England Biolabs, Germany) with PCR conditions 98 °C / 2 minutes,

followed by 30 cycles of 98 °C for 20 s, 66 °C for 40 s, 72 °C for 60 s, and 72 °C for 10

minutes. Primers containing either a T7 or T3 RNA polymerase promoter sequence were:

c-fos: sense 5`- GTAATACGACTCACTATAGGGTCACCCTGCCTCTTCTCAAT-3`,

and antisense 5`- AATTAACCCTCACTAAAGGGCACAGCCTGGTGTGTTTCAC-3`;

Bdnf: sense 5`-AATTAACCCTCACTAAAGGGGCGGATATTGCAAAGGGTTA-3`, and

antisense 5`-GTAATACGACTCACTATAGGGCGGCATCCAGGTAATTTTTG-3`.

Probes were labeled by incorporating digoxigenin-labeled UTP (Roche Diagnostics

GmbH, Mannheim, Germany). Sections were fixated, acetylated, dehydrated and delipidated

as described previously and hybridized with digoxigenin-labeled antisense RNA probe (5

ng/section). Post-hybridization stringency washings were in 1x SSC at 60 °C. Digoxigenin

was visualized using immunocytochemistry with alkaline phosphatase as reporter molecule

using NBT/BCIP as a substrate (van Kerkhof et al. 2014).

Quantification of hybridized probe was carried out on a MCID Elite image system

(Interfocus Imaging Ltd., Linton, UK) by assessing the surface area of individual

immunopositive cells multiplied by the individual cellular staining intensity (optical density)

(van Kerkhof et al. 2014).

Statistical analysis

Data was analyzed using SPSS software 20 (IBM, New York, NY, USA). A repeated

measures ANOVA was used for analyzing cocaine / sucrose self-administration in the 10 and

60 days-experiments, with treatment as a between-subject factor and self-administration

Chapter 2

50

session as a within-subject factor. A Greenhouse-Geisser correction was applied when

Mauchly's Test of sphericity indicated that the assumption of sphericity had been violated. To

determine whether the effects of short-term cocaine self-administration on IEG expression

differed from those after long-term administration, the quantitative RT-PCR data were

analyzed using two-way ANOVA with treatment and number of self-administration sessions

(10 or 60) as factors, followed by Tukey’s post-hoc test if appropriate. ISH signal of c-fos in 3

brain regions (VS, DS and mPFC) and Bdnf in mPFC were also analyzed with two-way

ANOVA followed by Tukey’s post-hoc test.

Results

Cocaine and sucrose self-administration

Rats were trained to self-administer cocaine or sucrose for either 10 or 60 days (Fig. 1 A-B).

The animals self-administered under a FR1 schedule of reinforcement, so that the number of

active lever presses equals the number of rewards obtained. Repeated measures ANOVA

showed a main effect of treatment on the active lever presses in the 10 days (F (2, 17) =

21.172, p < 0.001) and 60 days experiments (F (2, 21) = 181.993, p < 0.001). Post-hoc

analysis showed that the sucrose group differed significantly from the control and cocaine

groups in both experiments (both p < 0.001). A significant difference between the cocaine

and control groups was found in the 60 days experiment (p < 0.001). In both experiments,

there was a main effect of session on active lever presses (10 days: F (3.645, 61.97) = 3.026,

p = 0.028; 60 days: F (3.388, 71.15) = 6.312, p < 0.001), and there was a significant

interaction between treatment and session (10 days: F (7.29, 61.97) = 7.462, p < 0.001; 60

days: F (6.522, 61.96) = 2.946, p = 0.011). When the numbers of active lever presses

between the first and the last session of the experiment were compared, significant increases

were seen in the cocaine group (10 days: t = −9.205, df = 14, p < 0.001; 60 days: t = −9.521,

df = 14, p < 0.001), but not in the sucrose group (10 days: t = −2.131, df = 5.004, p = 0.086;

60 days: t = −1.854, df = 7.00, p = 0.106). In contrast, in the control group active lever

presses showed a decrease between the first and the final session in the 10 days experiment

(10 days: t = 3.201, df = 10, p = 0.009; 60 days: t = −1.802, df = 14, p = 0.093). Responses

to the inactive lever in the cocaine and sucrose groups were below 7 per session from the

third self-administration session onwards, in both experiments. The number of active lever

presses was significantly higher than the response to the inactive lever in the cocaine (10

day: F (1, 14) = 42.933, p < 0.001; 60 days: F (1, 14) = 407.68, p < 0.001) and sucrose self-

administration groups (10 day: F (1, 10) = 123.739, p < 0.001; 60 days: F (1, 14) =

Chapter 2

51

19305.395, p < 0.001), but not in the control group (10 day: F (1, 10) = 3.564, p = 0.08; 60

days: F (1, 14) = 2.336, p = 0.149).

Fig. 1. Short-term (10 days, A) vs. long-term (60 days, B) self-administration of cocaine or sucrose.

Data is presented as mean ± SEM number of active lever presses over animals per group.

Gene expression after cocaine or sucrose self-administration

Ventral striatum

In VS, a significant main effect of treatment was seen in the expression of 9 IEGs: c-fos (F (2,

37) = 28.428, p < 0.001), Mkp1 (F (2, 37) = 28.402, p < 0.001), Fosb/ΔFosb (F (2, 37) =

18.194, p < 0.001), Egr2 (F (2, 37) = 23.405, p < 0.001), Arc (F (2, 37) = 7.086, p = 0.002),

Egr4 (F (2, 37) = 9.751, p < 0.001), Egr3 (F (2, 37) = 7.882, p = 0.001), Jun (F (2, 37) =

3.457, p = 0.042), and Fosl1 (F (2, 37) = 3.707, p = 0.034) (Fig. 2 A-I) (for complete overview

of all 17 IEGs, see Supplementary Table 2. Please note that the designation IEG for

Fosb/ΔFosb and Trkb are used for ease of discussion; Fosb/ΔFosb is a specific transcript,

and Trkb was included because of its high affinity for BDNF). Post-hoc tests showed that

mRNA levels of 5 of these genes were significantly higher in the cocaine self-administration

Chapter 2

52

Fig. 2. Effects of cocaine or sucrose self-administration on 13 IEGs in ventral striatum. Relative

transcript expression levels of IEGs after 10 or 60 days of self-administration as determined by

quantitative RT-PCR. Data from the cocaine and sucrose groups were calculated as fold change in

gene expression relative to the control group, and presented as mean ± SEM. P values are shown if

the effects of treatment (Trt), session (Session), or the interaction (Session x Trt) were significant in

two-way ANOVA. Symbols refer to significant differences between experimental groups after post hoc

testing: *, cocaine and control groups, * p<0.05, ** P<0.001; ^, cocaine and sucrose groups, ^

p<0.05, ^^ p<0.001; #, 10 and 60 days cocaine groups, # p<0.05, ## p<0.001; $, 10 and 60 days

sucrose groups, $ p<0.05, $$ p<0.05.

Chapter 2

53

group (Con) than the sucrose self-administration (Suc) and control (Con) groups: c-fos (Coc

vs. Con/Suc, p < 0.001), Mkp1 (Coc vs. Con/Suc, p < 0.001), Fosb/ΔFosb (Coc vs. Con/Suc,

p < 0.001), Egr2 (Coc vs. Con/Suc, p < 0.001), Arc (Coc vs. Con: p = 0.001, Coc vs. Suc: p =

0.006) (Fig. 2 A-E). For Egr4, Egr3, Jun, and Fosl1, significant differences were only found

between the cocaine self-administration and control groups (Egr4: p = 0.001, Egr3: p = 0.001,

Jun: p = 0.036, Fosl1: p = 0.034) (Fig. 2 F-I).

A main effect of session (10 vs. 60 days) was found for the expression of Egr4 (F (1,

37) = 6.383, p = 0.016), Ccnl1 (F (1, 37) = 22.730, p < 0.001), Trkb (F (1, 37) = 8.469, p =

0.006), Egr1 (F (1, 37) = 8.143, p = 0.007), and Rgs2 (F (1, 37) = 7.099, p = 0.011) (Figs 2 F,

2 J-M).

For Ccnl1 a significant interaction between session and treatment was found (F (2, 37)

= 5.929, p = 0.006) (Fig. 2 J). Post-hoc tests showed that after 10 days of self-administration

the Ccnl1 mRNA levels in the cocaine group were significantly higher than in control (p =

0.006), but not higher than in the sucrose group (p = 0.499). The value in the sucrose group

was not significantly different from control (p = 0.08). After 60 days, no significance was

observed for any comparison among control, sucrose and cocaine groups (Coc vs. Con: p =

0.413, Coc vs. Suc: p = 1, Suc vs. Con: p = 0.413) (Fig. 2 J). In addition, for both cocaine

and sucrose groups, significant differences were seen between 10 and 60 days of self-

administration sessions (cocaine: t = 6.16, df = 14, p <0.001; sucrose: t = 4.918, df = 12, p <

0.001) (Fig. 2 J).

Dorsal striatum

In DS, increased expression of 6 IEGs was found after 10 or 60 days of cocaine self-

administration. Two-way ANOVA revealed a significant main effect of treatment on the

induction of c-fos (F (2, 38) = 91.535, p < 0.001), Mkp1 (F (2, 38) = 33.507, p < 0.001),

Fosb/ΔFosb (F (2, 38) = 60.208, p < 0.001), Egr2 (F (2, 38) = 42.690, p < 0.001), Arc (F (2,

38) = 14.260, p < 0.001), and Egr4 (F (2, 38) = 18.323, p < 0.001) (Fig. 3 A-F) (for complete

overview of all 17 IEGs, see Supplementary Table 2). Post-hoc tests showed that the mRNA

levels of these 6 genes were significantly higher after cocaine self-administration than after

sucrose self-administration and control (c-fos: Coc vs. Con/Suc, p < 0.001, Mkp1: Coc vs.

Con/Suc, p < 0.001, Fosb/ΔFosb: Coc vs. Con/Suc, p < 0.001, Egr2: Coc vs. Con/Suc, p <

0.001, Arc: Coc vs. Con/Suc, p < 0.001, Egr4: Coc vs. Con/Suc, p < 0.001), whereas no

differences were found between the sucrose and the control groups (c-fos: p = 0.14, Mkp1: p

= 0.466, Fosb/ΔFosb: p = 0.326, Egr2: p = 0.076, Arc: p = 0.75, Egr4: p = 0.234) (Fig. 3 A-F).

For Egr4, a main effect of session (10 vs. 60 days) was seen in DS (F (1, 38) = 8.672,

p = 0.006) (Fig. 3 F).

Chapter 2

54

For Fosb/ΔFosb, there was a significant interaction between session and treatment (F

(2, 38) = 3.651, p = 0.035) (Fig. 3 C). Post-hoc tests showed that Fosb/ΔFosb mRNA levels

in the cocaine group were significantly higher than those in the sucrose and control groups in

both the 10 and 60 days-experiments (p < 0.001 for all comparisons), but no differences

were present between sucrose and control (10 days: p = 0.951, 60 days: p = 0.489) (Fig. 3

C). In addition, significant differences were seen between 10 days and 60 days self-

administration in the cocaine groups (t = 2.524, df = 14, p = 0.024) but not in the sucrose

groups (t = -0.918, df = 12, p = 0.377) (Fig. 3 C).

Fig. 3. Effects of cocaine or sucrose self-administration on 6 IEGs in dorsal striatum. Relative

transcript expression levels of IEGs after 10 or 60 days of self-administration as determined by

quantitative RT-PCR. Data from the cocaine and sucrose groups were calculated as fold change in

gene expression relative to the control group, and presented as mean ± SEM. P values are shown if

the effects of treatment (Trt), session (Session), or the interaction (Session x Trt) were significant in

two-way ANOVA. Symbols refer to significant differences between experimental groups after post hoc


p<0.05, ^^ p<0.001; #, 10 and 60 days cocaine groups, # p<0.05.

Chapter 2

55

Medial prefrontal cortex

In mPFC, two-way ANOVA revealed a main effect of treatment on the expression of 10 IEGs,

i.e. c-fos (F (2, 38) = 41.875, p < 0.001), Mkp1 (F (2, 38) = 44.508, p < 0.001), Egr2 (F (2, 38)

= 39.807, p < 0.001), Fosb/ΔFosb (F (2, 38) = 42.594, p < 0.001), Arc (F (2, 38) = 10.027, p

< 0.001), Egr4 (F (2, 38) = 8.144 p = 0.001), Bdnf (F (2, 38) = 6.102, p = 0.005), Homer1 (F

(2, 38) = 8.881, p < 0.001), Sgk1 (F (2, 38) = 5.387, p = 0.009), and Rgs2 (F (2, 38) = 5.385,

p = 0.009) (Fig. 4 A-J) (for complete overview of all 17 IEGs, see Supplementary Table 2).

Post-hoc tests showed that cocaine self-administration, compared with sucrose self-

administration and control, significantly enhanced the mRNA levels of c-fos (Coc vs. Con/Suc,

p < 0.001), Mkp1 (Coc vs. Con/Suc, p < 0.001), Fosb/ΔFosb (Coc vs. Con/Suc, p < 0.001),

Egr2 (Coc vs. Con/Suc, p < 0.001), Arc (Coc vs. Con, p = 0.001; Coc vs. Suc, p = 0.003),

and Egr4 (Coc vs. Con, p = 0.005; Coc vs. Suc, p = 0.002) (Fig. 4 A-F). Both Egr2 and

Fosb/ΔFosb were significantly up-regulated by sucrose self-administration in comparison to

the control group (Egr2: p = 0.018, Fosb/ΔFosb: p = 0.012) (Fig. 4 C-D). For Bdnf and

Homer1, cocaine and sucrose self-administration significantly increased mRNA levels

compared to the control group (Bdnf: Coc vs. Con, p = 0.009, Suc vs. Con, p = 0.008;

Homer1: Coc vs. Con, p < 0.001, Suc vs. Con, p = 0.001, Fig. 4 G-H), but there was no

significant difference between the cocaine and the sucrose self-administration groups. For

Sgk1, significant differences were seen only between the cocaine and control groups (p =

0.007) (Fig. 4 I). Interestingly, ISH for Sgk1 demonstrated labeled cells not only in cortical

and striatal gray matter but also in corpus callosum. Small-sized cells in white and gray

matter - probably oligodendrocytes - were more heavily labeled than larger cells in gray

matter (Supplementary Fig. S1). For Rgs2, significant differences were seen only between

the cocaine and sucrose groups (p = 0.01) (Fig. 4 J).

A significant main effect of session was seen on the expression of Egr2 (F (1, 38) =

22.088, p < 0.001), Fosb/ΔFosb (F (1, 38) = 7.725, p = 0.008), Arc (F (1, 38) = 5.445, p =

0.025), Bdnf (F (1, 38) = 4.154, p = 0.049), Homer1 (F (1, 38) = 11.321, p = 0.002), Jun (F (1,

38) = 21.460, p < 0.001), Trkb (F (1, 38) = 21.989, p < 0.001), Egr3 (F (1, 38) = 10.727, p =

0.002), Dclk1 (F (1, 38) = 10.757, p = 0.002), Ccnl1 (F (1, 38) = 5.822, p = 0.021), and Egr1

(F (1, 38) = 4.717, p = 0.036) (Fig. 4. C-E, G-H, K-P).

A significant interaction between session and treatment was observed for the

expression of Egr2 (F (2, 38) = 8.457, p = 0.001), Jun (F (2, 38) = 11.343, p < 0.001), and

Trkb (F (2, 38) = 5.504, p = 0.008) (Fig. 4 C, K, L). Post-hoc tests showed that the Egr2

mRNA levels in the cocaine self-administration group were significantly higher than in the

sucrose self-administration (p = 0.001) and control groups (p = 0.005) in the 10 days

experiment. After 60 days, the Egr2 mRNA levels in the cocaine self-administration group still

Chapter 2

56

Fig. 4. Effects of cocaine or sucrose self-administration on 16 IEGs in medial prefrontal cortex.

Relative transcript expression levels of IEGs after 10 or 60 days of self-administration as determined

by quantitative RT-PCR. Data from the cocaine and the sucrose groups were calculated as fold

change in gene expression relative to the control group, and presented as mean ± SEM. P values are

shown if the effects of treatment (Trt), session (Session), or the interaction (Session x Trt) were

significant in two-way ANOVA. Symbols refer to significant differences between experimental groups

after post hoc testing: *, cocaine and control groups, * p<0.05, ** P<0.001; ^, cocaine and sucrose

groups, ^ p<0.05, ^^ p<0.001; @, sucrose and control groups, @ p<0.05; #, 10 and 60 days cocaine

groups, # p<0.05, ## p<0.001; $, 10 and 60 days sucrose groups, $ p<0.05.

Chapter 2

57

significantly differed from the other two groups (Coc vs. Con/Suc, p < 0.001), but also a

significant increase in Egr2 expression was seen in the sucrose self-administration group

compared to the control group (p = 0.033). Furthermore, the Egr2 up-regulation after 60 days

of cocaine or sucrose self-administration was significantly greater than that after 10 days

(cocaine: t = −4.568, df = 14, p < 0.001; sucrose: t = −2.619, df = 12, p = 0.022) (Fig. 4 C).

For Jun, the mRNA levels in the cocaine self-administration group were significantly higher

than in the sucrose self-administration group after 10 days (Coc vs. Suc: p = 0.022; Coc vs.

Con: p = 0.054). In contrast, after 60 days, the expression of Jun in the cocaine or sucrose

self-administration groups was significantly lower than in the control group (Coc vs. Con: p =

0.001, Suc vs. Con: p = 0.039). In addition, the induction of Jun mRNA after 60 days of

cocaine and sucrose self-administration was significantly lower than after 10 days (cocaine: t

= 6.566, df = 14, p < 0.001; sucrose: t = 3.454, df = 12, p = 0.005) (Fig. 4 K). For Trkb, no

significant differences were observed between groups after 10 days administration (Coc vs.

Con: p = 0.858, Con vs. Suc: p = 0.889, Suc vs. Con: p = 0.630), while after 60 days, the

mRNA levels in both cocaine and sucrose groups were significantly higher than in control

(Coc vs. Con: p = 0.001, Suc vs. Con: p = 0.029). No difference was seen between cocaine

and sucrose self-administration (p = 0.339). In addition, for both the cocaine and sucrose

groups, Trkb mRNA levels after 60 days of self-administration were significantly different

from those after 10 days (cocaine: t = 3.558, df = 14, p = 0.003; sucrose: t = 3.991, df = 12, p

= 0.002) (Fig. 4 L).

Histological validation for representative IEGs

ISH was performed in order to confirm the effects of cocaine self-administration that had

been established with RT-PCR. c-fos and Bdnf were selected as two representative genes

for ISH, since the RT-PCR data showed a strong increase of c-fos in both striatum and

mPFC, whereas up-regulation of Bdnf was only observed in mPFC.

For c-fos, visual inspection showed a high signal in animals that had self-

administered cocaine for either 10 or 60 days with a large amount of c-fos positive cells in

striatum and a vast accumulation of cells particularly in the dorsomedial striatum compared

to the control animals (compare Fig. 5 A with 5 B, and 5 C with 5 D). c-fos positive cells had

a label-free nucleus and darkly labeled cytoplasm, that clearly differed in labeling intensity

between the cocaine self-administration (Fig. 5 F) and control groups (Fig. 5 E).

Two-way ANOVA indicated a significant main effect of treatment on the total amount

of c-fos ISH signal in VS, DS, and mPFC (VS: F (2, 41) = 24.876, p < 0.001, DS: F (2, 41) =

29.973, p < 0.001, mPFC: F (2, 41) = 25.482, p < 0.001). A main effect of session was seen

in VS, DS, and mPFC (VS: F (1, 41) = 10.065, p = 0.003, DS: F (1, 41) = 8.544, p = 0.006,

Chapter 2

58

Fig. 5. C-fos transcript in striatum and mPFC. Representative micrographs of hybridized coronal

sections through striatum (Bregma +1.2) showing distribution of c-fos mRNA-positive cells after 10

days (A, control; B, cocaine) and 60 days self-administration (C, control; D, cocaine). Asterisks in B

and D indicate areas with high cell density in dorsomedial striatum. At high magnification (E, control;

F, cocaine, 10 days self-administration), differences in number and individual labeling intensity of the

striatal neurons can be seen. Quantification of c-fos probe hybridization (total ISH signal) in VS (G),

DS (H), and mPFC (I) is expressed as percentage of control. Values are presented as mean ± SEM

after normalizing to the control group. P values refer to two-way ANOVA, symbols refer to significant

differences between groups after post hoc testing: *, cocaine and control groups, * p<0.05, **

P<0.001; ^, cocaine and sucrose groups, ^ p<0.05, ^^ p<0.001; #, 10 and 60 days cocaine groups, #

p<0.05; $, 10 and 60 days sucrose groups, $ p<0.05. Scale bar: 500 µm in A-D, 100 µm in E-F.

Chapter 2

59

mPFC: F (1, 41) = 22.383, p < 0.001). There was a significant interaction between session

and treatment in all three regions (VS: F (2, 41) = 10.486, p < 0.001, DS: F (2, 41) = 6.065, p

= 0.005, mPFC: F (2, 41) = 8.213, p = 0.001) (Fig. 5 G-I). Post-hoc tests revealed that, after

10 days, c-fos mRNA expression was significantly increased in the cocaine self-

administration group compared to the sucrose self-administration and the control group in

three brain regions (VS: p < 0.001, DS: p < 0.001, mPFC: p < 0.001, Fig. 5 G-I). After 60

days, significant differences between the cocaine self-administration and other two groups

were only seen in DS (p < 0.001, Fig. 5 H). In VS and mPFC, c-fos mRNA expression in the

cocaine self-administration group was significantly higher than in the control group (VS: p =

0.004, mPFC: p = 0.041), but not different from the sucrose self-administration group (VS: p

= 0.097, mPFC: p = 0.089) (Fig. 5 G and I). In addition, c-fos mRNA after 60 days of cocaine

self-administration was significantly lower than that after 10 days in VS, DS, and mPFC (VS:

t = 3.834, df = 7.897, p = 0.005; DS: t = 2.66, df = 13, p = 0.02; mPFC: t = 4.355, df = 10.775,

p = 0.001). In contrast, only in mPFC were c-fos mRNA levels significantly higher after 60

days of sucrose self-administration compared to 10 days (t = 3.028, df = 14, p = 0.009) (Fig.

5 G-I).

Chapter 2

60

Fig. 6. Bdnf transcript in mPFC. Representative micrographs of hybridized coronal sections through

mPFC (Bregma +2.8) showing distribution of Bdnf mRNA-positive cells after 60 days self-

administration (A, control; B, sucrose; C, cocaine). At high magnification (D, Control; E, Sucrose; F,

Cocaine), differences in number and staining intensity of cortical neurons can be seen. In (G),

quantification of Bdnf probe hybridization (total ISH signal) in mPFC is expressed as percentage of

control. Values are presented as mean ± SEM after normalizing to the control group. P values refer to

two-way ANOVA, symbols refer to significant differences between experimental groups in post hoc


p<0.05; @, sucrose and control groups, @ p<0.05. Scale bar: 400 µm in A-C, 100 µm in D-F.

Bdnf ISH signal was increased in mPFC after cocaine self-administration (Fig. 6 A-F).

Two-way ANOVA indicated a significant main effect of treatment (F (2, 41) = 26.521, p

<0.001) and a main effect of session (F (1, 41) = 4.457, p = 0.041) on the total amount of

Bdnf ISH signal in mPFC. However, the interaction between treatment and session was not

significant (F (2, 41) = 1.186, p = 0.316) (Fig. 6 G). Post-hoc tests on the treatment effects

revealed that the Bdnf mRNA level in the cocaine self-administration group was significantly

higher than in the control (p < 0.001) and sucrose groups (p = 0.001). The Bdnf mRNA level

in the sucrose self-administration group was significantly higher than in the control group (p =

0.001) (Fig. 6 G)

Discussion

In the present study, we demonstrate profound changes after cocaine self-administration in

the expression of a subset of IEGs from a panel of 17 that was largely the same in striatum

and mPFC. Comparison of the effects of short- versus long-term cocaine self-administration

showed no major differences in the IEG expression profiles, except for two IEGs: Egr2 in

mPFC and Fosb/ΔFosb in dorsal striatum. In addition, in the mPFC, induction of certain IEGs

was also observed after long-term sucrose self-administration.

Neuronal reactivity in striatum and prefrontal cortex

A group of 6 IEGs (c-fos, Mkp1, Fosb/ΔFosb, Egr2, Arc and Egr4) was found to increase

expression in dorsal striatum (DS) as a corollary of cocaine self-administration. In ventral

striatum (VS), an identical response was established for these genes (except for Egr4), with

an additional set of 4 IEGs (Egr3, Egr4, Jun, Fosl1) showing significant differences between

cocaine self-administration and control but not between exposure to the drug and the natural

Chapter 2

61

reinforcer. For c-fos, Fosb/ΔFosb, or Arc in striatum, similar changes have been observed

after cocaine self-administration (Fumagalli et al. 2009; Larson et al. 2010; Zahm et al. 2010).

The response to cocaine self-administration in Mkp1, Egr2 and Egr4 expression - genes that

are involved in transcriptional regulation – is a novel finding, however. The induction of IEGs

acting as transcription factors or effectors in neuronal networks is considered to mediate the

neuroplastic changes that take place as a consequence of repeated drug use (Lüscher and

Malenka 2011; Robison and Nestler 2011). Interestingly, in the present study, the group of

IEGs with increased reactivity specifically to cocaine self-administration was the same in DS

and VS. These striatal regions are thought to be involved in different aspects of drug seeking

behavior (Everitt and Robbins 2005; Pierce and Vanderschuren 2010), but the present

findings suggest that cocaine self-administration-induced neuroplasticity in these two striatal

sectors is affected in a similar fashion (see also Besson et al. 2013; Coffey et al. 2015).

In mPFC, along with the same set of genes that was upregulated in striatum, Bdnf,

Homer1, Sgk1 and Rgs2 were found to respond to cocaine self-administration. Drug-induced

changes in the expression of Rgs2 have hitherto been described in cortex and VTA (Burchett

et al. 1999; Kuntz-Melcavage et al. 2009; Hearing et al. 2012). For Sgk1, the upregulation

response appeared to be present in both neurons and glial cells. Since Sgk1 has been

identified in oligodendrocytes (Miyata et al. 2011), the present findings might be of relevance

for the white matter abnormalities detected in cocaine-dependent subjects (O'Neill et al. 2001;

Moeller et al. 2005; Ma et al. 2009). For c-fos and Bdnf, similar results as in the present

study have been previously reported after short-term cocaine self-administration (Zahm et al.

2010; Fumagalli et al. 2013;). Both BDNF and Homer1 are thought to be involved in cortico-

striatal glutamatergic neurotransmission (Berglind et al. 2009; Ary et al. 2013;), while BDNF

and all members of the group of 6 IEGs that was upregulated after cocaine self-

administration in striatum and mPFC are known to play a role in regulatory networks

subserving synaptic plasticity, such as long-term potentiation (LTP) and long-term

depression (LTD) (Messaoudi et al. 1998; Messaoudi et al. 2002; Coba et al. 2008; McGinty

et al. 2010). Effects of cocaine exposure on LTP as well as LTD have been described (for

review, see (Wolf 2010). There is evidence to suggest blunted induction of LTP and LTD in

the VS after cocaine self-administration (Moussawi et al. 2009; Kasanetz et al. 2010), which

might be related to with the transcript upregulation observed in the present study.

Furthermore, in PFC impairment of LTD after cocaine self-administration has been found that

might facilitate induction of LTP (Kasanetz et al. 2013). In conclusion, the fact that largely the

same subset of IEGs as in striatum was affected in mPFC suggests considerable similarites

between the neuroplastic adaptations in the two brain regions to cocaine self-administration.

In addition, the upregulation of 4 additional IEGs in mPFC points to cortex-specific responses.

Chapter 2

62

Effects of cocaine and sucrose self-administration

Four IEGs, namely Bdnf, Homer1, Fosb/ΔFosb and Egr2, were found to respond both to

cocaine and to sucrose self-administration, and these responses were restricted to the

mPFC. For Egr2, this is a novel finding. With respect to Bdnf and Homer1, the observed

changes may point to altered corticostriatal excitatory neurotransmission, as noted above.

Since the sucrose-associated effects on these IEGs were not significantly different from

those induced by cocaine self-administration, it is reasonable to assume that Bdnf and

Homer1 in mPFC are involved in neuronal plasticity induced by both natural and drug

rewards. The same may hold true for Fosb/ΔFosb (Pitchers et al. 2010).

The present results demonstrate that self-administration of cocaine altered IEG

expression to a far greater extent than did sucrose. After cocaine, a greater number of IEGs

were upregulated and two (Egr2 and Fosb/ΔFosb) of the four (Egr2, Fosb/ΔFosb, Bdnf, and

Homer1) IEGs that were affected by self-administration of both cocaine and sucrose show a

higher response to the drug. These findings indicate that exposure to a substance of abuse

in reward-dependent learning has a greater effect on IEG-associated neuroadaptations than

the instrumental learning process per se. This is noteworthy for mPFC as well as DS and VS,

which have all been implicated in instrumental conditioning (Kelley et al. 2003; Yin et al.

2005). In interpreting the present data, it is important, however, to note that the IEG

responses were brought about by an acute “pharmacological” effect of cocaine (and sucrose,

for that matter) together with long(er)-term substance-induced neuroadaptive changes. The

choice to include cocaine and sucrose reward in the final self-administration session was

deliberate, since (in our view) it is not quite possible to disentangle the effects of instrumental

conditioning and cocaine exposure. In fact, omitting the reward in the final session would

render it an extinction session, which likely impacts by itself on cortical and striatal

processing (Self et al. 2004; Peters et al. 2009;). Similarly, the use of a yoked control would

have led to unwanted effects. Considerable differences have been reported between IEG

responses to drug self-administration or yoked administration. (Kuntz-Melcavage et al. 2009;

Larson et al. 2010; Zahm et al. 2010; Fumagalli et al. 2013; Radley et al. 2015). However,

these differences do not allow us to dissect out a substance effect.

Stable cocaine self-administration behavior and IEG responses

The IEG up-regulation patterns in mPFC and striatum did not markedly differ after short and

long periods of cocaine self-administration except for Egr2 and Fosb/ΔFosb. Egr2 in mPFC

was the only gene with a significantly different, i.e. augmented, response to cocaine self-

administration after long-term compared to short-term exposure. This suggests that Egr2 up-

Chapter 2

63

regulation might be related to loss of cognitive control over drug seeking and taking, possibly

leading to compulsive behavior (see below for further discussion of behavioral findings). As

outlined above, the increased expression of Egr2 might implicate synaptic plasticity changes.

A role for Egr2 in stabilization of LTP has indeed been suggested (Williams et al. 1995). With

respect to Fosb/ΔFosb, an increase of significantly smaller magnitude was seen after

extended compared to short-term cocaine exposure. A similar blunting of effect on

Fosb/ΔFosb mRNA levels has been reported after chronic self-administration of cocaine,

possibly as a consequence of tolerance induced by persistently high Fosb/ΔFosb protein

levels (Larson et al. 2010). Such changes will affect AP-1 binding activity and gene

expression in DS, which might be implicated in the (hypothesized) intensified functional

engagement of DS as the development addiction behavior progresses (Larson et al. 2010).

Other than for Egr2 and Fosb/ΔFosb, in all three brain regions, the increases in gene

expression that were seen after 10 days of self-administration were maintained after 60 days.

In this respect, it should be noted that, in contrast to the RT-PCR analysis, the in situ

hybridization experiments did show differences between the responses of c-fos and Bdnf

after 10 and 60 days. This discrepancy might be caused by the fact that RT-PCR analysis

was performed on much bigger portions of cortex and striatum than in situ hybridization;

alternatively, it might indicate higher sensitivity of the ISH technique compared to RT-PCR.

Using RT-PCR, no exposure time-dependent differences were detected in VS or DS, which

is largely consistent with the findings of Besson et al. (2013) who reported no major

differences between the expression of Egr1 in VS, DS and mPFC after short-term (10 days)

or long-term (50 days) cocaine self-administration. By contrast, Porrino et al. (2004b) showed

that 5 sessions of cocaine self-administration reduced glucose utilization in the monkey VS

and limited portions of the DS, whereas the effects after extended self-administration (up to

100 days) had intensified and spread to the most dorsal part of the striatum. At least two, not

mutually exclusive explanations for this discrepancy can be put forward. It might be that

changes in IEG expression levels are restricted to subregions of the brain areas that were

dissected in the present RT-PCR experiments. For instance, the present results of the c-fos

in situ hybridization experiment showed stronger responses in posterior dorsomedial striatum

after both short-term and long-term cocaine self-administration suggesting (sub)regional

differentiation of effects. A further methodological issue concerns the fact that the cocaine

self-administration regimens in our study and that of Porrino et al. (2004b) were not the same.

In the latter study, animals obtained a maximum number of cocaine infusions allowed in each

session for 100 days. In contrast, in the present study cocaine intake was stable yet never

reached maximum preset levels. This may be of consequence for the various (re)activity

patterns observed, and the similarity of the IEG responses after 10 and 60 days of cocaine

self-administration in the present study probably reflects the stable cocaine self-

Chapter 2

64

administration. Be that as it may, the total amount of cocaine intake was vastly different

between the 10 and 60 days cocaine-exposed animals (averages of 49.5 and 405.5 mg/kg,

respectively) and it is reasonable to expect that this would have resulted in major differences

in molecular plasticity (Taylor and Jentsch 2001; Koob and Le Moal 2005; Lüscher and

Malenka 2011; Robison and Nestler 2011;). The fact that such differences were not observed

as a function of prolonged cocaine self-administration indicates that at this level of analysis,

stable long-term cocaine taking evokes stable responses in neural reactivity.

We, and others, have previously shown that prolonged exposure to self-administered

cocaine results in compulsive, addiction-like patterns of behaviour (Deroche-Gamonet et al.

2004; Limpens et al. 2014b; Pelloux et al. 2007; Vanderschuren and Everitt 2004). Recent

studies have implicated functional changes in VS (Kasanetz et al. 2010; Bock et al. 2013),

DS (Zapata et al. 2010; Jonkman et al. 2012a) and mPFC (Chen et al. 2013; Kasanetz et al.

2013; Limpens et al. 2014a) in this behaviour. In view of these findings, it is remarkable that

we observed no major differences in IEG responsivity patterns in these brain regions

between animals with 10 and 60 days of cocaine self-administration experience. Indeed, it

has been shown that it is extended drug exposure that evokes compulsive cocaine seeking

(Jonkman et al. 2012b), albeit that the development of addiction-like changes in behaviour

does not seem to be directly related to the absolute amount of self-administered drug

(Deroche-Gamonet et al. 2004; Belin et al. 2009;). Consistent with our findings, a recent

study found no major differences in Egr1 expression in VS, DS and mPFC in animals with 10

and 50 days of cocaine self-administration experience (Besson et al. 2013), suggesting that

the development of compulsive cocaine seeking is not mirrored by changes in cellular

reactivity to the drug. At first glance, the resemblance of the IEG responses after 10 and 60

days of cocaine self-administration suggests a similarity in behavioral drive, i.e. controlled

responding continuing for up to 60 days. The resemblance, however, might be deceptive if

we take into account that a consistently increased reactivity was not readily foreseeable on

basis of the literature (see McCoy et al. 2011). For instance, for the Fos IEG family it has

been shown that extended cocaine self-administration (2-3 weeks) in comparison to acute

exposure leads to a reduced response and not to a persistent increase (Larson et al. 2010;

Zahm et al. 2010). Possibly, it is the sustained reactivity and not necessarily a further

sensitization of responsivity that provides the basis for neuroadaptive changes related to the

development of compulsive cocaine use.

In conclusion, our findings demonstrate cocaine self-administration-induced changes

in a similar subset of IEGs in mPFC, DS and VS. This response does not build up or dwindle

over time in any of the 3 anatomical regions for up to 60 days of continued drug taking. Thus,

the steady changes in IEG expression are associated with stable self-administration behavior

rather than the total dosage of cocaine obtained. Over this protracted period of drug taking,

Chapter 2

65

regulatory impulses to the IEGs are sustained, which might be associated with plastic

changes in neural networks underlying compulsive drug seeking and taking.

Chapter 2

66

Table 1. Primers used in the RT-PCR experiment.

Gene Name Forward primer Reverse primer GenBank Size (bp)

Egr1 / Krox24

early growth response 1 GTGCCTTTGTGTGACACACCTT GCTCTAAAGCCTCCCCTGAAA NM_012551.1 113

Egr2 / Krox20

early growth response 2 GGAGGGCAAAAGGAGATACC CACAACCTGGAGACCCAACT NM_053633.1 102

Egr3 early growth response 3 CGGCCTTGGACAGCAATCT TTCTGGAATGGAGCCCATGT NM_017086.1 83

Egr4 early growth response 4 CTACAGCGGCAGCTTCTTCA AGCCCAAGATGCCAGACATG NM_019137.1 89

Fos / c-fos FBJ osteosarcoma oncogene GGGACAGCCTTTCCTACTACCATT TTGGCACTAGAGACGGACAGATC NM_022197.2 106

ΔFosB FBJ osteosarcoma oncogene B GAAGACCCCGAGAAGAAACA CCGACGGTTTCTGCATTTAG XM_001057199.1 101

Arc activity-regulated cytoskeleton-associated protein

CCAGTCTGTGGCTTTTGTCA GCCAGTGGGTGAGAAGGTGT NM_019361.1 95

Dusp1 / Mkp1

dual specificity phosphatase 1 GCCACCATCTGCCTTGCTTA AGATAATACTCCGCCTCTGCTTCA NM_053769.3 91

Fosl1 / Fra-1 fos-like antigen 1 ACACCAGAGCCTTGTTCCTCAG AAAGCCAGGAGTGTGGGAGAA NM_012953.1 95

Jun / c-jun jun proto-oncogene TGCAAACGTTTTGAGGACAG CGCAACCAGTCAAGTTCTCA NM_021835.3 89

Bdnf brain-derived neurotrophic factor

GCTGGATGAGGACCAGAAGGT GAGGCTCCAAAGGCACTTGA NM_012513.3 104

Ntrk2 / TrkB neurotrophic tyrosine kinase, receptor, type 2

TCGCTCCTGAGGTTCTCCATAA CAGGCCATAGAGCATCTCATACAA NM_019232.3 92

Sgk1 serum/glucocorticoid regulated kinase 1

TGGAGCCTGGGAGTTGTGTT GCCCTGGGTGATGCATTCTAT NM_012731.2 99

Rgs2 regulator of G-protein signaling 2

TGGAAGACCCGTTTGAGCTATTT CCTCAGGAGAAGGCTTGATAAAAGT

NM_053453.2 106

Dclk1 doublecortin-like kinase 1 CTCGGTGAGTTGGGATCTGT CCCCGTAGAGCACCTGATAA NM_053343.3 91

Ccnl1 cyclin L1 CACAGAGACAGGCGTGAAAG AGGATGAAAGTCAGCGCCTA NM_053662.3 109

Homer1 homer homolog 1 TGGACTGGGATTCTCCTCTG TCTTCTCCTGCGACTTCTCC NM_031707.1 104

Actb / beta-actin

Rattus norvegicus actin, beta GCTACAGCTTCACCACCACA GCCATCTCTTGCTCGAAGTC NM_031144.2 94

Gapdh Rattus norvegicus glyceraldehyde-3-phosphate dehydrogenase

TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGA NM_017008.3 87

Eno2 / NSE Rattus norvegicus enolase 2, neuronal (Eno2)

ACGTGGTTCCATTTCAAGATGAC CGAGCTTCAGTTAGTGCACCAA NM_139325.3 107

Chapter 2

67

Table 2.

Gene Region

10 days self-administration 60 days self-administration Time Effect Treatment Effect

Time by Treatment

control Sucrose Cocaine control Sucrose Cocaine (p value) (p value) Interaction (p value)

c-fos DS 1.0 ± 0.102 0.9 ± 0.050 1.9 ± 0.130 1.0 ± 0.061 0.9 ± 0.040 1.9 ± 0.074 0.8725 <0.0001 * 0.9946

VS 1.0 ± 0.092 0.9 ± 0.072 1.5 ± 0.127 1.0 ± 0.067 1.0 ± 0.030 1.5 ± 0.037 0.6958 <0.0001 * 0.4465

mPFC 1.0 ± 0.078 1.0 ± 0.021 1.7 ± 0.116 1.0 ± 0.068 1.2 ± 0.074 1.8 ± 0.124 0.1908 <0.0001 * 0.5947

Mkp1 DS 1.0 ± 0.059 0.9 ± 0.029 1.5 ± 0.116 1.0 ± 0.044 1.0 ± 0.047 1.4 ± 0.055 0.9016 <0.0001 * 0.7211

VS 1.0 ± 0.047 1.0 ± 0.060 1.4 ± 0.088 1.0 ± 0.039 1.0 ± 0.053 1.3 ± 0.030 0.7027 <0.0001 * 0.6003

mPFC 1.0 ± 0.049 1.0 ± 0.038 1.5 ± 0.072 1.0 ± 0.058 1.0 ± 0.036 1.3 ± 0.064 0.1048 <0.0001 * 0.1758

ΔFosB DS 1.0 ± 0.078 1.0 ± 0.060 1.8 ± 0.061 1.0 ± 0.055 1.1 ± 0.053 1.5 ± 0.079 0.2715 <0.0001 * 0.0355

VS 1.0 ± 0.110 1.1 ± 0.191 1.7 ± 0.161 1.0 ± 0.061 1.2 ± 0.050 1.6 ± 0.083 0.6744 <0.0001 * 0.6988

mPFC 1.0 ± 0.126 1.1 ± 0.039 1.8 ± 0.086 1.0 ± 0.044 1.5 ± 0.104 2.0 ± 0.144 0.0084 <0.0001 * 0.1473

Egr2 DS 1.0 ± 0.081 1.1 ± 0.052 1.8 ± 0.132 1.0 ± 0.083 1.3 ± 0.068 2.0 ± 0.153 0.2340 <0.0001 * 0.7008

VS 1.0 ± 0.076 1.2 ± 0.162 1.7 ± 0.141 1.0 ± 0.096 1.3 ± 0.093 2.0 ± 0.157 0.1299 <0.0001 * 0.3998

mPFC 1.0 ± 0.105 1.1 ± 0.044 1.6 ± 0.088 1.0 ± 0.039 1.5 ± 0.135 2.5 ± 0.198 <0.0001 * <0.0001 * 0.0009 *

Arc DS 1.0 ± 0.060 1.0 ± 0.060 1.3 ± 0.116 1.0 ± 0.066 1.0 ± 0.059 1.3 ± 0.075 0.8615 <0.0001 * 0.9571

VS 1.0 ± 0.082 1.0 ± 0.062 1.2 ± 0.098 1.0 ± 0.062 1.1 ± 0.059 1.3 ± 0.059 0.5254 0.0020 * 0.8428

mPFC 1.0 ± 0.047 0.9 ± 0.053 1.0 ± 0.048 1.0 ± 0.070 0.9 ± 0.062 1.3 ± 0.086 0.0250 0.0003 * 0.0899

Egr4 DS 1.0 ± 0.147 1.0 ± 0.080 1.3 ± 0.088 1.0 ± 0.043 1.2 ± 0.066 1.7 ± 0.124 0.0055 * <0.0001 * 0.0625

VS 1.0 ± 0.110 1.0 ± 0.104 1.2 ± 0.094 1.0 ± 0.042 1.2 ± 0.035 1.5 ± 0.074 0.0159 0.0004 * 0.1999

mPFC 1.0 ± 0.078 1.0 ± 0.034 1.1 ± 0.072 1.0 ± 0.022 0.9 ± 0.040 1.2 ± 0.067 0.8423 0.0011 * 0.4008

Sgk1 DS 1.0 ± 0.164 1.1 ± 0.115 1.2 ± 0.217 1.0 ± 0.066 1.0 ± 0.065 1.4 ± 0.121 0.5392 0.1110 0.5050

VS 1.0 ± 0.125 1.0 ± 0.149 1.0 ± 0.109 1.0 ± 0.091 1.0 ± 0.030 1.2 ± 0.072 0.1956 0.3560 0.4742

mPFC 1.0 ± 0.037 1.1 ± 0.041 1.1 ± 0.073 1.0 ± 0.035 1.0 ± 0.060 1.2 ± 0.046 0.5160 0.0087 0.3346

Egr3 DS 1.0 ± 0.068 1.1 ± 0.043 1.1 ± 0.079 1.0 ± 0.025 1.0 ± 0.041 1.0 ± 0.037 0.1880 0.3350 0.6342

VS 1.0 ± 0.065 1.1 ± 0.043 1.2 ± 0.093 1.0 ± 0.086 1.1 ± 0.036 1.3 ± 0.044 0.2196 0.0014 * 0.6528

mPFC 1.0 ± 0.054 1.1 ± 0.037 1.1 ± 0.061 1.0 ± 0.024 0.9 ± 0.034 0.9 ± 0.043 0.0023 * 0.9298 0.0711

Bdnf DS 1.0 ± 0.118 0.9 ± 0.114 0.8 ± 0.110 1.0 ± 0.101 0.9 ± 0.199 0.8 ± 0.135 0.9317 0.3570 0.9975

VS 1.0 ± 0.157 0.9 ± 0.045 0.8 ± 0.080 1.0 ± 0.162 1.0 ± 0.119 0.9 ± 0.166 0.4724 0.4652 0.8723

mPFC 1.0 ± 0.075 1.1 ± 0.104 1.1 ± 0.045 1.0 ± 0.037 1.3 ± 0.074 1.3 ± 0.051 0.0486 0.0050 * 0.3673

Chapter 2

68

Table 2. continued

Summary of relative transcript expression levels of 17 IEGs after 10 or 60 days of self-administration. Fold changes in the cocaine and sucrose groups were

calculated relative to the control group and presented as mean ± SEM. Bold typing indicates significant changes. * indicates significant p level (< 0.05). DS,

dorsal striatum; VS, ventral striatum; mPFC, medial prefrontal cortex.

Gene Region

10 days self-administration 60 days self-administration Time Effect (p value)

Treatment Effect (p value)

Time by Treatment Interaction (p value)

Control Sucrose Cocaine Control Sucrose Cocaine

TrkB DS 1.0 ± 0.096 0.9 ± 0.063 0.9 ± 0.078 1.0 ± 0.028 0.9 ± 0.012 0.9 ± 0.043 0.9240 0.1360 0.9890

VS 1.0 ± 0.079 0.9 ± 0.042 0.9 ± 0.030 1.0 ± 0.062 1.1 ± 0.033 1.1 ± 0.029 0.0061 0.7337 0.1463

mPFC 1.0 ± 0.024 1.0 ± 0.036 1.0 ± 0.028 1.0 ± 0.010 0.9 ± 0.014 0.8 ± 0.040 <0.0001 * 0.0729 0.0080

Jun DS 1.0 ± 0.069 1.0 ± 0.042 1.1 ± 0.059 1.0 ± 0.042 1.0 ± 0.064 1.1 ± 0.071 0.9820 0.3840 0.8671

VS 1.0 ± 0.089 1.1 ± 0.092 1.2 ± 0.084 1.0 ± 0.060 1.1 ± 0.056 1.2 ± 0.033 0.8858 0.0421 0.9714

mPFC 1.0 ± 0.064 1.0 ± 0.014 1.1 ± 0.032 1.0 ± 0.030 0.9 ± 0.017 0.8 ± 0.034 <0.0001 * 0.1483 0.0001 *

Homer1 DS 1.0 ± 0.071 1.1 ± 0.092 1.0 ± 0.058 1.0 ± 0.027 1.0 ± 0.033 1.0 ± 0.019 0.3789 0.7113 0.8316

VS 1.0 ± 0.069 1.0 ± 0.039 1.1 ± 0.030 1.0 ± 0.058 1.0 ± 0.013 1.0 ± 0.029 0.7639 0.3187 0.3515

mPFC 1.0 ± 0.051 1.1 ± 0.069 1.1 ± 0.035 1.0 ± 0.032 1.3 ± 0.044 1.3 ± 0.057 0.0018 * 0.0007 * 0.0594

Dclk1 DS 1.0 ± 0.058 1.0 ± 0.076 1.0 ± 0.069 1.0 ± 0.051 1.0 ± 0.017 0.9 ± 0.036 0.6025 0.6193 0.9193

VS 1.0 ± 0.065 0.9 ± 0.028 0.9 ± 0.026 1.0 ± 0.060 1.0 ± 0.027 1.0 ± 0.036 0.0545 0.9941 0.3690

mPFC 1.0 ± 0.030 1.0 ± 0.049 1.0 ± 0.069 1.0 ± 0.009 0.9 ± 0.008 0.9 ± 0.039 0.0022 * 0.2425 0.0847

Ccnl1 DS 1.0 ± 0.072 1.0 ± 0.037 1.1 ± 0.040 1.0 ± 0.092 1.1 ± 0.058 1.0 ± 0.065 0.8845 0.8779 0.5108

VS 1.0 ± 0.054 1.2 ± 0.051 1.2 ± 0.033 1.0 ± 0.079 0.9 ± 0.022 0.9 ± 0.039 <0.0001 * 0.3758 0.0058

mPFC 1.0 ± 0.028 1.1 ± 0.050 1.3 ± 0.165 1.0 ± 0.025 0.9 ± 0.029 1.0 ± 0.025 0.0208 0.1440 0.1471

Egr1 DS 1.0 ± 0.053 1.0 ± 0.044 1.0 ± 0.035 1.0 ± 0.049 1.0 ± 0.042 1.0 ± 0.064 0.8798 0.8495 0.9756

VS 1.0 ± 0.057 1.0 ± 0.061 1.0 ± 0.060 1.0 ± 0.084 1.2 ± 0.046 1.2 ± 0.057 0.0070 0.1392 0.1646

mPFC 1.0 ± 0.046 1.1 ± 0.029 1.0 ± 0.042 1.0 ± 0.033 1.2 ± 0.083 1.2 ± 0.086 0.0362 0.1090 0.3090

Fra1 DS 1.0 ± 0.065 1.1 ± 0.062 1.1 ± 0.032 1.0 ± 0.039 1.0 ± 0.040 1.1 ± 0.052 0.7739 0.2256 0.8421

VS 1.0 ± 0.059 1.0 ± 0.069 1.2 ± 0.087 1.0 ± 0.030 1.1 ± 0.034 1.1 ± 0.035 0.7376 0.0341 0.1131

mPFC 1.0 ± 0.061 1.0 ± 0.042 1.1 ± 0.051 1.0 ± 0.040 0.9 ± 0.041 1.0 ± 0.038 0.1580 0.0522 0.4966

Rgs2 DS 1.0 ± 0.127 1.2 ± 0.122 1.2 ± 0.117 1.0 ± 0.079 1.2 ± 0.049 1.1 ± 0.061 0.5042 0.0600 0.8502

VS 1.0 ± 0.058 1.1 ± 0.050 1.1 ± 0.070 1.0 ± 0.052 1.0 ± 0.035 0.9 ± 0.044 0.0114 0.5087 0.1880

mPFC 1.0 ± 0.020 0.9 ± 0.029 1.1 ± 0.019 1.0 ± 0.038 1.0 ± 0.026 1.0 ± 0.020 0.9258 0.0087 0.1003

Chapter 2

69

Fig.S1. Sgk1 transcript in gray and white matter visualized with ISH. Representative

micrographs of hybridized coronal sections including cortex, corpus callosum and striatum

(Bregma +1.2) show Sgk1 mRNA-positive cells after 60 days of cocaine self-administration.

(A) Arrows point to small-sized, heavily labeled cells. (B) At high magnification, large (arrow

head)- and small-sized (arrow) types of cells can be identified. Scale bars: 100 µm in A, 50

µm in B.

Chapter 2

70

References

⬧ American Psychiatric Association (2013) DSM-5 Diagnostic and Statistical Manual of

Mental Disorders. American Psychiatric Association, Washington, DC, USA

⬧ Ary AW, Lominac KD, Wroten MG, Williams AR, Campbell RR, Ben-Shahar O, von

Jonquieres G, Klugmann M, Szumlinski KK (2013). Imbalances in prefrontal cortex CC-

Homer1 versus CC-Homer2 expression promote cocaine preference. J Neurosci 33: 8101-

8113.

⬧ Belin D, Balado E, Piazza PV, Deroche-Gamonet V (2009). Pattern of intake and drug

craving predict the development of cocaine addiction-like behavior in rats. Biol Psychiatry

65: 863-868.

⬧ Berglind WJ, Whitfield TW, Jr., LaLumiere RT, Kalivas PW, McGinty JF (2009). A single

intra-PFC infusion of BDNF prevents cocaine-induced alterations in extracellular glutamate

within the nucleus accumbens. J Neurosci 29: 3715-3719.

⬧ Berke JD, Paletzki RF, Aronson GJ, Hyman SE, Gerfen CR (1998). A complex program of

striatal gene expression induced by dopaminergic stimulation. J Neurosci 18: 5301-5310.

⬧ Berke JD, Sgambato V, Zhu PP, Lavoie B, Vincent M, Krause M, Hyman SE (2001).

Dopamine and glutamate induce distinct striatal splice forms of Ania-6, an RNA polymerase

II-associated cyclin. Neuron 32: 277-287.

⬧ Besson M, Pelloux Y, Dilleen R, Theobald DE, Lyon A, Belin-Rauscent A, Robbins TW,

Dalley JW, Everitt BJ, Berlin D (2013). Cocaine modulation of frontostriatal expression of

Zif268, D2, and 5-HT2c receptors in high and low impulsive rats.

Neuropsychopharmacology 38: 1963-1973.

⬧ Bock R, Shin JH, Kaplan AR, Dobi A, Markey E, Kramer PF, Gremel CM, Christensen CH,

Adrover MF, Alvarez VA (2013). Strengthening the accumbal indirect pathway promotes

resilience to compulsive cocaine use. Nat Neurosci 16: 632-638.

⬧ Burchett SA, Bannon MJ, Granneman JG (1999). RGS mRNA expression in rat striatum:

modulation by dopamine receptors and effects of repeated amphetamine administration. J

Neurochem 72: 1529-1533.

⬧ Chen BT, Yau HJ, Hatch C, Kusumoto-Yoshida I, Cho SL, Hopf FW, Bonci A (2013).

Rescuing cocaine-induced prefrontal cortex hypoactivity prevents compulsive cocaine

seeking. Nature 496: 359-362.

⬧ Chomczynski P, Sacchi N (1987). Single-step method of RNA isolation by acid guanidinium

thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159.

⬧ Coba MP, Valor LM, Kopanitsa MV, Afinowi NO, Grant SG (2008). Kinase networks

integrate profiles of N-methyl-D-aspartate receptor-mediated gene expression in

hippocampus. J Biol Chem 283: 34101-34107.

⬧ Coffey KR, Barker DJ, Gayliard N, Kulik JM, Pawlak AP, Stamos JP, West MO (2015).

Electrophysiological evidence of alterations to the nucleus accumbens and dorsolateral

striatum during chronic cocaine self-administration. Eur J Neurosci 41: 1538-1552.

Chapter 2

71

⬧ Corominas M, Roncero C, Ribases M, Castells X, Casas M (2007). Brain-derived

neurotrophic factor and its intracellular signaling pathways in cocaine addiction.

Neuropsychobiology 55: 2-13.

⬧ Courtin C, Crete D, Canestrelli C, Noble F, Marie-Claire C (2006). Regulation of genes

involved in dopamine transporter modulation by acute cocaine in rat striatum. Neurosci Lett

398: 235-240.

⬧ Deroche-Gamonet V, Belin D, Piazza PV (2004). Evidence for addiction-like behavior in the

rat. Science 305: 1014-1017.

⬧ Everitt BJ (2014). Neural and psychological mechanisms underlying compulsive drug

seeking habits and drug memories--indications for novel treatments of addiction. Eur J

Neurosci 40: 2163-2182.

⬧ Everitt BJ, Robbins TW (2005). Neural systems of reinforcement for drug addiction: from

actions to habits to compulsion. Nat Neurosci 8: 1481-1489.

⬧ Fumagalli F, Franchi C, Caffino L, Racagni G, Riva MA, Cervo L (2009). Single session of

cocaine intravenous self-administration shapes goal-oriented behaviours and up-regulates

Arc mRNA levels in rat medial prefrontal cortex. Int J Neuropsychopharmacol 12: 423-429.

⬧ Fumagalli F, Moro F, Caffino L, Orru A, Cassina C, Giannotti G, Di Clemente A, Racagni G,

Riva MA, Cervo L (2013). Region-specific effects on BDNF expression after contingent or

non-contingent cocaine i.v. self-administration in rats. Int J Neuropsychopharmacol 16: 913-

918.

⬧ Ghasemzadeh MB, Windham LK, Lake RW, Acker CJ, Kalivas PW (2009). Cocaine

activates Homer1 immediate early gene transcription in the mesocorticolimbic circuit:

differential regulation by dopamine and glutamate signaling. Synapse 63: 42-53.

⬧ Goldstein RZ, Volkow ND (2011). Dysfunction of the prefrontal cortex in addiction:

neuroimaging findings and clinical implications. Nat Rev Neurosci 12: 652-669.

⬧ Guez-Barber D, Fanous S, Golden SA, Schrama R, Koya E, Stern AL, Bossert JM, Harvey

BK, Picciotto MR, Hope BT (2011). FACS identifies unique cocaine-induced gene

regulation in selectively activated adult striatal neurons. J Neurosci 31: 4251-4259.

⬧ Hearing MC, Zink AN, Wickman K (2012). Cocaine-induced adaptations in metabotropic

inhibitory signaling in the mesocorticolimbic system. Rev Neurosci 23: 325-351.

⬧ Heller EA, Kaska S, Fallon B, Ferguson D, Kennedy PJ, Neve RL, Nestler EJ, Mazei-

Robison MS (2015). Morphine and cocaine increase serum- and glucocorticoid-inducible

kinase 1 activity in the ventral tegmental area. J Neurochem 132: 243-253.

⬧ Hope BT, Nye HE, Kelz MB, Self DW, Iadarola MJ, Nakabeppu Y, Duman RS, Nestler EJ

(1994). Induction of a long-lasting AP-1 complex composed of altered Fos-like proteins in

brain by chronic cocaine and other chronic treatments. Neuron 13: 1235-1244.

⬧ Jentsch JD, Taylor JR (1999). Impulsivity resulting from frontostriatal dysfunction in drug

abuse: implications for the control of behavior by reward-related stimuli.

Psychopharmacology (Berl) 146: 373-390.

Chapter 2

72

⬧ Jia W, Liu R, Shi J, Wu B, Dang W, Du Y, Zhou Q, Wang J, Zhang R (2013). Correction:

Differential Regulation of MAPK Phosphorylation in the Dorsal Hippocampus in Response

to Prolonged Morphine Withdrawal-Induced Depressive-Like Symptoms in Mice. PLoS One

8(9): 10.1371/annotation/99966397-acf2-41ca-ad92-69dbd87cc9f9.

⬧ Jonkman S, Pelloux Y, Everitt BJ (2012a). Differential roles of the dorsolateral and

midlateral striatum in punished cocaine seeking. J Neurosci 32: 4645-4650.

⬧ Jonkman S, Pelloux Y, Everitt BJ (2012b). Drug intake is sufficient, but conditioning is not

necessary for the emergence of compulsive cocaine seeking after extended self-

administration. Neuropsychopharmacology 37: 1612-1619.

⬧ Kasanetz F, Deroche-Gamonet V, Berson N, Balado E, Lafourcade M, Manzoni O, Piazza

PV (2010). Transition to addiction is associated with a persistent impairment in synaptic

plasticity. Science 328: 1709-1712.

⬧ Kasanetz F, Lafourcade M, Deroche-Gamonet V, Revest JM, Berson N, Balado E,

Fiancette JF, Renault P, Piazza PV, Manzoni OJ (2013). Prefrontal synaptic markers of

cocaine addiction-like behavior in rats. Mol Psychiatry 18: 729-737.

⬧ Kelley AE, Andrzejewski ME, Baldwin AE, Hernandez PJ, Pratt WE (2003). Glutamate-

mediated plasticity in corticostriatal networks: role in adaptive motor learning. Ann N Y

Acad Sci 1003: 159-168.

⬧ Koob GF, Le MM (2005). Plasticity of reward neurocircuitry and the 'dark side' of drug

addiction. Nat Neurosci 8: 1442-1444.

⬧ Koob GF, Volkow ND (2010). Neurocircuitry of addiction. Neuropsychopharmacology 35:

217-238.

⬧ Kuntz-Melcavage KL, Brucklacher RM, Grigson PS, Freeman WM, Vrana KE (2009). Gene

expression changes following extinction testing in a heroin behavioral incubation model.

BMC Neurosci 10: 95.

⬧ Larson EB, Akkentli F, Edwards S, Graham DL, Simmons DL, Alibhai IN, Nestler EJ, Self

DW (2010). Striatal regulation of DeltaFosB, FosB, and cFos during cocaine self-

administration and withdrawal. J Neurochem 115: 112-122.

⬧ Letchworth SR, Nader MA, Smith HR, Friedman DP, Porrino LJ (2001). Progression of

changes in dopamine transporter binding site density as a result of cocaine self-

administration in rhesus monkeys. J Neurosci 21: 2799-2807.

⬧ Limpens JH, Damsteegt R, Broekhoven MH, Voorn P, Vanderschuren LJMJ (2014a).

Pharmacological inactivation of the prelimbic cortex emulates compulsive reward seeking in

rats. Brain Res.

⬧ Limpens JH, Schut EH, Voorn P, Vanderschuren LJMJ (2014b). Using conditioned

suppression to investigate compulsive drug seeking in rats. Drug Alcohol Depend 142: 314-

324.

⬧ Livak KJ, Schmittgen TD (2001). Analysis of relative gene expression data using real-time

quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402-408.

Chapter 2

73

⬧ Lüscher C, Malenka RC (2011). Drug-evoked synaptic plasticity in addiction: from

molecular changes to circuit remodeling. Neuron 69: 650-663.

⬧ Ma L, Hasan KM, Steinberg JL, Narayana PA, Lane SD, Zuniga EA, Kramer LA, Moeller

FG (2009). Diffusion tensor imaging in cocaine dependence: regional effects of cocaine on

corpus callosum and effect of cocaine administration route. Drug Alcohol Depend 104: 262-

267.

⬧ McCoy MT, Jayanthi S, Wulu JA, Beauvais G, Ladenheim B, Martin TA, Krasnova IN,

Hodges AB, Cadet JL (2011). Chronic methamphetamine exposure suppresses the striatal

expression of members of multiple families of immediate early genes (IEGs) in the rat:

normalization by an acute methamphetamine injection. Psychopharmacology (Berl) 215:

353-365.

⬧ McGinty JF, Shi XD, Schwendt M, Saylor A, Toda S (2008). Regulation of psychostimulant-

induced signaling and gene expression in the striatum. J Neurochem 104: 1440-1449.

⬧ McGinty JF, Whitfield TW, Jr., Berglind WJ (2010). Brain-derived neurotrophic factor and

cocaine addiction. Brain Res 1314: 183-193.

⬧ Messaoudi E, Bardsen K, Srebro B, Bramham CR (1998). Acute intrahippocampal infusion

of BDNF induces lasting potentiation of synaptic transmission in the rat dentate gyrus. J

Neurophysiol 79: 496-499.

⬧ Messaoudi E, Ying SW, Kanhema T, Croll SD, Bramham CR (2002). Brain-derived

neurotrophic factor triggers transcription-dependent, late phase long-term potentiation in

vivo. J Neurosci 22: 7453-7461.

⬧ Miyata S, Koyama Y, Takemoto K, Yoshikawa K, Ishikawa T, Taniguchi M, Inoue K, Aoki O,

Katayama T, Tohyama M (2011). Plasma corticosterone activates SGK1 and induces

morphological changes in oligodendrocytes in corpus callosum. PLoS One 6: e19859.

⬧ Moeller FG, Hasan KM, Steinberg JL, Kramer LA, Dougherty DM, Santos RM, Valdes I,

Swann AC, Barratt ES, Narayana PA (2005). Reduced anterior corpus callosum white

matter integrity is related to increased impulsivity and reduced discriminability in cocaine-

dependent subjects: diffusion tensor imaging. Neuropsychopharmacology 30: 610-617.

⬧ Moussawi K, Pacchioni A, Moran M, Olive MF, Gass JT, Lavin A, Kalivas PW (2009). N-

Acetylcysteine reverses cocaine-induced metaplasticity. Nat Neurosci 12: 182-189.

⬧ O'Neill J, Cardenas VA, Meyerhoff DJ (2001). Separate and interactive effects of cocaine

and alcohol dependence on brain structures and metabolites: quantitative MRI and proton

MR spectroscopic imaging. Addict Biol 6: 347-361.

⬧ Otis JM, Fitzgerald MK, Mueller D (2014). Infralimbic BDNF/TrkB enhancement of GluN2B

currents facilitates extinction of a cocaine-conditioned place preference. J Neurosci 34:

6057-6064.

⬧ Pelloux Y, Everitt BJ, Dickinson A (2007). Compulsive drug seeking by rats under

punishment: effects of drug taking history. Psychopharmacology (Berl) 194: 127-137.

Chapter 2

74

⬧ Pelloux Y, Murray JE, Everitt BJ (2013). Differential roles of the prefrontal cortical

subregions and basolateral amygdala in compulsive cocaine seeking and relapse after

voluntary abstinence in rats. Eur J Neurosci.

⬧ Perrotti LI, Weaver RR, Robison B, Renthal W, Maze I, Yazdani S, Elmore RG, Knapp DJ,

Selley DE, Martin BR, Sim-selley L, Bachtell RK, Self DW, Nestler EJ (2008). Distinct

patterns of DeltaFosB induction in brain by drugs of abuse. Synapse 62: 358-369.

⬧ Peters J, Kalivas PW, Quirk GJ (2009). Extinction circuits for fear and addiction overlap in

prefrontal cortex. Learn Mem 16: 279-288.

⬧ Pierce RC, Kumaresan V (2006). The mesolimbic dopamine system: the final common

pathway for the reinforcing effect of drugs of abuse? Neurosci Biobehav Rev 30: 215-238.

⬧ Pierce RC, Vanderschuren LJMJ (2010). Kicking the habit: the neural basis of ingrained

behaviors in cocaine addiction. Neurosci Biobehav Rev 35: 212-219.

⬧ Pitchers KK, Frohmader KS, Vialou V, Mouzon E, Nestler EJ, Lehman MN, Coolen LM

(2010). DeltaFosB in the nucleus accumbens is critical for reinforcing effects of sexual

reward. Genes Brain Behav 9: 831-840.

⬧ Porrino LJ, Daunais JB, Smith HR, Nader MA (2004a). The expanding effects of cocaine:

studies in a nonhuman primate model of cocaine self-administration. Neurosci Biobehav

Rev 27: 813-820.

⬧ Porrino LJ, Lyons D, Smith HR, Daunais JB, Nader MA (2004b). Cocaine self-

administration produces a progressive involvement of limbic, association, and sensorimotor

striatal domains. J Neurosci 24: 3554-3562.

⬧ Radley JJ, Anderson RM, Cosme CV, Glanz RM, Miller MC, Romig-Martin SA, LaLumiere

RT (2015). The contingency of cocaine administration accounts for structural and functional

medial prefrontal deficits and increased adrenocortical activation. J Neurosci 35: 11897-

11910.

⬧ Robison AJ, Nestler EJ (2011). Transcriptional and epigenetic mechanisms of addiction.

Nat Rev Neurosci 12: 623-637.

⬧ Self DW, Choi KH, Simmons D, Walker JR, Smagula CS (2004). Extinction training

regulates neuroadaptive responses to withdrawal from chronic cocaine self-administration.

Learn Mem 11: 648-657.

⬧ Takaki M, Ujike H, Kodama M, Takehisa Y, Nakata K, Kuroda S (2001). Two kinds of

mitogen-activated protein kinase phosphatases, MKP-1 and MKP-3, are differentially

activated by acute and chronic methamphetamine treatment in the rat brain. J Neurochem

79: 679-688.

⬧ Taylor JR, Jentsch JD (2001). Repeated intermittent administration of psychomotor

stimulant drugs alters the acquisition of Pavlovian approach behavior in rats: differential

effects of cocaine, d-amphetamine and 3,4- methylenedioxymethamphetamine ("Ecstasy").

Biol Psychiatry 50: 137-143.

⬧ Thiriet N, Aunis D, Zwiller J (2000). C-fos and egr-1 immediate-early gene induction by

cocaine and cocaethylene in rat brain: a comparative study. Ann N Y Acad Sci 914: 46-57.

Chapter 2

75

⬧ van Kerkhof LW, Trezza V, Mulder T, Gao P, Voorn P, Vanderschuren LJMJ (2014).

Cellular activation in limbic brain systems during social play behaviour in rats. Brain Struct

Funct 219: 1181-1211.

⬧ Vanderschuren LJMJ, Ahmed SH (2013). Animal studies of addictive behavior. Cold Spring

Harb Perspect Med 3: a011932.

⬧ Vanderschuren LJMJ, Di CP, Everitt BJ (2005). Involvement of the dorsal striatum in cue-

controlled cocaine seeking. J Neurosci 25: 8665-8670.

⬧ Vanderschuren LJMJ, Everitt BJ (2004). Drug seeking becomes compulsive after prolonged

cocaine self-administration. Science 305: 1017-1019.

⬧ Williams J, Dragunow M, Lawlor P, Mason S, Abraham WC, Leah J, Bravo R, Demmer J,

Tate W (1995). Krox20 may play a key role in the stabilization of long-term potentiation.

Brain Res Mol Brain Res 28: 87-93.

⬧ Wolf ME (2010). The Bermuda Triangle of cocaine-induced neuroadaptations. Trends

Neurosci 33: 391-398.

⬧ Yin HH, Knowlton BJ (2006). The role of the basal ganglia in habit formation. Nat Rev

Neurosci 7: 464-476.

⬧ Yin HH, Ostlund SB, Knowlton BJ, Balleine BW (2005). The role of the dorsomedial

striatum in instrumental conditioning. Eur J Neurosci 22: 513-523.

⬧ Zahm DS, Becker ML, Freiman AJ, Strauch S, Degarmo B, Geisler S, Meredith GE,

Marinelli M (2010). Fos after single and repeated self-administration of cocaine and saline

in the rat: emphasis on the Basal forebrain and recalibration of expression.

Neuropsychopharmacology 35: 445-463.

⬧ Zapata A, Minney VL, Shippenberg TS (2010). Shift from goal-directed to habitual cocaine

seeking after prolonged experience in rats. J Neurosci 30: 15457-15463.

Chapter 3

76

Chapter 3

77

Chapter 3

A neuronal activation correlation in striatum and

prefrontal cortex of prolonged cocaine intake

Ping Gao1,

Jan C. de Munck2,

Jules H. W. Limpens3,

Louk J. M. J. Vanderschuren4,

Pieter Voorn1

1 Department of Anatomy and Neurosciences, Neuroscience Campus Amsterdam, VU

University Medical Center, Amsterdam, The Netherlands

2 Department of Physics and Medical Technology, VU University Medical Center,

Amsterdam, The Netherlands.

3 Brain Center Rudolf Magnus, Department of Translational Neuroscience, University

Medical Center Utrecht, Utrecht, The Netherlands

4 Department of Animals in Science and Society, Division of Behavioural Neuroscience,

Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands

Brain Struct Funct. 2017; 222(8):3453-3475

Chapter 3

78

Abstract

Maladaptive changes in the involvement of striatal and frontal cortical regions in drug

use are thought to underlie the progression to habitual drug use and loss of cognitive

control over drug intake that occur with accumulating drug experience. The present

experiments focus on changes in neuronal activity in these regions associated with

short-term (10 days) and long-term (60 days) self-administration of cocaine.

Quantitative in situ hybridization for the immediate early gene Mkp1 was combined

with Statistical Parametric Mapping to assess the distribution of neuronal activity. We

hypothesized that neuronal activity in striatum would increase in its dorsal part and

that activity in frontal cortex would decrease with prolonged cocaine self-

administration experience. Expression of Mkp1 was profoundly increased after

cocaine self-administration, and the magnitude of this effect was greater after short-

term compared to long-term self-administration. Increased neuronal activity was seen

in both dorsal and ventral sectors of the striatum after 10 days exposure to cocaine.

However, enhanced activity was restricted to dorsomedial and dorsocentral striatum

after 60 days cocaine self-administration. In virtually all medial prefrontal and most

orbitofrontal areas, increased expression of Mkp1 was observed after 10 days of

cocaine taking, whereas after 60 days, enhanced expression was restricted to caudal

parts of medial prefrontal and caudomedial parts of orbitofrontal cortex. Our data

reveal functional changes in cellular activity in striatum and frontal cortex with

increasing cocaine self-administration experience. These changes might reflect the

neural processes that underlie the descent from recreational drug-taking to

compulsive cocaine use.

Chapter 3

79

Abbreviations

Mkp1: mitogen-activated protein kinase phosphatase 1

IEG: immediate early gene

ISH: in situ hybridization

SPM: Statistical parametric mapping

DS: dorsal striatum

VS: ventral striatum

Tu: olfactory tubercle

mPFC: medial prefrontal cortex

OFC: orbitofrontal cortex

AC: anterior cingulate cortex

PrL: prelimbic cortex

IL: infralimbic cortex

MO: medial orbitofrontal cortex

VO: ventral orbitofrontal cortex

VLO: ventral lateral orbitofrontal cortex

LO: lateral orbitofrontal cortex

DLO: dorsolateral orbitofrontal cortex

AIv: ventral agranular insular cortex

AId: dorsal agranular insular cortex

DI: dysgranular insular cortex

Chapter 3

80

Introduction

Drug addiction is a chronic relapsing brain disorder hallmarked by persistent drug-

seeking and -taking that occurs even in the face of adverse consequences (American

Psychiatric Association 2000, 2013; Leshner 1997; Volkow and Li 2004). The

apparent loss of control over drug-directed behavior is thought to find its cause in a

maladaptive transition from goal-directed to habitual drug-directed behavior in

combination with breakdown of prefrontal cortical cognitive control over drug intake

as a result of prolonged and excessive drug use (Jentsch and Taylor 1999; Everitt

and Robbins 2005; Hyman et al. 2006; Koob and Volkow 2010; Pierce and

Vanderschuren 2010; Goldstein and Volkow 2011).

The neural substrate of the process of habit formation that is thought to be

pathologically affected by prolonged drug use lies within the striatum. Whereas the

ventral striatum (VS) is associated with reinforcement signaling and the medial

portion of dorsal striatum (DS) with goal-directed behavior, the lateral part of DS has

been implicated in habit learning (Carelli 2002; Corbit and Janak 2007; Yin et al.

2008; Roesch et al. 2009; Stalnaker et al. 2010; Gremel and Costa 2013; Burton et al.

2015). On basis of these findings, Everitt and Robbins (2005) have proposed a shift

in functional involvement in drug use from ventromedial to dorsolateral striatum as

drug experience progresses. For cocaine, support for this hypothesis comes from

behavioral studies in laboratory animals (Everitt and Robbins 2016) and from studies

examining changes in neural activation and dopaminergic neurotransmission in non-

human primates and human addicts (Garavan et al. 2000; Letchworth et al. 2001;

Porrino et al. 2004; Volkow et al. 2006; Wong et al. 2006). The cognitive ability to

limit drug intake involves a complex process of impulse control, planning and

decision-making in which medial prefrontal cortex (mPFC) and orbitofrontal cortex

(OFC) play a central role (London et al. 2000; O'Neill et al. 2001; Franklin et al. 2002;

Wilson et al. 2004; Volkow et al. 2005; Goldstein et al. 2009; Perry et al. 2011;

Wilcox et al. 2011; Mihindou et al. 2013; Lucantonio et al. 2014). Malfunction of these

cortical regions may lead to loss of control over drug seeking and taking, a

suggestion that is supported by substantial evidence concerning the transition to drug

addiction (Jentsch and Taylor 1999; Porrino and Lyons 2000; Volkow and Fowler

2000; Goldstein and Volkow 2002; Steketee 2003; Everitt et al. 2007; Kalivas 2008;

Feil et al. 2010; Goldstein and Volkow 2011; Lucantonio et al. 2012; Chen et al. 2013;

Kasanetz et al. 2013; Limpens et al. 2015).

Chapter 3

81

There is evidence to suggest actual changes in neuronal activity associated

with accumulating cocaine self-administration experience. These changes were

predominantly seen in VS and restricted parts of DS after limited access to cocaine,

and they spread to more dorsal parts of DS after long-term self-administration

(Letchworth et al. 2001; Porrino et al. 2004). In OFC and mPFC, differences between

the effects of acute or limited cocaine exposure and extended cocaine self-

administration have also been reported (Porrino and Lyons 2000). Studies using

expression of immediate early genes (IEGs) as markers of neuronal activity after

acute, limited and extended (self-) administration of cocaine have reported rather

complex patterns of region- and exposure time-dependent changes in expression of

several IEGs (Daunais et al. 1993, 1995; Larson et al. 2010; Zahm et al. 2010;

Besson et al. 2013; Fumagalli et al. 2013; Gao et al. 2015). Some of these patterns

appear in accordance with hypothesized changes in functional involvement of striatal

sectors or cortical regions, as described above, whereas others do not. At this point,

however, it is difficult to interpret these data since our knowledge on the effects of

prolonged cocaine self-administration on IEG expression is very limited indeed

(Larson et al. 2010; Besson et al. 2013). Therefore, in the present study the

corollaries of short (10 days)- and long-term (60 days) self-administration of cocaine

for IEG expression were assessed in rat striatum and prefrontal cortex. These time

points were chosen because they are considered to be equivalent to early and

advanced stages of the addiction process. Thus, it is well established that cocaine

self-administration patterns stabilize after approximately 10 sessions (e.g. De Vries et

al. 1998; Deroche-Gamonet et al. 2002; Veeneman et al. 2012; Gao et al. 2015),

whereas signs of addiction-like behavior typically emerge after about 50 self-

administration sessions (Deroche-Gamonet et al. 2004; Vanderschuren and Everitt

2004; Kasanetz et al. 2010; Limpens et al. 2014; for review see Vanderschuren et al.

2017). The IEG mitogen-activated protein kinase phosphatase 1 (Mkp1 or Dusp1)

was selected as neuronal activity marker.

An enzyme that dephosphorylates extracellular signal regulated kinase (ERK),

Jun N-terminal kinase (JNK) and p38 mitogen-activated protein kinase, Mkp1 serves

as a negative feedback regulator in MAPK pathway activity (Wancket et al. 2012;

Korhonen and Moilanen 2014). Numerous extracellular stimuli, including exposure to

drugs of abuse, have been found to induce Mkp1 transcription, either directly or

indirectly via activation of the MAPK pathway (Takaki et al. 2001; Ujike et al. 2002;

Miller and Marshall 2005; Wancket et al. 2012; Korhonen and Moilanen 2014; Gao et

al. 2015). The MAPK pathway has been shown to play an important role in cocaine

and opiate addiction processes, probably by modulating long-term synaptic plasticity

Chapter 3

82

(Lu et al. 2006; Pascoli et al. 2011; García-Pardo et al. 2016). Recently, using

quantitative PCR, we reported increased expression of Mkp1 after short- and long-

term self-administration of cocaine (Gao et al. 2015). These experiments, however,

did not allow for high resolution mapping of activated neurons that may unveil

subregional changes (Gao et al. 2015). Therefore, quantitative in situ hybridization

was used in the present experiments to assess Mkp1 expression levels after 10 or 60

days of self-administration of cocaine or sucrose. Furthermore, in addition to

conventional quantitative analysis of anatomically defined striatal and cortical

subregions of interest we also designed a mapping technique based on Statistical

Parametric Mapping (SPM) (Friston 1995) avoiding predetermined delineations,

since activational patterns do not necessarily respect conventional anatomical

boundaries. We expected to find a stronger functional involvement of VS compared

to DS after short-term cocaine self-administration, and activational patterns more

restricted to DS after long-term cocaine exposure. For mPFC and OFC, we expected

to see increased IEG expression after short-term cocaine self-administration,

followed by decreases after long-term cocaine experience.

Methods

Subjects

Male Wistar rats (n = 48) (Charles River, Sulzfeld, Germany) weighing 320-380 gram

were housed individually in Macrolon cages (L=40 cm, W=25 cm, H=18 cm) under

controlled conditions (temperature = 20 - 21°C, 55 ± 15% relative humidity) and a

reversed 12 h light - dark cycle (lights on at 19:00 hr.). Each subject received 20g

laboratory chow (SDS Ltd, UK) per day and free access to water, which was

sufficient to maintain body weight and growth. Self-administration sessions were

carried out between 09:00 and 18:00 hr. for 5 days a week. All experiments were

approved by the Animal Ethics Committee of Utrecht University and were conducted

in agreement with Dutch laws (Wet op de Dierproeven, 1996) and European

regulations (Guideline 86/609/EEC).

Apparatus

Subjects were trained and tested in operant conditioning chambers (L = 29.5 cm, W

= 32.5cm, H = 23.5cm; Med Associates, Georgia, VT, USA). The chambers were

Chapter 3

83

placed in light- and sound-attenuating cubicles equipped with a ventilation fan. Each

chamber was equipped with two 4.8 cm wide retractable levers, placed 11.7 cm apart

and 6.0 cm from the grid floor. A cue light (28 V, 100 mA) was present above each

active lever and a white house light (28 V, 100 mA) was located on the opposite wall.

Sucrose pellets (45 mg, formula F, Research Diets, New Brunswick, NJ, USA) were

delivered at the wall opposite to the levers via a dispenser. An infusion pump placed

on top of the cubicle and controlled cocaine infusions. During the cocaine self-

administration sessions, polyethylene tubing ran from the syringe placed in the

infusion pump via a swivel to the cannula on the animals’ back. In the operant

chamber, tubing was shielded with a metal spring. Experimental events and data

recording were controlled by procedures written in MedState Notation using MED-PC

for Windows.

Surgery

Rats allocated to the cocaine self-administration group were anaesthetized with

ketamine hydrochloride (0.075 mg/kg, i.m.) and medetomidine (0.40 mg/kg, s.c.) and

supplemented with ketamine as needed. A single catheter was implanted in the right

jugular vein aimed at the left vena cava. Catheters (Camcaths, Cambridge, UK)

consisted of a 22 g cannula attached to silastic tubing (0.012 ID) and fixed to nylon

mesh. The mesh end of the catheter was sutured subcutaneously (s.c.) on the

dorsum. Carprofen (50 mg/kg, s.c.) was administered once before and twice after

surgery. Gentamycin (50 mg/kg, s.c.) was administered before surgery and for 5

days post-surgery. Animals were allowed 10 days to recover from surgery.


Rats (n = 8 in both 10- and 60-days experiments) were trained to self-administer

cocaine under a fixed ratio-1 (FR-1) schedule of reinforcement. During the self-

administration sessions, two levers were present, an active lever and an inactive

lever. The left or right position of the active and inactive levers was counterbalanced

for individual animals. Pressing the active lever resulted in the infusion of 0.25 mg

cocaine in 0.1 mL saline over 5.6 seconds, retraction of the levers and switching off

of the house light. During the infusion, a cue light above the lever was switched on,

followed by a 20 sec time-out period after which the levers were reintroduced and the

house light illuminated. The time-out period was changed to 3 minutes after 5 training

Chapter 3

84

sessions in order to increase the session length. The session ended after 2 hours or

if animals had obtained 40 cocaine infusions, whichever occurred first. Responding

on the inactive lever had no programmed consequences. After each self-

administration session, intravenous catheters were flushed with a gentamycin-

heparin-saline solution to maintain the patency of the catheters.

The training procedure for the rats in the sucrose group (n = 8 in both 10- and

60-days experiments) was similar to that for cocaine self-administration, with the

exception that each response on the active lever resulted in delivery of a sucrose

pellet. Subjects in the control group (n = 8 in both 10- and 60-days experiments)

were also exposed to the self-administration box. Each response on the active lever

resulted in illumination of the cue-light for 5.6 seconds.

Tissue dissection

After the last training session, rats were moved back to their home cage, and

decapitated after thirty minutes. Brains were quickly removed and immediately frozen

in cold isopentane, and stored at -80°C. Fourteen micrometer thick coronal sections

were cut at -25°C C in a cryostat (Leica CM 1950), then mounted on SuperFrost®

Plus glass slides (Menzel-Gläser, Braunschweig, Germany) and stored at -80°C.


The synthesis of Mkp1 cRNA probe included total RNA extraction, cDNA synthesis

using TaqMan® reverse transcription reagents kit (Applied Biosystems, Branchburg,

NJ, USA), DNA amplification using Phusion® High-Fidelity PCR Kit (Finnzymes, New

England Biolabs, Inc.). Mkp1 primers contained either a T7 or T3 RNA polymerase

promoter sequence and their sequences are:

sense 5`-AATTAACCCTCACTAAAGGGTGAAGCAGAGGCGGAGTATT-3` and

antisense 5`-GTAATACGACTCACTATAGGGCAAGGGAAGAAACTGGCTCA-3`.

PCR amplification conditions were 98°C / 2 minutes, followed by 30 cycles of 98°C /

20 seconds, 66°C / 40 seconds, 72°C / 1 minute, and a final 72°C / 10 minutes.

Finally, cRNA probes were generated using MAXIscript® T3⁄T7 In Vitro Transcription

Kit (Ambion Inc., Austin, TX). Mkp1-probes were labeled by incorporating

digoxigenin-labeled UTP (Roche Diagnostics GmbH, Mannheim, Germany).

For in situ hybridization (ISH), rat brain sections were fixed in 4%

paraformaldehyde, acetylated using acetic anhydride (0.25% acetic anhydride in

Chapter 3

85

1.5% triethanolamine buffer), delipidated and dehydrated. Mkp1 digoxigenin-labeled

RNA probes (5ng/section) were diluted in 120 µl hybridization buffer (50% formamide,

4x SSC, tRNA 2.5 g/l, 2% 50x Denhardt`s reagent, 10% Dextran) and applied to

slides holding 4 sections. Hybridization was performed at 60°C in humid chambers

for 18 hours. Post-hybridization stringency washings were 1x SSC at 60°C (2 x 30

mins), followed by a RNase A treatment in 2x SSC buffer at 37°C for 15 minutes.

After another washing in 1x SSC at 60°C (30 mins) sections were incubated for 1

hour in 1x SSC at room temperature. Subsequently, sections were exposed to

blocking solution (TRIS-NaCl buffer with 1% blocking powder, Roche Diagnostics

GmbH, Mannheim, Germany) for 1 hour at room temperature and incubated with

anti-digoxigenin-alkaline phosphatase antibody (1:2500, Roche Diagnostics GmbH,

Mannheim, Germany) at 4°C overnight. Alkaline phosphatase was visualized using

NBT/BCIP (Roche Diagnostics GmbH, Mannheim, Germany) as a substrate. Color

development was in the dark at room temperature overnight and the enzymatic

reaction was stopped in TRIS-NaCl buffer with EDTA (1.212% TRIS, 0.876% NaCl,

0.0372% EDTA, pH = 7.5).

Data analysis of in situ hybridization

Quantification of hybridized Mkp1-probe was carried out using an MCID Elite image

system (Interfocus Imaging Ltd., Linton, UK). Coronal sections were digitized using

an objective magnification of 5X on a Leica DM/RBE photomicroscope connected to

a digital camera (EvolutionTM MP Color camera, Media Cybernetics, Rockville,

Maryland). A composite image of striatum and cortex was made utilizing the MCID

tiling tool and a motorized stage. The segmentation of Mkp1-positive cells from

background was performed using an algorithm combining several point operators

and spatial filters, aiming at detecting local changes in grey level and, thus, produce

a measuring template for objects. Images went through histogram equalization,

smoothing (low-pass filter, kernel size 7X7), and subtraction steps, and the positive

cells were finally detected according to their size and shape (van Kerkhof et al. 2014).

In order to improve visualization, contrast was enhanced of the in situ hybridization

images in Fig. 4a-d and Fig. 5a-f.

For each region, the analysis was performed at two anatomical levels from

anterior and posterior. For mPFC and OFC, two levels are Bregma +3.7mm and

+2.7mm, and for striatum, Bregma +1.7mm and +1.0mm. The outlines of brain

(sub)regions were defined according to Van De Werd and Uylings (2008).

Parameters that were measured included the number of positive cells in each

Chapter 3

86

subregion, the subregional surface area, the integrated optical density (OD) of each

individual cell body (representing labeling intensity) and the individual X-Y

coordinates of all cells. Changes in number of positive cells were expressed as

changes in density (number of cells/mm2.). Labeling intensity was expressed as OD

value averaged over all cells per subregion per animal. Subsequently, cell density

and OD values were used for Statistical Parametric Mapping (SPM) analysis (see

below).


Data was analyzed using SPSS software 20 (IBM, New York, NY, USA). A repeated

measures ANOVA was used for analyzing cocaine / sucrose self-administration, with

group as a between-subject factor and self-administration duration as a within-

subject factor. To determine whether the effects of short-term cocaine self-

administration on the Mkp1 mRNA differ from that after long-term administration in

cortex and striatum, for each sub-region the density and the intensity of Mkp1-

positive cells in the cocaine and the sucrose groups were normalized to control and

further analyzed using a two-way ANOVA with group and self-administration duration

as two factors. A Bonferroni post hoc test or Student’s t-test was used where

appropriate. A corrected p- value < 0.05 was considered to indicate statistical

significance.

Anatomical (sub)regions (including anterior and more posterior subregions)

were selected on basis of known differences in neuroanatomical connections and/or

functional involvement in drug addiction. Statistical comparisons involved planned

comparisons restricted to specific regions, the outcome of which was not generalized

to the entire brain. Furthermore, data was analyzed using two independent methods,

i.e. the above method and the statistical parametric mapping method described

below.

Statistical Parametric Mapping (SPM) analysis

To investigate the cocaine and sucrose induced-differences in the neuronal activation

patterns in cortex and striatum, the numbers of positive cells, cellular labeling

intensity, and X-Y coordinates were used to produce statistical parametric maps.

In this method, the response of Mkp1-cells to the experimental conditions was

compared in a manner that takes into account cellular labeling intensity and cell

Chapter 3

87

density. First, the entire population of cells at the anterior or posterior anatomical

levels of striatum or cortex in the sucrose and cocaine self-administration groups of

animals was divided into three groups on basis of the 33th and 66th percentile values

of cellular labeling intensity (OD) in the control group (Fig. 1). The cells in the three

bins were assigned a numerical and color code (i.e. red for dark, blue for light and

green for medium intensity) and plotted using the previously determined X-Y

coordinates in a RGB color image utilizing MatLab (Fig. 1). Each cell was

represented by a pixel kernel with approximately the size of striatal neurons, viz.

10x10 microns (11x11 pixels). Subsequently, a reference, average outline of the

striatum or cortical regions, was superimposed on the plotted cell image for use as a

template in a warping procedure that served to transform sections from all individual

animals to the same outline (Fig. 1). A set of approximately 25 fiducial points (for

striatum) was used in the warping procedure, ranging from anatomical landmarks,

such as the ventral tip of the lateral ventricle, to calculated landmarks like the

geometrical center of gravity of particular subregions. Care was taken to exclude

deformation of cellular pixel kernels during warping. Next, the warped sections were

used for SPM analysis (Fig. 1).

The warping process yielded for each section of each animal an image that

was subsequently converted into an array listing X-Y coordinates of the individual,

labeling intensity-coded activated cells in a common coordinate frame. These arrays

were converted into density images, by defining a rectangular raster and counting the

number of cells of each type per square. The optimal raster size is a trade-off

between resolution and sensitivity. We chose a raster size of 150 µm x 150 µm. To

increase sensitivity and to account for reminiscent errors due to imperfect image

warping, the density images were spatially blurred with a Gaussian filter with a

standard deviation of 200 µm. The statistical comparison of two groups of animals

over multiple pixels, and in different cell sizes, is equivalent to standard fMRI data

analysis methods (Worsley and Friston 1995), where statistical comparisons are

made between images made in resting and active conditions. Such statistical

comparisons are based on a linear regression, wherein the available data is modeled

as a sum regressors of interest and regressors acting as confounds. A partial

correlation co-efficient is derived for each pixel, of which the statistical significance is

computed, and corrections are made for multiple testing of null hypothesis over

different pixels. To apply the standard fMRI method for detecting the contrast

between (e.g.) cocaine and sucrose self-administration animals, we derived the

following regressors. First, the images of the NC “cocaine” animals (number of

images in the cocaine group) were stacked onto NS images of “sucrose” animals

Chapter 3

88

(number of images in the sucrose group). Each image contains three values (number

of light cells, number of medium cells and the number of dark cells). In this way, we

obtain for each pixel a 3(NC+NS) dimensional vector dj of measurements. The

following regressors are defined as confounds:

Fig. 1. Main steps in procedure for SPM analysis. Cellular labeling intensity and x-y position

of Mkp1-cells were recorded (top left) and cells were binned into 3 color-coded groups based

on labeling intensity (top middle). Next, the color-coded cells were plotted (top right) and the

anatomical region of interest with plotted cells (bottom right, 2) was warped to a reference

image (bottom right, 1). The warped image is shown in 4 (bottom right); the transformation is

illustrated by deformation of the raster overlying the reference image in 2 and the warped

image in 3. Finally (bottom, left), density images were generated from the warped images by

counting the number of cells for each labeling intensity per square in a raster image. These

images were used for performing statistic parametric mapping.

Chapter 3

89

These regressors refer to the hypothesis that the cell density is constant

(independent of the condition of the animal). Three regressors of interest, referring to

a possible difference in condition, are defined as

𝑆𝑗1 =

1 if j refers to a light pixel in "cocaine" animal 0 , otherwise

1

𝑆𝑗2 =

1 if j refers to a medium pixel in "cocaine" animal 0 , otherwise

2

𝑆𝑗3 =

1 if j refers to a dark pixel in "cocaine" animal 0 , otherwise

3

The data vector is modeled as

,

where ηj is assumed to be Gaussian white noise. The ML principle is applied to

estimate the regression coefficients αk and βk from the data and a partial correlation

co-efficient r, that expresses how well the data can be reconstructed using the

regressors of interest, when the confounds are removed from the data. This partial

correlation coefficient has a one-to-one relation to the F-statistic, and therefore its

significance can be tested in a straightforward way.

This statistical analysis is applied for each pixel independently. Although

background pixels were skipped, there are many pixels involved (N~~400 for

striatum), and therefore there is a large probability that some significant effects will

be found at some pixels, just by chance alone. To correct for these kinds of type I

errors, the observed probabilities were converted into a False Detection Rate

(Benjamini and Hochberg 1995), which gives the expected fraction of pixels with a

type I error. The activation images shown here (Fig. 8) are thresholded at a

maximum FDR of 20%. The meaning of this value indicates that 20% of the pixels

declared active, is in reality a false positive.

We present the results of the statistical mapping method by creating a

pseudo-anatomical gray scale image consisting of the average of all non-smoothed

density images. Superimposed on this gray scale image, we plot all pixels with an

FDR of 0.1% or larger in a color scale corresponding to the partial correlation

coefficient r.

Chapter 3

90

Results

Cocaine and sucrose self-administration

Rats were trained to self-administer cocaine or sucrose for either 10 or 60 days

under a FR1 schedule of reinforcement (Fig. 2). The number of active lever presses

represents the total amount of rewards acquired per session. Repeated measures

ANOVA revealed that there was a main effect of group on the active lever responses

in the 10-days [F (2, 20) = 45.85, p < 0.001] and the 60-days experiments [F (2, 20) =

179.41, p < 0.001]. Post-hoc tests showed significant differences between the

cocaine and control [10 days: p = 0,003, 60 days: p < 0.001], the cocaine and

sucrose [10 days: p < 0.001, 60 days: p < 0.001], as well as the sucrose and control

groups [10 days: p < 0.001, 60 days: p < 0.001] for both experiments. A main effect

of self-administration duration on the active lever presses was observed in 10 days [F

(4.05, 80.99) = 5.22, p = 0.001] and 60 days experiments [F (6.16, 123.15) = 6.02, p

< 0.001]. The interactions between group and self-administration duration were

significant [10 days: F (8.10, 80.99) = 9.96, p < 0.001; 60 days: F (12.32, 123.15) =

Fig. 2. Short-term (10 days, a) and long-term (60 days, b) self-administration of cocaine or

sucrose. Data is presented as mean ± SEM number of active lever presses over animals per

group.

Chapter 3

91

2.59, p = 0.004]. Comparing the numbers of active lever presses between the first

and the final sessions, there were significant increases in the cocaine (10 days: t =

-13.55, df = 14, p < 0.001; 60 days: t = -2.44, df = 7.89, p = 0.041) and sucrose

groups (10 days: t = -3.24, df = 7.008, p = 0.014; 60 days: t = -2.358, df = 7.073, p =

0.05). For the control groups we observed a decrease after 10 days (t = 4.32, df =

7.98, p = 0.003) and no changes after 60 days (t = 0.769, df = 14, p = 0.455). The

average number of inactive lever presses in the cocaine and sucrose groups was

lower than 4 per session from the fifth until the final self-administration session for

both experiments (data not shown). The number of active lever presses was

significantly higher than the number of responses to the inactive lever in the cocaine

group [10 day: F (1, 12) = 58.82, p < 0.001; 60 days: F (1, 12) = 212.31, p < 0.001]

and sucrose group [10 day: F (1, 14) = 1006.92, p < 0.001; 60 days: F (1, 14) =

10097.27, p < 0.001], but not in the control group [10 day: F (1, 14) = 0.01, p = 0.918;

60 days: F (1, 14) = 2.39, p = 0.144].

Fig. 3. Regions of interest in

coronal sections of rat brain at

anterior and posterior levels.

For mPFC and OFC, two levels

are Bregma +3.7mm (a) and

+2.7mm (b). For striatum, two

levels are Bregma +1.7mm (c)

and +1.0mm (d). AC: anterior

cingulate cortex, PrL: prelimbic

cortex, IL: infralimbic cortex,

MO: medial OFC, VO: ventral

OFC, VLO: ventral lateral OFC,

LO: lateral OFC, DLO: dorsal

lateral OFC, AIv: agranular

insular cortex - ventral part, AId:

agranular insular cortex - dorsal

part, DI: dysgranular insular

cortex, DS: dorsal striatum, Tu:

olfactory tubercle.

Chapter 3

92

Cell density

Mkp1-positive neurons were measured in 11 regions of interest in cortex and 4

regions of interest in striatum at two anterior-posterior levels (for most regions) (Fig.

3). Compared to the control and sucrose groups, cocaine self-administration

produced major changes in the density of the Mkp1-labeled neurons (Table 1 and

Table S1).

Striatum

In striatum, 10 days of cocaine self-administration induced a marked increase in the

density of Mkp1-positive cells in both the DS and VS (Fig. 4a-b). Likewise, after 60

days exposure to cocaine, an increase was observed, albeit of lower magnitude (Fig.

4c-d). In the anterior level of striatum, a main effect of group was seen in each

subregion. A main effect of self-administration duration (10 vs. 60 days) was seen in

core and olfactory tubercle (Tu), but not in DS and shell (Table 1). A significant

interaction between group and self-administration duration was seen in core, shell,

Tu, but not in DS (Table 1). Post-hoc tests showed that, compared to the control

(Con) and sucrose (Suc) groups, the density of Mkp1-positive cells in the cocaine

group (Coc) increased significantly in DS in both the 10 (Coc vs. Con: p < 0.001, Coc

vs. Suc: p < 0.001) and 60 days experiments (Coc vs. Con: p < 0.001, Coc vs. Suc: p

< 0.001) (Fig. 4e, left panel). In core, shell, and Tu, increases were observed after 10

days (Coc vs. Con: core, p < 0.001, shell, p < 0.001, Tu, p < 0.001; Coc vs. Suc: core,

p < 0.001, shell, p < 0.001, Tu, p = 0.002) but not after 60 days (Fig. 4f-h, left panels).

Similar results were obtained in the posterior level of striatum. A main effect of

group was seen in all striatal subregions (Table 1). Except in Tu, a main effect of self-

administration duration was seen in other subregions (Table 1). The interaction

between group and self-administration duration was also significant in DS, core, and

shell, but not in Tu (Table 1). Post-hoc tests showed that, in DS, 10 days of cocaine

self-administration significantly enhanced the density of Mkp1-positive cells when

compared to control (p < 0.001) and sucrose self-administration (p < 0.001). After 60

days, a significant difference was only observed between the cocaine and control

groups (p = 0.024) (Fig. 4e, right panel). In VS, 10 days of cocaine self-administration

significantly increased the density of Mkp1-positive cells, when compared to the

control (core: p < 0.001, shell: p < 0.001, Tu: p = 0.003) and the sucrose groups

(core: p < 0.001, shell: p < 0.001, not in Tu: p = 0.009) (Fig. 4f-h, right panels). In

Chapter 3

93

contrast, after 60 days no differences were seen in these three subregions (Fig. 4f-h,

right panels).

Fig. 4. Micrographs of representative hybridized coronal sections through striatum (at

posterior level) showing the distribution of Mkp1-positive cells after 10 days (a, control; b,

cocaine) and 60 days (c, control; d, cocaine) self-administration. Superimposed lines

delineate regions of interest for quantification. E-H show densities of Mkp1-positive cells in

individual striatal subregions at the two anterior-posterior anatomical levels after 10 and 60

days of self-administration. Values are presented as mean ± SEM percentage of cells/mm2 in

the control groups. * p < 0.05, significant differences between cocaine and control groups; #

p < 0.05, significant differences between cocaine and sucrose groups. Tu: olfactory tubercle.

Chapter 3

94

In summary, 10 days of cocaine self-administration increased the density of Mkp1-

positive cells in both DS and VS, whereas after 60 days such effects were only

observed in DS. Compared to the 10 days cocaine self-administration, the magnitude

of increases in the density of Mkp1-positive cells was much lower in the cocaine

group in the 60 days experiment. In addition, no effects of sucrose self-administration

were observed on the density of Mkp1-positive cells.


The density of Mkp1-positive cells in medial prefrontal cortex (mPFC) was examined

in two anterior to posterior levels of anterior cingulate (AC), prelimbic (PrL) and

infralimbic (IL) cortices (Fig. 3a-b). Figure 5 a-f shows representative images of the

Mkp1 in situ hybridization in sections taken at the anterior level of mPFC. In anterior

mPFC, two-way ANOVA revealed a main effect of group, of self-administration

duration and significant interactions between the two factors in AC, PrL and IL (Table

1). Post-hoc tests showed that, in the 10-days experiment, cocaine significantly

increased the density of Mkp1-positive cells in all subregions when compared to

control (AC, p < 0.001, PrL, p < 0.001, IL, p < 0.001) and sucrose groups (AC, p =

0.002, PrL, p = 0.006, IL, p = 0.002) (Fig. 5g-i, left panels). In contrast, after 60 days,

only in AC there was a significant difference in the density of Mkp-positive cells

between the cocaine and sucrose groups (p = 0.032) (Fig. 5g, left panel). No

changes were observed in PrL or IL (Fig. 5h-i, left panels).

In posterior mPFC (Fig. 3b), there was a main effect of group in AC, PrL, and

IL, and a main effect of self-administration duration in AC and PrL, but not in IL

(Table 1). The interaction between group and self-administration duration was

significant for AC and PrL but not for IL (Table 1). Post-hoc tests showed that, in the

10-days experiment, cocaine self-administration enhanced the density of Mkp1-

labeled cells in AC and PrL, when compared to the control (AC: p = 0.002, PrL: p <

0.001, IL: p = 0.065). Enhancements were seen in PrL and IL when compared to

sucrose self-administration (AC: p = 0.050, PrL: p = 0.005, IL: p = 0.049, Fig. 5g-h,

right panels). In the 60-days experiment, cocaine-induced increases in the density of

Mkp1-labeled cells were found in PrL and IL, when compared to control (AC: p =

0.245, PrL: p = 0.049, IL: p = 0.006), while an increase was seen only in PrL when

compared to the sucrose group (AC: p = 0.296, PrL: p = 0.011, IL: p = 0.056, Fig. 5g-

i, right panels). Finally, no effect of sucrose self-administration was observed at this

level (Fig. 5g-i, right panels).

Chapter 3

95

Fig. 5. Micrographs of representative hybridized coronal sections of mPFC and OFC (at

anterior level) showing the distribution of Mkp1-positive cells after 10 days (a, control; b,

sucrose; c, cocaine) and 60 days (d, control; e, sucrose; f, cocaine) self-administration.

Superimposed lines delineate regions of interest for quantification. Differences between

micrographs from the sucrose groups at 10 (b) and 60 (e) days of self-administration appear

larger than they actually are after normalization to control, as presented in g-i.

Normalization was used since signal levels were higher in 60 days controls (d) compared to

10 days controls (a). g-i show densities of Mkp1-positive cells in individual subregions of

mPFC at the two anterior-posterior anatomical levels after 10 and 60 days of self-

administration. Values are presented as mean ± SEM percentage of cells/mm2 in the control

groups. * p < 0.05, significant difference between cocaine and control groups; # p < 0.05,

significant difference between cocaine and sucrose groups. For abbreviations, see Fig. 3.

Chapter 3

96

In summary, 10 days of cocaine self-administration increased the density of Mkp1-

positive cells in both anterior and posterior mPFC, while 60-days cocaine self-

administration showed limited effects on the density of Mkp1-positive cells in the

posterior mPFC. In the anterior level of mPFC, the magnitude of changes in the

density of Mkp1-positive cells after 60 days was much lower, when compared to the

10 days of cocaine self-administration.

Orbitofrontal cortex

Cocaine and sucrose self-administration affected the Mkp1-positive cells in

orbitofrontal cortex (OFC, for anatomical structures see Fig. 3a-b) in a complex way.

Figure 5a-f show representative images of the Mkp1 in situ hybridization at the

anterior level of OFC. In this region, a two-way ANOVA revealed a main effect of

group in medial orbitofrontal (MO), ventral orbitofrontal (VO), ventral lateral

orbitofrontal (VLO) and lateral orbitofrontal (LO) cortices but not in the dorsolateral

orbitofrontal cortex (DLO) (Table 1). There was a main effect of self-administration

duration in MO and VO, but not in other subregions (Table 1). The interactions

between group and self-administration duration were significant in all subregions

(Table 1). Post-hoc tests showed that, in the 10-days experiment, the density of

Mkp1-labeled cells was increased significantly in the cocaine group in MO, VO, VLO

and LO, but not in DLO, when compared to the control (MO: p < 0.001, VO: p < 0.001,

VLO: p = 0.003, LO: p = 0.006, DLO: p = 0.103) and sucrose groups (MO: p < 0.001,

VO: p < 0.001, VLO: p = 0.007, LO: p = 0.021, DLO: p = 0.421) (Fig. 6a, c, d, left

panels; b, e). In contrast, after 60 days, differences were seen between cocaine and

sucrose groups in LO (p = 0.040) and DLO (p = 0.014) (Fig. 6d-e). Interestingly,

significant up-regulation of the density of Mkp1-labeled cells was also observed in the

sucrose self-administration animals in VLO (p = 0.044) and LO (p = 0.004) when

compared to the control (Fig. 6c-d, left panel).

For ease of discussion, the ventral part of agranular insular cortex (AIv), the

dorsal part of agranular insular cortex (AId), and the dysgranular insular cortex (DI)

will be described as part of the posterior OFC under investigation (Fig. 3b). Two-way

ANOVA showed a main effect of group on the density of Mkp1-positive cells in MO,

VLO, AIv and LO, but not in AId and DI (Table 1). A main effect of self-administration

duration was seen only in AIv and LO (Table 1). The interactions between group and

self-administration duration were significant in MO, VLO, AIv, and LO (Table 1). Post-

hoc testing showed that, after 10 days exposure, cocaine significantly enhanced the

density of Mkp1-labeled cells in MO, VLO, LO and AIv, when compared to the control

Chapter 3

97

Fig. 6. Mkp1 cell densities in subregions of OFC after short- and long-term cocaine and

sucrose self-administration. Quantification was performed at two anterior-posterior

anatomical levels for MO, VLO and LO. The other regions were present only in a single

anatomical level. Values are presented as mean ± SEM percentage of cells/mm2 in the control

groups. * p < 0.05, significant difference between cocaine and control groups; # p < 0.05,

significant difference between cocaine and sucrose groups. $ p < 0.05, significant difference

between sucrose and control groups. For abbreviations, see Fig. 3.

Chapter 3

98

(MO: p = 0.001, VLO: p = 0.002, LO: p = 0.006, AIv: p = 0.003) and sucrose groups

(MO: p = 0.004, VLO: p = 0.001, LO: p = 0.048, AIv: p = 0.009) (Fig. 6a, c, d, right

panels; f). After 60 days of self-administration, cocaine increased the density of

Mkp1-labeled cells in the medial portion of posterior OFC, i.e. MO (p = 0.046), VLO

(p = 0.017) and AIv (p = 0.043) when compared to control (Fig. 6a, c, right panels; f).

In addition, no effects of sucrose self-administration were seen in the posterior OFC.

To summarize, 10 days of cocaine self-administration increased the density of

Mkp1-labeled cells in both anterior and posterior OFC. After 60 days, this effect was

much smaller. Interestingly, in anterior OFC, 60 days of sucrose self-administration

enhanced the density of Mkp1-labeled cells. After 60 days of self-administration,

cocaine-induced Mkp1 signals were observed mainly in the medial parts of OFC (at

the posterior level), while sucrose induced-Mkp1 signals were located in the lateral

parts of OFC (at the anterior level). In both 10 -and 60-days experiments, neither

cocaine nor sucrose self-administration had effects in the most lateral part of

posterior OFC.

Intensity of cellular response

Cocaine and sucrose self-administration affected not only the density of Mkp1-

positive cells but also the labeling intensity of the positive cells. In striatum, two-way

ANOVA showed that there was a main effect of group on the staining intensity of

Mkp1-positive cells in all subregions (Table 1). A main effect of self-administration

duration was observed only in the shell at the posterior striatum level (Table 1). The

interaction between group and self-administration duration was also significant in the

posterior shell (Table 1). Post-hoc testing revealed that, in the anterior striatum, after

10 days exposure the intensity of Mkp1-positive cells in the cocaine group was

significantly higher than in the control (DS, p < 0.001; core, p = 0.007; shell, p =

0.007; Tu, p = 0.006) and sucrose groups (DS, p = 0.001; core, p = 0.003, shell, p =

0.034; Tu, p = 0.042) (Fig. 7a). After 60 days, significant differences were seen in DS

(p = 0.001), core (p = 0.001) and shell (p = 0.011) but not in Tu (p = 0.216) between

the cocaine and control groups. Significant differences between the cocaine and

sucrose groups were seen in DS (p = 0.041) and core (p = 0.015), but not in shell (p

= 0.076) and Tu (p = 0.709) (Fig. 7a). In the posterior striatum, significant differences

between cocaine and the other two groups were found in DS (p < 0.001 for both),

core (p < 0.001 for both), and shell (p < 0.001 for both), but not in Tu (Coc vs. Con, p

= 0.198; Coc vs. Suc, p = 0.197) in the 10-days experiment (Fig. 7b). In the 60-days

experiment, significant differences were seen in all subregions between the cocaine

Chapter 3

99

and control groups (DS, p < 0.001; core, p < 0.001; shell, p = 0.003; Tu, p = 0.002),

and between the cocaine and sucrose groups (DS, p < 0.001; core, p < 0.001; shell,

p < 0.001; Tu, p < 0.001) (Fig. 7b).

In mPFC, two-way ANOVA showed that there was a main effect of group on

the intensity of Mkp1-positive cells in all subregions (Table 1). A main effect of self-

administration duration was observed in the AC and PrL in anterior mPFC and the

AC, PrL, and IL in posterior mPFC (Table 1). The interaction between group and self-

administration duration was significant in the AC and PrL in both the anterior and

posterior mPFC (Table 1). Post-hoc tests showed that, in the anterior mPFC, the

intensity of Mkp1-positive cells was significantly higher after cocaine self-

administration in all subregions when compared to control (AC, p < 0.001; PrL, p <

0.001; IL, p < 0.001) and to sucrose self-administration (AC, p < 0.001; PrL, p <

0.001; IL, p < 0.001) in the 10-days experiment (Fig. 7c). In the 60-day experiment,

cocaine self-administration significantly increased the intensity of Mkp1-positive cells

in all subregions when compared to control (AC, p = 0.003; PrL, p = 0.003; IL, p =

0.001) when compared to sucrose self-administration, significant increases in the

cocaine group were observed in PrL and IL (AC, p = 0.06; PrL, p = 0.041; IL, p = 0.01)

(Fig. 7c). In posterior mPFC, 10 days cocaine exposure significantly increased the

intensity of Mkp1-positive cells in all subregions when compared to both the control

(AC, p < 0.001; PrL, p < 0.001; IL, p = 0.003) and the sucrose groups (AC, p < 0.001;

PrL, p < 0.001; IL, p = 0.003) (Fig. 7e). In contrast, 60 days cocaine exposure

significantly increased the intensity of Mkp1-positive cells in IL, but not in AC and PrL,

when compared to control (AC, p = 0.195; PrL, p = 0.169; IL, p = 0.038). Significant

differences were seen in all three subregions between the cocaine and the sucrose

groups (AC, p = 0.027; PrL, p = 0.01; IL, p = 0.003) (Fig. 7e). Furthermore, no

difference was observed between the sucrose and control groups in mPFC.

In OFC, a main effect of group was observed on the intensity of Mkp1-positive

cells in all subregions (Table 1). A main effect of self-administration duration was

seen in all subregions in anterior OFC and in VLO, AIv, AId, and DI in posterior OFC

(Table 1). A significant interaction between group and self-administration duration

was seen in all subregions of anterior OFC and in AIv, AId, and DI in posterior OFC

(Table 1). Post-hoc tests showed that, in anterior OFC, the intensity of Mkp1-positive

cells in the cocaine group was significantly higher than in the other two groups in all

subregions in the 10-days experiment (p < 0.001 for all comparisons) (Fig. 7d). In the

60-days experiment, similar results were observed in all subregions (Coc vs. Con:

MO, p = 0.003; VO, p = 0.01; VLO, p = 0.006; LO, p = 0.005; DLO, p = 0.003; Coc vs.

Suc: MO, p = 0.009; VO, p = 0.015; VLO, p = 0.019; LO, p = 0.027; DLO, p = 0.019)

Chapter 3

100

Fig. 7. Individual labeling intensity of Mkp1 cells in all regions of interest after short- and

long-term cocaine and sucrose self-administration. Values are presented as mean ± SEM

percentage of OD of Mkp1-positive cells (Mkp1+) in the control groups. * p < 0.05,

significant difference between cocaine group and the other two groups (control group and

sucrose group); ^ p < 0.05, significant difference between cocaine and control groups; # p <

0.05, significant difference between cocaine and sucrose groups. For abbreviations, see Fig.

3.

(Fig. 7d). In posterior OFC, after 10 days of self-administration the intensity of Mkp1-

positive cells was significantly enhanced in the cocaine group in all subregions in

comparison to the control group (MO, p = 0.007; VLO, p < 0.001; AIv, p < 0.001; LO,

p < 0.001; AId, p < 0.001; DI, p < 0.001). Between cocaine and sucrose groups

significant changes were observed in VLO, AIv, LO, AId, and DI (VLO, p < 0.001; AIv,

Chapter 3

101

p < 0.001; LO, p = 0.001; AId, p < 0.001; DI, p = 0.002) (Fig. 7f). After 60 days of self-

administration, the intensity of Mkp1-positive cells was significantly enhanced in the

cocaine group in MO, VLO, AIv, LO, and AId when compared to control and sucrose

groups (Coc vs. Con: MO, p = 0.002; VLO, p = 0.001; AIv, p = 0.006; LO, p = 0.009;

AId, p = 0.028; Coc vs. Suc: MO, p = 0.001; VLO, p < 0.001; AIv, p = 0.001; LO, p =

0.007; AId, p = 0.029) (Fig. 7f).

In summary, compared to the complex changes in the density of Mkp1-

labeled cells, the alterations in the cellular labeling intensity of Mkp1-positive cells

were rather straightforward, showing consistent increases in the cocaine groups in

most striatal and cortical subregions. Sucrose self-administration had no effect on the

cellular intensity, regardless of self-administration duration.

Topography of neuronal reactivity patterns

Visual inspection of the hybridized tissue sections showed that the cocaine or

sucrose self-administration-induced neuronal reactivity patterns did not obey the

conventional anatomical boundaries as shown in Figure 3. We compared the

distributional patterns of the reactive neurons to cocaine and sucrose self-

administration to establish qualitative and quantitative differences. Using their X-Y

coordinates, all Mkp1-positive cells in single sections were plotted and assigned a

(color) coding that represented each cell’s labeling intensity, viz. light, medium or

intense. This was followed by a warping step to standardized reference sections.

Distributional patterns of the cocaine group and sucrose group were compared using

SPM analysis.

Striatum

Statistical maps of striatum were produced from sections at the two anterior-posterior

levels described above. In the anterior striatum, significant differences between the

effects of limited (10 days) cocaine and sucrose self-administration were

predominantly seen in central parts of DS and laterally in VS (FDR = 0.001, Fig. 8a).

Applying the strict limit of FDR = 0.01 showed that, after prolonged (60 days)

exposure, the regions displaying significant differences in the anterior striatum had

greatly reduced in size (Fig. 8b) compared to the patterns after short-term exposure

(Fig. 8a). In contrast, the statistic maps of 10 days and 60 days self-administration

(cocaine vs. sucrose) in the posterior striatum were dissimilar. After 10 days of

Chapter 3

102

administration, significant differences were observed in the medial part of DS, dorsal

core and lateral shell (FDR = 0.001, Fig. 8c). However, the significant changes were

restricted to a medial sector of DS after 60 days self-administration (FDR = 0.001,

Fig. 8d).

Medial prefrontal and orbitofrontal cortices

In the anterior level, after 10 days of sucrose or cocaine self-administration, major

differences were found in the border regions between AC and dorsal PrL, and in a

small portion of IL (FDR = 0.001, Fig. 8e). In anterior OFC, the most significant

differences between the effects of 10 days of cocaine and sucrose self-administration

were seen in three clusters of pixels that were located in medial, central and lateral

OFC regions (FDR = 0.001, Fig. 8e). This pattern covered MO, VO, VLO and medial

LO, and crossed interregional boundaries; hardly any significant differences were

noted in DLO (Fig. 8e). However, after 60 days only minor regions (represented by a

few pixels) with significant differences were observed, both in mPFC and OFC, even

with a “permissive” FDR setting of 0.2 (Fig. 8f).

Statistical maps in the posterior mPFC showed regions with significant

differences primarily in AC and dorsal PrL after both 10 days (Fig. 8g, FDR = 0.001)

and 60 days (Fig. 8h, FDR = 0.001) of cocaine self-administration. Compared to 10

days of self-administration, the statistical maps of differences after 60 days of self-

administration displayed two marked discrepancies. First, the centers of the pixel

clusters (i.e. the yellow-white pixels in Fig. 8g-h) in dorsal mPFC appeared to have

shifted from central to more deep layers. Second, more prominent differences

between cocaine and sucrose exposure were seen in IL after 60 days exposure (Fig.

8h).

A different kind of contrast may be noted when comparing the statistical maps

of anterior with posterior mPFC after 60 days cocaine and sucrose self-administration.

Whereas significant changes (at FDR = 0.2) in anterior mPFC were minimal (Fig. 8f),

such changes were readily found in posterior mPFC (Fig. 8h) suggesting that

extended cocaine exposure induces strong neuronal responses mainly in the

posterior levels.

In posterior OFC, most subregions displayed significant differences between

the cocaine and sucrose experimental groups after 10 days self-administration, with

centers of pixel clusters sitting at the border between VLO and AIv as well as LO and

AId (FDR = 0.001, Fig. 8i). After 60 days of self-administration, similar patterns were

Chapter 3

103

found, although the areas displaying differences were much smaller (FDR = 0.01, Fig.

8j).

Chapter 3

104

Fig.8. Statistical maps of differences in neuronal activation patterns in frontal cortex and

striatum between cocaine –and sucrose-exposed animals. a, c, e, g and i present differences

after 10 days self-administration, whereas b, d, f, h and j show differences after 60 days self-

administration. In striatum, a and b represent the anterior levels and c and d the posterior

levels. In frontal cortex, e and f show the anterior levels, and g and h the posterior levels.

Images were thresholded at the following FDR: anterior striatum at 10 days (a) FDR = 0.001,

at 60 days (b) FDR = 0.01. Posterior striatum at 10 days (c) FDR = 0.001, at 60 days (d)

FDR = 0.001). Anterior mPFC + OFC at 10 days (e) FDR = 0.001, at 60 days (f) FDR = 0.2.

Posterior mPFC at 10 days (g) FDR = 0.001, at 60 days (h) FDR = 0.001. Posterior OFC at

10 days (i) FDR = 0.001, at 60 days (J) FDR = 0.01. Color scale corresponds to the partial

correlation coefficient “r”. Superimposed lines indicate the regions of interest in striatum,

mPFC and OFC.

Discussion

In the present study, we investigated the consequences of cocaine self-

administration on neuronal activity in striatum and frontal cortex. The aim of the study

was to assess how prolonged drug taking alters patterns of functional activity in these

brain structures, which may underlie the progression from casual to compulsive drug

use. Increased expression of Mkp1 was found in striatum and frontal cortex after both

short- and long-term self-administration of cocaine. These changes were not identical

to those reported previously using RT-PCR analysis (Gao et al. 2015). This

discrepancy may be caused by the fact that RT-PCR analysis was performed on

much larger portions of cortex and striatum than in situ hybridization. Alternatively, it

might indicate higher sensitivity of the hybridization technique compared to RT-PCR.

In the present study, increased expression of Mkp1 in striatum was seen in both

dorsal and ventral sectors after short-term cocaine exposure; the enhanced reactivity

persisted only in dorsal striatum (DS) in rats that had self-administered cocaine for 60

days. In frontal cortex, virtually all medial prefrontal and most orbitofrontal areas

showed increased reactivity after 10 days cocaine cocaine-administration. However,

after 60 days, enhanced expression of Mkp1 was restricted to caudal parts of medial

prefrontal and caudomedial parts of orbitofrontal cortex. In general, the magnitude of

changes in Mkp1 expression was far greater after short-term compared to long-term

cocaine self-administration.

Besides a conventional analysis including counting of IEG-expressing

neurons and measuring response intensities of individual cells in pre-defined regions

Chapter 3

105

of interest, we performed statistical parametric mapping (SPM) of differences

between activation patterns after cocaine and sucrose self-administration to establish

the distributional features of neuronal responses. The SPM analysis takes into

account both the density and intensity of cellular IEG labeling by binning and

comparing values for these parameters at the level of pixels. Of course, the size of

the pixels will determine the grade of detail in the delineations of local activational

differences. In the present experiments, pixel size was set to allow a spatial

resolution of approximately the diameter of the anterior commissure, which suffices

to distinguish subregions of functionally relevant proportion such as deep and

superficial cortical layers or small subregions of nucleus accumbens core and shell.

In a similar vein, the outcome of SPM analysis was determined by the face validity-

based choice to bin response intensity values into 3 classes (i.e. light, intermediate

and strong immunoreactivity). Using fewer or more classes will affect the grade of

detail in the detected differences. Transformation and combination of cellular

mappings from individual rats to experimental groups, followed by arithmetic

comparison of group differences (e.g. by subtraction) would allow visualization of

regional activation differences using, for instance, a LUT scale. However, the prime

advantage of the SPM method is that it allows identification of areas with significantly

different responses to cocaine and sucrose self-administration. The latter analysis is

unbiased, i.e. it does not impose a priori anatomical delineations. Thus, the present

data demonstrate changes induced by cocaine and sucrose self-administration at the

level of major cortical and striatal regions and subregions thereof.

Striatum

Limited cocaine self-administration experience (10 days) resulted in increased Mkp1

cell density and cellular labeling intensity in both ventral striatum (VS) and DS. In the

SPM analysis, these changes were represented by a band of pixels indicating

significant differences between cocaine and sucrose self-administration that ran from

dorsomedial to ventrolateral striatum. In contrast, after prolonged (60 days) exposure

to cocaine and sucrose this band was limited to DS. Whereas increased Mkp1 cell

density was observed in both DS and VS after short-term cocaine self-administration,

this response persisted only in DS after long-term cocaine use. In addition, in VS the

augmented intensity of cell labeling in nucleus accumbens shell was found to be

lower after 60 days compared to 10 days.

Activation of VS and DS after short-term cocaine self-administration as

opposed to more selective activation of DS after long-term cocaine use, hints at the

Chapter 3

106

notion that striatal control over drug intake mainly involves DS with prolonged drug

use (Everitt and Robbins 2005; 2016). The posterior dorsomedial part of striatum has

been implicated in action – outcome learning, typified by action selection that is

sensitive to changes in reward value and, hence, is flexible and goal-directed (Yin

and Knowlton 2006; Yin et al. 2008; Shiflett and Balleine 2011). Indeed, a clear

association has been reported between the action – outcome learning phase in a

behavioral task and cellular activity in the dorsomedial striatum (Stalnaker et al. 2010;

Thorn et al. 2010; Kim et al. 2013). Together with the present findings, this suggests

that corticostriatal networks involving the dorsomedial, associative compartment of

striatum play a role in the initial phases of the development of drug addiction. In later

phases, striatal control over cocaine seeking is thought to be governed by the

dorsolateral striatum (Vanderschuren et al. 2005; Belin and Everitt 2008; Pierce and

Vanderschuren 2010; Zapata et al. 2010; Jonkman et al. 2012a; Murray et al. 2012).

Interestingly, the present data demonstrate that in DS increased cocaine-specific

activity is restricted to medial and central locations after prolonged experience with

cocaine. The dorsocentral striatum is likely important in regulating cocaine intake

(Hollander et al. 2010). It has been proposed to mediate sequencing of actions that is

necessary for constructing complex action patterns – so called chunking (Barnes et

al. 2010; Graybiel and Grafton 2015) – a prerequisite for goal-directed behavior to

shift to habitual responding (Shiflett et al. 2010). The present patterns of neuronal

activity are likely related to this process, whereby the act of responding for cocaine

becomes a chunked, ingrained activity that ultimately results in automated, habitual

cocaine taking. Somewhat contrary to our hypothesis, we did not find changes in

Mkp1 expression in dorsolateral striatal parts implicated in habitual drug seeking. In

this study, we did not explicitly test whether cocaine self-administration had become

habitual or resistant to punishment, to avoid any influence of punishment on IEG

expression. For that reason, we can only speculate on whether the 60 days of

responding for cocaine under an FR1 schedule of reinforcement indeed resulted in

habitual behavior that depends on the dorsolateral striatum. On the one hand,

dopamine neurotransmission in the dorsolateral striatum has been shown to be

involved in responding for cocaine under fixed-ratio schedules of reinforcement

(Veeneman et al. 2012; Willuhn et al. 2012; Veeneman et al. 2015). On the other

hand, it has also been suggested that the dorsolateral striatum only becomes

involved in cocaine self-administration when high rates of behavior are required to

procure the drug (Murray et al. 2012). In addition, the development of punishment-

resistant cocaine seeking has been shown to require exposure to self-administration

episodes in which animals can self-administer large quantities of the drug during

Chapter 3

107

prolonged experimental sessions (Vanderschuren and Everitt 2004; Jonkman et al.

2012b). Even under these conditions, compulsive patterns of drug seeking and taking

may only occur in a subset of animals (Deroche-Gamonet et al. 2004; Pelloux et al.

2007; 2012). Thus, we cannot be sure that the behavior of our cocaine self-

administering animals after 60 days of drug taking had gained a habitual, or perhaps

compulsive quality that relies on the dorsolateral striatum. Rather, the involvement of

dorsocentral regions after 60 days of cocaine self-administration suggests that the

self-administration behavior had become ‘chunked’ and was therefore in the process

of becoming automated.


Loss of cognitive control over drug use is thought to occur as a consequence of drug-

induced dysfunction of prefrontal and orbitofrontal cortex (Jentsch and Taylor 1999;

Goldstein and Volkow 2011; Everitt and Robbins 2016). In the present experiments,

we hypothesized such a process to result in neuronal reactivity patterns that differed

between short –and long-term self-controlled cocaine intake. Indeed, all three

prefrontal regions (i.e. AC, PrL and IL) showed increased activity after 10 days of

cocaine self-administration, whereas much smaller rises in activity were seen after 60

days, restricted to posterior parts of PrL and IL. The neuronal activity in PrL is likely

related to the role that this cortical region plays in goal-directed behavior, i.e.

outcome value-controlled responding (Chudasama et al. 2003; Killcross and

Coutureau 2003; Balleine and O'Doherty 2010). The present data indicate that this

model-based control over instrumental responding (Daw et al. 2011) is strong after

limited drug exposure, whereas PrL control over drug seeking weakens after long-

term repeated exposure to the drug. The IL has been implicated in the development

of habitual responding by organizing action sequences into habits (Killcross and

Coutureau 2003; Smith and Graybiel 2013) and such activity may be reflected by the

shift in neuronal reactivity from anterior to posterior levels in IL after long-term

cocaine self-administration. Activity in AC has been demonstrated to be important for

the temporal organization of action chains in which executive attention processes

play a crucial role (Passetti et al. 2002; Chudasama et al. 2003; Heidbreder and

Groenewegen 2003). Experimental findings on conditioning processes involving

cocaine are in agreement with the purported function in attention for AC in humans

as well as rats (Weissenborn et al. 1997; Garavan et al. 2000; Neisewander et al.

2000; McLaughlin and See 2003; Baeg et al. 2009; Goldstein et al. 2009). Our SPM

Chapter 3

108

analysis showed neuronal reactivity to engage a larger part of AC in posterior mPFC

after long-term cocaine self-administration. This may reflect enhanced attention and

learning or perhaps a form of attentional bias (Luijten et al. 2011; Marhe et al. 2013;

Kilts et al. 2014).

Orbitofrontal cortex

Augmented neuronal reactivity after short-term cocaine self-administration was

observed in both medial and lateral OFC, except the most lateral portion of the OFC

(i.e., the DLO) in the present study. After long-term cocaine exposure increased

neuronal reactivity was largely restricted to posterior levels of VLO and LO (and AIv)

whereas anterior lateral and medial parts of OFC no longer were responsive. These

differential effects suggest diverse changes in response regulation related to

dissociable functions of OFC subregions (Elliott et al. 2000; Windmann et al. 2006;

Burton et al. 2015 and references therein; see also Rudebeck and Murray 2011a, b).

Although both medial and lateral OFC have been implicated in responding to

cocaine-associated cues (Fuchs et al. 2004; Stalnaker et al. 2006; Goldstein et al.

2007; Kantak et al. 2013), we are only beginning to understand the precise functional

involvement of the individual OFC subregions in behavioral control (Noonan et al.

2010; Mar et al. 2011; Burton et al. 2014).

The OFC is thought to encode the value of anticipated rewards or outcome of

actions. Prior cocaine use has been shown to affect the sensitivity of OFC neurons to

value of predicted outcome required for behavioral response flexibility (Lucantonio et

al. 2014). The current findings of increased neuronal activity in OFC after 10 days of

cocaine self-administration may represent the involvement of value sensitivity in drug

taking. According to our SPM analysis, increased activity engaged the entire OFC

except the DLO region. This response dwindles as experience with cocaine self-

administration grows and after 60 days, enhanced activity was reduced to a minimum

in anterior levels, whereas posteriorly an activity pattern was seen that essentially

resembled the distribution at 10 days albeit with lower significance (i.e. FDR rates).

Interestingly, after 60 days, sucrose exposure resulted in significantly increased

neuronal activity in LO and no apparent effect of cocaine use, inducing a significant

difference between the cocaine -and sucrose-exposed experimental groups. These

findings point to a strong influence on behavioral control of anticipated outcome value

after 10 days of cocaine self-administration and a greatly reduced impact of value

encoding in response regulation after 60 days exposure. High neuronal activity levels

in OFC have been associated with goal-directed actions whereas lower activity was

Chapter 3

109

found with habitual responding (Gremel and Costa, 2013). The reduced rise in

activity in OFC as seen in the present experiments, suggests that OFC involvement

is waning and that responding is becoming routinized.

Sucrose and cocaine self-administration

In contrast to cocaine, sucrose self-administration did not induce major changes in

neuronal reactivity. Only after long-term access to sucrose increases were found in

Mkp1 cell density, which were restricted to anterior dorsal mPFC and lateral OFC.

Interestingly, in the same regions the effects of cocaine exposure had disappeared

after long-term self-administration. These findings suggest that different cortical

areas are involved in instrumental conditioning for a drug or natural reward.

Alternatively, temporal differences in engaging the cortical regions in the conditioning

process may play a role and the present observation of sucrose-associated effects

after long-term exposure might represent an initial stage in sucrose-induced

neuroadaptive changes. Indeed, in mPFC as well as striatum, neuroadaptive

changes in protein expression have been reported after limited and excessive intake

of sucrose (Van den Oever et al. 2006; Ahmed et al. 2014). A late role for mPFC and

OFC would be in line with lesion experiments showing no effect on acquisition of

sucrose self-administration whereas cocaine self-administration was impaired

(Weissenborn et al. 1997). In a reinstatement paradigm, Liu et al. (2013) showed

distinct neuronal encoding of cocaine -or sucrose-associated stimuli in striatum and

mPFC subregions, although the same areas were activated by the differently

conditioned cues. In addition, Levy et al. (2007) found no effect of mPFC stimulation

on sucrose-rewarded behavior in contrast to cocaine-rewarded behavior.

Conclusions

The present findings provide a neuronal activation correlate of the proposed change

in functional involvement of prefrontal cortex, and dorsal and ventral striatum in

prolonged drug intake. After long-term cocaine self-administration, neuronal activity

was largely confined to the dorsomedial and dorsocentral striatum. In the frontal lobe

much less activation was seen after long-term compared to short-term cocaine

exposure. The observed changes in neuronal activity from short-term to long-term

drug exposure might reflect drug-taking becoming routinized and in the process of

becoming habitual.

Chapter 3

110

Table 1

Region

Sub-

region

Treatment effect Administration Session

Effect

Interaction

(F-ratio; p value) (F-ratio; p value) (F-ratio; p value)

Density

(CD)

Intensity

(OD)

Density

(CD)

Intensity

(OD)

Density

(CD)

Intensity

(OD)

Striatum

(Anterior)

DS F(2.40)=54.39 F(2.40)=22.04 F(1.40)=0.22 F(1.40)=1.46 F(2.40)=2.11 F(2.40)=0.42

p<0.001 * p<0.001 * p=0.640 p=0.233 p=0.134 p=0.656

Core F(2.40)=39.59 F(2.40)=17.53 F(1.40)=17.98 F(1.40)=3.75 F(2.40)=22.78 F(2.40)=0.96

p<0.001 * p<0.001 * p<0.001 * p=0.060 p<0.001 * p=0.392

Shell F(2.40)=16.16 F(2.40)=11.56 F(1.40)=3.52 F(1.40)=0.39 F(2.40)=6.08 F(2.40)=0.11

p<0.001 * p<0.001 * p=0.068 p=0.531 p=0.005 * p=0.894

Tu F(2.40)=10.45 F(2.40)=5.94 F(1.40)=13.78 F(1.40)=0.06 F(2.40)=9.72 F(2.40)=0.37

p<0.001 * p=0.006 * p=0.001 * p=0.797 p<0.001 * p=0.687

Striatum

(Posterior)

DS F(2.40)=39.00 F(2.40)=54.23 F(1.40)=23.76 F(1.40)=1.64 F(2.40)=16.31 F(2.40)=1.76

p<0.001 * p<0.001 * p<0.001 * p=0.207 p<0.001 * p=0.185

Core F(2.40)=20.41 F(2.40)=43.29 F(1.40)=16.85 F(1.40)=1.71 F(2.40)=11.53 F(2.40)=0.43

p<0.001 * p<0.001 * p<0.001 * p=0.198 p<0.001 * p=0.647

Shell F(2.40)=14.79 F(2.40)=45.24 F(1.40)=4.33 F(1.40)=16.00 F(2.40)=4.76 F(2.40)=4.69

p<0.001 * p <0.001 * p =0.044 * p <0.001 * p=0.014 * p=0.015 *

Tu F(2.40)=6.59 F(2.40)=9.79 F(1.40)=0.91 F(1.40)=0.01 F(2.40)=1.12 F(2.40)=0.55

p=0.003 * p<0.001 * p=0.345 p=0.945 p=0.336 p=0.576

mPFC

(Anterior)

AC F(2.40)=6.20 F(2.40)=34.38 F(1.40)=9.92 F(1.40)=5.40 F(2.40)=14.52 F(2.40)=6.97

p=0.004 * p<0.001 * p=0.003 * p=0.025 * p<0.001 * p=0.003 *

PrL F(2.40)=6.82 F(2.40)=35.23 F(1.40)=9.51 F(1.40)=9.57 F(2.40)=9.31 F(2.40)=8.79

p=0.003 * p<0.001 * p=0.004 * p=0.004 * p<0.001 * p=0.001 *

IL F(2.40)=9.93 F(2.40)=27.30 F(1.40)=7.27 F(1.40)=0.59 F(2.40)=7.69 F(2.40)=2.72

p<0.001 * p<0.001 * p=0.010 * p=0.444 p=0.001 * p=0.077

mPFC

(Posterior)

AC F(2.39)=10.43 F(2.39)=20.57 F(1.39)=9.91 F(1.39)=11.45 F(2.39)=3.68 F(2.39)=3.26

p<0.001 * p<0.001 * p=0.003 * p=0.002 * p=0.034 * p=0.049 *

PrL F(2.39)=18.63 F(2.39)=22.11 F(1.39)=15.40 F(1.39)=12.99 F(2.39)=5.60 F(2.39)=3.93

p<0.001 * p<0.001 * p<0.001 * p=0.001 * p=0.007 * p=0.028 *

IL F(2.39)=9.83 F(2.39)=14.17 F(1.39)=0.76 F(1.39)=4.76 F(2.39)=0.31 F(2.39)=1.43

p<0.001 * p<0.001 * p=0.388 p=0.035 * p=0.730 p=0.252

Chapter 3

111

Table 1 continued

Table 1. Results of two-way ANOVA in subregions of striatum, mPFC and OFC with group

and self-administration duration (i.e. 10 versus 60 days of self-administration) as independent

variables. Cell density (i.e. number of cells per surface area) and labeling intensity were

dependent variables. A corrected p-value < 0.05 indicates statistical significance.

Region

Sub-

region

Treatment effect

(F-ratio; p value)

Administration Session

Effect

(F-ratio; p value)

Interaction

(F-ratio; p value)

Density

(CD)

Intensity

(OD)

Density

(CD)

Intensity

(OD)

Density

(CD)

Intensity

(OD)

OFC

(Anterior)

MO F(2.40)=13.99 F(2.40)=36.67 F(1.40)=13.07 F(1.40)=7.77 F(2.40)=13.62 F(2.40)=7.04

p<0.001 * p<0.001 * p=0.001 * p=0.008 * p<0.001 * p=0.002 *

VO F(2.40)=7.14 F(2.40)=25.72 F(1.40)=8.51 F(1.40)=10.44 F(2.40)=19.15 F(2.40)=5.15

p=0.002 * p<0.001 * p=0.006 * p=0.002 * p<0.001 * p=0.010 *

VLO F(2.40)=5.24 F(2.40)=36.00 F(1.40)=1.11 F(1.40)=8.34 F(2.40)=8.19 F(2.40)=6.08

p=0.009 * p<0.001 * p=0.296 p=0.006 * p=0.001 * p=0.005 *

LO F(2.40)=6.50 F(2.40)=32.47 F(1.40)=0.64 F(1.40)=9.37 F(2.40)=7.90 F(2.40)=5.24

p=0.004 * p<0.001 * p=0.426 p=0.004 * p=0.001 * p=0.010 *

DLO F(2.40)=1.83 F(2.40)=31.06 F(1.40)=2.84 F(1.40)=12.22 F(2.40)=4.67 F(2.40)=6.52

p=0.172 p<0.001 * p=0.099 p=0.001 * p=0.015 * p=0.004 *

OFC

(Posterior)

MO F(2.39)=13.50 F(2.39)=17.08 F(1.39)=2.04 F(1.39)=0.79 F(2.39)=3.51 F(2.39)=0.70

p<0.001 * p<0.001 * p=0.161 p=0.379 p=0.039 * p=0.500

VLO F(2.39)=16.63 F(2.39)=38.23 F(1.39)=1.78 F(1.39)=4.40 F(2.39)=4.58 F(2.39)=1.21

p<0.001 * p<0.001 * p=0.190 p=0.042 * p=0.016 * p=0.309

AIv F(2.39)=12.28 F(2.39)=40.31 F(1.39)=5.52 F(1.39)=14.40 F(2.39)=4.50 F(2.39)=5.04

p<0.001 * p<0.001 * p=0.024 * p=0.001 * p=0.017 * p=0.011 *

LO F(2.39)=9.51 F(2.39)=23.86 F(1.39)=6.20 F(1.39)=2.92 F(2.39)=3.61 F(2.39)=1.32

p<0.001 * p<0.001 * p=0.017 * p=0.095 p=0.036 * p=0.279

AId F(2.39)=1.48 F(2.39)=30.28 F(1.39)=0.12 F(1.39)=4.86 F(2.39)=0.06 F(2.39)=3.34

p=0.240 p<0.001 * p=0.722 p=0.033 * p=0.941 p=0.046 *

DI F(2.39)=0.50 F(2.39)=12.38 F(1.39)=3.96 F(1.39)=14.48 F(2.39)=1.08 F(2.39)=4.21

p=0.606 p<0.001 * p=0.054 p<0.001 * p=0.347 p=0.022 *

Chapter 3

112

Supplementary Table S1

Region Sub-

region Group

Short term (10 days) Long term (60 days)

Density Intensity Density Intensity

Striatum DS Control 42 ± 7.29 0.028 ± 0.0012 50 ± 4.17 0.023 ± 0.0024

(Anterior) Sucrose 35 ± 3.84 0.031 ± 0.0013 52 ± 6.09 0.028 ± 0.0015

Cocaine 102 ± 5.61 0.039 ± 0.0012 103 ± 9.09 0.034 ± 0.0014

Core Control 20 ± 3.21 0.032 ± 0.0023 74 ± 6.21 0.025 ± 0.0026

Sucrose 17 ± 2.29 0.031 ± 0.0012 75 ± 8.44 0.029 ± 0.0020

Cocaine 62 ± 5.58 0.044 ± 0.0031 97 ± 6.68 0.037 ± 0.0013

Shell Control 26 ± 4.74 0.031 ± 0.0017 82 ± 8.53 0.026 ± 0.0029

Sucrose 23 ± 2.66 0.033 ± 0.0016 82 ± 12.64 0.029 ± 0.0012

Cocaine 55 ± 4.20 0.041 ± 0.0023 106 ± 11.90 0.036 ± 0.0022

Tu Control 26 ± 3.36 0.030 ± 0.0017 167 ± 15.28 0.025 ± 0.0029

Sucrose 31 ± 5.85 0.032 ± 0.0018 171 ± 21.30 0.028 ± 0.0012

Cocaine 66 ± 6.89 0.038 ± 0.0014 173 ± 30.66 0.029 ± 0.0008

Striatum DS Control 38 ± 5.27 0.034 ± 0.0014 63 ± 3.28 0.028 ± 0.0011

(Posterior) Sucrose 50 ± 2.77 0.037 ± 0.0008 71 ± 8.73 0.029 ± 0.0010

Cocaine 118 ± 10.58 0.049 ± 0.0028 93 ± 7.33 0.043 ± 0.0024

Core Control 20 ± 2.33 0.039 ± 0.0026 50 ± 8.05 0.030 ± 0.0015

Sucrose 27 ± 2.84 0.041 ± 0.0023 60 ± 10.08 0.029 ± 0.0017

Cocaine 53 ± 3.15 0.058 ± 0.0037 64 ± 5.08 0.044 ± 0.0022

Shell Control 24 ± 3.30 0.036 ± 0.0020 49 ± 6.03 0.032 ± 0.0014

Sucrose 26 ± 2.06 0.040 ± 0.0011 54 ± 9.37 0.030 ± 0.0017

Cocaine 51 ± 3.64 0.055 ± 0.0030 66 ± 5.93 0.041 ± 0.0019

Tu Control 26 ± 6.45 0.037 ± 0.0037 102 ± 17.01 0.027 ± 0.0011

Sucrose 31 ± 2.87 0.037 ± 0.0020 123 ± 18.42 0.025 ± 0.0008

Cocaine 50 ± 5.03 0.044 ± 0.0028 145 ± 15.26 0.035 ± 0.0018

mPFC AC Control 157 ± 12.59 0.033 ± 0.0018 394 ± 17.39 0.036 ± 0.0012


Cocaine 260 ± 14.19 0.052 ± 0.0014 364 ± 20.35 0.045 ± 0.0020

PrL Control 124 ± 9.28 0.037 ± 0.0024 329 ± 14.41 0.037 ± 0.0012

Sucrose 146 ± 10.49 0.039 ± 0.0025 388 ± 33.42 0.039 ± 0.0015

Cocaine 197 ± 10.00 0.059 ± 0.0012 326 ± 19.84 0.045 ± 0.0016

Chapter 3

113

Table S1 continued

Region Sub-

region Group



IL Control 122 ± 12.36 0.040 ± 0.0015 266 ± 12.61 0.038 ± 0.0015

Sucrose 136 ± 11.20 0.040 ± 0.0030 302 ± 24.47 0.040 ± 0.0016

Cocaine 207 ± 12.47 0.057 ± 0.0022 290 ± 19.18 0.048 ± 0.0017

mPFC AC Control 148 ± 11.16 0.037 ± 0.0019 302 ± 8.32 0.037 ± 0.0027

(Posterior) Sucrose 176 ± 10.97 0.040 ± 0.0011 304 ± 22.30 0.034 ± 0.0021

Cocaine 232 ± 19.19 0.052 ± 0.0011 344 ± 12.18 0.043 ± 0.0011

PrL Control 106 ± 13.94 0.041 ± 0.0025 260 ± 12.67 0.038 ± 0.0021

Sucrose 125 ± 8.13 0.043 ± 0.0011 247 ± 16.09 0.035 ± 0.0013

Cocaine 183 ± 7.35 0.056 ± 0.0008 309 ± 8.68 0.043 ± 0.0015

IL Control 69 ± 13.28 0.044 ± 0.0030 139 ± 12.79 0.035 ± 0.0020

Sucrose 66 ± 5.61 0.047 ± 0.0017 159 ± 17.36 0.032 ± 0.0012

Cocaine 101 ± 4.30 0.056 ± 0.0010 213 ± 11.60 0.041 ± 0.0014

OFC MO Control 156 ± 14.00 0.038 ± 0.0022 337 ± 11.52 0.038 ± 0.0013


Cocaine 272 ± 15.23 0.060 ± 0.0015 347 ± 22.39 0.047 ± 0.0022

VO Control 178 ± 13.33 0.036 ± 0.0022 467 ± 17.44 0.039 ± 0.0015

Sucrose 177 ± 9.26 0.040 ± 0.0028 554 ± 53.39 0.039 ± 0.0012

Cocaine 299 ± 18.73 0.056 ± 0.0013 429 ± 22.95 0.046 ± 0.0019

VLO Control 229 ± 14.63 0.035 ± 0.0017 455 ± 14.53 0.042 ± 0.0020

Sucrose 238 ± 17.44 0.037 ± 0.0025 564 ± 44.29 0.044 ± 0.0016

Cocaine 328 ± 20.83 0.056 ± 0.0016 474 ± 20.13 0.053 ± 0.0026

LO Control 208 ± 18.50 0.036 ± 0.0019 378 ± 10.04 0.044 ± 0.0020

Sucrose 222 ± 13.31 0.041 ± 0.0028 483 ± 30.70 0.046 ± 0.0018

Cocaine 298 ± 19.47 0.059 ± 0.0020 405 ± 11.98 0.056 ± 0.0029

DLO Control 118 ± 14.12 0.033 ± 0.0017 351 ± 13.02 0.037 ± 0.0011

Sucrose 131 ± 9.95 0.037 ± 0.0026 415 ± 26.97 0.038 ± 0.0013

Cocaine 159 ± 12.55 0.053 ± 0.0020 323 ± 17.03 0.045 ± 0.0020

Chapter 3

114

Table S1 continued

Region Sub-

region Group



OFC

(Posterior)

MO

Control

Sucrose

Cocaine

55 ± 11.89

59 ± 3.98

105 ± 5.27

0.037 ± 0.0029

0.041 ± 0.0024

0.049 ± 0.0007

181 ± 15.57

213 ± 22.36

247 ± 12.94

0.031 ± 0.0017

0.030 ± 0.0019

0.041 ± 0.0011

VLO Control 160 ± 20.49 0.037 ± 0.0021 351 ± 13.12 0.039 ± 0.0019

Sucrose 150 ± 13.99 0.040 ± 0.0012 366 ± 21.85 0.038 ± 0.0027

Cocaine 250 ± 7.24 0.055 ± 0.0017 426 ± 13.37 0.052 ± 0.0015

AIv Control 163 ± 23.99 0.039 ± 0.0024 357 ± 10.36 0.041 ± 0.0021

Sucrose 171 ± 8.99 0.042 ± 0.0017 366 ± 15.68 0.039 ± 0.0026

Cocaine 253 ± 7.28 0.061 ± 0.0017 407 ± 11.32 0.051 ± 0.0010

LO Control 125 ± 19.71 0.041 ± 0.0030 299 ± 12.21 0.041 ± 0.0021

Sucrose 141 ± 8.26 0.042 ± 0.0013 314 ± 11.08 0.040 ± 0.0029

Cocaine 195 ± 7.29 0.059 ± 0.0022 341 ± 10.58 0.051 ± 0.0007

AId Control 96 ± 16.53 0.037 ± 0.0020 257 ± 13.09 0.037 ± 0.0022

Sucrose 111 ± 5.81 0.039 ± 0.0007 281 ± 15.49 0.037 ± 0.0021

Cocaine 111 ± 4.00 0.054 ± 0.0011 292 ± 13.19 0.045 ± 0.0012

DI Control 107 ± 16.14 0.035 ± 0.0021 309 ± 11.93 0.038 ± 0.0019

Sucrose 129 ± 11.86 0.038 ± 0.0011 289 ± 18.62 0.034 ± 0.0026

Cocaine 115 ± 7.84 0.047 ± 0.0011 272 ± 17.65 0.040 ± 0.0013

Table S1. Overview of cellular density (Density, i.e. number of cells per mm2) and cellular labeling

intensity (intensity, i.e. OD) of Mkp1-positive cells in individual subregions of striatum, mPFC, and

OFC.

Chapter 3

115

References

⬧ American Psychiatric Association (2000) DSM-IV-TR, Diagnostic and Statistical Manual of Mental

Disorders. American Psychiatric Association, Washington, DC, USA.

⬧ American Psychiatric Association (2013) Diagnostic and Statistical Manual of Mental Disorders.

Fifth Edition (DSM-5). American Psychiatric Association, Washington, DC, USA.

⬧ Ahmed S, Kashem MA, Sarker R, Ahmed EU, Hargreaves GA, McGregor IS (2014)

Neuroadaptations in the striatal proteome of the rat following prolonged excessive sucrose intake.

Neurochem Res 39:815-824.

⬧ Baeg EH, Jackson ME, Jedema HP, Bradberry CW (2009) Orbitofrontal and anterior cingulate

cortex neurons selectively process cocaine-associated environmental cues in the rhesus monkey. J

Neurosci 29:11619-11627.


determinants of goal-directed and habitual action. Neuropsychopharmacology 35:48-69.

⬧ Barnes KA, Cohen AL, Power JD, Nelson SM, Dosenbach YB, Miezin FM, Petersen SE, Schlaggar

BL (2010) Identifying Basal Ganglia divisions in individuals using resting-state functional

connectivity MRI. Front Syst Neurosci 4:18.

⬧ Belin D, Everitt BJ (2008) Cocaine seeking habits depend upon dopamine-dependent serial

connectivity linking the ventral with the dorsal striatum. Neuron 57:432-441.

⬧ Benjamini Y, Hochberg Y (1995) Controlling the false discovery rate: a practical and powerful

approach to multiple testing. J.R.Statist.Soc.B 57(1)289-300.

⬧ Besson M, Pelloux Y, Dilleen R, Theobald DE, Lyon A, Belin-Rauscent A, Robbins TW, Dalley JW,

Everitt BJ, Belin D (2013) Cocaine modulation of frontostriatal expression of Zif268, D2, and 5-HT2c

receptors in high and low impulsive rats. Neuropsychopharmacology 38:1963-1973.

⬧ Burton AC, Kashtelyan V, Bryden DW, Roesch MR (2014) Increased firing to cues that predict low-

value reward in the medial orbitofrontal cortex. Cereb Cortex 24:3310-3321.

⬧ Burton AC, Nakamura K, Roesch MR (2015) From ventral-medial to dorsal-lateral striatum: neural

correlates of reward-guided decision-making. Neurobiol Learn Mem 117:51-59.

⬧ Carelli RM (2002) The nucleus accumbens and reward: neurophysiological investigations in

behaving animals. Behav Cogn Neurosci Rev 1:281-296.

⬧ Chen BT, Yau HJ, Hatch C, Kusumoto-Yoshida I, Cho SL, Hopf FW, Bonci A (2013) Rescuing

cocaine-induced prefrontal cortex hypoactivity prevents compulsive cocaine seeking. Nature

496:359-362.

⬧ Chudasama Y, Passetti F, Rhodes SE, Lopian D, Desai A, Robbins TW (2003) Dissociable aspects

of performance on the 5-choice serial reaction time task following lesions of the dorsal anterior

cingulate, infralimbic and orbitofrontal cortex in the rat: differential effects on selectivity, impulsivity

and compulsivity. Behav Brain Res 146:105-119.

⬧ Corbit LH, Janak PH (2007) Inactivation of the lateral but not medial dorsal striatum eliminates the

excitatory impact of Pavlovian stimuli on instrumental responding. J Neurosci 27:13977-13981.

Chapter 3

116

⬧ Daunais JB, Roberts DC, McGinty JF (1993) Cocaine self-administration increases preprodynorphin,

but not c-fos, mRNA in rat striatum. Neuroreport 4:543-546.

⬧ Daunais JB, Roberts DC, McGinty JF (1995) Short-term cocaine self-administration alters striatal

gene expression. Brain Res Bull 37:523-527.

⬧ Daw ND, Gershman SJ, Seymour B, Dayan P, Dolan RJ (2011) Model-based influences on

humans’ choices and striatal prediction errors. Neuron 69(6):1204-1215.

⬧ Deroche-Gamonet V, Piat F, Le Moal M, Piazza PV (2002) Influence of cue-conditioning on

acquisition, maintenance and relapse of cocaine intravenous self-administration. Eur J Neurosci

15:1363-1370.

⬧ Deroche-Gamonet V, Belin D, Piazza PV (2004) Evidence for addiction-like behavior in the rat.

Science 305:1014-1017.

⬧ De Vries TJ, Schoffelmeer ANM, Binnekade R, Mulder AH, Vanderschuren LJMJ (1998) Drug-

induced reinstatement of heroin- and cocaine-seeking behaviour following long-term extinction is

associated with expression of behavioural sensitization. Eur J Neurosci 10:3565-3571.

⬧ Elliott R, Dolan RJ, Frith CD (2000) Dissociable functions in the medial and lateral orbitofrontal

cortex: evidence from human neuroimaging studies. Cereb Cortex 10:308-317.

⬧ Everitt BJ, Hutcheson DM, Ersche KD, Pelloux Y, Dalley JW, Robbins TW (2007) The orbital

prefrontal cortex and drug addiction in laboratory animals and humans. Ann N Y Acad Sci 1121:576-

597.

⬧ Everitt BJ, Robbins TW (2005) Neural systems of reinforcement for drug addiction: from actions to

habits to compulsion. Nat Neurosci 8:1481-1489.

⬧ Everitt BJ, Robbins TW (2016) Drug Addiction: Updating Actions to Habits to Compulsions Ten

Years On. Annu Rev Psychol 67:23-50.

⬧ Feil J, Sheppard D, Fitzgerald PB, Yucel M, Lubman DI, Bradshaw JL (2010) Addiction, compulsive

drug seeking, and the role of frontostriatal mechanisms in regulating inhibitory control. Neurosci

Biobehav Rev 35:248-275.

⬧ Franklin TR, Acton PD, Maldjian JA, Gray JD, Croft JR, Dackis CA, O'Brien CP, Childress AR (2002)

Decreased gray matter concentration in the insular, orbitofrontal, cingulate, and temporal cortices of

cocaine patients. Biol Psychiatry 51:134-142.

⬧ Friston KJ (1995) Commentary and opinion: II. Statistical parametric mapping: ontology and current

issues. J Cereb Blood Flow Metab 15:361-370.

⬧ Fuchs RA, Evans KA, Parker MP, See RE (2004) Differential involvement of orbitofrontal cortex

subregions in conditioned cue-induced and cocaine-primed reinstatement of cocaine seeking in rats.

J Neurosci 24:6600-6610.

⬧ Fumagalli F, Moro F, Caffino L, Orru A, Cassina C, Giannotti G, Di Clemente A, Racagni G, Riva

MA, Cervo L (2013) Region-specific effects on BDNF expression after contingent or non-contingent

cocaine i.v. self-administration in rats. Int J Neuropsychopharmacol 16:913-918.

⬧ Gao P, Limpens JH, Spijker S, Vanderschuren LJMJ, Voorn P (2015) Stable immediate early gene

expression patterns in medial prefrontal cortex and striatum after long-term cocaine self-

administration. Addict Biol. doi:10.1111/adb.12330.

Chapter 3

117

⬧ Garavan H, Pankiewicz J, Bloom A, Cho JK, Sperry L, Ross TJ, Salmeron BJ, Risinger R, Kelley D,

Stein EA (2000) Cue-induced cocaine craving: neuroanatomical specificity for drug users and drug

stimuli. Am J Psychiatry 157:1789-1798.

⬧ García-Pardo MP, Roger-Sanchez C, Rodríguez-Arias M, Miñarro J, Aguilar MA (2016)

Pharmacological modulation of protein kinases as a new approach to treat addiction to cocaine and

opiates. Eur J Pharmacol 781:10-24.

⬧ Goldstein RZ, Alia-Klein N, Tomasi D, Carrillo JH, Maloney T, Woicik PA, Wang R, Telang F,

Volkow ND (2009) Anterior cingulate cortex hypoactivations to an emotionally salient task in cocaine

addiction. Proc Natl Acad Sci U S A 106:9453-9458.

⬧ Goldstein RZ, Tomasi D, Rajaram S, Cottone LA, Zhang L, Maloney T, Telang F, Alia-Klein N,

Volkow ND (2007) Role of the anterior cingulate and medial orbitofrontal cortex in processing drug

cues in cocaine addiction. Neuroscience 144:1153-1159.

⬧ Goldstein RZ, Volkow ND (2002) Drug addiction and its underlying neurobiological basis:

neuroimaging evidence for the involvement of the frontal cortex. Am J Psychiatry 159:1642-1652.


findings and clinical implications. Nat Rev Neurosci 12:652-669.

⬧ Graybiel AM, Grafton ST (2015) The striatum: where skills and habits meet. Cold Spring Harb

Perspect Biol 7:a021691.

⬧ Gremel CM, Costa RM (2013) Orbitofrontal and striatal circuits dynamically encode the shift

between goal-directed and habitual actions. Nat Commun 4:2264.

⬧ Heidbreder CA, Groenewegen HJ (2003) The medial prefrontal cortex in the rat: evidence for a

dorso-ventral distinction based upon functional and anatomical characteristics. Neurosci Biobehav

Rev 27:555-579.

⬧ Hollander JA, Im HI, Amelio AL, Kocerha J, Bali P, Lu Q, Willoughby D, Wahlestedt C, Conkright

MD, Kenny PJ (2010) Striatal microRNA controls cocaine intake through CREB signalling. Nature

466:197-202.

⬧ Hyman SE, Malenka RC, Nestler EJ (2006) Neural mechanisms of addiction: the role of reward-

related learning and memory. Annu Rev Neurosci 29:565-598.



146:373-390.

⬧ Jonkman S, Pelloux Y, Everitt BJ (2012a) Differential roles of the dorsolateral and midlateral

striatum in punished cocaine seeking. J Neurosci 32:4645-4650.

⬧ Jonkman S, Pelloux Y, Everitt BJ (2012b) Drug intake is sufficient, but conditioning is not necessary



⬧ Kalivas PW (2008) Addiction as a pathology in prefrontal cortical regulation of corticostriatal habit

circuitry. Neurotox Res 14:185-189.

Chapter 3

118

⬧ Kantak KM, Yager LM, Brisotti MF (2013) Impact of medial orbital cortex and medial subthalamic

nucleus inactivation, individually and together, on the maintenance of cocaine self-administration

behavior in rats. Behav Brain Res 238:1-9.

⬧ Kasanetz F, Deroche-Gamonet V, Berson N, Balado E, Lafourcade M, Manzoni O, Piazza PV (2010)

Transition to addiction is associated with a persistent impairment in synaptic plasticity. Science

328:1709-1712.

⬧ Kasanetz F, Lafourcade M, Deroche-Gamonet V, Revest JM, Berson N, Balado E, Fiancette JF,

Renault P, Piazza PV, Manzoni OJ (2013) Prefrontal synaptic markers of cocaine addiction-like

behavior in rats. Mol Psychiatry 18:729-737.

⬧ Killcross S, Coutureau E (2003) Coordination of actions and habits in the medial prefrontal cortex of

rats. Cereb Cortex 13:400-408.

⬧ Kilts CD, Kennedy A, Elton AL, Tripathi SP, Young J, Cisler JM, James GA (2014) Individual

differences in attentional bias associated with cocaine dependence are related to varying

engagement of neural processing networks. Neuropsychopharmacology 39:1135-1147.

⬧ Kim H, Lee D, Jung MW (2013) Signals for previous goal choice persist in the dorsomedial, but not

dorsolateral striatum of rats. J Neurosci 33:52-63.

⬧ Korhonen R, Moilanen E (2014) Mitogen-activated protein kinase phosphatase 1 as an inflammatory

factor and drug target. Basic Clin Pharmacol Toxicol 114(1):24-36.

⬧ Koob GF, Volkow ND (2010) Neurocircuitry of addiction. Neuropsychopharmacology 35:217-238.

⬧ Larson EB, Akkentli F, Edwards S, Graham DL, Simmons DL, Alibhai IN, Nestler EJ, Self DW (2010)

Striatal regulation of DeltaFosB, FosB, and cFos during cocaine self-administration and withdrawal.

J Neurochem 115:112-122.

⬧ Leshner AI (1997) Addiction is a brain disease, and it matters. Science 278:45-47.

⬧ Letchworth SR, Nader MA, Smith HR, Friedman DP, Porrino LJ (2001) Progression of changes in

dopamine transporter binding site density as a result of cocaine self-administration in rhesus

monkeys. J Neurosci 21:2799-2807.

⬧ Levy D, Shabat-Simon M, Shalev U, Barnea-Ygael N, Cooper A, Zangen A (2007) Repeated

electrical stimulation of reward-related brain regions affects cocaine but not "natural" reinforcement.

J Neurosci 27:14179-14189.

⬧ Limpens JHW, Schut EHS, Voorn P, Vanderschuren LJMJ (2014) Using conditioned suppression to

investigate compulsive drug seeking in rats. Drug Alcohol Depend 142:314-324.

⬧ Limpens JHW, Damsteegt R, Broekhoven MH, Voorn P, Vanderschuren LJMJ (2015)

Pharmacological inactivation of the prelimbic cortex emulates compulsive reward seeking in rats.

Brain Res 1628:210-218.

⬧ Liu HS, Chefer S, Lu H, Guillem K, Rea W, Kurup P, Yang Y, Peoples L, Stein EA (2013)

Dorsolateral caudate nucleus differentiates cocaine from natural reward-associated contextual cues.

Proc Natl Acad Sci U S A 110:4093-4098.

⬧ London ED, Ernst M, Grant S, Bonson K, Weinstein A (2000) Orbitofrontal cortex and human drug

abuse: functional imaging. Cereb Cortex 10:334-342.

Chapter 3

119

⬧ Lu L, Koya E, Zhai H, Hope B, Shaham Y (2006) Role of ERK in cocaine addiction. Trends Neurosci.

29(12):695-703.


dysfunction on cocaine addiction. Nat Neurosci 15:358-366.

⬧ Lucantonio F, Takahashi YK, Hoffman AF, Chang CY, Bali-Chaudhary S, Shaham Y, Lupica CR,

Schoenbaum G (2014) Orbitofrontal activation restores insight lost after cocaine use. Nat Neurosci

17:1092-1099.

⬧ Luijten M, Veltman DJ, van den Brink W, Hester R, Field M, Smits M, Franken IH (2011)

Neurobiological substrate of smoking-related attentional bias. Neuroimage 54:2374-2381.

⬧ Mar AC, Walker AL, Theobald DE, Eagle DM, Robbins TW (2011) Dissociable effects of lesions to

orbitofrontal cortex subregions on impulsive choice in the rat. J Neurosci 31:6398-6404.

⬧ Marhe R, Luijten M, van de Wetering BJ, Smits M, Franken IH (2013) Individual differences in

anterior cingulate activation associated with attentional bias predict cocaine use after treatment.


⬧ McLaughlin J, See RE (2003) Selective inactivation of the dorsomedial prefrontal cortex and the

basolateral amygdala attenuates conditioned-cued reinstatement of extinguished cocaine-seeking

behavior in rats. Psychopharmacology (Berl) 168:57-65.

⬧ Mihindou C, Guillem K, Navailles S, Vouillac C, Ahmed SH (2013) Discriminative inhibitory control of

cocaine seeking involves the prelimbic prefrontal cortex. Biol Psychiatry 73:271-279.

⬧ Miller CA, Marshall JF (2005) Molecular substrates for retrieval and reconsolidation of cocaine-

associated contextual memory. Neuron 47:873-884.

⬧ Murray JE, Belin D, Everitt BJ (2012) Double dissociation of the dorsomedial and dorsolateral

striatal control over the acquisition and performance of cocaine seeking. Neuropsychopharmacology

37:2456-2466.

⬧ Neisewander JL, Baker DA, Fuchs RA, Tran-Nguyen LT, Palmer A, Marshall JF (2000) Fos protein

expression and cocaine-seeking behavior in rats after exposure to a cocaine self-administration

environment. J Neurosci 20:798-805.

⬧ Noonan MP, Walton ME, Behrens TE, Sallet J, Buckley MJ, Rushworth MF (2010) Separate value

comparison and learning mechanisms in macaque medial and lateral orbitofrontal cortex. Proc Natl

Acad Sci U S A 107:20547-20552.

⬧ O'Neill J, Cardenas VA, Meyerhoff DJ (2001) Separate and interactive effects of cocaine and

alcohol dependence on brain structures and metabolites: quantitative MRI and proton MR

spectroscopic imaging. Addict Biol 6:347-361.

⬧ Pascoli V, Turiault M, Lüscher C (2011) Reversal of cocaine-evoked synaptic potentiation resets

drug-induced adaptive behavior. Nature 481(7379):71-75.

⬧ Passetti F, Chudasama Y, Robbins TW (2002) The frontal cortex of the rat and visual attentional

performance: dissociable functions of distinct medial prefrontal subregions. Cereb Cortex 12:1254-

1268.

Chapter 3

120

⬧ Pelloux Y, Dilleen R, Economidou D, Theobald D, Everitt BJ (2012) Reduced forebrain serotonin

transmission is causally involved in the development of compulsive cocaine seeking in rats.


⬧ Pelloux Y, Everitt BJ, Dickinson A (2007) Compulsive drug seeking by rats under punishment:

effects of drug taking history. Psychopharmacology (Berl) 194:127-137.

⬧ Perry JL, Joseph JE, Jiang Y, Zimmerman RS, Kelly TH, Darna M, Huettl P, Dwoskin LP, Bardo MT

(2011) Prefrontal cortex and drug abuse vulnerability: translation to prevention and treatment

interventions. Brain Res Rev 65:124-149.

⬧ Pierce RC, Vanderschuren LJMJ (2010) Kicking the habit: the neural basis of ingrained behaviors in

cocaine addiction. Neurosci Biobehav Rev 35:212-219.

⬧ Porrino LJ, Lyons D (2000) Orbital and medial prefrontal cortex and psychostimulant abuse: studies

in animal models. Cereb Cortex 10:326-333.

⬧ Porrino LJ, Lyons D, Smith HR, Daunais JB, Nader MA (2004) Cocaine self-administration produces

a progressive involvement of limbic, association, and sensorimotor striatal domains. J Neurosci

24:3554-3562.

⬧ Roesch MR, Singh T, Brown PL, Mullins SE, Schoenbaum G (2009) Ventral striatal neurons encode

the value of the chosen action in rats deciding between differently delayed or sized rewards. J

Neurosci 29:13365-13376.

⬧ Rudebeck PH, Murray EA (2011a) Balkanizing the primate orbitofrontal cortex: distinct subregions

for comparing and contrasting values. Ann N Y Acad Sci 1239:1-13.

⬧ Rudebeck PH, Murray EA (2011b) Dissociable effects of subtotal lesions within the macaque orbital

prefrontal cortex on reward-guided behavior. J Neurosci 31:10569-10578.

⬧ Shiflett MW, Balleine BW (2010) At the limbic-motor interface: disconnection of basolateral

amygdala from nucleus accumbens core and shell reveals dissociable components of incentive

motivation. Eur J Neurosci 32:1735-1743.

⬧ Shiflett MW, Balleine BW (2011) Molecular substrates of action control in cortico-striatal circuits.

Prog Neurobiol 95:1-13.

⬧ Smith KS, Graybiel AM (2013) A dual operator view of habitual behavior reflecting cortical and

striatal dynamics. Neuron 79:361-374.

⬧ Stalnaker TA, Roesch MR, Franz TM, Burke KA, Schoenbaum G (2006) Abnormal associative

encoding in orbitofrontal neurons in cocaine-experienced rats during decision-making. Eur J

Neurosci 24:2643-2653.

⬧ Stalnaker TA, Calhoon GG, Ogawa M, Roesch MR, Schoenbaum G (2010) Neural correlates of

stimulus-response and response-outcome associations in dorsolateral versus dorsomedial striatum.

Front Integr Neurosci 4:12.

⬧ Steketee JD (2003) Neurotransmitter systems of the medial prefrontal cortex: potential role in

sensitization to psychostimulants. Brain Res Rev 41:203-228.

⬧ Takaki M, Ujike H, Kodama M, Takehisa Y, Nakata K, Kuroda S (2001) Two kinds of mitogen-

activated protein kinase phosphatases, MKP-1 and MKP-3, are differentially activated by acute and

chronic methamphetamine treatment in the rat brain. J Neurochem 79:679-688.

Chapter 3

121

⬧ Thorn CA, Atallah H, Howe M, Graybiel AM (2010) Differential dynamics of activity changes in

dorsolateral and dorsomedial striatal loops during learning. Neuron 66:781-795.

⬧ Ujike H, Takaki M, Kodama M, Kuroda S (2002) Gene expression related to synaptogenesis,

neuritogenesis, and MAP kinase in behavioral sensitization to psychostimulants. Ann N Y Acad Sci

965:55-67.

⬧ Van den Oever MC, Spijker S, Li KW, Jimenez CR, Koya E, Van der Schors RC, Gouwenberg Y,

Binnekade R, De Vries TJ, Schoffelmeer AN, Smit AB (2006) A proteomics approach to identify

long-term molecular changes in rat medial prefrontal cortex resulting from sucrose self-

administration. J Proteome Res 5:147-154.

⬧ Van De Werd HJ, Uylings HB (2008) The rat orbital and agranular insular cortical areas: a

cytoarchitectonic and chemoarchitectonic study. Brain Struct Funct 212(5):387-401.

⬧ van Kerkhof LWM, Trezza V, Mulder T, Gao P, Voorn P, Vanderschuren LJMJ (2014) Cellular

activation in limbic brain systems during social play behaviour in rats. Brain Struct Funct 219:1181-

1211.

⬧ Vanderschuren LJMJ, Di Ciano P, Everitt BJ (2005) Involvement of the dorsal striatum in cue-

controlled cocaine seeking. J Neurosci 25:8665-8670.


self-administration. Science 305:1017-1019.

⬧ Vanderschuren LJMJ, Minnaard AM, Smeets JAS, Lesscher HMB (2017) Punishment models of

addictive behavior. Curr Opin Behav Sci 13:77-84.

⬧ Veeneman MMJ, Broekhoven MH, Damsteegt R, Vanderschuren LJMJ (2012) Distinct contributions


of cocaine. Neuropsychopharmacology 37:487-498.

⬧ Veeneman MMJ, Damsteegt R, Vanderschuren LJMJ (2015) The nucleus accumbens shell and the

dorsolateral striatum mediate the reinforcing effects of cocaine through a serial connection. Behav

Pharmacol 26:193-199.

⬧ Volkow ND, Fowler JS (2000) Addiction, a disease of compulsion and drive: involvement of the

orbitofrontal cortex. Cereb Cortex 10:318-325.

⬧ Volkow ND, Li TK (2004) Drug addiction: the neurobiology of behaviour gone awry. Nat Rev

Neurosci 5:963-970.

⬧ Volkow ND, Wang GJ, Ma Y, Fowler JS, Wong C, Ding YS, Hitzemann R, Swanson JM, Kalivas P

(2005) Activation of orbital and medial prefrontal cortex by methylphenidate in cocaine-addicted

subjects but not in controls: relevance to addiction. J Neurosci 25:3932-3939.

⬧ Volkow ND, Wang GJ, Telang F, Fowler JS, Logan J, Childress AR, Jayne M, Ma Y, Wong C (2006)

Cocaine cues and dopamine in dorsal striatum: mechanism of craving in cocaine addiction. J

Neurosci 26:6583-6588.

⬧ Wancket LM, Frazier WJ, Liu Y (2012) Mitogen-activated protein kinase phosphatase (MKP)-1 in

immunology, physiology, and disease. Life Sci 90(7-8):237-248.

Chapter 3

122

⬧ Weissenborn R, Robbins TW, Everitt BJ (1997) Effects of medial prefrontal or anterior cingulate

cortex lesions on responding for cocaine under fixed-ratio and second-order schedules of

reinforcement in rats. Psychopharmacology (Berl) 134:242-257.

⬧ Wilcox CE, Teshiba TM, Merideth F, Ling J, Mayer AR (2011) Enhanced cue reactivity and fronto-

striatal functional connectivity in cocaine use disorders. Drug Alcohol Depend 115:137-144.

⬧ Willuhn I, Burgeno LM, Everitt BJ, Phillips PE (2012) Hierarchical recruitment of phasic dopamine

signaling in the striatum during the progression of cocaine use. Proc Natl Acad Sci U S A

109:20703-20708.

⬧ Wilson SJ, Sayette MA, Fiez JA (2004) Prefrontal responses to drug cues: a neurocognitive analysis.

Nat Neurosci 7:211-214.

⬧ Windmann S, Kirsch P, Mier D, Stark R, Walter B, Gunturkun O, Vaitl D (2006) On framing effects in

decision making: linking lateral versus medial orbitofrontal cortex activation to choice outcome

processing. J Cogn Neurosci 18:1198-1211.

⬧ Wong DF, Kuwabara H, Schretlen DJ, Bonson KR, Zhou Y, Nandi A, Brasic JR, Kimes AS, Maris

MA, Kumar A, Contoreggi C, Links J, Ernst M, Rousset O, Zukin S, Grace AA, Lee JS, Rohde C,

Jasinski DR, Gjedde A, London ED (2006) Increased occupancy of dopamine receptors in human

striatum during cue-elicited cocaine craving. Neuropsychopharmacology 31:2716-2727.

⬧ Worsley KJ, Friston KJ (1995) Analysis of fMRI time-series revisited—again. Neuroimage 2(3):173-

81.

⬧ Yin HH, Knowlton BJ (2006) The role of the basal ganglia in habit formation. Nat Rev Neurosci

7:464-476.

⬧ Yin HH, Ostlund SB, Balleine BW (2008) Reward-guided learning beyond dopamine in the nucleus

accumbens: the integrative functions of cortico-basal ganglia networks. Eur J Neurosci 28:1437-

1448.



on the Basal forebrain and recalibration of expression. Neuropsychopharmacology 35:445-463.

⬧ Zapata A, Minney VL, Shippenberg TS (2010) Shift from goal-directed to habitual cocaine seeking

after prolonged experience in rats. J Neurosci 30:15457-15463.

Chapter 3

123

Chapter 4

124

Chapter 4

125

Chapter 4

Heterogeneous neuronal activity in the lateral

habenula after short- and long-term cocaine self-

administration in rats

Ping Gao1,

Henk J. Groenewegen1,

Louk J. M. J. Vanderschuren2,

Pieter Voorn1

1 Department of Anatomy and Neurosciences, VU University Medical Center, Amsterdam, The

Netherlands; Neuroscience Campus Amsterdam, Amsterdam, The Netherlands

2 Department of Animals in Science and Society, Division of Behavioural Neuroscience, Faculty of

Veterinary Medicine, Utrecht University, Utrecht, The Netherland

Eur J Neurosci. 2018;47(1):83-94.

Chapter 4

126

Abstract

Cocaine addiction is thought to be the result of drug-induced functional changes in a neural

network implicated in emotions, learning, and cognitive control. Recent studies have

implicated the lateral habenula (LHb) in drug-directed behaviour, especially its aversive

aspects. Limited cocaine exposure has been shown to alter neuronal activity in the LHb, but

the impact of long-term drug exposure on habenula function has not been determined.

Therefore, using c-fos as a marker, we here examined neuronal activity in LHb in rats that

self-administered cocaine for either 10 or 60 days. Both the density of labeled cells and the

cellular labelling intensity were measured in the lateral (LHbL) and medial (LHbM) parts of

LHb. After 10 days of cocaine self-administration, both the density and intensity of c-fos

positive cells were significantly increased in LHbL, but not LHbM, while after 60 days an

increased density (but not intensity) of labeled neurons in both LHbL and LHbM was

observed. Most c-fos-labeled neurons were glutamatergic. In addition, we found increased

GAD65 expression after 10 but not 60 days of cocaine self-administration in the rostral

mesencephalic tegmental nucleus. These data shed light on the complex temporal dynamics

by which cocaine self-administration alters activity in LHb circuitry, which may play an

important role in the descent to compulsive drug use as a result of prolonged cocaine taking

experience.

Chapter 4

127

Introduction

Drug addiction is a chronic relapsing disorder characterized by loss of control over drug

intake (American Psychiatric Association, 2013). Addiction to substances of abuse is thought

to be caused by functional changes in a neural network implicated in emotions, learning, and

cognitive control (Robinson & Berridge, 2003; Goldstein & Volkow, 2011; Koob, 2013; Piazza

& Deroche-Gamonet, 2013; Volkow & Morales, 2015; Everitt & Robbins, 2016) as a result of

prolonged exposure to drugs (Deroche-Gamonet et al., 2004; Vanderschuren & Everitt,

2004; Pelloux et al., 2007; Jonkman et al., 2012; Vanderschuren & Ahmed, 2013; Limpens et

al., 2014). Brain structures widely implicated in addiction include the prefrontal cortex,

striatum, amygdala and the ventral tegmental area (VTA) (Jentsch & Taylor, 1999; Feil et al.,

2010; Koob & Volkow, 2010; Hearing et al., 2012; Everitt & Robbins, 2016; Oliva & Wanat,

2016). More recently, studies have begun to investigate the role of the lateral habenula (LHb)

in addictive behaviour, and it has been suggested that this structure is important for the

aversive aspects of drug intake (Jhou et al., 2013; Meye et al., 2015; Shelton et al., 2016).

The LHb is a crucial node in the circuitry that connects the limbic basal forebrain with

the monoaminergic cell groups in the mesencephalon, via which the ascending midbrain

dopamine and serotonin projections to the cerebral cortex, basal ganglia and other basal

forebrain regions can be modulated (Herkenham & Nauta, 1979; Araki et al., 1988; Jhou et

al., 2009b; Ji & Shepard, 2007; Matsumoto & Hikosaka, 2007; Hikosaka et al., 2008). Based

on its structure and its afferent and efferent connections, it can be subdivided into a medial

part (LHbM) and a lateral part (LHbL) (Herkenham & Nauta, 1979) that display a complex

subnuclear organization (Andres et al., 1999; Geisler et al., 2003). The medial part collects

more limbic-related inputs whereas the lateral part is more related to basal ganglia

(Herkenham & Nauta, 1977; Kowski et al., 2008). Importantly, LHb can exercise control over

dopaminergic neurons, that have been widely implicated in addictive behaviour (Robinson &

Berridge, 2003; Koob, 2013; Volkow & Morales, 2015; Everitt & Robbins, 2016). LHb exerts

its influence via direct efferents from its medial part to VTA, and indirectly by way of

projections from its lateral part to the rostral mesencephalic tegmental nucleus (RMTg),

which contains GABAergic neurons that, in turn, contact the dopaminergic neurons of VTA

(Jhou et al., 2009a; Kaufling et al., 2009; Omelchenko et al., 2009; Brinschwitz et al., 2010;

Barrot et al., 2012).

Immediate early gene (IEG) studies have reported effects of short-term exposure to

cocaine on LHb function. It is noteworthy that these cellular responses were far from

homogeneous, in that they strongly differed between the lateral and medial compartments of

LHb (Wirtshafter et al., 1994; Kowski et al., 2009; Zahm et al., 2010 ; Zhang et al., 2005).

Chapter 4

128

However, little is known about the effects of prolonged drug exposure, i.e. long-term cocaine

self-administration, on neuronal activation in LHb. Since prolonged drug use is a critical

factor in the precipitation of addiction, we here examined c-fos expression in the LHb in

animals that experienced 10 days (short-term) or 60 days (long-term) of cocaine self-

administration. We compared these cellular activity responses to those after short- or long-

term self-administration of the natural reinforcer sucrose. In view of the LHb’s complex

organization and its considerable length in the sagittal plane, we studied the lateral and

medial subregions of LHb throughout its rostrocaudal extent. Furthermore, in order to

establish possible consequences of changes in habenular neuronal activation for regulation

of VTA function, we assessed GABAergic neuronal activity in the RMTg by quantifying

cellular levels of GAD mRNA. We expected that short-term cocaine self-administration would

lead to activation of glutamatergic neurons in the LHb based on the aversive effects of

cocaine after limited exposure to the drug (Jhou et al., 2013; Meye et al., 2015; Shelton et

al., 2016). For this reason, experiments included double-labelling procedures allowing us to

establish a possible glutamatergic identity of the c-fos expressing neurons. Whether after

prolonged exposure (60 days) there would be (further) changes in the strength of activation

or the pattern of activated neurons is subject of the present study.

Materials and methods

Animals

Male Wistar rats (Charles River, Sulzfeld, Germany) weighing 320-380 gram were housed

individually in Macrolon cages (L= 40 cm, W = 25 cm, H = 18 cm) under controlled conditions

(20−21°C, 55 ± 15% relative humidity) and reversed 12h light - dark cycle (lights on at 19

hrs). Each subject received 20 g laboratory chow (SDS Ltd, UK) per day and free access to

water, which was sufficient to maintain body weight and growth. All experiments were

approved by the Animal Ethics Committee of Utrecht University and were conducted in

agreement with Dutch laws (Wet op de Dierproeven, 1996) and European regulations

(Guideline 86/609/EEC). The new EU directives from 2010 have been implemented into

Dutch law in 2014. The present experiments were initiated under the old (1996) guidelines

and these are valid until January 1, 2018.

Chapter 4

129

Apparatus

Subjects were trained and tested in operant conditioning chambers (L = 29.5 cm, W =

32.5cm, H = 23.5cm; Med Associates, Georgia, VT, USA). The chambers were placed in

light- and sound-attenuating cubicles equipped with a ventilation fan. Each chamber was

equipped with two 4.8 cm wide retractable levers, placed 11.7 cm apart and 6.0 cm from the

grid floor. A cue light (28 V, 100 mA) was present above each active lever and a white house

light (28 V, 100 mA) was located on the opposite wall. Sucrose pellets (45 mg, formula F,

Research Diets, New Brunswick, NJ, USA) were delivered at the wall opposite to the levers

via a dispenser. Cocaine infusions were controlled by an infusion pump placed on top of the

cubicles. During the cocaine self-administration sessions, polyethylene tubing ran from the

syringe placed in the infusion pump via a swivel to the cannula on the animals’ back. In the

operant chamber, tubing was shielded with a metal spring. Experimental events and data

recording were controlled by procedures written in MedState Notation using MED-PC for

Windows.

Surgery

Rats in the cocaine self-administration group were anaesthetized with ketamine

hydrochloride (0.075 mg/kg, i.m) and medetomidine (0.40 mg/kg, s.c.) and supplemented

with ketamine as needed. A single catheter was implanted in the right jugular vein aimed at

the left vena cava. Catheters (Camcaths, Cambridge, UK) consisted of a 22g cannula

attached to silastic tubing (0.012 ID) and fixed to nylon mesh. The mesh end of the catheter

was sutured subcutaneously (s.c.) on the dorsum. Carprofen (50 mg/kg, s.c.) was

administrated once before and twice after surgery. Gentamycin (50 mg/kg, s.c.) was

administered before surgery and for 5 days post-surgery. Animals were allowed 10 days to

recover from surgery.


Rats were trained to self-administer cocaine under a fixed ratio-1 (FR-1) schedule of

reinforcement, as previously published (Veeneman et al., 2012; Gao et al., 2017). During the

self-administration sessions, two levers were present, an active lever and an inactive lever.

The left or right position of the active and inactive levers was counterbalanced for individual

animals. Pressing the active lever resulted in the infusion of 0.25 mg cocaine in 0.1 ml saline

over 5.6 seconds, retraction of the levers and switching off of the house light. During the

Chapter 4

130

infusion, a cue light above the lever was switched on, followed by a 20 sec time-out period

after which the levers were reintroduced and the house light illuminated. The time-out period

was changed to 3 minutes after five training sessions in order to increase the session length.

The session ended after 2 hours or if animals had obtained 40 cocaine infusions, whichever

occurred first. Responding on the inactive lever had no programmed consequences, but was

recorded to assess general levels of activity. After each self-administration session,

intravenous catheters were flushed with a gentamycin-heparin-saline solution to maintain the

patency of the catheters.

The training procedure for the rats in the sucrose group was similar to that for cocaine

self-administration, with the following exception: each response on the active lever resulted

in presentation of a sucrose pellet. Subjects in the control group were also exposed to the

self-administration box. Each response on the active lever resulted in illumination of the cue-

light for 5.6 seconds. With respect to the numbers of animals in experimental groups: in the

10 days experiment, n = 5 in control, n = 5 in sucrose, n = 6 in cocaine groups; in the 60

days experiment, n = 6, in control, n = 6 in sucrose, n = 6 in cocaine groups. For c-fos in situ

hybridization, three animals were excluded (1 control in the 10 days experiment for both

LHbL and LHbM, 1 control in the 60 days experiment for LHbL, 1 cocaine animal in the 10

days experiment for LHbM), in all cases due to damage of tissue sections. For GAD65

mRNA in situ hybridization, n = 4 in control, n = 6 in cocaine groups for both 10 and 60 days-

experiments.

Tissue dissection

After the last training session, rats were moved back to their home cage, and decapitated

after thirty minutes. Brains were quickly removed and immediately frozen in cold isopentane,

then stored at −80 °C. Fourteen micrometer thick coronal sections were cut at −25 °C in a

cryostat (Leica CM 1950) and mounted on SuperFrost®Plus glass slides (Menzel-Glnser,

Braunschweig, Germany) and stored at −80°C.

Probe generation

Probes for c-fos and vGluT2 in situ hybridization were designed using Primer 3 software.

Each primer contained either a T7 or T3 RNA polymerase promoter sequence. A mixture of 4

different vGluT2 probes with similar length was used for detecting vGluT2 mRNA signal. The

full sequences of the primers are as follows:

c-fos: sense 5`- GTAATACGACTCACTATAGGGTCACCCTGCCTCTTCTCAAT -3` and

antisense 5`- AATTAACCCTCACTAAAGGGCACAGCCTGGTGTGTTTCAC -3`, vGluT2 (1):

Chapter 4

131

sense 5`- AATTAACCCTCACTAAAGGG CAACTCACAGCCTTGCTGAA -3` and antisense

5`- GTAATACGACTCACTATAGGGCAGAAGAACGACCCGTGAAT -3`, vGluT2 (2): sense

5`- AATTAACCCTCACTAAAGGGATGCCCCTAGCTGGTATCCT -3` and antisense 5`-

GTAATACGACTCACTATAGGGAGCCAACAACCAGAAGCAGT -3`, vGluT2 (3): sense 5`-

AATTAACCCTCACTAAAGGGACAAGTCCCGTGAAGAATGG -3` and antisense 5`-

GTAATACGACTCACTATAGGGGAATGGCCTGAATGGAAATG -3`, vGluT2 (4): sense 5` -

AATTAACCCTCACTAAAGGGTCAATGAAATCCAACGTCCA -3` and antisense 5`-

GTAATACGACTCACTATAGGGGCAGGTTTATGCTTCGCACT -3`. Probe generation was

started with a total RNA extraction, followed by a cDNA synthesis procedure (Applied

Biosystems, Branchburg, NJ, USA). Specific DNA fragments were produced using Phusion®

High-Fidelity PCR Kit (New England Biolabs, Germany) and the PCR conditions were 98 °C

for 20 seconds, 60 °C for 40 seconds, 72°C for 60 seconds, and a final step at 72°C for 10

minutes. For GAD65 in situ hybridization, pBluescript plasmid that contained 2.3 kb GAD65

DNA and T7 or T3 sequence was kindly supplied by N. Tillakaratne (University of California

Los Angeles) (Erlander et al., 1991). The insert DNA in each clone was amplified by PCR

with T7 and T3 primers. PCR conditions were 93 °C for 60 seconds, 55 °C for 60 seconds,

72 °C for 60 seconds, and a final step at 72°C for 10 minutes. All probes (c-fos, vGluT2,

GAD65) were produced using MAXIscript® T3 ⁄ T7 In Vitro Transcription Kit (Ambion Inc,

Austin, TX, USA). C-fos and GAD65 probes were labeled by incorporating digoxigenin-

labeled UTP, and vGluT2 probes were labeled by Fluorescein-12-UTP (Roche Diagnostics

GmbH, Mannheim, Germany).


For c-fos and GAD65 in situ hybridization (ISH), coronal sections were fixed in 4%

paraformaldehyde, acetylated using acetic anhydride (0.25% acetic anhydride in 1.5%

triethanolamine buffer), delipidated and dehydrated. Digoxigenin-labeled RNA probes (5ng /

section) were applied at 60°C in a humid chamber to hybridize for 16-20 hrs. Post-

hybridization stringency washing was 1x SSC at 60°C (30 min x 2), followed by a RNase A

treatment in 2x SSC buffer at 37°C for 15 min. After another washing in 1x SSC at 60°C (30

min), sections were incubated for 1 hr in 1x SSC at room temperature. Subsequently,

sections were exposed to blocking solution (1.212% TRIS, 0.876% NaCl, 1% blocking

powder, Roche Diagnostics GmbH, Mannheim, Germany) for 1 hr at room temperature, and

incubated with an anti-digoxigenin antibody conjugated with alkaline phosphatase (1:2500)

(Roche Diagnostics GmbH, Mannheim, Germany) at 4 °C overnight. Detection of alkaline

phosphatase activity was performed using BCIP/NBT substrate (Roche Diagnostics GmbH,

Mannheim, Germany) at room temperature. Color development reaction was stopped in

Chapter 4

132

TRIS - NaCl buffer with EDTA (1.212% TRIS, 0.876% NaCl, 0.0372 % EDTA, pH = 7.5),

sections were air-dried and cover-slipped.

For c-fos and vGluT2 double-labeling in situ hybridization, coronal sections were first

hybridized with digoxigenin-labeled c-fos probes (5ng/section) at 60°C overnight. After

washing with 2x SSC buffer, sections were hybridized with fluorescein-labeled vGluT2

probes (5ng / section) at 60°C overnight. The post-hybridization stringency washing steps

were the same as described above for c-fos in situ hybridization. Sections were incubated

with a mix of alkaline phosphatase-conjugated anti-digoxigenin antibody (1:2500, Roche

Diagnostics GmbH, Mannheim, Germany) and anti-Fluorescein-POD antibody (1:1000,

Roche Diagnostics GmbH, Mannheim, Germany) at 4°C overnight with alkaline

phosphatase-conjugated anti-digoxigenin antibody against digoxigenin-labeled c-fos probes

and anti-Fluorescein-POD antibody against fluorescein-labeled vGluT2 probes. Fluorescent

signal was amplified using the Tyramide Signal Amplification (TSA)TM Kit #22 (Ambion,

Austin, TX, USA) by incubating the slides in fluorescein tyramide diluted amplification buffer

(1:100) for 30 minutes, followed by a further amplification step using VECTASTAIN® ABC Kit

(1:200) (Vector Laboratories, Burlingame, CA, USA). Finally, digoxigenin-labeled c-fos signal

was detected using the filtered HNPP/Fast Red TR mix for 2 x 20 minutes at room

temperature. The incubation mix contained 10 µl HNPP stock solution, 10ml Fast Red TR

stock solution and 1ml detection buffer (HNPP/Fast Red TR system, Roche Diagnostics

GmbH, Mannheim, Germany).

Image analysis

Changes in IEG (or GAD65) expression may result in more cells being detected because the

stimulus results in previously undetected cells synthesizing mRNA above detection levels.

However, the existing (detected) population of cells might also produce more mRNA without

significant changes in numbers. For this reason, both the number of c-fos- and GAD65-

positive cells per surface area (i.e. cell density) and individual cellular labeling intensity

(expressed as integrated optical density) were measured. A MCID Elite imaging system

(Interfocus Imaging Ltd., Linton, UK) was used to quantify the numbers and/or individual

labeling intensity of neurons immunopositive for c-fos, GAD65 or VGluT2 mRNA. Coronal

sections of the habenula and RMTg were digitized using an objective magnification of 5X on

a Leica DM/RBE photo-microscope connected to a digital camera (EvolutionTM MP Color

camera, Media Cybernetics, Rockville, Maryland). The segmentation of c-fos and GAD65

positive cells from background was performed using an algorithm combining several point

operators and spatial filters, aimed at detecting local changes in grey level and, thus,

produce a measuring template for objects. Images went through histogram equalization,

Chapter 4

133

smoothing (low-pass filter, kernel size 7X7), and subtraction steps, and positive cells were

detected using size and shape criteria (Gao et al., 2017).

In both the 10- and 60-days experiments, the cell density and labeling intensity of c-

fos positive neurons were plotted against the rostrocaudal level of LHbL and LHbM (see Fig.

3). The mRNA levels of c-fos were examined at 10 levels from rostral to caudal of the LHbL

(approximately from Bregma –2.96 mm to Bregma -4.1 mm) and 13 levels from rostral to

caudal of the LHbM (approximately from Bregma -2.6 mm to Bregma -4.1 mm). The Bregma

positions of each anatomical level are as follows: level 1 = Bregma -2.6 mm, level 2 =

Bregma -2.72 mm, level 3 = Bregma -2.84 mm, level 4 = Bregma -2.96 mm, level 5 =



Bregma -3.85 mm, level 12 = Bregma -3.97 mm, level 13 = Bregma -4.1 mm. Since the very

rostral portion of the LHb consists of only the LHbM (Andres et al., 1999), the analysis of the

LHbL comprises fewer anatomical levels than that of the LHbM. GAD65 mRNA levels were

examined in the RMTg area and expressed as the average of 3 anatomical levels

approximately at Bregma -6.0 mm to Bregma -6.5 mm (Bourdy & Barrot, 2012). Parameters

that were measured include the number of positive cells in each subregion, the subregional

surface area, and the integrated optical density (OD) of labelled cell body (representing

labeling intensity of positive cells). The number of positive cells per region of interest was

expressed as cell density, i.e., number of cells / mm2.

For the analysis of c-fos and vGluT2 mRNA co-expression, coronal section images

(8 levels from Bregma -3.09 mm to Bregma -3.97 mm) were captured using a Leica SP2

confocal laser scanning microscope (Leica Microsystems, Heidelberg, Germany). The

scanning was performed with an objective magnification of 40x, 6 focal planes, and 1 airy

unit of a spatial pinhole. The quality of digital images was improved by 3 times averaging and

the image size was expressed as 512 x 512 pixels. Double-labeled samples were

sequentially scanned at wavelengths of 488nm and 543nm. Fluorescence emission was then

collected in the green and red regions of the spectrum. A MCID Elite imaging system

(Interfocus Imaging Ltd., Linton, UK) was used for the imaging analysis of the maximum

projected images to determine the co-localization of c-fos and vGluT2.


Data was analyzed using SPSS software 20 (IBM, New York, NY, USA). For the analysis of

cocaine/sucrose self-administration behavior, a repeated measures ANOVA was performed

with experimental group (i.e. cocaine self-administration, sucrose self-administration or

control) as a between-subjects factor and self-administration session as a within-subject

http://www.ncbi.nlm.nih.gov/pubmed?term=andres%25252525252525252525252525252525252525252525252525252520kh%2525252525252525252525252525252525252525252525252525255bauthor%2525252525252525252525252525252525252525252525252525255d&cauthor=true&cauthor_uid=10213193

Chapter 4

134

factor. A Greenhouse-Geisser correction was applied when Mauchly's Test of sphericity

indicated that the assumption of sphericity had been violated. To determine the effects of 10

or 60 days of cocaine/sucrose self-administration on c-fos expression, a repeated measures

ANOVA was used with experimental group as a between-subjects factor and rostrocaudal

level as a within-subject factor. Parameters measured included cell density (the number of c-

fos positive cells/mm2) and labeling intensity (the integrated optical density) of each individual

cell body. Comparison of c-fos ISH after 10 and 60 days of cocaine self-administration was

done by normalizing the data from the cocaine groups to controls per rostrocaudal level and

applying Student’s t-test at each anatomical level. In addition, Student’s t-test was used to

test for differences in the percentages of cells in the LHbL co-expressing c-fos and vGluT2

after 10 and 60 days of cocaine self-administration. Finally, to determine the effects of

cocaine self-administration on the GAD65 mRNA levels in RMTg, the cell density and the

cellular labeling intensity of GAD65 positive neurons were analyzed by two-way ANOVA with

experimental group and self-administration duration as between-subjects factors. Same as

for c-fos, comparison of GAD65 ISH after 10 and 60 days of cocaine self-administration was

done by normalizing the data from the cocaine groups to controls.

Results

Cocaine and sucrose self-administration behaviour

Rats were trained to self-administer cocaine or sucrose for either 10 or 60 days (Fig. 1).

Responding on the active lever differed as a function of group and session in both the 10-day

(Fgroup (2, 13) = 25.07, p < 0.001; Fsession (3.63, 47.2) = 1.74, p = 0.162; Fgroup x session (7.27,

47.2) = 8.04, p < 0.001) and 60-day experiments (Fgroup (2, 15) = 181.9, p < 0.001; Fsession

(6.97, 104.5) = 6.28, p < 0.001; Fgroup x session (13.94, 104.5) = 3.67, p < 0.001) (Fig. 1). Post-

hoc analysis showed that the number of rewards obtained in the sucrose group was

significantly higher than that in the control and the cocaine groups in both experiments (both

p < 0.001). In the 60-day but not the 10-day experiment, the cocaine group obtained more

rewards than the control group (10 days: p = 0.113; 60 days: p < 0.001). When the numbers

of active lever presses between the first and the final administration sessions were

compared, significant increases were seen in the cocaine group (10 days: t = −7.96, df = 10,

p < 0.001; 60 days: t = -10.30, df = 10, p < 0.001), but not in the sucrose group (10 days: t =

−1.53, df = 4.01, p = 0.20; 60 days: t = -0.77, df = 5, p = 0.48), whereas the number of active

lever presses declined from the first to the final session in the control group in the 10-day (t =

3.54, df = 8, p = 0.008), but not in the 60-day experiment (t = −1.13, df = 10, p = 0.282) (Fig.

Chapter 4

135

1). The average number of active lever presses was significantly higher than the number of

inactive responses in the cocaine (10 days: t = 6.02, df = 9.87, p < 0.001; 60 days: t = 34.72,

df = 93.7, p < 0.001) and sucrose self-administration groups (10 days: t = 16.03, df = 18, p<

0.001; 60 days: t = 60.62, df = 75.33, p < 0.001) (data not shown). In the control group, no

differences were seen between the number of active and inactive lever presses in either

experiment (10 days: t = −0.72, df = 18, p = 0.482; 60 days: t = 1.82, df = 118, p = 0.071)

(data not shown).

Fig. 1. Short-term (10 days, A) vs. long-term (60 days, B) self-administration of cocaine or sucrose.

Data is presented as mean ± SEM number of active lever presses over animals per group.

Cocaine self-administration induces c-fos expression in lateral habenula

Lateral part of lateral habenula

Animals were killed and the tissue was collected for c-fos visualization 30 minutes after the

final training session. The structure of LHb varies from rostral to caudal, with LHbM present

through the whole structure while LHbL occurring more caudally (Fig. 2). The distribution of

c-fos ISH signal in LHb showed a heterogeneous pattern through the rostral-caudal extent,

but also differed between the medial and lateral parts in specific portions (Fig. 2). In the

sucrose and control groups, the c-fos signal in the LHb was generally very low. By contrast,

Chapter 4

136

in the cocaine self-administration group we observed two groups of cells in the LHb. In most

cases the group with stronger signals was located in the LHbL (Fig. 2 B-C). The density of

labeled neurons in the LHbL increased from the rostral to the mid-rostrocaudal levels of the

structure (approximately from Bregma -3.21 mm to Bregma -3.97 mm) and then decreased

again to low levels in the most caudal part of the LHbL after cocaine self-administration (Fig.

3). This was observed in both the 10- (Fgroup (2, 12) = 81.95, p < 0.001; Flevel (2.27, 27.20) =

3.14, p = 0.054; Fgroup x level (4.53, 27.20) = 4.15, p = 0.008) (Fig. 2, Fig. 3 A) and the 60-day

experiment (Fgroup (2, 14) = 22.38, p < 0.001; Flevel (2.14, 30.02) = 3.94, p = 0.028; Fgroup x level

(4.29, 30.02) = 3.75, p = 0.012) (Fig. 3 B). Post-hoc tests revealed that the density of c-fos-

labeled cells was significantly enhanced in the cocaine group compared to the control and

Fig.2. Representative micrographs of c-fos hybridized sections in habenula. Two subregions including

medial habenula (MHb) and medial part of lateral habenula (LHbM) are present throughout the

rostral-caudal axis of habenula (A-D), whereas the lateral part of lateral habenula (LHbL) is present

more caudally (B-D). Ten days of cocaine self-administration had no effects on c-fos expression in the

most rostral and caudal level of LHb (A and D; A, Bregma -2.72 mm, level 2; D, Bregma -4.1 mm,

level 13), but increased c-fos ISH signal in the mid-rostrocaudal portion (B and C; B, Bregma -3.21

mm, level 6; C, Bregma -3.59 mm, level 9). Scale bar: 200µm in A-D.

Chapter 4

137

Fig. 3. Changes in density and labeling intensity of c-fos positive cells along the rostrocaudal axis in

the lateral part of lateral habenula (LHbL) after cocaine or sucrose self-administration. Left panels

(A, C) show results after 10 days self-administration, right panels (B, D) after 60 days self-

administration. X-axis represents anatomical levels from rostral to caudal in A-D. Differences in the

density of c-fos positive cells between 10 days cocaine and 60 days cocaine groups were compared at

six anatomical levels (E). Values are presented as mean ± SEM cell density or optical density. * p <

0.05, significant difference between cocaine and control/sucrose groups.

Chapter 4

138

sucrose groups in both the 10 days (p < 0.001) and 60 days experiments (p < 0.001). No

differences were found between the control and sucrose groups. In the 10-day experiment,

differences between cocaine and the other two groups were found at rostrocaudal levels 6-

12 (approximately from Bregma -3.21 mm to Bregma -3.97 mm) in the LHbL (cocaine vs.

control: level 6, p = 0.006; level 7, p = 0.009; level 8, p < 0.001; level 9, p < 0.001; level 10, p

< 0.001; level 11, p = 0.033; level 12, p = 0.005; cocaine vs. sucrose: level 6, p = 0.014; level

7, p = 0.004; level 8, p < 0.001; level 9, p < 0.001; level 10, p < 0.001; level 11, p = 0.04;

level 12, p = 0.006). In the 60-day experiment, the cocaine group differed from the control

and sucrose groups at levels 7-12 (approximately from Bregma -3.34 mm to Bregma -3.97

mm) (cocaine vs. control: level 7, p = 0.012; level 8, p < 0.001; level 9, p < 0.001; level 10, p

= 0.028; level 11, p = 0.005; level 12, p < 0.001; cocaine vs. sucrose: level 7, p = 0.009; level

8, p < 0.001; level 9, p < 0.001; level 10, p = 0.028; level 11, p = 0.005; level 12, p < 0.001)

(Fig. 3 A-B). Taken together, both 10 and 60 days of cocaine self-administration evoked an

increased density of c-fos positive neurons in the LHbL that displayed a rostrocaudal

gradient with a peak in cell numbers at level 8 (Bregma -3.46 mm).

As the density of c-fos positive cells was increased at levels 7-12 in the LHbL after

both short- and long-term cocaine self-administration, we further analyzed whether the

cocaine-induced increases in density of c-fos positive neurons differed between the 10- and

60-days experiments at these levels. Student’s t-test showed that at two levels, cocaine

exposure-induced increases in the density of c-fos neurons were significantly higher after 10

days than after 60 days (level 8: t = 3.05, df = 10, p = 0.012; level 10: t = 3.42, df = 10, p =

0.007) (Fig. 3 E). No differences were seen between the experiments at the other four levels

(level 7: t = 0.27, df = 10, p = 0.799; level 9: t = 0.07, df = 10, p = 0.945; level 11: t = 0.72, df

= 10, p = 0.489; level 12: t = 0.58, df = 10, p = 0.574) (Fig. 3 E).

For the cellular labeling intensity of c-fos positive cells in the LHbL, there was a main

effect of group and anatomical level (Fgroup (2, 12) = 8.11, p = 0.006; Flevel (3.91, 46.94) =

2.95, p = 0.031) after 10 days of self-administration. However, the interaction between group

and anatomical level was not significant (Fgroup x level (7.82, 46.94) = 1.48, p = 0.193) (Fig. 3

C). Post-hoc testing showed that the density of c-fos positive cells in the cocaine group was

significantly higher than that in the control (p = 0.044) and sucrose groups (p = 0.006). When

animals were exposed to cocaine or sucrose for 60 days, neither the group nor the

anatomical level had a significant main effect on the intensity of c-fos positive cells (Fgroup (2,

14) = 1.77, p = 0.207; Flevel (3.58, 50.08) = 1.14, p = 0.347; Fgroup x level (7.15, 50.08) = 0.74, p

= 0.639) (Fig. 3 D). To summarize, 10 days of cocaine self-administration increased the

labeling intensity of c-fos positive cells in the LHbL, but no changes were observed after 60

days of cocaine self-administration.

Chapter 4

139

Medial part of lateral habenula

After 10 days of self-administration, there were no differences in the density of c-fos labeled

neurons between the experimental groups, although c-fos cell density differed as a function

of anatomical level (Fgroup (2, 11) = 2.89, p = 0.098; Flevel (3.90, 42.93) = 3.82, p = 0.01; Fgroup x

level (7.80, 42.93) = 1.79, p = 0.107) (Fig. 2, Fig. 4 A). After 60 days of cocaine self-

administration, there was an increase in the density of c-fos positive cells in the LHbM as a

function of anatomical level (Fgroup (2, 15) = 11.06, p = 0.001; Flevel (5.34, 80.06) = 3.18, p =

0.01; Fgroup x level (10.67, 80.06) = 3.25, p = 0.001) (Fig. 4 B). Post-hoc tests revealed that 60

days of cocaine exposure significantly enhanced the density of c-fos positive cells in the

LHbM compared to the control (p = 0.001) and the sucrose (p = 0.002) groups (Fig. 4 B). The

differences between cocaine and the other two groups were seen at rostrocaudal levels 7-9

Fig. 4. Changes in density and labeling intensity of c-fos positive cells along the rostrocaudal axis in

the medial part of lateral habenula (LHbM) after cocaine or sucrose self-administration. Left panels

(A, C) show results after 10 days self-administration, right panels (B, D) after 60 days self-

administration. X-axis represents 13 anatomical levels from rostral to caudal. Values are presented as

mean ± SEM cell density or optical density. * p < 0.05, significant difference between cocaine and

control/sucrose groups.

Chapter 4

140

(cocaine vs. control: level 7, Bregma -3.34, p = 0.003; level 8, Bregma -3.46, p < 0.001; level

9, Bregma -3.59, p = 0.002; cocaine vs. sucrose: level 7, p = 0.048; level 8, p < 0.001; level

9, p = 0.005) (Fig. 4 B). Since the 60 days of cocaine self-administration significantly

increased the density of c-fos positive cells at 3 levels (7-9) in LHbM, we further examined

whether this effect was different from that after 10 days at these levels. Student’s t-test

showed no significant differences between 10 and 60 days of cocaine self-administration

(level 7: t = -2.01, df = 10, p = 0.073; level 8: t = 0.31, df = 10, p = 0.77; level 9: t = -1.94, df =

6.36, p = 0.098). In summary, 60 days, but not 10 days of cocaine self-administration

enhanced the density of c-fos positive cells in the LHbM.

Cocaine or sucrose self-administration did not affect the labelling intensity of c-fos

positive neurons in the LHbM, although there were minor rostrocaudal differences (10 days:

Fgroup (2, 11) = 2.53, p = 0.124; Flevel (5.38, 59.22) = 2.59, p = 0.031; Fgroup x level (10.77, 59.22)

= 1.43, p = 0.185; 60 days: Fgroup (2, 15) = 0.73, p= 0.50; Flevel (3.77, 56.52) = 1.88, p = 0.130;

Fgroup x level (7.54, 56.52) = 0.85, p = 0.561) (Fig. 4 C-D).

Fig. 5. Double-labeling in situ hybridization of c-fos mRNA (red in A) and vGluT2 mRNA (green in B)

and the merged images (C) in the lateral part of lateral habenula (LHbL) after 10 days of cocaine

self-administration. “Arrows” point to examples of cells that are both c-fos and vGluT2 positive. D.

Percentages of c-fos positive cells expressing vGluT2 in LHbL after 10 and 60 days of cocaine self-

administration. Scale bar: 75µm in A-C.

Chapter 4

141

The majority of c-fos positive neurons in the LHbL is glutamatergic

To test whether the c-fos positive cells that were induced by the cocaine self-administration

were glutamatergic, we performed a double in situ hybridization for c-fos and vGluT2. As

shown in figure 5 A-C, most of the c-fos-positive cells in the LHbL expressed vGluT2 mRNA.

After 10 days cocaine exposure, 75.5% ± 1.7% c-fos-labeled cells were vGluT2 positive, and

75.7% ± 2.4% were vGluT2 positive after 60 days of cocaine self-administration (Fig. 5 D).

There were no differences in the percentage of c-fos-labeled cells that expressed vGluT2

between the 10- and 60-days cocaine groups (t = −0.051, df = 4, p = 0.962). The identity of

the vGluT2-negative c-fos-labeled cells was not established. The latter cells might have a

different phenotype; however, they might also produce low levels of VGlut2 that – in our

hands – remained under the detection limit of the double-labeling procedure. Evidence in

literature suggests that a GABAergic phenotype is not very likely (Brinschwitz et al., 2010, Li

et al., 2011, Aizawa et al., 2012).

Increases of GAD mRNA in RMTg after 10 days but not 60 days cocaine SA

The density and labeling intensity of GAD65-positive cells in RMTg were compared between

the cocaine-exposed groups and control. The sucrose groups were omitted because sucrose

self-administration did not affect c-fos expression in the habenula. Ten days of cocaine self-

administration increased the GAD65 ISH signals in RMTg (Fig. 6 B), when compared to the

control group (Fig. 6 A). In contrast, after 60 days of cocaine self-administration, no obvious

differences were observed between the control and the cocaine group (Fig. 6 C-D). Two-way

ANOVA demonstrated that the cocaine-induced increases in the density of GAD65-neurons

were affected by the duration of self-administration (Fgroup (1, 16) = 3.93, p = 0.065; Fduration (1,

16) = 11.02, p = 0.004; Fgroup x duration (1, 16) = 11.04, p = 0.004). Post-hoc tests revealed that,

compared to control, the density of GAD65-positive cells increased significantly in the

cocaine group in the 10-day experiment (t = -4.19, df = 7.40, p = 0.004), but not in the 60-day

experiment (t = -0.98, df = 8, p = 0.354) (Fig. 6 E). In addition, the density of GAD65-positive

neurons in the 10 days cocaine group was higher than that in the 60-days-cocaine group (t =

4.53, df = 10, p = 0.001) (Fig. 6 E).

The labelling intensity of the GAD65 positive cells in the RMTg was also affected by

cocaine self-administration in a manner that depended upon self-administration experience

(Fgroup (1, 16) = 19.06, p < 0.001; Fduration (1, 16) = 14.25, p = 0.002; Fgroup x duration (1, 16) =

14.3, p = 0.002). Post-hoc tests revealed that after 10 days of self-administration, the

intensity of GAD65-labeled cells was significantly increased in the cocaine group (t = 5.14, df

= 8, p = 0.001). After 60 days of self-administration, there was no difference between the

Chapter 4

142

cocaine self-administration and the control groups (t = 0.49, df = 8, p = 0.644). In addition,

the intensity of GAD65-positive neurons in the 10 days cocaine group was significantly

higher than that in the 60 days cocaine self-administration group (t = 6.05, df = 10, p < 0.001)

(Fig. 6 F). In summary, 10 days of cocaine self-administration significantly increased both the

density and the labeling intensity of GAD65-positive cells in RMTg, while after 60 days no

differences were seen between the cocaine and the control groups.

Fig. 6. Changes in GAD-65 expression in RMTg after short- or long-term cocaine self-administration.

Four representative micrographs of hybridized coronal sections show immunostaining of GAD-65

probe after 10 days of cocaine self-administration in the control (A) and cocaine (B) groups and after

60 days in controls (C) and cocaine-exposed animals (D). The density (E) and labeling intensity (F) of

GAD-65 positive cells in RMTg are expressed as mean ± SEM percentage of control. * p < 0.05,

significant difference between groups. Scale bar: 200µm in A-D.

Chapter 4

143

Discussion

The aim of the present study was to examine the consequences of prolonged drug taking on

neuronal activity in subregions of the LHb. Increased expression of c-fos was primarily found

in the lateral part of the LHb after both short -and long-term self-administration of cocaine.

The cocaine-exposed animals not only displayed a higher number of c-fos positive neurons

in the LHb but also enhanced response intensity of the individual reactive cells. The increase

in reactive cell numbers was similar after short- and long-term cocaine self-administration.

However, the augmented cellular response intensity was no longer significant after 60 days

of cocaine taking. Cocaine self-administration did not alter cellular reactivity in the LHbM

after short-term drug taking, but after 60 days of self-administration, an increase in the

number of c-fos positive cells was found in the LHbM. Interestingly, the distribution of c-fos

positive cells was far from homogeneous since most reactive neurons were located in the

mid-rostrocaudal part of habenula. The majority of activated neurons in the LHbL was

vGluT2-positive, that is, glutamatergic, after both 10 and 60 days of cocaine self-

administration. Furthermore, in the RMTg, which is a principal output structure of the LHb,

both the number of GABAergic cells and their individual response intensity were upregulated

after short-term but not after long-term cocaine self-administration. Together, these data

reveal the complex temporal dynamics by which cocaine self-administration alters activity in

LHb circuitry, which may play an important role in the underlying mechanisms of drug taking

with prolonged cocaine use experience.

Heterogeneous neuronal activation in LHb

c-fos neurons in the present report displayed a highly heterogeneous distribution that was

first and foremost characterized by a gradient with a peak in the numbers of c-fos positive

neurons in the LHbL and LHbM centering at (approximately) Bregma levels -3.32mm to -

3.72mm. This response pattern may be related to the subnuclear organization of the LHb,

although a clear distinction between subnuclei cannot be made on basis of rostrocaudal

location (Andres et al., 1999; Geisler et al., 2003). Besides size and shape of the habenular

subnuclei, differences that were found along the rostrocaudal extent of LHb in (immuno-)

histochemical characteristics indicative of differences in cellular phenotype may be related to

the present heterogeneous functional response to cocaine self-administration (Geisler et al.,

2003).

Comparison of the rostro-caudal response pattern of c-fos expression after cocaine

self-administration with structural connectivity of LHb does not readily reveal a resemblance.

Chapter 4

144

Whereas Goncalves et al. (2012) found projections from LHb to VTA to originate mainly from

medial and caudal regions, Petzel et al. (2017) in the rat and Quina et al. (2015) in the

mouse demonstrated projections to VTA and raphe nuclei that are widely distributed

throughout the LHb’s rostrocaudal extent. With respect to dopaminergic input, the dopamine

transporter – a primary target of cocaine – has been shown to be primarily expressed in the

parvocellular and central subnuclei of the medial division of the lateral habenular complex

which are found along the rostrocaudal length of LHb (Geisler et al., 2003).

In a number of previous studies, a differentiation in the activation of the lateral and

medial parts of LHb has been described. For example, following the systemic administration

of dopamine receptor agonists, neurons were activated only in the LHbL (Wirtshafter et al.,

1994; Kowski et al., 2009). Interestingly, short-term (i.e., one of six sessions) cocaine self-

administration has been found to increase c-fos expression in both LHbL and in LHbM (Zahm

et al., 2010). In the latter study, the response in the LHbL was comparable between one and

six sessions, whereas the response in the LHbM declined between the first and sixth cocaine

self-administration session. In the present study, we observed two clusters of c-fos-labelled

cells in the LHb after cocaine self-administration, with the larger one situated in the LHbL and

the smaller one in the LHbM (see Fig. 2). The activational response was much stronger in

LHbL than LHbM. Comparison with the subnuclear organization of LHb as described by

Andres et al. (1999) suggests that the larger cluster of c-fos positive cells in the LHbL in our

study is situated in the oval part of the LHbL (LHbLO); the smaller cluster of activated

neurons in the LHbM is presumably located in the parvocellular and/or the central part of the

LHbM (LHbMPc and/or LHbMC) (Andres et al., 1999). Unfortunately, due to technical

restrictions, we were not able to relate the location of the activated neurons precisely to the

fine subnuclear division (Andres et al., 1999, Geisler et al., 2003).

The more global medial-lateral division of the LHb as demonstrated in our study

appears relevant in the context of organization of the afferent and efferent connections of the

habenula (Lecourtier & Kelly, 2007). Neuroanatomical tracing studies have shown that the

LHbM predominantly receives afferents from limbic-related areas such as the lateral preoptic

and lateral hypothalamic areas, whereas the LHbL collects primarily inputs from the

entopeduncular nucleus (Herkenham & Nauta, 1977; Lecourtier & Kelly, 2007; Hikosaka et

al., 2008). Thus, the strongest response to cocaine self-administration in the present

paradigm occurred in the basal ganglia-related portion of the LHb. As regards its efferents,

the LHb is known to issue fibres to VTA, the substantia nigra complex and adjacent

tegmental nuclei, as well as to the raphe nuclei and the lateral hypothalamus (Herkenham &

Nauta, 1979; Barrot et al., 2012). Direct projections from LHb to the dopaminergic VTA

originate predominantly in the LHbM, as do efferents to the 5HT system (Goncalves et al.,

2012; Proulx et al. 2014; Sego et al., 2014). However, with respect to efferent control over

Chapter 4

145

dopaminergic cell groups, LHb projections - arising from its lateral part - primarily target the

rostral midbrain tegmental nucleus (RMTg), which forms a GABAergic intermediate between

the habenula and the dopaminergic neurons in the VTA (Jhou et al., 2009b; Kaufling et al.,

2009; Omelchenko et al., 2009; Brinschwitz et al., 2010; Balcita-Pedidino et al., 2011; Proulx

et al., 2014). The enhanced c-fos expression in the present experiments that was observed

in LHbL and LHbM therefore signifies a stronger influence on different aspects of reward

processing involving dopaminergic and serotoninergic mechanisms after cocaine self-

administration (see Proulx et al., 2014, for review). Our finding that upregulation of c-fos was

more robust in the LHbL suggests an important effect on dopaminergic neurotransmission.

That is, increased output of the LHbL may reduce firing activity of dopaminergic neurons via

its glutamatergic projections to the GABAergic neurons in RMTg. Indeed, a glutamatergic

identity could be established for the majority of c-fos neurons in the present experiments, as

could an augmentative effect on GAD65 expression in RMTg. The latter findings are in line

with the cocaine-induced c-fos activation that has been reported in the LHbL-to-RMTg

projections (Jhou et al., 2013).

Neuronal activity in LHb after short and long-term cocaine use

Cocaine has been shown to both decrease and increase the firing rate of LHb neurons, with

the inhibitory effect preceding excitation (see Lecca et al., 2014 for review). The increase in

firing frequency may be prolonged and this response is likely related to the c-fos activation

seen in the present study and in other work (Jhou et al., 2013). Previous reports have shown

that exposure to cocaine, through stimulation of dopamine receptors, increases glutamate

function in the LHb (Maroteaux & Mameli, 2012; Jhou et al., 2013; Zuo et al., 2013; Meye et

al., 2015; Neumann et al., 2015), which then leads to changes in post-synaptic AMPA

receptor function (Maroteaux & Mameli 2012; Meye et al., 2015). This provides a likely

underlying mechanism for the increases in c-fos expression observed in the present study.

As LHb neurons are excited by aversive states and inhibited by unexpected

rewarding events, their activation thus results in inhibition of dopaminergic neurons and

suppression of appetitive behaviour (Matsumoto & Hikosaka, 2009; Bromberg-Martin et al.,

2010a, b; Bromberg-Martin & Hikosaka, 2011). Interestingly, also activation of the direct

pathway from LHb to VTA appears to have aversive effects (Lammel et al., 2012). This

means that the over-activity in LHb after cocaine self-administration that was observed in the

present study likely represents increased inhibition of dopaminergic neurons, a process that

may be associated with aversive effects evoked by cocaine. Dopaminergic and glutamatergic

mechanisms in the habenula - besides playing a likely role in the observed increase in c-fos

expression - have been shown to be involved in the aversive effects of cocaine exposure

Chapter 4

146

(Jhou et al., 2013; Meye et al., 2015; Shelton et al., 2016). Moreover, it has been

demonstrated that intact LHb function is necessary for rats to inhibit responding to cocaine-

associated cues when it is signalled that cocaine is not available (Mahler & Aston-Jones,

2012; Zapata et al., 2017), although there is no evidence that the habenula is involved in

punished cocaine seeking (see Jean-Richard-Dit-Bressel & McNally, 2014; Zapata et al.,

2017). Thus, the LHb may subserve the ability to inhibit drug use on the basis of internal

(aversive- or expected aversive effects of the drug) or external stimuli (indicating

unavailability of cocaine).

Importantly, prolonged cocaine exposure has been shown to result in impaired

function of the LHb and its outputs (Meshul et al., 1998; see also Zahm et al., 2010; Lax et

al., 2013). In the context of these data, our findings suggest that the influence of the LHb

over cocaine use changes with prolonged drug taking experience. In early stages of drug use

(i.e., after 10 days of self-administration), the lateral portion of the LHb, perhaps by its output

to the RMTg, may serve to control drug intake by encoding its negative aspects. After

extensive cocaine taking experience, however, the LHb involvement shifts somewhat to its

medial portion and the LHbL-RMTg projection becomes disengaged, as evidenced by the

fact that increased GAD expression in the RMTg was found after 10 days of self-

administration only. As a result, the influence of aversive aspects of drug use on behaviour

may decline, which provides a neural pathway by which cocaine taking becomes less

sensitive to adversity (Deroche-Gamonet et al., 2004; Vanderschuren & Everitt 2004;

Vanderschuren & Ahmed 2013; for reviews see Vanderschuren et al., 2017). The latter is a

hallmark of addictive behaviour. Future behavioural studies should directly investigate this

possibility and, in the process, should establish the hypothesized causal relationship

between LHbL activation and GABAergic activity in RMTg.

In conclusion, the present study demonstrates a strongly heterogeneous neuronal

activation pattern in LHb after cocaine self-administration. After short-term cocaine exposure,

increased neuronal activity predominated in the basal ganglia-related LHbL, whereas after

long-term cocaine self–administration, the limbic-related LHbM became more engaged. We

speculate that this process leads to increased LHb output to RMTg after short-term drug

exposure resulting in enhanced inhibitory control over mesencephalic dopaminergic cells and

that this effect abates after long-term drug use. Our finding of increased metabolic activity in

the RMTg after 10 days of self-administration but not after 60 days supports this conjecture.

Since the LHb is implicated in the processing of negative emotional stimuli, signalling

aversive states related to cocaine taking may be attenuated after prolonged drug use,

possibly leading to diminished reluctance to engage in drug self-administration.

Chapter 4

147

References

⬧ Aizawa H, Kobayashi M, Tanaka S, Fukai T, Okamoto H (2012) Molecular characterization of the

subnuclei in rat habenula. J. Comp. Neurol. 520, 4051-4066.

⬧ American Psychiatric Association (2013) Diagnostic and Statistical Manual of Mental Disorders.

Fifth Edition (DSM-5). American Psychiatric Association, Washington, DC, USA.

⬧ Andres KH, von During M, Veh RW (1999) Subnuclear organization of the rat habenular complexes.

J. Comp. Neurol. 407, 130-150.

⬧ Araki M, McGeer PL, Kimura H (1988) The efferent projections of the rat lateral habenular nucleus

revealed by the PHA-L anterograde tracing method. Brain Res. 441, 319-330.

⬧ Balcita-Pedicino JJ, Omelchenko N, Bell R, Sesack SR (2011) The inhibitory influence of the lateral

habenula on midbrain dopamine cells: ultrastructural evidence for indirect mediation via the

rostromedial mesopontine tegmental nucleus. J. Comp. Neurol. 519, 1143-1164.

⬧ Barrot M, Sesack SR, Georges F, Pistis M, Hong S, Jhou TC (2012) Braking dopamine systems: a

new GABA master structure for mesolimbic and nigrostriatal functions. J. Neurosci. 32, 14094-

14101.

⬧ Bourdy R, Barrot M (2012) A new control center for dopaminergic systems: pulling: the VTA by the

tail. Trend. Neurosci., 35, 681-690.

⬧ Brinschwitz K, Dittgen A, Madai VI, Lommel R, Geisler S, Veh RW (2010) Glutamatergic axons from

the lateral habenula mainly terminate on GABAergic neurons of the ventral midbrain. Neuroscience,

168, 463-476.

⬧ Bromberg-Martin ES, Hikosaka O (2011) Lateral habenula neurons signal errors in the prediction of

reward information. Nat. Neurosci. 14, 1209-1216.

⬧ Bromberg-Martin ES, Matsumoto M, Hikosaka O (2010a) Distinct tonic and phasic anticipatory

activity in lateral habenula and dopamine neurons. Neuron. 67, 144-155.

⬧ Bromberg-Martin ES, Matsumoto M, Hikosaka O (2010b) Dopamine in motivational control:

rewarding, aversive, and alerting. Neuron. 68, 815-834.

⬧ Deroche-Gamonet V, Belin D, Piazza PV (2004) Evidence for addiction-like behavior in the rat.

Science. 305, 1014-1017.

⬧ Erlander MG, Tillakaratne NJ, Feldblum S, Patel N, Tobin AJ (1991) Two genes encode distinct

glutamate decarboxylases. Neuron. 7, 91-100.


Years On. Annu. Rev. Psychol. 67, 23-50.

⬧ Feil J, Sheppard D, Fitzgerald PB, Yucel M, Lubman DI, Bradshaw JL (2010) Addiction, compulsive

drug seeking, and the role of frontostriatal mechanisms in regulating inhibitory control. Neurosci.

Biobehav. Rev. 35, 248-275.

⬧ Gao P, de Munck JC, Limpens JHW, Vanderschuren LJMJ, Voorn P (2017) A neuronal activation

correlate in striatum and prefrontal cortex of prolonged cocaine intake. Brain Struct. Funct., doi:

10.1007/s00429-017-1412-4.

Chapter 4

148

⬧ Geisler S, Andres KH, Veh RW (2003) Morphologic and cytochemical criteria for the identification

and delineation of individual subnuclei within the lateral habenular complex of the rat. J. Comp.

Neurol. 458, 78-97.


findings and clinical implications. Nat. Rev. Neurosci. 12, 652-669.

⬧ Goncalves L, Sego C, Metzger M (2012) Differential projections from the lateral habenula to the

rostromedial tegmental nucleus and ventral tegmental area in the rat. J. Comp. Neurol. 520, 1278-

1300.

⬧ Hearing MC, Zink AN, Wickman K (2012) Cocaine-induced adaptations in metabotropic inhibitory

signaling in the mesocorticolimbic system. Rev. Neurosci. 23, 325-351.

⬧ Herkenham M, Nauta WJ (1977) Afferent connections of the habenular nuclei in the rat. A

horseradish peroxidase study, with a note on the fiber-of-passage problem. J. Comp. Neurol. 173,

123-146.

⬧ Herkenham M, Nauta WJ (1979) Efferent connections of the habenular nuclei in the rat. J. Comp.

Neurol. 187, 19-47.

⬧ Hikosaka O, Sesack SR, Lecourtier L, Shepard PD (2008) Habenula: crossroad between the basal

ganglia and the limbic system. J. Neurosci. 28, 11825-11829.

⬧ Jean-Richard-Dit-Bressel P, McNally GP (2014) The role of the lateral habenula in punishment.

PLoS One. 9, e111699.


implications for the control of behavior by reward-related stimuli. Psychopharmacology (Berl), 146,

373-390.

⬧ Jhou TC, Fields HL, Baxter MG, Saper CB, Holland PC (2009a) The rostromedial tegmental nucleus

(RMTg), a GABAergic afferent to midbrain dopamine neurons, encodes aversive stimuli and inhibits

motor responses. Neuron, 61, 786-800.

⬧ Jhou TC, Geisler S, Marinelli M, Degarmo BA, Zahm, DS (2009b) The mesopontine rostromedial

tegmental nucleus: A structure targeted by the lateral habenula that projects to the ventral tegmental

area of Tsai and substantia nigra compacta. J. Comp. Neurol., 513, 566-596.

⬧ Jhou TC, Good CH, Rowley CS, Xu SP, Wang H, Burnham NW, Hoffman AF, Lupica, CR, Ikemoto

S (2013) Cocaine drives aversive conditioning via delayed activation of dopamine-responsive

habenular and midbrain pathways. J. Neurosci., 33, 7501-7512.

⬧ Ji H, Shepard PD (2007) Lateral habenula stimulation inhibits rat midbrain dopamine neurons

through a GABA(A) receptor-mediated mechanism. J. Neurosci. 27, 6923-6930.

⬧ Jonkman S, Pelloux Y, Everitt BJ (2012) Drug intake is sufficient, but conditioning is not necessary


Neuropsychopharmacology, 37, 1612-1619.

⬧ Kaufling J, Veinante P, Pawlowski SA, Freund-Mercier MJ, Barrot M (2009) Afferents to the

GABAergic tail of the ventral tegmental area in the rat. J. Comp. Neurol., 513, 597-621.

⬧ Koob GF (2013) Negative reinforcement in drug addiction: the darkness within. Curr. Opin.

Neurobiol., 23, 559-563.

Chapter 4

149

⬧ Koob GF, Volkow ND (2010) Neurocircuitry of addiction. Neuropsychopharmacology, 35, 217-238.

⬧ Kowski AB, Geisler S, Krauss M, Veh RW (2008) Differential projections from subfiekds in the

lateral preoptic area to the lateral habenular complex of the rat. J. Comp. Neurol. 507, 1465-78.

⬧ Kowski AB, Veh RW, Weiss T (2009) Dopaminergic activation excites rat lateral habenular neurons

in vivo. Neuroscience, 161, 1154-1165.

⬧ Lammel S, Lim BK, Ran C, Huang KW, Betley MJ, Tye KM, Deisseroth K, Malenka RC (2012)

Input-specific control of reward and aversion in the ventral tegmental area. Nature. 491, 212-217.

⬧ Lax E, Friedman A, Croitoro O, Sudai E, Ben-Moshe H, Redlus L, Sasson E, Katzir T, Assaf Y,

Yadid G (2013) Neurodegeneration of lateral habenula efferent fibers after intermittent cocaine

administration: Implications for deep brain stimulation. Neuropharmacology. 75, 246-254.

⬧ Lecca S, Meye FJ, Mameli M (2014) The lateral habenula in addiction and depression: an

anatomical, synaptic and behavioral overview. Eur. J. Neurosci. 39, 1170-1178.

⬧ Lecourtier L, Kelly PH (2007) A conductor hidden in the orchestra? Role of the habenular complex

in monoamine transmission and cognition. Neurosci. Biobehav. Rev. 31, 658-672.

⬧ Li B, Piriz J, Mirrione M., Chung C., Proulx C.D, Schulz D, Henn F, Malinow R (2011) Synaptic

potentiation onto habenula neurons in the learned helplessness model of depression. Nature. 470,

535-539.

⬧ Limpens JHW, Schut EHS, Voorn P, Vanderschuren LJMJ (2014) Using conditioned suppression to

investigate compulsive drug seeking in rats. Drug Alcohol. Depend., 142, 314-324.

⬧ Mahler SV, Aston-Jones G (2012) Fos activation of selective afferents to ventral tegmental area

during cue-induced reinstatement of cocaine seeking in rats. J. Neurosci. 32, 13309-13325.

⬧ Maroteaux M, Mame M (2012) Cocaine evokes projection-specific synaptic plasticity of lateral

habenula neurons. J. Neurosci. 32, 12641-12646.

⬧ Matsumoto M, Hikosaka O (2007) Lateral habenula as a source of negative reward signals in

dopamine neurons. Nature. 447, 1111-1115.

⬧ Matsumoto M, Hikosaka O (2009) Representation of negative motivational value in the primate

lateral habenula. Nat. Neurosci. 12, 77-84.

⬧ Meshul CK, Noguchi K., Emre N, Ellison G (1998) Cocaine-induced changes in glutamate and

GABA immunolabeling within rat habenula and nucleus accumbens. Synapse. 30, 211-220.

⬧ Meye FJ, Valentinova K, Lecca S, Marion-Poll L, Maroteaux MJ, Musardo S, Moutkine I, Gardoni F,

Huganir RL, Georges F, Mameli M (2015) Cocaine-evoked negative symptoms require AMPA

receptor trafficking in the lateral habenula. Nat. Neurosci. 18, 376-378.

⬧ Neumann PA, Ishikawa M, Otaka M, Huang YH, Schlüter OM, Dong Y (2014) Increased excitability

of lateral habenula neurons in adolescent rats following cocaine self-administration. Int. J.

Neuropsychopharmacol. 18, 1-10.

⬧ Oliva I, Wanat MJ (2016) Ventral Tegmental Area Afferents and Drug-Dependent Behaviors. Front.

Psychiatry. 7, doi: 10.3389.

⬧ Omelchenko N, Bell R, Sesack SR (2009) Lateral habenula projections to dopamine and GABA

neurons in the rat ventral tegmental area. Eur. J. Neurosci. 30, 1239-1250.

Chapter 4

150

⬧ Piazza PV, Deroche-Gamonet V (2013) A multistep general theory of transition to addiction.

Psychopharmacology. 229, 387-413.


effects of drug taking history. Psychopharmacology (Berl). 194, 127-137.

⬧ Petzel A, Bernard R, Poller WC, Veh RW (2017) Anterior and posterior parts of the rat ventral

tegmental area and the rostromedoal tegmental nucleus receive topographically distinct afferents

from the lateral complex. J. Com. Neurol. doi: 10.1002/cne.24200.

⬧ Proulx CD, Hikosaka O, Malinow R (2014) Reward processing by the lateral habenula in normal and

depressive behaviors. Nat. Neurosci. 17, 1146-1152.

⬧ Quina LA, Tempest L, Ng L, Harris JA, Ferguson S, Jhou TC, Turner EE (2015) Efferent pathways

of the mouse lateral habenula. J. Comp. Neurol. 523, 32-60.

⬧ Robinson TE, Berridge KC (2003) Addiction. Annu. Rev. Psychol. 54, 25-53.

⬧ Sego C, Goncalves L, Lima L, Furigo IC, Donato JJr, Metzger M (2014) Lateral habenula and the

rostromedial tegmental nucleus innervate neurochemically distinct subdivisions of the dorsal raphe

nucleus in the rat. J. Comp. Neurol, 522, 1454-1484.

⬧ Shelton K, Bogyo K, Schick T, Ettenberg A (2016) Pharmacological modulation of lateral habenular

dopamine D2 receptors alters the anxiogenic response to cocaine in a runway model of drug self-

administration. Behav. Brain Res. 310, 42-50.

⬧ Vanderschuren LJMJ, Ahmed SH (2013) Animal studies of addictive behavior. Cold Spring Harb

Perspect Med. 3, a011932.


self-administration. Science. 305, 1017-1019.

⬧ Vanderschuren LJMJ, Minnaard AM, Smeets JAS, Lesscher HMB (2017) Punishment models of

addictive behavior. Curr. Opin. Behav. Sci. 13, 77-84.

⬧ Veeneman MMJ, Broekhoven MH, Damsteegt R, Vanderschuren LJMJ (2012) Distinct contributions


of cocaine. Neuropsychopharmacology. 37, 487-498.

⬧ Volkow ND, Morales M (2015) The brain on drugs: from reward to addiction. Cell. 162, 712-725.

⬧ Wirtshafter D, Asin KE, Pitzer MR (1994) Dopamine agonists and stress produce different patterns

of Fos-like immunoreactivity in the lateral habenula. Brain Res. 633, 21-26.



on the Basal forebrain and recalibration of expression. Neuropsychopharmacology. 35, 445-463.

⬧ Zapata A, Huang EK, Lupica CR (2017) Lateral habenula involvement in impulsive cocaine seeking.

Neurosychopharmacology. 42, 1103-1112.

⬧ Zhang F, Zhou W, Liu H, Zhu H, Tang S, Lai M, Yang G (2005) Increased c-Fos expression in the

medial part of the lateral habenula during cue-evoked heroin-seeking in rats. Neurosci. Lett. 386,

133-137.

⬧ Zuo W, Chen L, Wang L, Ye JH (2013) Cocaine facilitates glutamatergic transmission and activates

lateral habenular neurons. Neuropharmacology 70, 180-189.

Chapter 4

151

Chapter 5

152

Chapter 5

153

Chapter 5

General discussion

Chapter 5

154

Drug addiction poses great legal, economic and health problems. These problems bear on

both the individual users and the society as a whole. Addictive behavior is a very complex

phenomenon; in the development and maintenance of this behavior biological, genetic and

psychological as well as environmental aspects play a role. As to the biological factors, it has

been shown that extended exposure to drugs induces multiple changes at the molecular and

cellular levels in the brain, which in turn may play a role in the descent from recreational drug

use to addiction (Nestler, 2001; Lüscher and Malenka, 2011; Robison and Nestler, 2011;

Volkow and Morales, 2015). Considering that a better understanding of the brain

mechanisms that underlie drug addiction is essential for developing more effective

treatments, it is important to study and explore the relevant neurobiological underpinnings. In

the present thesis our primary aim was to identify whether the functional control of striatum

will change from ventral to dorsal when cocaine self-administration progresses from an early

to a prolonged period. We also aimed to explore the neurobiological and functional

alterations in prefrontal cortex and lateral habenula in these two different periods.

To that aim we investigated, with quantitative PCR methods, the changes in neuronal

activity in the prefrontal cortex and the striatum after short- and long-term cocaine self-

administration. Thus, we first examined the expression of a panel of 17 immediate early

genes (IEGs) in the medial prefrontal cortex (mPFC), the dorsal striatum (DS) and the ventral

striatum (VS) (Chapter 2). Indeed, IEGs act as transcription factors or effectors to regulate

activity within a neuronal network, change nucleosome structure, and mediate key aspects of

the synaptic plasticity after drug use (Lüscher and Malenka, 2011; Robison and Nestler,

2011). These IEGs were selected on basis of previous observations that they respond

directly or indirectly to cocaine exposure and their functions are involved in several aspects

of addiction. Prefrontal cortex and striatum are crucial in mediating the behavioral effects of

cocaine. Thus, it is generally thought that the mPFC puts inhibitory control over (compulsive)

drug seeking behavior. Moreover, metabolism in the dorsal and ventral striatum has been

shown to be different between early and later stages of cocaine self-administration, which

constitutes a central part of our research hypothesis. Out of this panel, the IEG Mkp1 was

chosen for a detailed anatomical and histological analysis, in order to determine the exact

location in the prefrontal cortex and striatum of the neuronal activity following cocaine self-

administration (Chapter 3). We expected a major activation in the ventral striatum after a

short-term cocaine self-administration and a shift to the more dorsal part after prolonged

cocaine exposure. In the mPFC, changes in the neuronal activation were also expected

when cocaine administration sessions were extended. According to the results in chapter 2,

Mkp1 responded significantly to both short- and long-term cocaine self-administration, which

make it possible to identify and compare the neuronal activation patterns between these two

periods. Increases of Mkp1 transcription have been found when laboratory animals were

https://www.ncbi.nlm.nih.gov/pubmed/?term=Robison%25252520AJ%2525255BAuthor%2525255D&cauthor=true&cauthor_uid=21989194

https://www.ncbi.nlm.nih.gov/pubmed/?term=Nestler%25252520EJ%2525255BAuthor%2525255D&cauthor=true&cauthor_uid=21989194

Chapter 5

155

exposed to drugs of abuse and its activation may play a role in modulating long-term

synaptic plasticity. Therefore, Mkp1 was chosen for this experiment. Furthermore, in view of

the presumed role of lateral habenula (LHb) in the aversive aspects of cocaine, we examined

the activation patterns in the LHb as well as in one of its major output structures, i.e., the

rostromedial tegmental nucleus (RMTg) (Chapter 4). In the following account we will

summarize the main findings of our experiments and discuss them in relation to the relevant

literature. Finally, we will discuss our findings in the context of the current theories on

addiction in general and provide some thoughts about future perspectives.

Cocaine self-administration-induced IEGs profiles

In the first part of the thesis (chapter 2), we examined the induction profiles of 17 candidate

IEGs in the mPFC and striatum by using RT-PCR in a cocaine self-administration paradigm;

animals that self-administered sucrose for 10 or 60 days were used as control groups. In this

way, we aimed to get a general insight in which of these IEGs are regulated by cocaine use

and which IEGs are not. We found that in the dorsal striatum, cocaine self-administration had

effects on eight IEGs, i.e. c-fos, Mkp1, Fosb/ΔFosb, Egr2, Egr4, Arc, Fosl1, and Ccnl1.

Among them, c-fos, Mkp1, Fosb/ΔFosb, Egr2 showed the largest increases in expression;

however, none of them showed differences in the expression between the 10 days and 60

days experiments. In ventral striatum, cocaine increased the expression of six IEGs: c-fos,

Mkp1, Fosb/ΔFosb, Egr2, Egr4 and Arc. Except for Fosb/ΔFosb, none of these showed

differences in expression level between 10 and 60 days of cocaine self-administration. The

IEG expression profiles in the mPFC revealed that the expression of 10 IEGs (c-fos, Mkp1,

Fosb/ΔFosb, Egr2, Egr4, Arc, Bdnf, Homer1, Sgk1, and Rgs2) was increased after cocaine

self-administration, and that only the expression of Egr2 showed a statistically significant

difference between the 10 days and 60 days of cocaine self-administration experiments.

Interestingly, six IEGs showed similar induction profiles in the dorsal and ventral striatum.

The finding that the same group of IEGs was activated in both the dorsal and ventral striatum

indicates similarities in neuroplastic changes in these two regions, perhaps as a result of the

fact that neurons throughout the striatum are highly comparable in terms of cytochemistry,

even though the dorsal and ventral striatum are thought to be responsible for different

aspects and stages of addictive behavior. It is notable that the mPFC is cytoarchitecturally

different from the striatum and that it has been implicated in different aspects of addiction,

but the same group of IEGs that was increased in striatum was also highlighted in the mPFC.

This result suggests a similarity in the neuronal adaptations between these brain regions

after cocaine self-administration.

Chapter 5

156

Previous studies have shown that prolonged exposure to self-administered cocaine

can evoke compulsive, addiction-like behavior (Deroche-Gamonet et al., 2004;

Vanderschuren and Everitt 2004; Pelloux et al. 2007; Jonkman et al. 2012; Chen et al.,

2013). This indicates that sustained drug-taking behavior causes neurobiological adaptations

that result in the development of compulsive drug use. In our experiment, except for

Fosb/ΔFosb in the ventral striatum and Egr2 in the mPFC, no major differences were

observed between the expression profiles of the studied IEGs after 10 and 60 days of

cocaine self-administration. In line with this, Besson et al. (2013) reported a stable

expression of Egr1 between 10 days and 50 days of cocaine self-administration. However,

although we observed stable expression profiles of IEGs in mPFC and striatum between 10

days and 60 days of cocaine self-administration, this does not necessarily mean that the

neuronal activities in these regions were exactly the same between short- and long-term

cocaine exposure. For instance, differences may exist in the subregional distribution of

neuronal activation patterns or at cellular intensity levels. In other words, the RT-PCR

technique is very sensitive to detect changes in the expression levels of IEGs, but it is

difficult to show the distribution patterns of the activated cells. In both striatum and prefrontal

cortex functional differences have been identified between subregions. For instance, the

dorsomedial striatum is thought to control goal-directed behavior while the dorsolateral

striatum guides the performance of habitual actions (Balleine and O’Doherty, 2010), and

functional differences between the core and shell regions of the ventral striatum (Floresco,

2015), and prelimbic and infralimbic portions of the mPFC have also been reported (Peters et

al., 2009). Thus, there is a possibility that the activated neuronal populations move from the

medial to lateral, or ventral to dorsal subregions when drug exposure was extended. Such

changes will not be identified in an RT-PCR experiment. However, a shift of neuronal activity

within the striatum is considered a crucial process underlying the development of drug

addiction (Everitt and Robbins, 2016). In summary, this experiment provided us several

candidate genes that were increased in mPFC and striatum after both short- and long-term

cocaine self-administration and that are of interest for further detailed histological studies. To

this purpose, we have chosen Mkp1 as the activity marker in the next experiment, due to its

strong responses to cocaine after both 10 days and 60 days of self-administration.

Furthermore, the Mkp1-related signal transduction pathway may be involved in cocaine

addiction-related neuroplasticity, although its activation pattern and function after prolonged

cocaine exposure are incompletely understood (Lu et al. 2006; Pascoli et al. 2011; García-

Pardo et al. 2016).

Chapter 5

157

Neuronal reactivity patterns to cocaine in corticostriatal systems

In chapter 3, we examined the neuronal reactivity patterns in the striatum and prefrontal

cortex in animals that self-administered cocaine for either 10 or 60 days, using Mkp1 in situ

hybridization (ISH). The results were analysed by conventional counting methods as well as

with the aid of a statistical parametric mapping (SPM) technique. In the conventional

counting methods both the density of the Mkp1 positive cells and the labelling intensity of

these cells were measured in each sub-region of the mPFC, orbitofrontal cortex (OFC), and

striatum. The SPM analysis was employed based on the distribution patterns of Mkp1

positive cells. With this method, statistical analysis was performed on each pixel of the

distribution map throughout the mPFC, OFC, and striatum separately, without necessary

limitation of the traditional anatomical boundaries. In this way, we obtained a map of

statistical differences in neuronal reactivity between cocaine and sucrose self-administration.

Our results from the SPM analysis showed that 10 days of cocaine self-administration

produced strong neuronal responses in the dorsomedial and the ventrolateral striatum. In

contrast, after 60 days of exposure the main reactions to cocaine were largely found in the

medial and central parts of the dorsal striatum. Conventional analysis showed that after 10

days of cocaine self-administration, both the density and the intensity of Mkp1 positive cells

were increased in the dorsal, as well as the ventral striatum. In contrast, after 60 days of

cocaine exposure, increases of the intensity of Mkp1 expression remained in all three

subregions, but the density of Mkp1 labeled cells was increased in the dorsal striatum only.

This may explain for the less pronounced increases of signals in the SPM analysis after 60

days of cocaine exposure. That is, although 60 days of cocaine self-administration largely

increased the intensity of Mkp1 positive cells, it had less effects on the density of Mkp1

positive cells in the dorsal striatum and no longer altered density of Mkp1 expression in

ventral striatal regions (i.e., nucleus accumbens core and shell, and olfactory tubercle).

Taken together, these results indicate that the functional striatal control over drug use may

change from entire striatum in the initial stages to more dorsal parts when drug taking

experience is extended.

The patterns of striatal neuronal reactivity to cocaine use are reminiscent of studies in

primates in which the patterns of striatal glucose metabolism were compared between 5 days

and 100 days of cocaine self-administration (Porrino et al., 2004). Comparable to IEG

expression, glucose metabolism is widely used as a measure for neuronal activity. For

example, Kiyatkin and Lenoir (2012) have shown that in the nucleus accumbens, a rapid

increase in glucose level induced by intravenous cocaine infusion is strongly related to

phasic activation of neurons in this region. Porrino et al. (2004) found that five sessions of

Chapter 5

158

cocaine self-administration reduced glucose utilization in the ventral striatum and limited

areas of the dorsal striatum. When cocaine administration was extended to 100 days, the

alteration of glucose utilization spread not only to most dorsal striatum but also more rostrally

and caudally (Porrino et al., 2004). One remarkable difference between our study and the

findings of Porrino is, of course, that our study indicates increases, whereas the Porrino

study shows decreases in neuronal activity after cocaine self-administration. Thus, although

the anatomical progression of altered neural activity is comparable, the differential

directionality of glucose metabolism vs Mkp1 expression does hint at the possibility that

distinct functional or temporal dimensions of neuronal activity are assessed with these

methods. Moreover, whereas the Porrino study in primates showed a spreading of cocaine

effects in the striatum with extended self-administration experience, our data in rats suggest

that there may be a functional narrowing of cocaine effects in the striatum after long-term

self-administration of this drug.

In the medial prefrontal and orbitofrontal cortices, SPM analysis indicated that short-

term cocaine self-administration induced neuronal reactivity in most subregions, with the

strongest effects in the dorsal part of the mPFC (anterior cingulate and prelimbic regions)

and the medial and central part of the orbitofrontal cortex (medial, ventrolateral, and lateral

orbital regions). In contrast, long-term access to cocaine generated much less increases of

neuronal activation. In fact, the effects were restricted to modest increases at posterior levels

in the anterior cingulate, prelimbic, ventrolateral orbitofrontal and anteroventral insular

cortices. Likewise, the conventional analysis showed that after 10 days of cocaine

administration both the density and the intensity of Mkp1 positive cells were increased in

most subregions of mPFC and OFC. In contrast, after 60 days, cocaine had much less

effects on the density of Mkp1 positive cells, with limited signals at the posterior level and

hardly any effects at the anterior level. Regarding the intensity of Mkp1 expression, most of

the increases remained, but their magnitudes were much reduced, especially at the anterior

level.

Addictive behavior has been related to dysfunction of the prefrontal cortex in both

humans and laboratory animals. Several lines of research have indicated that the cognitive

functions subserved by the mPFC, in particular inhibitory control over behavior, are important

to limit drug use (Jentsch and Taylor, 1999; Perry et al., 2011; Minhindou et al., 2013).

Dysfunction of the prefrontal cortex can lead to a loss of cognitive control over drug use and

compulsive use of drugs (Chen et al., 2013; Kasanetz et al., 2013; Pelloux Y et al., 2013;

Limpens et al. 2015). In this regard the prelimbic and infralimbic subregions of the mPFC

play important, complementary roles in maintaining the balance between goal-directed and

habitual behavior (Killcross and Coutureau, 2003; Balleine and O’Dohertv, 2010), as well as

in different forms of impulse control (Eagle and Baunez, 2010). In our experiment, we saw

Chapter 5

159

strong activation of mPFC after 10 days of cocaine self-administration but limited effects after

60 days especially in the anterior mPFC. This suggests that after prolonged cocaine

exposure the function of mPFC in controlling drug taking behavior declines. The OFC has

been implicated in integration of information about the consequences of behavior with the

subjective value of rewards (Schoenbaum et al., 2006; Murray et al., 2007). Thus, the OFC

plays an important role in guiding appetitive behavior after outcome revaluation, which may

be related to a switch between goal-directed actions and habitual responses (Lucantonio et

al., 2012; Gremel and Costa, 2013). Furthermore, the involvement of the OFC in drug

addiction is supported by the findings that the OFC is activated after the presentation of

stimuli associated with self-administered cocaine (Goldstein and Volkow, 2011; Lucantonio et

al., 2012). Indeed, overactivation of the OFC was observed when addicts were exposed to

drug-related cues, and the degree of craving was also correlated with the activation of OFC

(London et al., 2000; Schoenbaum et al., 2006). Our data showed a strong activation after 10

days of cocaine self-administration but much less after 60 days. The reduced increases of

signal in OFC suggest a reduced influence of the OFC on cocaine taking behavior after a

long-term drug exposure.

Cocaine self-administration affects neuronal activation in the lateral

habenula

In recent years, there has been an increasing interest in the role of lateral habenula (LHb) in

addiction in view of the fact that this structure may be involved in processing of negative

emotions, including the aversive effects of drugs (Matsumoto and Hikosaka 2007, 2009;

Jhou TC et al., 2013; Meye et al., 2015). Furthermore, insights into the circuitry in which the

LHb is embedded have also recently been revisited. Whereas it has long been thought that

habenular projections via the fasciculus retroflexus primarily reach the dopaminergic neurons

in the ventral mesencephalon directly, several studies have now shown that a small

GABAergic nucleus in the caudal part of the ventral tegmental area (VTA), i.e., the

rostromedial tegmental nucleus (RMTg) forms an intermediary station between the LHb and

the dopaminergic neurons of the VTA (Jhou et al., 2009; Balcita-Pedicino et al., 2011).

Therefore, to examine whether cocaine self-administration, especially after prolonged

administration, results in functional changes in the habenular-mesencephalic system, in

Chapter 4 we tested the neuronal activation in the LHb after 10 and 60 days of cocaine self-

administration using c-fos in situ hybridization. In the RMTg, we measured the expression of

glutamic acid decarboxylase (GAD) expression as a measure for the activity of GABAergic

neurons in this structure.

Chapter 5

160

With respect to the habenula, we found that 10 days of cocaine self-administration

increased both the density and the intensity of c-fos positive neurons in the lateral part of the

LHb (LHbL), but no effects were seen in the medial part of LHb (LHbM). By contrast, 60 days

of cocaine self-administration increased the density of c-fos positive neurons in both LHbL

and LHbM, but there were no changes in the intensity of c-fos positive cells. In both

experiments, most activated cells in the LHbL were glutamatergic. With respect to the RMTg,

we found increases in the density and the intensity of GAD positive cells after 10 days, but

not 60 days, of cocaine self-administration.

The large increases in the density of c-fos positive cells in our experiments indicate

the strong effects of cocaine self-administration on neuronal reactivity in the LHb. It has been

previously reported that cocaine self-administration or systemic treatment with dopamine

receptor agonists increased neuronal activation in LHb (Kowski et al., 2009; Zahm et al.,

2010). In line with these results, Jhou et al., (2013) found that cocaine-administration

increased the firing frequency of the neurons in LHb. In our experiments, cocaine-induced c-

fos positive cells were found in clusters and the majority of these positive cells was found in

the LHbL. According to Gonçalves et al., (2012), the habenular inputs to the RMTg mostly

arise from the LHbL, and inputs to the VTA mainly emerge from the LHbM. Others have

reported that a GABAergic cell group in the RMTg receives inputs from glutamatergic

neurons in habenula, in turn, which may have a profound influence on dopaminergic cells in

the VTA (Ji and Sheard, 2007; Maroteaux and Mameli, 2012; Jhou et al., 2013; Meye et al.,

2015). Altogether, our data on the increases of neuronal activity in the LHbL and GAD

signals in the RMTg suggest that the aversive effects of cocaine may be a result of activation

of the glutamatergic cells in the LHbL, that in turn activate the GABAergic cells in the RMTg,

which finally have an inhibitory effect on the dopaminergic cells in VTA. We also showed an

increase of GAD expression after 10 days but not 60 days of cocaine self-adinistration in the

RMTg, further suggesting that prolonged cocaine administration may have an influence on

the function of LHb-RMTg circuitry. When cocaine self-administration was extended from 10

days to 60 days, LHbL activation was slightly shifted to LHbM and the increased GAD

expression in RMTg returned to normal level. This could reduce the inhibition on dopamine

release and lead to a decline of the aversive effects of cocaine. As a result, cocaine taking

behavior may become less sensitive to the aversive aspects of drugs.

Relevance for the neurobiology of cocaine addiction

In the past years, standard instrumental conditioning procedures have been employed to

study drug self-administration behaviors in laboratory animals. Over the course of extended

https://www.ncbi.nlm.nih.gov/pubmed/?term=Gon%C3%A7alves%20L%5BAuthor%5D&cauthor=true&cauthor_uid=22020635

Chapter 5

161

self-administration, instrumental performance is thought to transit from goal-directed action to

habit-based stimulus-response behavior (Everitt and Robbins, 2005). In the instrumental

learning process, both prefrontal cortex and striatum are involved. For instance, the cortical-

ventral striatal circuit seems to mediate the motivational control of performance, cortical-

dorsomedial striatum seems mediate the goal-directed action, and the cortico-dorsolateral

connection mediates the performance of habit actions (Balleine et al., 2009; Hart et al.,

2014). Furthermore, the involvement of prefrontal cortex-basal ganglia circuits in mediating

the development of drug addiction was outlined in the introduction of the present thesis.

According to the instrumental learning theory of drug addiction, the process of behavioral

changes from voluntary, recreational to habitual and compulsive drug seeking is paralleled

by a transition in striatal control over drug use from ventromedial to dorsolateral regions

(Everitt et al., 2008; Everitt and Robbins, 2016). This instrumental learning theory is the

primary theoretical base for our central hypothesis. We aimed to further our neurobiological

understanding of addiction, particularly with regard to the functional alterations in

corticostriatal systems between short- and long-term exposure to self-administered cocaine.

Thus, we hypothesized that when cocaine self-administration is extended from 10 days to 60

days, the focus of neuronal activity in the striatum will move from the ventral part to more

dorsal areas, and meanwhile the activities in the prefrontal cortex will also change. Sucrose

self-administration was used to control for the effects of operant training and responding on

corticostriatal reactivity. This provided us with information on the effects of learning to

respond for a natural reward on the neuronal activities in prefrontal cortex and striatum. Our

results showed that the main neuronal activation patterns first included in the dorsomedial

and ventral striatum, but after 60 days of cocaine self-administration the more dorsocentral

parts of striatum became involved. Strong neuronal activities in prefrontal cortex were

observed after 10 days of cocaine self-administration but such increases turned out to be

much less, if present at all, after 60 days.

Our data confirmed the involvement of the striatum and the prefrontal cortex in

cocaine self-administration. The data also showed that the responses of these regions to

drugs are different when cocaine taking experience is extended. These results can be

explained to a large extent by the instrumental learning theory of addiction. In this theory,

drug seeking begins as a goal-directed behavior in a recreational context, and the drug’s

rewarding effects were mainly associated with activity in the ventral and dorsomedial

striatum. As drug use progresses, drug seeking becomes more under control of drug-

associated stimuli, being consolidated as a maladaptive stimulus-response habit, and

eventually drug seeking and taking behavior become compulsive. The dorsal striatum is

thought to be critical in guiding stimulus-response behavior (Balleine and O’Doherty, 2010;

Everitt and Robbins, 2016). In addition, we saw profoundly decreased neuronal reactivity in

Chapter 5

162

the medial prefrontal and orbitofrontal cortices after prolonged cocaine self-administration.

This indicates reduced involvement of these areas in cocaine use. Drug-induced dysfunction

of frontocortical systems is thought to impair the inhibitory control over drug-taking and -

seeking behavior, which further contributes to the development of compulsive drug use

(Everitt and Robbins, 2016). Importantly, sucrose self-administration was used as a control

condition to cocaine taking. Whereas cocaine-induced neural activation patterns to a

substantial degree fit the pattern of corticostriatal control in the instrumental learning process,

these responses were only observed in animals self-administering cocaine, not sucrose. This

indicates that the neuronal activity patterns associated with cocaine self-administration in our

experiments were not merely the result of instrumental learning.

Cocaine can produce both rewarding and aversive effects. A negative emotional

state, such as during withdrawal, is central to the negative reinforcement view of addiction,

whereby the negative emotions are driven by the brain stress system and decreased function

of brain reward systems (Koob and Le Moal, 1997; Wise and Koob, 2014; Koob and Volkow,

2016). This negative emotional state may play a crucial role in drug craving, and as such

contributes to compulsive drug use. In recent years, studies have focused on the role of

lateral habenula (LHb) in addictive behavior, suggesting that the LHb is an important brain

region mediating the aversive effects of drugs (Jhou et al., 2013; Meye et al., 2015).

However, little is known about the effects of prolonged cocaine exposure on LHb function.

We therefore examined the activation of the LHb in animals that self-administered cocaine

for 10 or 60 days. Our data showed that both 10 and 60 days of cocaine self-administration

increased neuronal activity in the lateral part of LHb (LHbL), demonstrating strong responses

of the habenula to cocaine, after both short and lengthy drug taking experience, possibly

related to the aversive properties of drugs. Differences were also observed between the two

experiments, however. For instance, after 10 days of cocaine self-administration the

neuronal activity was mainly enhanced in the LHbL, whereas 60 days of administration

increased the activities in both LHbL and LHbM. Since studies in recent years have

suggested that activation of the LHb regulates dopamine release in the VTA via the

GABAergic neurons in the RMTg, we further investigated GAD expression in the RMTg

(Balcita-Pedicino et al., 2011; Maroteaux and Mameli, 2012). We found that 10 days of

cocaine exposure increased the GAD expression in RMTg; however, no changes were

observed after 60 days of self-administration.

Previous studies have shown that cocaine alters neuronal activity in the LHb, and

application of deep brain stimulations to the LHb modulate cocaine seeking behavior

(Friedman et al., 2010; Jhou et al., 2013; Meye et al., 2015). Recently, the functions of the

habenula in voluntary behaviors and loss of control over drug use have been discussed,

suggesting that it may play a role in the emergence of compulsive drug seeking behavior

Chapter 5

163

(Mathis and Kenny, 2018). The LHb and output to the RMTg are thought to be critically

involved in processing of signals of aversive stimuli through inhibition of dopaminergic

neurons in the VTA (Jhou, et al., 2009; Hikosaka, 2010; Meye et al., 2015). Our data

demonstrated that both the LHb and RMTg strongly respond to cocaine after short-term

administration. After long-term cocaine self-administration, extended cocaine-taking

experiences may have effects on the LHb-RMTg pathway. The finding that GAD expression

in the RMTg was no longer affected by cocaine after long-term exposure hints at a decline in

the inhibitory influence of the LHb on dopamine activity, and as a consequence of that,

cocaine use may become less sensitive to the aversive properties of the drug. Together,

these data suggest that cocaine self-administration influences the LHb circuitry in a dynamic

way.

Concluding remarks and future directions

In this thesis, we demonstrated that both short-term and long-term cocaine self-

administration produced neuronal activation in the main structure of basal ganglia, i.e. the

striatum and two prefrontal cortical areas, i.e., the mPFC and OFC, that provide input to the

striatum. Furthermore, we analyzed changes in the areas of the LHb which receives input,

among others, from the basal ganglia but that also has an important influence on the

mesolimbic dopamine system. We showed changes in activation patterns after cocaine self-

administration, by comparing the data at two different time points (10 days and 60 days). In

addition, the investigation in the LHb revealed its heterogeneous responses to cocaine self-

administration, from rostral to caudal and also from medial to lateral. These brain regions

have been implicated in different aspects of adaptive, appetitive behavior. That is, the

prefrontal cortex has been implicated in managing cognitive control and behavioral inhibition,

the striatum in processing of rewards and habit formation, and the LHb in mediating negative

signals and aversive effects. As a result, cocaine self-administration appears to affect

multiple brain systems and circuitries. In the early stages of drug use, cocaine evokes

rewarding and aversive effects, and influences cognition as well. It is well accepted that the

rewarding effects of cocaine are mainly mediated by the mesolimbic dopamine system

arising in the VTA and targeting the ventral striatum and prefrontal cortex. Indeed, we do see

neuronal activations in the ventral striatum and the prefrontal cortex by self-administered

cocaine. Furthermore, our data on the activation of dorsomedial striatum after 10 days of

self-administration is in line with the notion that initial drug use is goal-directed. Activation of

the prefrontal cortex in our experiment may be related to its function in cognitive inhibition

over cocaine use, since drug use is casual consumption in the early stage. On the other

Chapter 5

164

hand, the aversive aspects of cocaine are thought to be regulated by the LHb-RMTg-VTA

pathway. In this way, activation of LHb leads to an inhibition on the dopamine release in

VTA. In our 10 days experiment, we found strong neuronal activations in LHb and increased

GAD expression in the RMTg. This probably means that the aversive effects of cocaine can

reduce the amount of dopamine via LHb in the early stage of drug use, which may contribute

to the control over drug taking and seeking behavior. In later stages, drug use may switch

from voluntary use to habitual behavior and eventually compulsive drug seeking and taking.

Our data showed that the strong neuronal activation in the ventral striatum by cocaine waned

and major responses were seen in the dorsomedial and dorsocentral striatum instead,

suggesting that more habitual-directed responding is involved after prolonged cocaine self-

administration. The profoundly reduced activation in the prefrontal cortex after long-term

cocaine use suggests decreased inhibitory control over drug seeking and taking behavior.

With respect to the LHb-RMTg-VTA pathway, long-term repeated cocaine exposure may

change its function in our experiment, with no significant increases of neuronal activation in

RMTg after 60 days of cocaine taking. This may produce a lesser inhibition on dopamine

release and make the drug taking behavior less sensitive to the aversive effects of cocaine.

Our findings increase our understanding of the biological mechanisms underlying the

development of addictive behavior. They also propose several avenues for future studies.

Firstly, the current thesis revealed multiple IEGs that respond strongly to cocaine self-

administration. Further investigation on the function of these genes, for instance identifying

the signaling pathways of their activation in neurons as well as the downstream targets, will

provide us with a better knowledge of the neurobiology of addiction and possibilities for

enhanced diagnosis and treatment. Secondly, cocaine abuse leads to the dysfunctions of

multiple brain regions and circuitries. We have collected data on activity changes in the

prefrontal cortex, striatum and habenula after the short- and long-term of cocaine self-

administration. Investigation on the activities in other regions such as amygdala, VTA, and

thalamus will also be highly informative to establish a more complete circuitry map of

addictive behavior. For instance, VTA is an important region where the mesocorticolimbic

dopamine system originates, and it projects mainly to the nucleus accumbens and prefrontal

cortex, but also to the amygdala. The amygdala is thought to play an important role in the

generation and perception of emotions, and in emotion-related associative learning. As for

the thalamus, it is considered as a key relay between the ventral striatopallidum and dorsal

striatum and it may thus contribute to the development of compulsive drug behaviors.

Studies of the connectivity and influence between these regions will be helpful to complete

our understanding in their functions in intact circuitries in drug addiction. Thirdly, the results

of the present thesis on cocaine self-administration may have generalizability to other drugs

of abuse and behavioral addictions like problem gambling and binge eating disorders. Some

Chapter 5

165

major commonalities have been found in the existence of specific brain circuitry, namely the

mesolimbic dopamine system in self-administration behaviors, and in the lasting effects on

neuronal plasticity and signaling pathways among these diseases. Additionally, different

pharmacological classes of abused drugs may increase expression of IEGs in the same

brain regions. Lastly, in the present thesis, we have evaluated the effects of cocaine on the

lateral habenula especially after a prolonged self-administration. Heterogeneous activation

patterns in the lateral habenula indicate the complexity of this structure and it could be a

good start in investigating how individual parts of the habenula play a role in mediating drug

addiction. Considering the importance of dopamine in drug reinforcement, more attention on

habenula and the habenular circuitries will improve our understanding of the underlying

mechanisms of drug abuse.

Chapter 5

166

References

⬧ Balcita-Pedicino JJ, Omelchenko N, Bell R, Sesack SR (2011) The inhibitory influence of the

lateral habenula on midbrain dopamine cells: ultrastructural evidence for indirect mediation via

the rostromedial mesopontine tegmental nucleus. J. Comp. Neurol. 519:1143-1164.

⬧ Balleine BW, Liljeholm M, Ostlund SB (2009) The integrative function of the basal ganglia in

instrumental conditioning. Behav. Brain. Res. 199(1):43-52.


determinants of goal-directed and habitual action. Neuropsychopharmacology 35:48-69.

⬧ Besson M, Pelloux Y, Dilleen R, Theobald DE, Lyon A, Belin-Rauscent A (2013) Cocaine

modulation of frontostriatal expression of Zif268, D2, and 5-HT2c receptors in high and low

impulsive rats. Neuropsychopharmacology 38: 1963-1973.

⬧ Chen BT, Yau HJ, Hatch C, Kusumoto-Yoshida I, Cho SL, Hopf FW, Bonci A (2013) Rescuing

cocaine-induced prefrontal cortex hypoactivity prevents compulsive cocaine seeking. Nature

496:359-362.

⬧ Deroche-Gamonet V, Berlin D, Piazza PV (2004) Evidence for addiction-like behavior in the rat.

Science. 305(5686):1014-1017.

⬧ Eagle DM, Baunez C (2010) Is there an inhibitory-response-control; system in the rat? Evidence

from anatomical and pharmacological studies of behavior inhibition. Neurosci Biobehav Rev.

34(1):50-72.

⬧ Everitt BJ, Berlin D, Economidou D, Pelloux Y, Dalley JW, Robbins TW (2008) Neural

mechanisms underlying the vulnerability to develop compulsive drug-seeking habits and

addiction. Philos. Trans. R Soc. Lond B Biol Sci. 363(1507): 3125-3135.

⬧ Everitt BJ, Robbins TW (2005) Neural systems of reinforcement for drug addiction: from actions

to habits to compulsion. Nat. Neurosci. 8:1481-1489.


Years On. Annu. Rev. Psychol. 67:23-50.

⬧ Floresco SB (2015) The nucleus accumbens: an interface between cognition, emotion, and

action. Annu Rev Psychol. 66:25-52.

⬧ Friedman A, Lax E, Dikshtein Y, Abraham L, Flaumenhaft Y, Sudai E, Ben-Tzion M, Ami-Ad L,

Yaka R, Yadid G (2010) Electrical stimulation of the lateral habenula produces enduring inhibitory

effect on cocaine seeking behavior. Neuropharmacology. 59(6):452-459.

⬧ García-Pardo MP, Roger-Sanchez C, Rodríguez-Arias M, Miñarro J, Aguilar MA (2016)

Pharmacological modulation of protein kinases as a new approach to treat addiction to cocaine

and opiates. Eur. J. Pharmacol. 781:10-24.

⬧ Gonçalves L, Sego C, Metzger M (2012) Differential projections from the lateral habenula to the

rostromedial tegmental nucleus and ventral tegmental area in the rat. J Comp Neurol. 520:1278-

1300.


findings and clinical implications. Nat. Rev. Neurosci. 12:652-669.





https://www.ncbi.nlm.nih.gov/pubmed/?term=Gon%C3%A7alves%20L%5BAuthor%5D&cauthor=true&cauthor_uid=22020635

Chapter 5

167

⬧ Gremel CM, Costa RM (2013) Orbitofrontal and striatal circuits dynamically encode the shift

between goal-directed and habitual actions. Nat Commun. 4:2264.

⬧ Hart G, Leung BK, Balleine BW (2014) Dorsal and ventral streams: the distinct role of striatal

subregions in the acquisition and performance of goal-directed actions. Neurobiol Learn Mem.

108:104-118.

⬧ Hikosaka O (2010) The habenula: from stress evasion to value-based decision-making. Nat. Rev.

Neurosci. 11(7):503-513.



146:373-390.

⬧ Jhou. TC, Geisler. S, Marinelli. M, Degarmo. BA, Zahm. DS (2009) The mesopontine

rostromedial tegmental nucleus: A structure targeted by the lateral habenula that projects to the

ventral tegmental area of Tsai and substantia nigra compacta. J. Comp. Neurol. 513: 566-596.

⬧ Jhou TC, Good CH, Rowley CS, Xu SP, Wang H, Burnham NW, Hoffman AF, Lupica CR,

Ikemoto S (2013) Cocaine drives aversive conditioning via delayed activation of dopamine-

responsive habenular and midbrain pathways. J. Neurosci. 33:7501-7512.

⬧ Ji H, Shepard PD, (2007) Lateral habenula stimulation inhibits rat midbrain dopamine neurons

through a GABA(A) receptor-mediated mechanism. J. Neurosci. 27: 6923-6930.

⬧ Jonkman S, Pelloux Y, Everitt BJ (2012) Drug intake is sufficient, but conditioning is not

necessary for the emergence of compulsive cocaine seeking after extended self-administration.


⬧ Kasanetz F, Lafourcade M, Deroche-Gamonet V, Revest JM, Berson N, Balado E, Fiancette JF,

Renault P, Piazza PV, Manzoni OJ (2013) Prefrontal synaptic markers of cocaine addiction-like

behavior in rats. Mol Psychiatry 18:729-737.

⬧ Killcross S, Coutureau E (2003) Coordination of actions and habits in the medial prefrontal cortex

of rats. Cereb Cortex 13:400-408.

⬧ Kiyatkin EA, Lenoir M (2012) Rapid fluctuation in extracellular brain glucose levels induced by

natural arousing stimuli and intravenous cocaine: fueling the brain during neural activation. J

Neurophysiol. 108(6):1669-1684.

⬧ Koob GF, LeMoal M (1997) Drug abuse: hedonic homeostatic dysregulation. Science.

278(5225):52-58.

⬧ Koob GF, Volkow ND (2016) Neurobiology of addiction: a neurocircuitry analysis. Lancet

Psychiatry 3(8):760-773.

⬧ Kowski AB, Veh RW, Weiss T (2009) Dopaminergic activation excites rat lateral habenular

neurons in vivo. Neuroscience 161:1154-1165.

⬧ Limpens JH, Damsteegt R, Broekhoven MH, Voorn P, Vanderschuren LJMJ (2015)

Pharmacological inactivation of the prelimbic cortex emulates compulsive reward seeking in rats.

Brain Res. 1628:210-218.

⬧ London ED, Ernst M, Grant S, Bonson K, Weinstein A (2000) Orbitofrontal cortex and human

drug abuse: functional imaging. Cereb Cortex. 10(3):334-342.


Chapter 5

168

⬧ Lu H, Chefer S, Kurup PK, GuillemK, Vaupel DB, Ross TJ, Moore A, Yang Y, Peoples LL, Sten

EA (2012) fMRI response in the medial prefrontal cortex predicts cocaine but not sucrose self-

administration history. Neuroimage 62(3):1857-1866.


dysfunction on cocaine addiction. Nat. Neurosci. 15:358-366.

⬧ Lüscher C, Malenka RC (2011) Drug-evoked synaptic plasticity in addiction: from molecular

changes to circuit remodeling. Neuron. 69(4):650-663.

⬧ Maroteaux M, Mameli M (2012) Cocaine evokes projection-specific synaptic plasticity of lateral

habenula neurons. J. Neurosci. 32:12641-12646.

⬧ Mathis V, Kenny PJ (2018) From controlled to compulsive drug-taking: The role of the habenula

in addiction. Neurosci. Biobehav. Rev. pii:S0149-7634(18)30120-129.

⬧ Matsumoto M, Hikosaka O (2007) Lateral habenula as a source of negative reward signals in

dopamine neurons. Nature 447:1111-1115.

⬧ Matsumoto M, Hikosaka O (2009) Representation of negative motivational value in the primate

lateral habenula. Nat. Neurosci. 12:77-84.

⬧ Meye FJ, Valentinova K, Lecca S, Marion-Poll L, Maroteaux MJ, Musardo S, Moutkine I, Gardoni

F, Huganir RL, Georges F, Mameli M (2015) Cocaine-evoked negative symptoms require AMPA

receptor trafficking in the lateral habenula. Nat. Neurosci. 18:376-378.

⬧ Mihindou C, Guillem K, Navailles S, Vouillac C, Ahmed SH (2013) Discriminative inhibitory control

of cocaine seeking involves the prelimbic prefrontal cortex. Biol Psychiatry 73:271-279.

⬧ Murray EA, O’Doherty JP, Schoenbaum G (2007) what we know and do not know about the

functions of the orbitofrontal cortex after 20 years of cross-species studies. J. Neurosci. 27:8166-

8169.

⬧ Nestler EJ (2001) Molecular basis of long-term plasticity underlying addiction. Nat. Rev. Neurosci.

2(2):119-128.

⬧ Pascoli V, Turiault M, Lüscher C (2011) Reversal of cocaine-evoked synaptic potentiation resets

drug-induced adaptive behavior. Nature 481(7379):71-75.

⬧ Peters J, Kalivas PW, Quirk GJ (2009) Extinction circuits for fear and addiction overlap in

prefrontal cortex. Learn Mem. 16(5):279-288.

⬧ Porrino LJ, Lyons D, Smith HR, Daunais JB, Nader MA (2004) Cocaine self-administration

produces a progressive involvement of limbic, association, and sensorimotor striatal domains. J.

Neurosci 24:3554-3562.


effects of drug taking history. Psychopharmacology (Berl) 194:127-137.

⬧ Pelloux Y, Murray JE, Everitt BJ (2013) Differential roles of the prefrontal cortical subregions and

basolateral amygdala in compulsive cocaine seeking and relapse after voluntary abstinence in

rats. Eur J Neurosci. 38:3018-302.

⬧ Perry JL, Joseph JE, Jiang Y, Zimmerman RS, Kelly TH, Darna M, Huettl P, Dwoskin LP, Bardo

MT (2011) Prefrontal cortex and drug abuse vulnerability: translation to prevention and treatment

interventions. Brain Res Rev. 65(2):124-149.

https://www.ncbi.nlm.nih.gov/pubmed/?term=L%C3%BCscher%20C%5BAuthor%5D&cauthor=true&cauthor_uid=21338877

Chapter 5

169

⬧ Robison AJ, Nestler EJ (2011) Transcriptional and epigenetic mechanisms of addiction. Nat. Rev.

Neurosci. 12: 623-63Schoenbaum G, Roesch MR, Stalnaker TA (2006) Orbitofrontal cortex,

decision-making and drug addiction. Trends Neurosci. 29:116-124.

⬧ Schoenbaum G, Roesch MR, Stalnaker TA (2006) Orbitofrontal cortex, decision-making and drug

addiction. Trends Neurosci. 29(2):116-124.

⬧ Vanderschuren LJMJ, Everitt BJ (2004) Drug seeking becomes compulsive after prolonged

cocaine self-administration. Science 305:1017-1019.

⬧ Volkow ND, Morales M (2015) The brain on drugs: from rewards to addiction. Cell. 162(4):712-

725.

⬧ Wise RA, Koob GF (2014) The development and maintenance of drug addiction.

Neuropsychopharmacology 39(2):254-262.

⬧ Zahm DS, Becher ML, Freiman AJ, Strauch S, Degarmo B, Geisler S, Meredith GE, Marinelli M

(2010) Fos after single and repeated self-administration of cocaine and saline in the rat:

emphasis on the basal forebrain and recalibration of expression. Neuropsychopharmacology

35:445-463.

Chapter 5

170

Summary

171

Summary

Drug addiction is a chronic relapsing disorder that is characterized by the compulsive use of

addictive substances. Over the years, addiction to drugs has increasingly become a major

public health problem worldwide. It has been thought that drug addiction is influenced by the

interactions of genes, epigenetics, and the environment. Researchers have identified

profound actions of drugs in the nervous system, especially in the brain. Our knowledge of

the functions of various brain regions plays an important role in understanding the

consequences and the underlying mechanisms of continued repetition of drug seeking and

drug taking behaviors, and may ultimately help finding effective treatments.

In this thesis, we evaluated the possible involvement of the prefrontal cortex, striatum

and lateral habenula in the development and maintenance of cocaine-addiction. Chapter 1

provides a general introduction into the phenomenon of drug addiction, first providing an

overview of four contemporary theories in drug addiction, addressing different

neurobiological mechanisms underlying addictive behaviors. This overview includes the

positive reinforcement theory, the negative reinforcement theory, the incentive sensitization

theory, and the instrumental learning theory. Central hypotheses in these theories help us in

understanding how drug use is maintained and what drives drug use into a state of

compulsion. We specially focused on the instrumental learning theory, in which it has been

hypothesized that transition from voluntary to habitual drug seeking parallels the transition of

the involvement of ventromedial towards dorsolateral striatal systems. Furthermore, a

progressive decrease in inhibitory control by the prefrontal cortex over drug seeking behavior

has been thought to be an important factor contributing to the occurrence of compulsivity. In

line with the instrumental learning theory, we then focused on the brain structures and

circuits that are implicated in the maintenance of drug use and the development of drug

addiction. We emphasized the involvement of two different cortical-subcortical loops in,

respectively, the early and late phases of the development of drug addiction. A detailed

introduction was given on the anatomical features of the medial prefrontal and orbitofrontal

cortices, dorsal and ventral parts of striatum, and the lateral habenula. The experimental

evidence of how these brain regions are involved in drug use or addiction is also discussed

in Chapter 1.

In Chapter 1 we also introduced the immediate early genes (IEGs), including the

definition and the classification of IEGs as well as the application of IEGs in mapping

neuronal activities in research. In the context of this thesis, IEGs were selected on basis of

previous observations that they respond directly or indirectly to drug exposure and their

functions are involved in several aspects of addiction. This information on the association

Summary

172

between IEGs expression and drug-induced brain activation indeed demonstrated that

certain IEGs can act as a promising neuronal activation marker, and on the basis of which

we made our selection of particular IEGs for the present study. In the final part of Chapter 1

the central hypothesis of our study is outlined and it explained how we are going to test our

hypothesis using IEGs.

In Chapter 2, we studied the changes in neuronal activity after short- and long-term

cocaine self-administration and as a control the self-administration of sucrose. Changes in

the expression of IEGs were shown in the medial prefrontal cortex, the dorsal and ventral

striatum in animals that self-administered cocaine or sucrose for 10 or 60 days. We observed

that cocaine self-administration increased the expression of multiple IEGs in all these regions

in both 10 days and 60 days experiments. However, sucrose self-administration increased

the expression of several IEGs only in mPFC after 60 days. Indeed, we found that cocaine

self-administration had strong effects on some IEGs in the dorsal (eight IEGs) and ventral

striatum (six IEGs), but none of these showed differences in expression level between 10

and 60 days of cocaine self-administration. Differences were observed in the IEGs

expression profiles in the mPFC, showing that 10 IEGs were upregulated after cocaine self-

administration. Among these IEGs, six of them (c-fos, Mkp1, Fosb/ΔFosb, Egr2, Arc and

Egr4) were the same candidates that responded to cocaine self-administration also in dorsal

and ventral striatum. The similar expression patterns of IEGs in the dorsal and ventral

striatum suggests similarities in cytochemical characteristics and neuroplastic adaptations in

the two striatal regions. Interestingly, remarkable upregulations in these six IEGs were also

seen in mPFC, suggesting a similarity in the neuronal adaptations between mPFC and

striatum after cocaine self-administration. The results of the experiments outlined in Chapter

2 thus showed that cocaine self-administration produced profound changes in the expression

of a set of IEGs in both the striatum and mPFC. However, no major differences were seen in

the IEGs induction profiles between short- and long-term cocaine self-administration.

The techniques used in Chapter 2 did not allow to study regional differences in the

expression of IEGs while in the light above-mentioned theories such differences might be

highly relevant. Thus, in both the prefrontal cortex and striatum regional differences are

considered to exist in the behavioral effects of cocaine. It has been shown that the

dorsomedial striatum controls goal-directed behavior while the dorsolateral striatum guides

the performance of habitual actions. Furthermore, there are functional differences between

the core and shell regions of the ventral striatum, and prelimbic and infralimbic portions of the

mPFC. In experiments in which drug exposure was extended, activated striatal neuronal

populations were seen to shift or expand from the medial to lateral, or ventral to dorsal

striatal subregions. Such a shift of neuronal activity within the striatum is considered a crucial

process underlying the development of drug addiction.

Summary

173

Therefore, in Chapter 3 we investigated the subregional changes in prefrontal cortex

and striatum. We measured the cellular expression levels of Mkp1 in specific subregions by

conventional methods of positive cell counting and, in addition, the distribution patterns of the

Mkp1-labeled activated neurons were analysed using a statistical parametric mapping

technique (SPM). The changes in the expression of Mkp1 were shown in both the density of

the Mkp1 positive cells and the labeling intensity of these cells. Conventional analysis

showed that after 10 days of cocaine self-administration, both the density and the intensity of

Mkp1 positive cells were increased in the dorsal and ventral striatum. After 60 days of

cocaine exposure, increases of the intensity of Mkp1 expression remained in all subregions,

but the density of Mkp1 labeled cells was increased in the dorsal striatum only. In the medial

prefrontal and orbitofrontal cortices, after 10 days of cocaine administration both the density

and the intensity of Mkp1 positive cells were increased in most subregions. In contrast, after

60 days, cocaine had much less effect on the density of Mkp1 positive cells, with only limited

signals at the posterior level and hardly any effects at the anterior level of prefrontal cortex.

Regarding the intensity of Mkp1 expression, most of the increases remained, but their

magnitudes were much reduced. Our results from the SPM analysis showed that 10 days of

cocaine self-administration produced strong neuronal responses in the dorsomedial and the

ventrolateral striatum. In contrast, after 60 days of exposure the main reactions to cocaine

were largely found in the medial and central parts of the dorsal striatum. In the medial

prefrontal and orbitofrontal cortices, SPM analysis indicated that short-term cocaine self-

administration induced neuronal reactivity in most subregions, with the strongest effects in

the dorsal part of the medial prefrontal cortex and the medial and central parts of the

orbitofrontal cortex. In contrast, long-term access to cocaine generated much less increases

of neuronal activation. By assessing how prolonged drug taking alters patterns of functional

neuronal activities, we concluded in Chapter 3 that neuronal activities were largely restricted

to the dorsomedial and dorsocentral striatum and were much less increased in the prefrontal

cortices after long-term cocaine exposure. These changes in functional neuronal activity

patterns may reflect the behavior development of repetitive and continued drug use.

Cocaine is thought to produce both rewarding and aversive effects. In Chapter 2 and

3 we focused on its rewarding effects, while in Chapter 4 we shifted our attention to the

neuroscientific basis of the aversive effects of cocaine. In recent years, there has been an

increasing interest in the role of the lateral habenula in addiction in view of its role in the

aversive effects of drugs. Furthermore, the results of various studies on circuits involving the

lateral habenula indicated that a small GABAergic nucleus in the rostromedial tegmental

nucleus in the ventral mesencephalon forms an intermediary station between the lateral

habenula and the dopaminergic neurons of the VTA. Using the IEG c-fos, we investigated

the changes in neuronal activation in the medial and lateral subnuclei of the lateral habenula

Summary

174

following short- and long-term of cocaine self-administration. In addition, we assessed in the

same experiments the GABAergic neuronal activity in the rostromedial tegmental nucleus.

We found that 10 days of cocaine self-administration increased both the density and the

intensity of c-fos positive neurons in the lateral subnucleus of the lateral habenula. By

contrast, 60 days of cocaine self-administration resulted in an increase in the density of c-fos

positive neurons in both lateral and medial subnuclei of the lateral habenula. There were no

changes in the intensity of c-fos positive cells after 60 days. In both the short- and long-term

experiments, we found that most activated cells in the lateral part of the lateral habenula

were glutamatergic. With respect to the rostromedial tegmental nucleus, following 10 days

cocaine self-administration both the density and the intensity of GAD positive cells were

increased, but not after 60 days. Our data suggests that the aversive effects of cocaine may

be a result of the activation of glutamatergic cells in the lateral habenula. These neurons, in

turn, activate the GABAergic cells in the rostromedial tegmental nucleus, which finally have

an inhibitory effect on the dopaminergic cells in VTA.

Taken together, on the basis of the results of the experiments conducted in the

context of the present thesis, we may conclude that both short-term and long-term cocaine

self-administration affect multiple brain systems and circuitries. Cocaine self-administration

produced neuronal activation in the prefrontal-striatal circuits, as well in subnuclei of the

lateral habenula that receive input from the basal ganglia and project, indirectly, to

dopaminergic neurons in the ventral mesencephalon. The involvement of these brain regions

in cocaine self-administration is believed to be closely related to their functions, in reward

and habit formation, or aversive effects. When cocaine exposure was extended from short-

term to long-term, activation patterns change in these brain regions, which indicates the

alterations of the brain functions during the development of drug use. Therefore, cocaine

self-administration produces effects on the brain in a complexity and dynamic way, which

may eventually result in the development of addictive behavior.

Acknowledgements

175

Acknowledgements

It is a genuine pleasure to express my gratitude and deep sense of thanks towards the

people who helped me over the past years to complete this PhD project. The course of this

PhD project is also the journey of my life and I also wish to thank all those who influenced my

life in a holistic way.

I owe a deep sense of gratitude to my promotors and my copromotor.

I would like to thank my first promotor, prof.dr. Henk Groenewegen, for guiding me

patiently, scheduling regular meetings with me, spending a lot of time in reviewing my thesis

and the habenula paper, and providing valuable comments on it. Your guidance and support

have helped me and encouraged me to complete my PhD thesis. Thank you so much for

your undivided attention.

I would like to thank my second promotor, prof.dr. Louk Vanderschuren, for consistent

advices and constructive and valuable comments on my publications, thesis, and the project

as a whole. I was totally impressed by the accuracy of your memory every time when we

discussed the literature. Thank you so much for all your comments, approaches and

explanation during the period of the writing papers and the thesis.

I would like to thank my copromotor, dr. Pieter Voorn, for providing me the opportunity to

join this exciting PhD project, giving me strong support and patient guidance during my work.

When I went to you with a question or problem, you always responded to it. Thank you so

much for sharing experiences and ideas in our discussions and give me enormous support in

making progress in my experiments.

I highly appreciated the support of the co-authors on the various publications.

I would like to thank prof.dr. Sabine Spijker for her expert guidance on the application of

RT-PCR technique in my experiments and her valuable comments in reviewing the first

paper of this project.

I would like to thank dr. Jan de Munck for his expert designing of SPM analysis for our

publication and as well as his comments on my manuscript.

I would like to thank Jules Limpens for his generous help in the behavioral test and

taking care of the animals in my experiments. Jules, you always explained everything to me

in details like a big brother and I think you are a wonderful teammate. I really enjoyed all the

time when we worked together.

Acknowledgements

176

I also highly appreciated the expert assistance of a number of colleagues on my project.

Many thanks to prof.dr. Harry Uylings for your patient guidance in helping me with the

structure of subregions in prefrontal cortex.

Also, thanks to Allert Jonker for all your help with my project. From tissue dissection to

data analysis, you have helped me a lot and taught me many tips for the experiments. No

matter the job is simple or difficult, you never complained about it.

Finally, Evelien Timmermans, thank you so much for your kind explanation of the

confocal microscopic experiments and your help with the measurements.

I would like to thank other colleagues, with whom I have shared my moments of anxiety but

also of big excitement. Angela Ingrassia, we have shared and experienced so many things:

experiments, Dutch, food and happiness. I really like your Italian food and miss so much the

taste of the espresso you made after lunch. Luus, because of my poor Dutch, you have

helped me many times with translation from Dutch to English and even helped me with

phone calls. I miss the jokes and lunchtime with you and other girls. Linda, I am glad that I

could work with you for such a long time. I enjoyed the time when we discussed about

problems together, and I am glad to share with you the experiences of trying again and again

to solve the problems. Bori, Cathrin, Angela Engel, Anke, Karin, and Dagmar, thanks for all

your assistance and encouragement. I also record my thanks to other colleagues: Nico, Dirk,

Piet, Floris, Wilma, Anne-Marie, Taco, Tommy, Yvonne, John (Bol), John (Breve), and Kees.

I would also like to thank Meiling, Sandera, and Floor for their help with my

administrative affairs.

Also thanks the department of Anatomy and Neuroscience for providing me three-month

extension after my employment contract.

I highly appreciated the way in which I have received by colleagues in Louk’s group in

Utrecht. Every time when I went there, your kindness gave me the feeling that I was a

member of your group.

Finally, my deep and sincere gratitude to my family

I wish to express my heart-felt gratitude to my parents and my parents-in-law, for your

self-denying love, your encouragement and support that made it possible for me to

accomplish this work.

I am grateful to my sister, Li Gao, for staying with our parents in these years. Without

your help, it would be extremely difficult for me to stay and work in Holland.

Also, many thanks to other family members for all your help.

Acknowledgements

177

My special thanks are due to my husband, Renping Pan, for your support, patience,

encouragement and appreciation throughout these years. My lovely son Shou, you have

been the light of my life and given me the extra strength and motivation to get things done.

You deserve the credit for the successful completion of my thesis.

Acknowledgements

178

Curriculum Vitae

179

Curriculum Vitae

Ping Gao was born on the 29th June 1978 in Urumuqi, Xinjiang, China. In 2002, Ping finished

her study in Medicine in Xinjiang Medical University in China. In the following three years,

she has worked as a teaching assistant at the department of Biochemistry and Molecular

biology at the same university. Just before Christmas in 2005, Ping arrived in the

Netherlands. Soon in 2006 she started her Research Master program in Neuroscience at

BCN graduate school, University medical center, Groningen. During the study in the master

program, Ping has participated in two research projects. In the first project, she evaluated the

inhibitory effects of neural stem cell-conditioned media on brain tumor. In the second project,

she examined the activation of microglia in hippocampal neurogenesis in mice. After

completing her master study, Ping moved from Groningen to Amsterdam and joined a PhD

project at the department of Anatomy and Neurosciences at Vrije University medical center

(VUmc). Her PhD project was under the supervision of dr. Pieter Voorn at the department of

Anatomy and Neurosciences at VUmc, and of prof.dr. Louk Vanderschuren at the

department of Animals in Science and Society at Utrecht University. In this project, Ping

evaluated the neuronal activities in the prefrontal cortex and the dorsal and ventral striatum

after cocaine self-administration, especially interested in the plastic changes in these regions

when cocaine exposure was extended to a prolonged period. In September 2019, Ping will

join a research project as a postdoctoral researcher in dr. Joris Pothof’s group at the

department of Molecular Genetics at Erasmus University medical center, Rotterdam. Ping is

also excited to be involved in prof.dr. Jan Hoeijmakers’ research projects and appreciates the

opportunity to learn from him. Together with other colleagues, Ping will study the molecular

mechanisms of DNA damage and transcriptional stalling in aging.

Acknowledgements

180

Publications

181

Publications

Gao P, Groenewegen HJ, Vanderschuren LJMJ, Voorn P. Heterogeneous neuronal activity

in the lateral habenula after short- and long-term cocaine self-administration in rats. (2018)

Eur J Neurosci. 47(1):83-94.

Gao P, De Munck JC, Limpens JH, Vanderschuren LJMJ, Voorn P. A neuronal activation

correlate in striatum and prefrontal cortex of prolonged cocaine intake. (2017) Brain Struct

Funct. 222(8):3453-3475.

Gao P, Limpens JH, Spijker S, Vanderschuren LJMJ, Voorn P. Stable immediate early gene

expression patterns in medial prefrontal cortex and striatum after long-term cocaine self-

administration. (2017) Addict Biol. 22(2):354-368.

Van Kerkhof LW, Tressa V, Mulder T, Gao P, Voorn P, vanderschuren LJMJ. Cellular

activation in limbic brain systems during social play behavior in rats. (2014) Brain Struct

Funct. 219(4):1181-211.

Olah M, G Ping, De Haas AH, Brouwer N, Meerlo P, Van Der Zee EA, Biber K, Boddeke HW.

Enhanced hippocampal neurogenesis in the absence of microglia T cell interaction and

microglia activation in the murine running wheel model. (2009) Glia. 57(10):1046-61.

neuronal activity after cocaine self-administration. an ... dissertation.pdf · chapter 4...

Documents