Deepika kritaniya

Ph.D scholar

Enrol.no-B1382/14

(College of biotechnology)

DUVASU

overview Introduction

Location of neural stem cell (NSC)

Development of NSC

Cell signalling pathway for NSC

Markesr’s of NSC

Factor affecting growth and multiplication of NSC

Isolation and culture of NSC

NSC for Therapeutic Use

Conclusion

Introduction

The term“neural stem cell” is used loosely to describe cells

that:

Can generate neural tissue or are derived from the nervous

system

Have some capacity for self-renewal, and

Can give rise to cells other than themselves through

asymmetric cell division

Neural stem cell

NSC

Glialprecursors

Sensory

neurons

Motor

neurons

Multipolar

neurons

Inter

neurons

Astroglia Oligodendroglia

The differentiation of the neuroepithelial stem cells intoneurons and glial then proceeds in a temporal specificmanner and in specific region of the developing neuraltube (McConnell,1995; Rao, 1999)

For decades, it was believed that most neurons in the adultcentral nervous system (CNS) were terminallydifferentiated and usually not replaced when they died

It has been established that active neurogenesis, a processof generating functionally integrated neurons fromundifferentiated, multipotent progenitor cells (Gage, 2000;Temple, 2001)

The concept of NSC plasticity and of their dependence onenvironmental cues is strengthened by transplantation andmanipulation studies in vivo (Gage et al., 1995)

This plasticity may perhaps outstretch the brainboundaries, so that NSCs (neuroectodermal in origin) cangive rise to cells that normally derive from germ layersother than the neuroectoderm (Jiang et al., 2002)

In addition, NSCs have been utilized as one of thepotential sources for the cell replacement therapy of CNSdisorders (Bjorklund et al., 2000; Falk, 2009)

Alternative sources of NSC progenitor cell for

cell therapy

Bone marrow

Blood cord

Hair follicles

Skin

Amniotic placental fluid

Human foetus

Location of (NSC)

NSC have been assumed to exist only in the embryonic

nervous system at the beginning of neural tube formation

NSC are present in the central nervous system (CNS), in the

peripheral nervous system (PNS) and in neural crest cell

populations

Germinal regions persist in the adult mammalian brain that is

capable of generating new neurons: the subventricular zone

(SVZ), and the subgranular zone (SGZ)

The spinal cord Progenitor cells in the mammalian fetal CNS

are considered to be concentrated in seven major areas:

Olfactory bulb

Ventricular zone (VZ)

Subventricular zone (SVZ) of the forebrain

Hippocampus

Cerebellum

Cerebral cortex

Spinal cord

Progenitor cells number and pattern of development vary in

different species (Gage, 2000)

Development of (NSCs)

Postnatal stage

RADIAL GLIAL

ASTROCYTES

SUBVENTRICULAR

ZONEVENTRICULAR

ZONE

OLIGODENDROCYTES

ADULTHOOD

When the neural plate first emerges, does it consist solely of

stem cells ?

Analysis of adherent clone production suggests stem cells are

prevalent at early stages

In spinal neural tube from embryonic day 8 (E8) rat, over 50%

of the viable cells at 24 hours are stem cells (Kalyani et al.,

1997, 1998; Qian et al., 2000)

In telencephalon of E10 mouse, estimates of stem cells range

from 5 to 20% (Kilpatrick and Bartlett, 1993)

But the frequency of stem cells declines rapidly (Kalyani et al.,

1997, 1998)

Stem cells seem to be much rarer when neurosphere production

is used as the assay: only 0.3% of E8.5 mouse anterior neural

plate cells make neurospheres

Perhaps neurosphere-generating cells are a subpopulation of

early stem cells

If stem cells are, or rapidly become, a subset of early neural

progenitor cells in vivo, how are they distributed ?

Clonal studies suggest that most glial, both astrocytes and

oligodendrocytes, originate from stem cells (Rao, 1999)

Neurospheres generated from different CNS regions express

region- specific markers

Regulatory sequences control region-specific expression of the

transcription factor Sox2, so that expression is seen in

telencephalic but not spinal cord stem cells (Zappone, 2000)

Neural stem cells cultured from early to mid-gestation give rise

to more neurons than those cultured at later periods (Qian et al.,

2000)

Nestin is an intermediate filament expressed by the

neuroepithelial cells of the neural tube (Lendahl et al., 1990)

Nestin-positive cells make contact with the ventricular surface

and have radially oriented processes

Developmental changes in stem cells are accomplished by

changes in their growth factor

Thus signaling molecules, such as FGF, bone

morphogenetic proteins and Noggin can influence neural

stem cells from neural induction

Growth factor concentrations vary during development of

NSC (Wolpert, 1994)

Cell signalling pathway for neural stem cells

Notch signaling pathway

It has been found that Notch signaling plays a significant rolein neurogenesis in both embryonic and adult brains (Hitoshi etal., 2002; Yoon et al., 2008)

Upon activation of Notch by its ligands, the Notch intracellulardomain (NICD) is released from the membrane andtranslocates to the nucleus

It was reported that subsets of GFAP+ cells function as neuralstem cells in the adult SVZ (Imura et al., 2003)

Transcriptional genes

NICD

Hes1

Hes3

Hes5

WNT Signaling Pathway

The Wnt family of signaling proteins participates in multiple

developmental events during embryogenesis

Mitogenic stimulation

Prevent differentiation

Cell fate determination

Removal of Wnt1 results in severe defects of the midbrain,

cerebellum and spinal cord

Marker’s of Neural Stem Cells

Cell specific markers are a valuable tool in tracing neural

stem cells during development

A reliable marker should identify NSC not only in the

embryonic brain but also in the adult brain

Markers have been described which are either cell surface

proteins such as CD133, Nestin, an intermediate filament

molecule, or Musashi, an RNA binding protein

Nestin

Highly accepted marker for NSC (Frederikson et al., 1988;Naresh k. et al., 2012 )

Nestin expression, neither restricted to the embryonic CNS, northe progenitor cells of neurons, but can be found in the PNS

Nestin seems to play a role in the structural organisation ofcells where it probably participates in remodelling processesand isolated from human fetal striatum and from rat brain(Michalczyk and Ziman, 2005,Li et al. 2005, Zhanget al. 2006)

Sox2

Sox2 is a “founder member” of the Sox gene family

Sox2 can also re-establish pluripotency in terminallydifferentiated cells reprogramming them to induced pluripotentstem cells (iPS) (Silva J et al.,2009)

Sox2 express in the developing central nervous system (CNS)(Ellis et al., 2004, Collignon etal., 1996)

Regulate the Notch pathway which is responsible formaintenance of neural stem cells (Bani-Yaghoub et al., 2006)

RNA-binding protein Musashi-1

Musashi is an evolutionarily conserved family of RNA-binding

proteins that is expressed in the nervous system (Okano et al.,

2002)

Level of expression is selectively higher in NSCs than in neural

precursor cells (Kaneko et al., 2000)

Musashi-1 protein has been found to function in cooperation

with Musashi-2 protein to activate Notch signaling

Pax 6

Members of Pax family proteins are HD (homeodomain)containing transcription factors

Transcription factor Pax6 plays an important role in fatedetermination of neural progenitor cells in animal models(Gehring and Ikeo, 1999)

Pax6 is expressed in ventral region (Spinal Cord) andplays crucial roles in generation of ventral neurons(Kuldeep k. et al., 2014)

CD 133

Widely used as a marker for identification and isolation ofneural precursor cells from normal brain or tumor tissue (Sunet al.,2009)

CD133 five membrane domain glycoprotein and is expressedon immature hematopoietic and progenitor cells (Uchida et al.,2000)

When these CD133+cells were isolated, they were able to formClonal neurospheres and produce new tumours after serialtransplantation (Yuan et al., 2004; Li et al., 2005)

Genes Primers Product

No Temp(°C) (bp)

Nestin F: 5’-AACGCTGAGTCATTGAGAAC-3’

R: 5'-CACTGCCTCCTGGTCTTC-3’

276bp

Sox-2 F: 5'-CGAGTCAAGCGGCCCATGAAC-3‘

R: 5'-TGGCAGCCATCTTGCGTAGG-3'

187bp

Pax6 F:5’AACAGAGTTCTTCGCAACCTGGCTA

G-3‘

R: 5'-TGGCAGCCATCTTGCG TAGG-3'

164bp

Mushashi F: 5-GGTGAAGGAGTGTCTGGTGATGC-3R: 5-TCGAGTCACCATCTTAGGCTGTGC-3

187

Factor Affecting Growth And Multiplication Of

Neural Stem Cells

The most commonly used methods for the isolation and cultureof stem cells use serum-free culture medium supplementedwith various hormones and nutrients and mitogenic growthfactors EGF or FGF-2 (Bottenstein and Sato, 1979, Naresh k.et al., 2012 )

EGF has been used to culture forebrain stem cells asneurospheres from embryonic and adult mouse (Reynolds etal., 1992)

A combination of EGF and FGF-2 is needed to cultureembryonic and adult mouse spinal cord, striatum andsubventricular zone (SVZ) derived progenitor cells asneurospheres (Gritti et al.,1999; Kuldeep k. et al., 2014)

Neurospheres, are kept proliferating by adding growth

factors (EGF), (bFGF) and (LIF) (Palmer et al., 2001)

It also suggest signaling of FGF together with Wnt

signaling regulates late features of the dorsal

telencephalon (Gunhaga et al., 2003)

Isolation and culture of fetal

brain stem cells

Structure of Neurospheres Karyotype of NSC CELL (P6)

Neural Stem Cells for Therapeutic Use

In the nervous system, replacement of neurons is often

considered to be the main goal of cell therapy

But cells, including stem cells, are already being used as gene

delivery tools and for rescuing neurons rather than replacing

them

NSC can be genetically transduced currently, by the most

efficient and popular way of introducing genes into NSC is by

means of mutagenesis

Clinical trials of neural stem cells

Stem cell

source

Disease Delivery Year References Current

state of the

art

Fetal neural

stem cells

Batten disease,

or neuronal

ceroid

lipofuscinosis

Brain

neurosurgery

2006 Taupin

P.(2006)

phaseI

ongoing

Embryonic

stem cell-

oligodendroc

yte

progenitors

Spinal cord

injury

Spinal cord

injection

2009 Alper

J.(2009)

Withdrawn

because of

risk of

economic

failure

Fetal neural

stem cells

(8-week-old

fetus)

Amyotrophic

lateral

sclerosis

Multisite

injection into

the

spinal cord

2010 Raore

B.(2011)

ongoing (14

patients

transplanted)

Stem cell source Disease Delivery Year References Current state of

the art

Human

embryonic

stem

cells

Stroke Brain

neurosurgery2010 Stroemer

P.(2009)

Under way

Genetically

modified

human

neural stem

cells (Seung

U. Kim,

University

of British

Columbia)

Glioma Intravenous

delivery

2010 Aboody

KS.(2008)

Recruitment

of

patients

Neural fetal

stem cells

(Stem

Cell Factory,

Hospital S.

Maria,

Terni, Italy)

Amyotrophic

lateral

sclerosis

Multisite

injection

into the

spinal cord

2012 Vescovi

AL.(1999)

Recruitment

of patients

Cell Therapy Treatments in Development

Amyotrophic lateral sclerosis (ALS)

Spinal Cord Injury

Ischemic Stroke

Multiple Sclerosis

Alzheimer’s Disease

Traumatic Brain Injury

Peripheral Nerve Injury

Parkinson’s Disease

Drug Treatments in Development

Major Depressive Disorder

Alzheimer’s Disease

Stroke

Traumatic Brain Injury

Post-Traumatic Stress Disorder

Neurodegeneration

CONCLUSION The development of methods to establish NSC lines in vitro has

been one of the main goals of researchers since the discovery ofactive neurogenesis in the adult mammalian CNS

Current preclinical studies strongly suggest that the therapeuticefficacy of stem cell transplantation

For clinical application, it is important that these protective strategiesare proven safe and effective in humans

Several clinical trials using human embryonic stem-derived NSCs orfetal NSCs are currently under way

Our greatest limitation in treating many neurodegenerative disorders is

the lack of understanding of what causes the onset or drives the

progression of sporadic and idiopathic pathologies

They show tropism towards brain pathology, which appears to be

mediated at least in part by chemokines

We will be benefit from repetive and unconvential concept and

unexpected result that will lead us to future discoveries that we cannot

imagine today

Reference

Alvarez-Buylla, A. and Lim, D.A. (2004). For the long run:

Maintaining germinal niches in the adult brain. Neuron, 41: 683-686.

Bani-Yaghoub, M., Tremblay, R.G., Lei, J.X., Zhang, D., Zurakowski, B.

and Sandhu, J.K. (2006). Role of SOX2 in the development of the mouse

neocortex. Dev. Biol., 295: 52-66.

Bjorklund, A. and Lindvall, O. (2000). Cell replacement

therapies for central nervous system disorders. Nat Neurosci., 3: 537-

44.

Bottenstein, J.E. and Sato, G. (1979). Growth of rat neurobalstoma cell line

in serum-free supplemented medium. Proc. Natl. Acad. Sci.,76: 514–517.

Collignon, J., Sockanathan, S., Hacker, A., Cohen-Tannoudji, M., Norris,D.and Rastan, S. (1996). A comparison of the properties of Sox-3 with Sry andtwo related genes Sox-1 and Sox-2. Development,122: 509-520.

Doetsch. F., (2003). The glial identity of neural stem cells., Nat.Neurosci.,6: 1127–1134.

Ellis, P., Fagan, B.M., Magness, S.T., Hutton, S., Taranova, O. and Hayashi,S. (2004). SOX2, a persistent marker for multipotential neural stem cellsderived from embryonic stem cells, the embryo or the adult. Dev. Neurosci.,26: 148-65.

Falk, S. and Sommer, L. (2009). Stage- and area-specific control of stemcells in the developing nervous system. Curr. Opini. Genet. Dev., 19: 454-60.

Frederikson, K., Jat, P.S.,Valtz, N., Levy, D. and McKay, R. (1988).Immortalization of precursor cells from the mammalian CNS. Neuron, 6:439-448.

Gage, F.H. (1995). Survival and differentiation of adult neuronal progenitorcells transplanted to the adult brain. Proc. Natl. Acad. Sci. USA, 92: 11879-11883.

Gage, F.H. (2000). Mammalian neural stem cells. Science, 287: 1433-

1438.

Gehring W.J. and Ikeo, K. (1999). Pax6: mastering eye morphogenesis and

eye evolution. Trends. Genet., 15: 371-377.

Gritti, A., Frolichsthal-Schoeller, P., Galli, R., Parati, E., Cova, L., Pagano,

S., Bjornson, C. and Vescovi, A. (1999). Epidermal and fibroblast growth

factors behave as mitogenic regulators for a single multipotent stem cell-like

population from the subventricular region of the adult mouse forebrain. J.

Neurosci., 19: 3287–3297.

Gunhaga, L., Marklund, M., Sjodal, M., Hsieh, J. C., Jessell, T. M. and

Edlund, T. (2003). Specification of dorsal telencephalic character by

sequential Wnt and FGF signaling. Nat. Neurosci., 6: 701-707.

Hitoshi, S., Alexson, T., Tropepe, V., Donoviel, D., Elia, A.J., Nye, J.S.,

Conlon, R.A., Mak T.W., Bernstein, A. and Van Der Kooy, D. (2002). Notch

pathway molecules are essential for the maintenance, but not the generation,

of mammalian neural stem cells. Genes Dev., 16: 846- 858.

Imura, T., Kornblum, H.I. and Sofroniew, M.V. (2003). Thepredominantneural stem cell isolated from postnatal and adultforebrain but not early embryonic forebrain expresses GFAP., J.Neurosci., 23:2824 –2832.

Jiang, X., Iseki, S., Maxson, R.E., Sucov, H.M. and Morriss-Kay, G.M.(2002). Tissue origins and interactions in the mammalian skull vault. Dev.Biol., 241: 106-116.

Kalyani, A., Hobson, K., and Rao, M. S. (1997). Neuroepithelial stem cellsfrom the embryonic spinal cord: Isolation, characterization and clonalanalysis. Dev. Biol., 186: 202–223.

Kalyani, A.J., Piper, D., Mujtaba, T., Lucero, M.T. and Rao, M.S. (1998).Spinal cord neuronal precursors generate multiple neuronal phenotypes inculture. J. Neurosci., 18: 7856-7868.

Kaneko, Y., Sakakibara, S., Imai, T., Suzuki, A., Nakamura, Y., Sawamoto,K., Ogawa Y., Toyama, Y., Miyata, T. and Okano, H. (2000). Musashi1: anevolutionally conserved marker for CNS progenitor cells including neuralstem cells, Dev. Neurosci., 22139- 22153.

Kilpatrick, T.J. and Bartlett, P.F. (1993). Cloning and growth of

multipotential neural precursors: requirements for proliferation and

differentiation. Neuron, 10: 255-265.

Kilpatrick, T.J., Richards, L.J. and Bartlett, P.F. (1995). The regulation of

neural precursor cells within the mammalian brain. Mol. Cell.Neurosci.,

6(1): 2-15.

Kriegstein, A. and Alvarez-Buylla, A. (2009). The glial nature of embryonic

and adult neural stem cells. Annu. Rev. Neurosci., 32:149 –184.

Kuldeep. K,Renu Singh,Manish .K, P S Mahapatra,Ajay Kumar., Dhruba

Malakar, and Sadhan Bag . International Journal of Neuroscience, 2014;

124(6): 450–456.

Lendahl, U. and McKay, R.D.G. (1990). The use of cell lines in

neurobiology. Trends Neurosci., 13: 132-137.

Li, X. J., Du, Z.W., Zarnowska, E. D., Pankratz, M., Hansen, L. O., Pearce,

R.A. and Zhang, S.C. (2005). Specification of motoneurons from human

embryonic stem cells. Nature Biotechnol., 23: 215–221.

Mujtaba, T., Mayer-Proschel, M.and Rao, M.S. (1998). A common neural

progenitor for the CNS and PNS. Dev Biol., 200:1–15.

McConnell, S.K. (1995). Constructing the cerebral cortex:

neurogenesis and fate determination. Neuron, 15: 761-768.

Naresh k., Nilesh Bari., Kuldeep k.,B C Das., Sadhan Bag.

(2013). Isolation and characterization of neural stem cells from

caprine, Indian Journal of Animal Sciences 83 (2): 146–149,

Okano, H., Imai, T., Okabe, M. (2002). Musashi: Atranslational regulator of cell fates. J. Cell Sci., 115: 1355–1359.

Palmer, T.D., Schwartz, P.H., Taupin, P., B. Kaspar, Stein, S.Aand Gage, F.H. (2001). Progenitor cells from human brain afterdeath. Nature, 411: 42–43.

Pinson, K.,I., Brennan, J., Monkley, S., Avery, B.J., andSkarnes, W.C. (2000). An LDL-receptor-related proteinmediates Wnt signalling in mice. Nature, 407: 535–538.

Qian, X., Shen, Q., Goderie, S.K., He, W., Capela, A., Davis,A.A. and Temple, S. (2000). Timing of CNS cell generation: aprogrammed sequence of neuron and glial cell production fromisolated murine cortical stem cells. Neuron, 28: 69-80.

Rao, M.S. (1999). Multipotent and restricted precursors in the central nervoussystem. Anat. Rec., 257: 137-148.

Reynolds, B.A. and Weiss, S. (1992). Generation of neurons and astrocytesfrom isolated cells of the adult mammalian nervous system. Science, 255: 1707-1710.

Stemple, D.L. and Anderson, D.J. (1992). Isolation of a stem cell for neuronsand glia from the mammalian neural crest. Cell, 71: 973-985.

Sun, Y, Kong. W, Falk. A, Hu. J, Zhou L, Pollard. S, and Smith A. (2009).CD133 (Prominin) negative human neural stem cells are clonogenic andtripotent. Epub. 4(5):5498.

Temple, S. (2001). The development of neural stem cells. Nature, 414: 112-

117. Uchida, N., Buck, D.W., He, D., Reitsma, M.J., Masek, M., Phan,

T.V.,Tsukamoto, A.S., Gage, F.H. and Weissman, I.L. (2000). Directisolation of human central nervous system cells. Proc. Natl. Acad. Sci.USA., 97(26): 14720-14725.